Seediscussions,stats,andauthorprofilesforthispublicationat:https://www.researchgate.net/publication/49836370

MatrixMetalloproteinase-9ParticipatesinNGF-Inducedalpha-SecretaseCleavageofAmyloid-betaProteinPrecursorinPC12...

ArticleinJournalofAlzheimer'sdisease:JAD·February2011

DOI:10.3233/JAD-2011-101893·Source:PubMed

CITATIONS

14

READS

80

5authors,including:

Someoftheauthorsofthispublicationarealsoworkingontheserelatedprojects:

theroleofMMP-9oninsulinresistanceinADViewproject

NeurotrophinreceptorsroleonadultneurogenesisViewproject

ApostoliaFragkouli

BiomedicalResearchFoundation

12PUBLICATIONS300CITATIONS

SEEPROFILE

AthinaTzinia

NationalCenterforScientificResearchDemo…

35PUBLICATIONS482CITATIONS

SEEPROFILE

IoannisCharalampopoulos

MedicalSchool,UniversityofCrete

72PUBLICATIONS1,541CITATIONS

SEEPROFILE

AchilleasGravanis

UniversityofCrete

179PUBLICATIONS4,318CITATIONS

SEEPROFILE

AllcontentfollowingthispagewasuploadedbyAthinaTziniaon01December2016.

Theuserhasrequestedenhancementofthedownloadedfile.Allin-textreferencesunderlinedinblue

arelinkedtopublicationsonResearchGate,lettingyouaccessandreadthemimmediately.

Journal of Alzheimer’s Disease 24 (2011) 705–719DOI 10.3233/JAD-2011-101893IOS Press

705

Matrix Metalloproteinase-9 Participatesin NGF-Induced �-Secretase Cleavageof Amyloid-� Protein Precursor in PC12Cells

Apostolia Fragkoulia,∗, Athina K. Tziniaa, Ioannis Charalampopoulosb, Achille Gravanisb

and Effie C. Tsilibarya

aInstitute of Biology, NCSR Demokritos, Athens, GreecebDepartment of Pharmacology, School of Medicine, University of Crete, Heraklion, Greece

Handling Associate Editor: Elliott Mufson

Accepted 5 January 2011

Abstract. Amyloid-� protein precursor (A�PP) is a ubiquitously expressed glycoprotein, which under physiological conditionscan be cleaved following two alternative routes; the non-amyloidogenic and the amyloidogenic pathway. Shift of A�PP processingin favor of the amyloidogenic pathway is a key event in the pathogenesis of Alzheimer’s disease (AD). Among the factors thatregulate A�PP processing, nerve growth factor (NGF) appears to play an important role; abnormal NGF signaling has beenimplicated in the onset of AD. In the present study, we used PC12 cells to study the effects of NGF on A�PP processing andprovide evidence that NGF, through binding to its high affinity receptor, TrkA moderately down-regulates the expression of the�-secretase �-site A�PP cleaving enzyme-1 and, most importantly, upregulates the expression of two enzymes with �-secretaseactivity, a disintegrin and metalloprotease-17 and to a greater extent matrix metalloproteinase-9 (MMP9) in a phosphoinositidekinase-3 dependent manner. Finally, we demonstrate that MMP9 actively participates in NGF-induced �-secretase cleavage ofA�PP, thus it contributes to the shift of A�PP processing towards the non-amyloidogenic pathway precluding the formation ofneurotoxic A� peptides.

Keywords: A�PP, �-secretase, ADAM10, ADAM17, BACE1, MMP9, NGF, PC12 cells, TrkA

INTRODUCTION

Amyloid-� protein precursor (A�PP) constitute afamily of integral glycoproteins with an extensiveextracellular domain, all derived by alternative splic-ing of A�PP messenger RNA (mRNA) and namedafter their length [1]. The A�PP gene is ubiquitously

∗Correspondence to: Dr. Apostolia Fragkouli, Institute of Biol-ogy, NCSR Demokritos, Patriarchou Grigoriou and Neapoleos Str,15310 Agia Paraskevi, Athens, Greece. Tel.: +30 10 650 3631; Fax:+30 10 651 1767; E-mail: ApostoliaFragkouli@gmail.com.

expressed in mammalian tissues, but most abundantin the brain, where A�PP proteins are present in bothneurons and glial cells [2, 3]. The highly conservedsequence of the A�PP gene throughout phylogeny,as well as its highly regulated expression argue foran important physiological role in brain function;A�PP has been implicated in cell adhesion, neu-rite outgrowth, synaptogenesis, synaptic plasticity, andneuroprotection against a broad number of insults [4].

The extensive ectodomain of A�PP is releasedfrom cells by proteolytic cleavage, and dependingon the pathway followed, various soluble fragments

ISSN 1387-2877/11/$27.50 © 2011 – IOS Press and the authors. All rights reserved

706 A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA

are released. More specifically, cleavage of A�PP by�-secretases, known as non-amyloidogenic pathway,results in the secretion of a soluble N-terminal frag-ment (sA�PP�), a potent neurotrophic factor [5–7],and the generation of a membrane-bound C-terminalfragment (CTF-�). Two members of the a disintegrinand metalloprotease (ADAM) family, ADAM 10 [8,9], and ADAM17/TACE [10, 11], have been shownto have �-secretase activity (for review, see [12]).Recently, matrix metalloproteinase-9, a member ofgelatinase/matrix metalloproteinase family, has alsobeen demonstrