Model System for High-Throughput Screening of Novel Human Immunodeficiency Virus Protease Inhibitors...

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, July 2004, p. 2437–2447 Vol. 48, No. 70066-4804/04/$08.00�0 DOI: 10.1128/AAC.48.7.2437–2447.2004Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Model System for High-Throughput Screening of Novel HumanImmunodeficiency Virus Protease Inhibitors in Escherichia coli

Ting-Jen Cheng,1 Ashraf Brik,2 Chi-Huey Wong,2 and Chen-Chen Kan1*Keck Graduate Institute of Applied Life Sciences, Claremont, California 91711,1 and Department of Chemistry

and the Skaggs Institute for Chemical Biology, The Scripps Research Institute, La Jolla, California 920372

Received 10 February 2004/Returned for modification 28 February 2004/Accepted 5 March 2004

Novel human immunodeficiency virus (HIV) protease inhibitors are urgently needed for combating thedrug-resistance problem in the fight against AIDS. To facilitate lead discovery of HIV protease inhibitors, wehave developed a safe, convenient, and cost-effective Escherichia coli-based assay system. This E. coli-basedsystem involves coexpression of an engineered �-galactosidase as an HIV protease substrate and the HIVprotease precursor comprising the transframe region and the protease domain. Autoprocessing of the HIVprotease precursor releases the mature HIV protease. Subsequently, the HIV protease cleaves �-galactosidase,resulting in a loss of the �-galactosidase activity, which can be detected in high-throughput screens. UsingFood and Drug Administration-approved HIV protease inhibitors, this E. coli-based system is validated as asurrogate screening system for identifying inhibitors that not only possess inhibitory activity against HIVprotease but also have solubility and permeability for in vivo activity. The usefulness of the E. coli-based systemwas demonstrated with the identification of a novel HIV protease inhibitor from a library of compounds thatwere prepared by an amide-forming reaction with transition-state analog cores. A novel inhibitor with asulfonamide core of amprenavir, E2, has shown good correlation with the in vitro enzymatic assay and in vivoE. coli-based system. This system can also be used to generate drug resistance profiles that could be used tosuggest therapeutic uses of HIV protease inhibitors to treat the drug-resistant HIV strains. This simple yetefficient E. coli system not only represents a screening platform for high-throughput identification of leadstargeting the HIV proteases but also can be adapted to all other classes of proteases.

Human immunodeficiency virus (HIV) protease, essentialfor processing HIV viral polyproteins into individual structuralproteins and replication enzymes during virus maturation, hasbeen an attractive target for antiviral therapy development (9).Several HIV protease inhibitors designed to bind the activesite of HIV protease have been shown to have in vivo efficacyand are currently in clinical use. This line of therapy, by itselfor in combination with reverse transcriptase inhibitors, hasrevolutionized antiviral treatments and dramatically loweredthe number of deaths due to AIDS (32). However, widespreaduse of HIV protease inhibitors has caused the rapid emergenceof drug-resistant HIV proteases (8), rendering AIDS with nodefinitive cure. In these HIV proteases, mutations have beenfound in 49 of the 99 amino acids of the coding sequence.Substitutions at 18 or more positions are directly correlatedwith loss of responsiveness to HIV protease inhibitor treat-ment. Since the existing HIV protease inhibitors target theactive site of HIV protease and have similar structures, most ofthe drug-resistant HIV proteases confer cross-resistance tomultiple HIV protease inhibitors. There is a great need forsecond-generation HIV protease inhibitors with differentchemical structures and/or with an alternative mode of inhibi-tion, such as targeting activation, i.e., dimerization and foldingof HIV protease.

HIV protease is an aspartyl protease. The active HIV pro-tease is an obligatory dimer, consisting of two identical and

noncovalently associated monomers. The active site of theenzyme is formed at the dimer interface and contains twoconserved catalytic aspartic acid residues, one from eachmonomer (5). Instead of being translated as an active enzyme,HIV protease is synthesized as an integral part of the viralGag-Pol polyprotein and needs to be activated to gain catalyticactivity. Activation of the HIV protease requires appropriatefolding and dimerization of the protease domain in the viralGag-Pol polypeptide to form an active site, which then cancatalyze the hydrolysis of peptide bonds at cleavage sites torelease the mature HIV protease (34).

The molecular mechanism of HIV protease activation is notcompletely clear yet. It has been suggested that the transframeregion (TF), flanking the N terminus of the protease domain inthe Pol gene, is involved in the regulation of HIV proteaseactivity (26). The native TF comprises an 8-amino-acid trans-frame peptide and a 48-amino-acid p6pol protein. Purified re-combinant p6pol protein was shown to have inhibitory effectson HIV protease activity (25). The intact HIV protease pre-cursor, including TF and the protease domain, has a very lowdimer stability relative to that of the mature enzyme and ex-hibits negligible levels of stable tertiary structure (33). Louis etal. (19) proposed that TF interacts with the dimer interfaceand thus destabilizes the dimeric structure to regulate HIVprotease activity. The solution structure of the HIV proteaseprecursor confirmed that TF hinders dimerization of the HIVprotease domain and influences the catalytic activity of HIVprotease (11).

Standard screening methods of HIV protease inhibitors in-clude both in vitro and in vivo assays. While the in vitro enzymekinetic assays use purified recombinant HIV proteases and

* Corresponding author. Mailing address: Keck Graduate Instituteof Applied Life Sciences, 535 Watson Dr., Claremont, CA 91711.Phone: (909) 607-8563. Fax: (909) 607-8086. E-mail: [email protected].

2437

specific substrates, the in vivo assays use mammalian cells andthe HIV viruses to evaluate the permeability as well as the invivo antiviral activities of the potential drug leads. The com-plexity and time-consuming nature of the current protocolsprompted us to explore the use of an Escherichia coli-basedsystem as a simple and safe alternative approach for HIVprotease inhibitor screening.

Several E. coli-based systems have been developed for invivo HIV protease activity assays. Some systems have usedreporter enzymes, like thymidylate synthase (16) or �-galacto-sidase (2), while other systems used the proteins involved inregulatory pathways, such as the lytic/lysogenic cycle of �phage (22, 29), transcriptional control (6, 12, 30), or the cyclicAMP signaling pathway (7). These systems have limited suc-cess, however, in adaptation for high-throughput screening orin the detection of in vivo activity of HIV protease inhibitors.

We report here the development of an E. coli-based systemin a high-throughput format and with the sensitivity to detectin vivo activity of HIV protease inhibitors. This system involvesan engineered �-galactosidase to report in vivo HIV proteaseactivity, and the HIV protease precursor (TF-PR) that com-prises TF and the protease domain from the Gag-Pol polypro-tein. The autoproteolytic processing of the HIV protease pre-cursor occurs in the E. coli cells and results in the release of themature HIV protease. Subsequently, the mature HIV proteasecleaves the �-galactosidase, causing a loss of �-galactosidaseactivity. �-Galactosidase activity, which can be further quanti-tated by the enzymatic assay with specific chromogenic sub-strates, is thus inversely related to HIV protease activity. Thesensitive and robust enzymatic assay of �-galactosidase enablesthe detection of �-galactosidase activity by using either thepurified enzyme, crude cell lysates (27), or whole cells (23).

The validation of this system was performed with Food andDrug Administration (FDA)-approved HIV protease inhibi-tors and a library of new inhibitors against both the wild-typeHIV protease and the drug-resistant HIV proteases. The rank-ing of the inhibitory potency of FDA-approved HIV proteaseinhibitors against the wild-type HIV protease in this E. coli-based system was shown to correspond well with what wasdetermined in standard antiviral assays. A novel HIV proteaseinhibitor, E2, was identified as a potential drug lead from alibrary of compounds generated through diversity-orientedsynthesis in a microtiter plate for in situ screening. Also, the invivo inhibitory activity of E2 obtained from the E. coli systemcorrelates well with the in vitro activity. This E. coli-basedsystem represents an efficient and cost-effective method fordiscovery of new drug leads targeting the HIV protease. Fur-thermore, it can also be applied to drug discovery for manyother diseases, as long as a protease, regardless of the proteaseclass to which it belongs, is involved in these disease processes.

MATERIALS AND METHODS

Materials. The bacterial expression vector pBAD-TOPO-LacZ was obtainedfrom Invitrogen Corp. (Carlsbad, Calif.). HIV-1 NL4.3 DNA was a gift fromJiing-Kuan Yee (The City of Hope, Duarte, Calif.). All DNA-modifying enzymeswere from New England Biolabs (Beverly, Mass.), except that Taq polymerasewas from Panvera (Madison, Wis.). Oligonucleotides for PCRs were synthesizedby MWG Biotech (High Point, N.C.), and the amplified DNA fragments werethen purified with ZymoClean (Zymo Research, Orange, Calif.). Pepstatin A wasobtained from ICN Biochemicals (San Diego, Calif.). FDA-approved HIV pro-tease inhibitors including amprenavir (APV), indinavir (IDV), nelfinavir (NFV),

ritonavir (RTV), and saquinavir (SQV) were obtained through the NationalInstitutes of Health (NIH) AIDS Research and Reference Reagent Program,Divisions of AIDS, National Institute of Allergy and Infectious Diseases, NIH.Analytical thin-layer chromatography was performed on precoated plates (silicagel 60F-254; Merck). Silica gel used for flash column chromatography wasMallinckrodt type 60 (230 to 400 mesh). Novex Bis-Tris polyacrylamide gels forprotein separation were purchased from Invitrogen Corp., and the polyvinyli-dene fluoride membranes were from Millipore (Bedford, Mass.). Anti-�-galac-tosidase monoclonal antibodies were purchased from Roche Applied Science(Indianapolis, Ind.), and HIV type 1 (HIV-1) protease antiserum was providedby D. Bailey and Mark Page (Pfizer Inc.) through the NIH AIDS Research andReference Reagent Program, Divisions of AIDS, National Institute of Allergyand Infectious Diseases, NIH. The horseradish peroxidase-conjugated secondaryantibodies as well as the Lumi-Glo chemiluminescence reagent were purchasedfrom KPL Inc. (Gaithersburg, Md.). Reagents for the highest purity were pur-chased from Aldrich, Sigma, Acros, Novabiochem, or Bachem, Inc.

Construction of expression plasmids. The pBAD system, which uses the BADpromoter for recombinant protein expression, was used to construct all expres-sion plasmids in this study. To engineer �-galactosidase as a substrate for theHIV protease, a pair of cleavage cassettes, encoding the decapeptide corre-sponding to the p6/PR cleavage site (Val-Ser-Phe-Asn-Phe-Pro-Gln-Ile-Thr-Leu) of the HIV Gag-Pol polyprotein, were synthesized and ligated with SauI-digested pBAD-TOPO LacZ (2). The construct was designated p�-GalPR.

Coexpression of the HIV protease and �-GalPR was carried out by using atwo-cistron approach (Fig. 1A). The first cistron encodes the HIV protease orTF-PR. Right before the stop codon of the first cistron was a Shine-Dalgarnosequence of AGGAGGAA for ribosome binding, which was followed with a startcodon for translation of the second cistron, �-GalPR. The coding sequence forthe HIV protease gene was amplified by PCR from HIV-1 NL4.3 DNA witholigonucleotide PR-F (ATACCATGGCCCCTCAGATCACTCTTTGGCAGCGACC) as the forward primer and oligonucleotide PR-R (AGCCCATGGGTTATTCCTCCTTAAAATTTA) as the reverse primer. The italicized nucleotidesrepresent the NcoI restriction sites. Likewise, the coding sequence for the HIVprotease precursor consisting of the TF and the protease domain was amplifiedwith oligonucleotide TF-F (CATACCATGGGCTTTTTTAGGGAAGATCTGGCCTTC) as the forward primer and oligonucleotide PR-R as the reverseprimer. After digestion with NcoI, the amplified fragments were then cloned intothe unique NcoI site of p�-GalPR. The resulting plasmid was designated pPRWT

or pTF-PRWT, respectively. E. coli DH5� was used as the host for plasmidpreparations and for recombinant protein expression (27).

In vitro PCR-mediated mutagenesis. The HIV protease mutant with a muta-tion at residue 25 was constructed by PCR-mediated mutagenesis (1). ThePCR-mediated mutagenesis includes three PCRs. The first PCR used pTF-PRWT as the template to generate the upstream fragment of the mutation sitewith TF-F as the forward primer and PRD25N-R (ATTTAATAGAGCTTCCTTTAATTTGC) as the reverse primer. The changed nucleotides are shown inboldface type, and the codons corresponding to the mutated residues are under-lined. The second PCR was to generate the downstream fragment of the muta-tion site with PRD25N-F (GCAATTAAAGGAAGCTCTATTAAAT) as the for-ward primer and PR-R as the reverse primer. The upstream fragment from thefirst PCR and the downstream fragment from the second PCR were mixed andthen used as templates for the final PCR. The final PCRs yielded either PRD25N

if PR-F and PR-R were used as primers or TF-PRD25N if TF-F and PR-R wereused. The amplified fragments were then digested with NcoI and subcloned intop�-GalPR. The resulting construct was designated pPRD25Nor pTF-PRD25N, re-spectively.

The HIV protease precursor variant containing the D30N mutation or theI84V mutation was similarly constructed by PCR-mediated mutagenesis as de-scribed previously (1). The oligonucleotides TF-F and PRD30N-R (CCTGGCAAATTCATTTCTTCTAATACTGTGTT) or PRI84V-R (TA[C/T]GTTGACAGGTCTAGGTCCTACTAATACTGTACC) were used as primers for the first-round PCR to generate the upstream fragment of the mutation site. Theoligonucleotides PRD30N-F (AACACAGTATTAGAAGAAATGAATTTGCCAGG) or PRI84V-F (GGTACAGTATTAGTAGGACCTACACCTGTCAAC[A/GTA]) and PR-R were used as primers for the second-round PCR to generatethe downstream fragment containing the mutation site. The corresponding frag-ment pairs were then combined, and TF-F and PR-R were used as primers toamplify the final product, i.e., TF-PRD30N or TF-PRI84V. Again, these fragmentswere digested with NcoI and subcloned into p�-GalPR. The resulting plasmid wasdesignated pTF-PRD30N or pTF-PRI84V. The sequences of all constructs wereconfirmed by automatic DNA sequencing (DAVIS Sequencing, Davis, Calif.)

Diversity-oriented chemical synthesis of HIV protease inhibitors. Fifty micro-liters of each different carboxylic acid (3 �mol) was added to each well of a

2438 CHENG ET AL. ANTIMICROB. AGENTS CHEMOTHER.

96-well microplate that contained 50 �l of N-[(1-H-benzotriazole-1-y) (dimeth-ylamino) methylene]-N-methylmethanaminium hexafluorophosphate N-oxide(HBTU, 3 �mol), and N,N-disopropylethyl amine (DIEA, 6 �mol). To eachreaction mixture, 50 �l of 2 �mol of amine core 1 (Fig. 2) dissolved in anhydrousdimethyl formamide (DMF) was added. All of the reaction mixtures were mixedand kept at room temperature. The reactions went to completion in 1 h, basedon the disappearance of the free amine monitored by thin-layer chromatography(10:1 CHCl3/MeOH ratio; Rf � 0.28) and analysis of the crude reaction mixtureby electrospray ionization mass spectrometry (3).

Synthesis and purification of inhibitor E2. Core 1 was prepared as previouslyreported (31). To a solution of a free amine 1 (200 mg, 0.45 mmol), 2-methyl-3-hydroxy benzoic acid (102 mg, 0.67 mmol) in 6 ml of dry DMF was added toHBTU (253 mg, 0.67 mmol) followed by DIEA (230 �l, 1.3 mmol) at 20°C in anargon atmosphere. The reaction mixture was stirred for 3 h, then quenched bythe addition of brine, and extracted with ethyl acetate. The organic layer waswashed with 1 N HCl, saturated aqueous NaHCO3, and brine, dried overMgSO4, filtered, and concentrated in vacuo. The crude product was purified byflash chromatography (CHCl3-MeOH), and the desired product was obtained ina 90% yield. The chemical structure of E2 was determined by nuclear magneticresonance and electrospray ionization mass spectrometry (3).

Determination of in vitro IC50s of inhibitors against HIV protease. Recom-binant HIV protease for enzymatic assays was prepared as described previously(3). The determination of kinetic parameters of HIV protease was performed at37°C at pH 5.6 by using an F-2000 fluorescence spectrophotometer (Hitachi) anda Packard fluorescence spectrophotometer (Fusion-Universal microplate ana-lyzer) for the microplate assay. For HIV protease, the Km and Vmax values for thefluorogenic peptide substrate 2-aminobenzoyl (Abz)-Thr-Ile-Nle�Phe-(p-NO2)-

Gln-Arg-NH2 were determined by measuring the initial rate of hydrolysis atdifferent substrate concentrations (2.5, 5.0, 10, 25, 50, and 100 �M) by monitor-ing the changes in fluorescence at a 420-nm emission and fitting the obtaineddata to the Michaelis-Menten equation with the GRAFIT program (version 3.0;Erithacus Software, Surrey, United Kingdom). Assays were run in 0.1 M mor-pholineethanesulfonic acid (MES) buffer containing 0.2 M NaCl and 1 mMdithiothreitol in a final volume of 200 �l in the wells of microplates. The enzymeconcentration (30 �g/ml) that gave an ideal progress curve was used for theassays. The in vitro IC50, the concentration required for 50% inhibition of in vitroHIV protease activity, was determined from the percentage of inhibition ren-dered by E2 at various concentrations: 0.1, 0.5, 2.0, 4.0, 8.0, 12, and 16 nM. TheKi of the compound E2 was derived from the in vitro IC50 by using the formulafor competitive inhibition: Ki � IC50/(1�[S]Km).

Treatment of E. coli cells with HIV protease inhibitors. Pepstatin A wasdissolved in water at 100 mM. Stock solutions of the FDA-approved HIV pro-tease inhibitors were prepared by solubilizing the drugs in 100% dimethyl sul-foxide (DMSO) at 100 mM. A single colony of the cells bearing the respectiveplasmid, namely pTF-PRWT or pTF-PRmutant, was inoculated to 2 ml of Luria-Bertani medium with 100 �g of ampicillin/ml and grown overnight at 37°C. Theculture was diluted 100-fold with fresh Luria-Bertani medium containing 100 �gof ampicillin/ml and incubated at 37°C for 2 h until the optical density at 630 nm(OD630) of the cells reached 0.6. The cells were then induced for protein ex-pression with 0.2% arabinose and simultaneously treated with either HIV pro-tease inhibitors at the indicated concentrations dissolved in 2% DMSO or 2%DMSO alone as the negative control. After incubation for an additional 3 h at30°C, the cells were collected for Western blot analysis of proteins.

FIG. 1. Coexpression of HIV protease and �-galactosidase in E. coli. (A) The two-cistron constructs used in this study. The first cistron is theHIV protease precursor, which consists of the TF, including the transframe peptide (TFP) and p6pol, and the protease domain (PRWT). The secondcistron is the engineered �-galactosidase, containing an insertion of the protease cleavage site, Val-Ser-Phe-Asn-Phe-Pro-Gln-Ile-Thr-Leu, atamino acid 131 (�-GalPR). In the pTF-PRD25N construct, the inactive HIV protease with the catalytic Asp25-to-Asn mutation was used. The arrowsrepresent the cleavage sites of HIV protease. (B) Autoprocessing of the HIV protease precursor detected with HIV-1 protease antiserum. Cellsbearing individual plasmids (indicated at the top of the blots) were induced with 0.2% arabinose for 3 h at 30°C. The cells were then collected andprocessed for separation on 4 to 12% Bis-Tris gels followed by immunoblot analysis. M denotes the molecular weight standards. Each lanecontained the lysate from 0.3 OD630 equivalents of cells, except the lane for PRD25N, which contained 0.1 OD630 equivalents of cells expressingPRD25N. (C) Cleavage of �-GalPR detected with antibodies against �-galactosidase. Lanes 1, 3, and 4 were the same as mentioned earlier, exceptthat lane 2 contained the lysates from the cells expressing only �-GalPR. Each lane contained the lysate from 0.3 OD630 equivalents of cells.

VOL. 48, 2004 E. COLI-BASED IN VIVO HIV PROTEASE INHIBITOR ASSAY 2439

Western blot analysis of proteins. After the cells were induced and treated asdescribed above, they were collected by centrifugation and solubilized in Lae-mmli sample buffer (17) at a concentration of 0.01 OD630 cells per �l of samplebuffer. The cellular proteins were separated on 4 to 12% Novex Bis-Tris poly-acrylamide gels and electrotransferred onto polyvinylidene fluoride membranesfor analysis with specific antibodies. The membranes were blocked with 5%nonfat milk in TTBS (10 mM Tris � HCl [pH 7.4], 500 mM NaCl, 0.1% Tween 20)for 1 h and then incubated with 1:5,000 anti-�-galactosidase monoclonal anti-bodies or 1:5,000 HIV-1 protease antiserum in 1% nonfat milk in TTBS foranother hour. The bound antibodies were detected by chemiluminescence byhorseradish peroxidase and Lumi-Glo chemiluminescence reagent.

Cell-based �-galactosidase activity assay. E. coli cells bearing each of theexpression plasmids were grown as described, except that after incubation at37°C for 2 h to an OD630 of 0.6, the cells were transferred in triplicate sets to thewells of 96-well microplates. Similarly, the cells were subjected to simultaneousinduction for recombinant protein expression as well as drug treatment with HIVprotease inhibitors at the indicated concentrations in 2% DMSO. For the screen-

ing of the compound library generated by the amide-forming reaction, DMF wasused in place of DMSO. After incubation for an additional 3 h at 30°C, the cellswere made permeable for the entry of the �-galactosidase substrate, i.e., ortho-nitrophenyl-�-D-galactopyranoside (ONPG), by diluting the cells in assay buffer(10 mM NaP [pH 7.3], 10 mM NaCl, 1 mM MgSO4, 5 mM �-mercaptoethanol)that contained 50 �g of polymyxin B sulfate/ml and 2% Triton X-100 (28). Thecells were then incubated for 5 min at room temperature in 96-well microplates.After the OD630 of the cells were determined by using an Ultramark microplateimaging system (Bio-Rad, Hercules, Calif.), ONPG was added at a final concen-tration of 200 �M to start the enzymatic reactions at 37°C. Changes in the OD415,indicating the production of ortho-nitrophenol, were continuously monitoredwith the Ultramark microplate imaging system. The linear portion of the pro-gression curve was used to determine the initial velocity with MATLAB (TheMathWorks Inc., Natick, Mass.). The difference in OD415 (�A) was converted tothe increase in product concentration (�C) by using the equation �A �ε � �C � L, where L is the light path of 0.4 cm and the extinction coefficient (ε) ofortho-nitrophenol was 3,500 M1 cm1 under the assay conditions. The �-ga-

FIG. 2. Preparation and in situ screening of different inhibitors with various P2 residues. The upper panel depicts the conditions used for theamide-forming reaction. Structures of the 30 carboxylic acids used for library compound synthesis are shown in the middle panel. In the lowerpanel, the structure of E2 and its Ki and in vitro IC50s are given.


lactosidase activity was determined as the number of micromoles of ortho-nitro-phenol produced per minute at 37°C. The �-galactosidase activity was thennormalized against the amount of total cellular proteins, which was estimated byassuming that an OD630 unit corresponds to 1.4 109 cells and that every 109

cells yield approximately 150 �g of proteins (23).

RESULTS

Validation of detection of HIV protease activity in vivo in ahigh-throughput format. It was reported that the engineered�-galactosidase that contains an insertion of HIV proteasecleavage site at amino acid 131 still retains its activity, however,loses its activity when cleaved (2). Therefore, �-GalPR, i.e.,�-galactosidase with an insertion of Val-Ser-Phe-Asn-Phe-Pro-Gln-Ile-Thr-Leu, corresponding to the sequence of the p6/PRjunction in HIV Gag-Pol polyprotein, was used as the reporterof HIV protease activity in this E. coli-based model system.

Our model system uses the HIV protease precursor thatcomprises the TF, including the transframe peptide and p6pol

protein, and the protease domain for coexpression togetherwith �-GalPR (pTF-PRWT) (Fig. 1A). Coexpression under thesame promoter control was carried out by using a two-cistronexpression plasmid, where the HIV protease precursor wasused as the first cistron and �-GalPR was used as the secondcistron. A modified form of the HIV protease precursor thatcontained a D25N mutation at the catalytic residue Asp25 toabolish the proteolytic activity (14) was constructed by PCR-mediated mutagenesis and was used as a control (pTF-PRD25N) (Fig. 1A).

The expression of recombinant proteins in the E. coli cellsbearing the expression plasmid, pTF-PRWT or pTF-PRD25N,was analyzed by Western blotting with HIV-1 protease anti-serum (Fig. 1B) and with �-galactosidase antibodies (Fig. 1C).The immunoblots confirmed that both HIV protease and �-ga-lactosidase could be translated from a single mRNA in thistwo-cistron system. Most of the wild-type HIV protease pre-cursor was autoprocessed, and the mature HIV protease wasreleased in the E. coli cells (Fig. 1B, lane 3). The mature HIVprotease subsequently cleaves �-GalPR, resulting in the ap-pearance of an extra band with a lower molecular weight in thelysates from the cells expressing TF-PRWT and �-GalPR (Fig.1C).

The cleavage of the engineered �-galactosidase by HIV pro-tease would cause a loss of �-galactosidase activity. In an effortto develop a high-throughput screening platform, we opti-mized the experimental procedures to quantitatively determinethe �-galactosidase activity that requires minimal sample prep-arations, i.e., with no need for cell lysis and further proteinpurification steps. We used Triton X-100 and polymyxin Bsulfate to increase the permeability of the �-galactosidase sub-strate (28) and then started the �-galactosidase reaction withthe addition of ONPG. Using this protocol, we determinedthat uninduced E. coli contained no detectable �-galactosidaseactivity and the E. coli cells expressing only �-GalPR gave a�-galactosidase activity of 0.191 � 0.005 �mol/min/mg of totalE. coli proteins. When �-galactosidase was coexpressed withHIV protease, �-galactosidase activity changed to 0.041 �0.003 and 0.178 � 0.007 �mol/min/mg for E. coli producingactive and inactive HIV protease, respectively. These data con-firmed E. coli �-galactosidase as a valid reporter for in vivoHIV protease activity.

Dose-dependent effects of the FDA-approved HIV proteaseinhibitors on the autoproteolytic processing of the HIV pro-tease precursor. The in vivo inhibitory effects of the HIVprotease inhibitors were evaluated by a peptide-based proteaseinhibitor, pepstatin A, and the FDA-approved small-moleculeHIV protease inhibitors APV, IDV, NFV, RTV, and SQV.

Drug permeability was evaluated by Western blot analysis inwhich E. coli cells were treated with HIV protease inhibitorswithout the use of permeabilization agents. As shown in Fig. 3,all small-molecule HIV protease inhibitors, except pepstatinA, inhibited the autoprocessing of the HIV protease precursorin a dose-dependent fashion. The dose-dependent inhibition ofautoprocessing could be detected with 1.6 �M HIV proteaseinhibitors and reached a limit with 200 �M HIV proteaseinhibitors. The cleavage at the TFP-p6 pol site, resulting in therelease of p6pol-PR, still occurred in the presence of 5 mMHIV protease inhibitors (Fig. 3). The concentration of IDVand RTV needed for 50% inhibition of the release of matureHIV protease was shown to be between 8 and 40 �M, and the

FIG. 3. In vivo dose-dependent effects of protease inhibitors onautoprocessing of the protease precursor, TF-PRWT, in E. coli cells.Protease inhibitors were pepstatin A (Pep A), APV, IDV, NFV, RTV,and SQV. The E. coli cells containing the expression constructpPRD25N, pTF-PRWT, or pTF-PRD25N were induced with 0.2% arabi-nose for 3 h at 30°C in the presence of 2% DMSO. Simultaneously, theE. coli cells expressing TF-PRWT were treated with the HIV proteaseinhibitors at the indicated concentrations in 2% DMSO. The cells werethen collected, and the proteins were analyzed by Western blottingwith HIV-1 antiserum. Each lane contained 0.3 OD630 equivalents ofcells, except the lane for PRD25N, which contained 0.1 OD630 equiva-lents of cells expressing PRD25N.


concentrations of APV, NFV, and SQV needed for 50% inhi-bition of the release of mature HIV protease was between 1.6and 8 �M.

Dose-dependent effects of the HIV protease inhibitor on�-galactosidase activity. Since in vivo inhibitory effects of theFDA-approved HIV protease inhibitors in E. coli were con-firmed by the inhibition of autoprocessing of the HIV proteaseprecursor, we further investigated if we could detect the in vivopotency of the HIV protease inhibitors by an increase in thecleavage-induced loss of �-galactosidase activity. After drugtreatment for 3 h, the cells were processed for detection of�-galactosidase activity in 96-well microplates as described. Asshown in Fig. 4, �-galactosidase activity increased exponen-tially as the concentration of HIV protease inhibitors in-creased. Consistent with the inhibition of autoprocessing of theHIV protease precursor, the increase in �-galactosidase activ-ity could be detected with as little as 1.6 �M HIV proteaseinhibitors and showed little differences between 200 �M and

400 �M HIV protease inhibitors, except with IDV. Addition-ally, with 400 �M HIV protease inhibitors, �-galactosidaseactivity was around 0.145 �mol/min/mg of total proteins, whichwas a little lower than the maximal �-galactosidase activitydetected in the presence of inactive HIV protease. It is impor-tant that permeabilization reagents were used to allow theentry of ONPG for the in vivo �-galactosidase assay only aftercells were harvested from drug treatment. Thus, it could nothave had any effect on the permeability of HIV protease in-hibitors. Indeed, pepstatin A with poor cell permeability didnot show any in vivo inhibitory activity (data not shown).

The IC50 of a given HIV protease inhibitor against thewild-type HIV protease in the E. coli system was determined bycurve-fitting with MATLAB (Fig. 4 and Table 1). IC50 refers tothe concentration of the HIV protease inhibitor required toreach a 50% inhibition of the cleavage-induced loss of �-ga-lactosidase activity. The �-galactosidase activity detected in E.coli coexpressing TF-PRWT and �-GalPR in the absence of

FIG. 4. In vivo dose-dependent effects of HIV protease inhibitorsagainst the wild-type HIV protease. The in vivo activity of the HIVprotease inhibitors was determined by the inhibition of the cleavage-induced loss of �-galactosidase activity. The cells coexpressing TF-PRWT and �-GalPR were treated with HIV protease inhibitors at theindicated concentrations. Subsequently, �-galactosidase activities (mi-cromoles per minute per milligram of total protein) in the treated E.coli cells were determined by using whole cells in a 96-well microplateformat as described in Materials and Methods. Representative resultsfrom three separate experiments are shown, and each experiment hada triplicate set of each sample.


HIV protease inhibitors was referred to as 0% inhibition. Themaximal �-galactosidase activity observed in E. coli containingpTF-PRD25N was regarded as 100% inhibition, which couldtheoretically be achieved by the most potent HIV proteaseinhibitor. As shown in Table 1, the IC50 for each HIV proteaseinhibitor was in the micromolar range, many times higher thanwhat was determined in standard antiviral assays. Neverthe-less, this E. coli-based system successfully detected the in vivoinhibitory activities of HIV protease inhibitors.

Dose-dependent effects of HIV protease inhibitor on a drug-resistant D30N HIV protease mutant. The usefulness of thismodel system for drug-resistant HIV proteases was furthervalidated with a D30N HIV protease mutant, a variant ob-served in HIV clinical isolates and specifically conferring drugresistance to NFV.

The HIV protease D30N mutant was created by PCR-me-diated mutagenesis and was used to replace the wild-type HIVprotease domain in the two-cistron expression construct forcoexpression together with �-galactosidase to create the con-struct pTF-PRD30N. After the E. coli cells containing the ex-pression plasmid pTF-PRD30N were induced for recombinantprotein expression, �-galactosidase activity was determined byusing whole cells in 96-well microplates. The �-galactosidaseactivity in the E. coli cells coexpressing TF-PRD30N and�-GalPR was 0.074 � 0.011 �mol/min/mg of total proteins,which was higher than the �-galactosidase activity (0.041 �0.003 �mol/min/mg of total proteins) detected in the presenceof the wild-type HIV protease. This indicated that the D30NHIV protease mutant has a lower catalytic efficiency uponcleaving the substrate, i.e., �-galactosidase, causing an increasein �-galactosidase activity compared with that determined inthe presence of the wild-type HIV protease. Therefore, thissystem is suitable for detecting the HIV protease variantswhose activities were different from the wild-type HIV pro-tease activity.

The drug response of the D30N HIV protease to HIV pro-tease inhibitors was investigated by using an experimental pro-tocol similar to that used in the study of the wild-type HIVprotease (Fig. 5). It is important to stress that, in this study, 0%inhibition was defined as the �-galactosidase activity detectedin the E. coli cells coexpressing the D30N HIV protease and

�-GalPR in the absence of HIV protease inhibitors. The refer-ence to 100% inhibition was still the same as mentioned ear-lier. As shown in Fig. 5, the sensitivities toward APV, IDV,RTV, and SQV for the D30N HIV protease were similar tothose for the wild-type HIV protease. On the other hand,compared to 75% inhibition against the wild-type HIV pro-tease, 400 �M NFV only showed 30% inhibition against theD30N HIV protease. The IC50 of NFV for the D30N HIVprotease mutant was thus determined to be greater than 400�M, at least ninefold higher than the IC50 determined for thewild-type HIV protease (Table 1).

Preparation of a library of compounds by amide-formingreaction and in situ screening of in vitro HIV protease activity.Starting from the sulfonamide isostere core 1, a compoundlibrary was prepared in microplates and was screened in situagainst the HIV protease. The library was initially screened at100 nM, and those reaching 50% or greater inhibition wereselected for a second screening at 10 nM. The two rounds ofscreening revealed the preference of aromatic residues at theP2 position, such as benzoic acid. More than thirty acids ofortho-, meta-, para-substituted benzoic acids (Fig. 2) were cou-pled to the core and screened at 5 nM, in which E2 emerged asthe best inhibitor from this library (Table 2). Following theseresults, E2 was synthesized and purified. The in vitro IC50s andKi values of the purified E2 against the wild-type HIV proteaseand three other mutants were subsequently determined (Fig.2).

Detection of in vivo inhibitory activity of the compoundlibrary against the wild-type HIV protease. The library of com-pounds was also tested for inhibitory potency of HIV proteaseactivity in the E. coli-based model system. The initial screeningwas conducted at 200 �M. Consistent with in vitro enzymaticstudies, E2 was identified as the most potent compound in theE. coli-based model system. As shown in Fig. 6A, E2 inhibitedautoprocessing of the HIV protease precursor at 1.6 �M andthe inhibitory effects reached the maximum at 100 �M. Afterdetermining �-galactosidase activity in the cells treated withdifferent concentrations of E2, the in vivo IC50 of E2 in the E.coli-based system was determined as 87.3 � 25.4 �M, which iscomparable to the potency of current drugs against HIV pro-tease (Fig. 6B and Table 1).

TABLE 1. IC50s of protease inhibitors determined in our E. coli-based screening system and comparison of efficacies of HIV proteaseinhibitors determined in different systems

HIV proteaseinhibitor

IC50 from our E. coli-based assaysystema (�M) with:

EC90 from standard antiviral assayb

(�M) with:IC50 from another E. coli-

based assay system withwild-type HIV proteasec

(�M)Wild-type

HIV proteaseD30N HIV

protease Wild-type HIV D30N HIV strain

APV 53.4 � 17.4 35.9 � 17.7 —e — —IDV 132.5 � 17.5 137.3 � 13.7 0.060 0.010 100NFV 48.4 � 4.8 �400.0 0.030 0.180 —RTV 42.6 � 9.1 26.9 � 7.5 0.050 0.010 —SQV 23.7 � 3.4 9.3 � 3.5 0.030 0.010 20Pepstatin A NDd ND — — —

a IC50 refers to the inhibitor concentration required to reach a 50% inhibition of the loss of �-galactosidase activity caused by HIV protease induced cleavage. IC50sand standard errors were determined from three separate experiments as shown in Fig. 4 and 5.

b Results are from reference 24. EC90 refers to the drug concentration that inhibited 90% of mammalian cell death induced by HIV infection.c Results are from reference 7. IC50 refers to the inhibitor concentration required to reach a 50% inhibition of the cyclic AMP production induced by HIV protease

in the system.d ND, not detectable.e —, not reported in literature.


Detection of in vivo inhibitory activity of E2 against the I84VHIV protease. Since the core of inhibitor E2 is similar to thatof APV, we were interested in investigating the drug responseof E2 against the APV-resistant HIV protease mutants. One ofthe key signature substitutions for APV resistance resides atthe amino acid residue I84 (10). The in vivo EC90, the inhibitorconcentration that inhibits 90% of virus-induced cytotoxicity,of APV against I84V HIV protease mutant is twofold higherthan the EC90 against the wild-type HIV protease (13). The invitro enzymatic assay also showed a threefold increase of the Ki

of APV against the I84V HIV protease mutant compared tothat of the wild-type HIV protease (13).

Again, the I84V HIV protease mutant was created by PCR-mediated mutagenesis and used to replace the wild-type HIVprotease domain in the two-cistron system to construct theplasmid pTF-PRI84V. After inducing E. coli cells bearing theexpression plasmid pTF-PRI84V, �-galactosidase activity wasdetermined as described. The �-galactosidase activity in thecells expressing TF-PRI84V and �-GalPR was 0.081 � 0.001�mol/min/mg of total proteins. Again, this was higher than the

�-galactosidase activity (0.041 � 0.003 �mol/min/mg of totalproteins) detected in the presence of the wild-type HIV pro-tease. This confirmed that the I84V HIV protease mutant hasa lower catalytic efficiency than the wild-type HIV protease inthis E. coli-based system.

The drug response of the I84V HIV protease mutant towardE2 was investigated by using similar experimental protocols, asdescribed, and with APV as a control (Fig. 6C and D). In thisstudy, 0% inhibition was defined as the �-galactosidase activitydetected in the E. coli coexpressing the I84V HIV protease and�-GalPR without the treatment of HIV protease inhibitors.The IC50 of E2 against I84V HIV protease was determined as141.3 � 50 �M while the IC50 of APV was 280 � 39 �M. Dataobtained with E2 demonstrated that subtle changes of thestructure at the P2 position could generate new HIV proteaseinhibitors with improved binding affinities toward drug-resis-tant HIV proteases.

The results indicated that this E. coli-based model system isuseful in serving multiple purposes, including quick identifica-tion of drug leads against the protease target and establish-

FIG. 5. In vivo dose-dependent effects of HIV protease inhibitorsagainst the D30N drug-resistant HIV protease. The in vivo activities ofthe HIV protease inhibitors were determined as described in the leg-end to Fig. 4 with the cells coexpressing TF-PRD30N and �-GalPR.�-Galactosidase activities (micromoles per minute per milligram oftotal protein) in the treated E. coli cells were determined, and the datawere used to generate the dose-response curves by curve-fitting withMATLAB. Representative results from three separate experimentsare shown, and each experiment had a triplicate set of each sample.


ment of differential inhibition profiles for drug-resistant vari-ants against various drugs.

DISCUSSION

HIV protease inhibitors have been developed into effectiveantiviral therapeutics for treating AIDS in the past decade.However, the effectiveness of the existing HIV protease inhib-itors has been hampered by the emergence of the drug-resis-tant HIV proteases. HIV protease variants can escape inhibi-tion by current HIV protease inhibitors and thus pose a greatmedical need for novel HIV protease inhibitors. We reporthere a simple yet efficient E. coli-based system for screeningthe HIV protease inhibitors that are not only potent but alsopermeable for crossing the cell membrane. This system uses�-galactosidase as the reporter to adapt high-throughputscreening and was validated with the in vivo inhibitory effectsof existing HIV protease inhibitors against both the wild-typeand drug-resistant HIV proteases. The ranking of IC50s of HIVprotease inhibitors against the HIV proteases, the wild typeand the drug-resistant variants, determined in our E. coli-basedsystem corresponded well with published data (24). Further-more, we demonstrated rapid identification of a novel HIVprotease inhibitor from a library of compounds prepared bydiversity-oriented synthesis in microtiter plates.

The usefulness of this E. coli-based system was demon-

strated with the FDA-approved HIV protease inhibitors andpepstatin A, a peptide-based aspartic protease inhibitor, as acontrol for cell permeability. Concentrations of each HIV pro-tease inhibitor in this E. coli-based system ranged from 1.6 �Mto as high as 5 mM. The small-molecule HIV protease inhib-itors exerted in vivo inhibitory effects on the autoprocessing ofthe HIV protease precursor at as low as 1.6 �M (NFV andSQV) or 8 �M (IDV and RTV) (Fig. 3), and these were threemagnitudes greater than the in vitro IC50s in the nanomolarrange against the purified wild-type HIV protease. Pepstatin Ahas an in vitro IC50 of 0.7 �M against the purified HIV pro-tease (15). Therefore, if it were permeable, then one wouldexpect to detect an in vivo IC50 for pepstatin A of around 700�M. In fact, pepstatin A, up to 5 mM, failed to exert anyinhibitory effects in the E. coli-based system. These data indi-cated that pepstatin A has low cell permeability; thus, it fails todiffuse passively across the cell membrane to inhibit autopro-cessing of the HIV protease precursor intracellularly. Thisresult suggested that the E. coli-based system could be used asan alternative method for rapidly selecting compounds with invivo activities which require both potent inhibitory activity anddesirable permeability.

The in vivo inhibition of HIV protease precursor autopro-cessing by HIV protease inhibitors reached a limit at 200 �M.Interestingly, the cleavage at the TFP-p6pol site, resulting inthe release of p6 pol-PR, still occurred in the presence of 5 mMHIV protease inhibitors (Fig. 3). Consistent with our results, invivo studies with HIV-infected human T lymphocytes found anaccumulation of the Pol intermediates, p6 pol-PR-RT-IN andp6-PR, in the presence of 1 �M SQV (18), which was manytimes higher than the nanomolar concentrations used in stan-dard antiviral assays. Therefore, it was reasonable that weobserved residual activity of autoproteolytic processing in thepresence of 5 mM HIV protease inhibitor in the E. coli-basedsystem.

The in vivo inhibitory effects of HIV protease inhibitorswere quantitated by determining the IC50 of a given proteaseinhibitor by using an in vivo �-galactosidase activity assay. Wecompared the IC50s determined in our study with other re-ported data sets: (i) EC90s determined from antiviral assayswith mammalian cells and (ii) IC50s obtained from another E.coli-based screening system (Table 1). Obviously, in E. coli-based systems, the drug concentrations needed to detect the invivo inhibitory activity of HIV protease inhibitors are threemagnitudes higher than what were needed for antiviral testingwith mammalian cells. However, the ranking of IC50s deter-mined in our system was similar to that determined with stan-dard antiviral tests (24). The higher IC50s obtained from the E.coli system might be mainly due to an additional barrier posedby the bacterial cell wall.

We demonstrated the feasibility of this system for drug re-sistance enzymes by using an HIV protease variant that has aD30N mutation in the HIV protease coding sequence. TheD30N mutation is an active-site mutation and represents themajor mutation that confers drug resistance specifically againstNFV. The structural analysis of binary complex D30N HIVprotease with NFV indicated altered interactions with hydro-phobic P2 side chains, resulting in variable substrate specificityand lower catalytic efficiency (20). The kcat/Km of D30N HIVprotease was determined to be 0.089 min1 �M1 compared

TABLE 2. Percentage of in vitro HIV protease activity detected inthe presence of 5 nM inhibitors from the compound librarya

R-COOHHIV protease activity

(%) with 5 nMinhibitor

A1 ......................................................................................... 75B1.......................................................................................... 70C1.......................................................................................... 75D1 ......................................................................................... 70E1.......................................................................................... 68F1.......................................................................................... 65A2 ......................................................................................... 35B2.......................................................................................... 74C2.......................................................................................... 80D2 ......................................................................................... 50E2.......................................................................................... 0F2.......................................................................................... 90A3 ......................................................................................... 5B3.......................................................................................... 80C3.......................................................................................... 96D3 ......................................................................................... 30E3.......................................................................................... 60F3.......................................................................................... 60A4 ......................................................................................... 90B4.......................................................................................... 94C4.......................................................................................... 99D4 ......................................................................................... 98E4.......................................................................................... 93F4.......................................................................................... 95A5 ......................................................................................... 90B5.......................................................................................... 70C5.......................................................................................... 97D5 ......................................................................................... 86E5.......................................................................................... 79F5.......................................................................................... 40

a All measurements were run in triplicate, and the reported values are themeans of these measurements.


to 0.41 min1 �M1 for the wild-type HIV protease (21). Thisindicated that the D30N HIV protease has a catalytic efficiencyfivefold lower than the wild-type HIV protease does. Whileusing the �-galactosidase activity as the reporter, we detecteda roughly twofold-lower activity for the D30N HIV proteasecompared to that for the wild-type enzyme. This system thuscould be used to identify HIV protease variants that havedifferent catalytic efficiencies than the wild-type HIV protease.

The drug response of the D30N HIV protease determined inour studies was similar to the drug resistance profile deter-mined in standard antiviral assays (Table 1). In our HIV pro-tease inhibitor studies with the E. coli-based model system, thedrug-resistant D30N HIV protease showed low responsivenessspecifically to NFV but not to other HIV protease inhibitors.The IC50s of APV, IDV, RTV, and SQV are similar or a littlelower against the D30N HIV protease versus the wild-typeHIV protease. However, the IC50 of NFV for the D30N HIVprotease increased at least ninefold compared with that for thewild-type HIV protease. This result suggested that the mosteffective agent among the five tested in this study for treatingpatients infected with the HIV strain carrying a D30N muta-tion in its protease coding sequence may be SQV, followed byRTV. This E. coli-based system could potentially provide asimple alternative method for generating drug resistance pro-

files that could be used in turn to suggest therapeutic use ofHIV protease inhibitors to treat drug-resistant HIV strains.

The amide-forming reaction has been successfully demon-strated as a rapid synthesis method for preparing diversity-oriented libraries against HIV protease for in situ screening(4). The method was used to prepare a library of compoundscontaining an APV-like core attached to various P2 residues,in which E2 emerged as a novel HIV protease inhibitor withpotency against both the wild type and the I84V HIV pro-teases. The amino residue I84 resides in the S2 binding pocket,and its mutation occurs during most of the HIV proteaseinhibitor treatments. The inhibitor E2, containing the 2-methyl-3-hydroxyl-benzamide portion at the P2 residue ratherthan the tetrahydrofuran ring at the P2 residue of APV,showed higher potency against the I84V HIV protease mutant.

The amide-forming reaction could be used to combine dif-ferent transition-state analog cores with various P2 or P3 res-idues to produce new inhibitors. Together with the E. coli-based screening platform, we should be able to perform rapidlead discovery of novel HIV protease inhibitors targeting theactive site of HIV proteases. It is plausible that this E. coli-based screening method developed for the HIV protease in-hibitor screening can be easily modified for inhibitor screeningfor other proteases, especially proteases from infectious agents

FIG. 6. In vivo dose-dependent effects of E2 against HIV proteases in the E. coli-based screening system. (A) Inhibition of autoprocessing ofthe wild-type HIV protease precursor. The drug treatment of E. coli cells containing the expression construct, pTF-PRWT, and Western blotanalysis with HIV protease antiserum was performed as described. Each lane contained 0.3 OD630 equivalents of cells, except the lane for PRD25N,which contained 0.1 OD630 equivalents of cells expressing PRD25N. (B) Inhibition of cleavage-induced loss of �-galactosidase activity in thepresence of the wild-type HIV protease. The E2-treated cells were processed for �-galactosidase activity detection by using whole cells in the96-well microplates as described. (C and D) In vivo dose-dependent effects of APV (C) and E2 (D) against the I84V HIV protease mutant. Thein vivo activity of the HIV protease inhibitors was determined by the inhibition of the cleavage-induced loss of �-galactosidase activity. The cellscoexpressing TF-PRI84V and �-GalPR were treated with HIV protease inhibitors at the indicated concentrations. �-Galactosidase activities(micromoles per minute per milligram of total protein) in the treated E. coli cells were determined, and the data were used to generate thedose-response curves by curve-fitting with MATLAB. Representative results from three separate experiments are shown, and each experiment hada triplicate set of each sample.


that can cause serious diseases with unmet medical needs. Suchproteases include the lethal factor from Bacillus anthracis andviral proteases from poliovirus and other viruses. The standarddrug discovery process involves laborious in vitro kinetic assaysfollowed by dangerous in vivo virus-induced cytotoxicity assaysin biosafety level 3 and 4 labs. This E. coli-based assay systemcould be used as an efficient, convenient, and safe surrogatesystem for rapid identification of promising protease inhibitorswith minimal exposure of human lives to infectious agents.

ACKNOWLEDGMENTS

We thank David Galas for manuscript review and critical discus-sions.

This work was supported in part by the Keck Graduate Institute ofApplied Life Sciences and the NIH (grant CA 99898 to C.-C.K.).

REFERENCES

1. Ansaldi, M., M. Lepelletier, and V. Mejean. 1996. Site-specific mutagenesisby using an accurate recombinant polymerase chain reaction method. Anal.Biochem. 234:110–111.

2. Baum, E. Z., G. A. Bebernitz, and Y. Gluzman. 1990. �-Galactosidase con-taining a human immunodeficiency virus protease cleavage site is cleavedand inactivated by human immunodeficiency virus protease. Proc. Natl.Acad. Sci. USA 87:10023–10027.

3. Brik, A., Y.-C. Lin, J. Elder, and C.-H. Wong. 2002. A quick diversity-oriented amide-forming reaction to optimize P-subsite residues of HIV pro-tease inhibitors. Chem. Biol. 9:891–896.

4. Brik, A., and C.-H. Wong. 2003. HIV-1 protease: mechanism and drugdiscovery. Org. Biomol. Chem. 1:5–14.

5. Cheng, Y. S. E., F. H. Yin, S. Foundling, D. Blomstrom, and C. A. Kettner.1990. Stability and activity of human immunodeficiency virus protease: com-parison of the natural dimer with a homologous, single-chain tethered dimer.Proc. Natl. Acad. Sci. USA 87:9660–9664.

6. Dasmahapatra, B., B. DiDomenico, S. Dwyer, J. Ma, I. Sadowski, and J.Schwartz. 1992. A genetic system for studying the activity of a proteolyticenzyme. Proc. Natl. Acad. Sci. USA 89:4159–4162.

7. Dautin, N., G. Karimova, A. Ullmann, and D. Ladant. 2000. A sensitivegenetic screen for protease activity based on a cyclic AMP signaling cascadein Escherichia coli. J. Bacteriol. 182:7060–7066.

8. Erickson, J. W. 2001. HIV-1 protease as a target for AIDS therapy, p. 1–25.In R. C. Ogden and C. W. Flexner (ed.), Protease inhibitors in AIDStherapy. Marcel Dekker, Inc., New York, N.Y.

9. Frankel, A. D., and J. A. Yong. 1998. HIV-1: fifteen proteins and a RNA.Annu. Rev. Biochem. 67:1–25.

10. Gong, Y.-F., B. S. Robinson, R. E. Rose, C. Deminie, T. P. Spicer, D. Stock,R. J. Colonno, and P.-F. Lin. 2000. In vitro resistance profile of the humanimmunodeficiency virus type 1 protease inhibitor BMS-232632. Antimicrob.Agents Chemother. 44:2319–2326.

11. Ishima, R., D. A. Torchia, S. M. Lynch, A. M. Gronenborn, and J. M. Louis.2003. Solution structure of the mature HIV-1 protease monomer: insight intothe tertiary fold and stability of a precursor. J. Biol. Chem. 278:43311–43319.

12. Kim, S. Y., K. W. Park, Y. J. Lee, S. H. Back, J. H. Goo, O. K. Park, S. K.Jang, and W. J. Park. 2000. In vivo determination of substrate specificity ofhepatitis C virus NS3 protease: genetic assay for site-specific proteolysis.Anal. Biochem. 284:42–48.

13. Klabe, R. M., L. T. Bacheler, P. J. Ala, S. Erickson-Viitanen, and J. L. Meek.1998. Resistance to HIV protease inhibitors: a comparison of enzyme inhi-bition and antiviral potency. Biochemistry 37:8735–8742.

14. Kohl, N. E., E. A. Emini, W. A. Schleif, L. J. Davis, J. C. Heimbach, R. A.Dixon, E. M. Scolnick, and I. S. Sigal. 1988. Active human immunodeficiency

virus protease is required for viral infectivity. Proc. Natl. Acad. Sci. USA85:4686–4690.

15. Krausslich, H. G., R. H. Ingraham, M. T. Skoog, E. Wimmer, P. V. Pallai,and C. A. Carter. 1989. Activity of purified biosynthetic proteinase of humanimmunodeficiency virus on natural substrates and synthetic peptides. Proc.Natl. Acad. Sci. USA 86:807–811.

16. Kupiec, J.-J., S. Hazebrouck, T. Leste-Lasserre, and P. Sonigo. 1996. Con-version of thymidylate synthase into an HIV protease substrate. J. Biol.Chem. 271:18465–18470.

17. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227:680–685.

18. Lindhofer, H., K. von der Helm, and H. Nitschko. 1995. In vivo processing ofPr160gag-pol from human immunodeficiency virus type 1 (HIV) in acutelyinfected, cultured human T-lymphocytes. Virology 214:624–627.

19. Louis, J. M., C. M. Clore, and A. M. Gronenborn. 1999. Autoprocessing ofHIV-1 protease is tightly coupled to protein folding. Nat. Struct. Biol. 6:868–875.

20. Mahalingam, B., J. M. Louis, J. Hung, R. W. Harrison, and I. T. Weber.2001. Structural implications of drug-resistant mutants of HIV-1 protease:high-resolution crystal structures of the mutant protease/substrate analoguecomplexes. Proteins 43:455–464.

21. Mahalingam, B., J. M. Louis, C. C. Reed, J. M. Adomat, J. Krouse, Y.-F.Wang, R. W. Harrison, and I. T. Weber. 1999. Structural and kinetic analysisof drug resistant mutants of HIV-1 protease. Eur. J. Biochem. 263:238–245.

22. Martínez, M.-A., M. Cabana, M. Parera, A. Gutierrez, J. A. Este, and B.Clotet. 2000. A bacteriophage lambda genetic screen for characterization ofthe activity and phenotype of the human immunodeficiency virus type 1protease. Antimicrob. Agents Chemother. 44:1132–1139.

23. Pardee, A. B., F. Jacob, and J. Monod. 1959. The genetic control andcytoplasmic expression of inducibility in the synthesis of �-galactosidase ofEscherichia coli. J. Mol. Biol. 1:165–168.

24. Patick, A. K., M. Duran, Y. Cao, D. Shugarts, M. R. Keller, E. Mazabel, M.Knowles, S. Chapman, D. R. Kuritzkes, and M. Markowitz. 1998. Genotypicand phenotypic characterization of human immunodeficiency virus type 1variants isolated from patients treated with the protease inhibitor nelfinavir.Antimicrob. Agents Chemother. 42:2637–2644.

25. Paulus, C., S. Hellebrand, U. Tessmer, H. Wolf, H. G. Krauslich, and R.Wagner. 1999. Competitive inhibition of human immunodeficiency virustype-1 protease by the Gag-Pol transframe protein. J. Biol. Chem. 274:21539–21543.

26. Pettit, S. C., S. Gulink, L. Everitt, and A. H. Kaplan. 2003. The dimerinterfaces of protease and extra-protease domains influence the activation ofprotease and the specificity of GagPol cleavage. J. Virol. 77:366–374.

27. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd edition. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

28. Schupp, J. M., S. E. Travis, L B. Price, R. F. Shand, and P. Keim. 1995.Rapid bacterial permeabilization reagent useful for enzyme assays. BioTech-niques 19:18–20.

29. Sices, H. J., and T. M. Kristie. 1998. A genetic screen for the isolation andcharacterization of site-specific proteases. Proc. Natl. Acad. Sci. USA 95:2828–2833.

30. Smith, T. A., and B. D. Kohorn. 1991. Direct selection for sequences encod-ing proteases of known specificity. Proc. Natl. Acad. Sci. USA 88:5159–5162.

31. Tung, R. D., D. J. Livingston, B. G. Rao, E. E. Kim, C. T. Baker, J. S. Boger,S. P. Chambers, D. D. Deininger, M. Dwyer, L. Elsayed, J. Fulghum, B. Li,M. A. Murcko, M. A. Navia, P. Novak, S. Pazhanisamy, C. Stuver, and J. A.Thomson. 2002. Design and synthesis of amprenavir, a novel HIV proteaseinhibitor. Infect. Dis. Ther. 25:101–118.

32. Wlodawer, A., and J. Erickson. 1993. Structure-based inhibitors of HIV-1protease. Annu. Rev. Biochem. 62:543–5858.

33. Wondrak, E. M., and J. M. Louis. 1996. Influence of flanking sequences onthe dimer stability of human immunodeficiency virus type 1 protease. Bio-chemistry 35:12957–12962.

34. Zybarth, G., and C. Carter. 1995. Domains upstream of the protease (PR) inhuman immunodeficiency virus type 1 Gag-Pol influence PR autoprocessing.J. Virol. 69:3878–3884.


Model System for High-Throughput Screening of Novel Human Immunodeficiency Virus Protease Inhibitors...

Documents

Transcript of Model System for High-Throughput Screening of Novel Human Immunodeficiency Virus Protease Inhibitors...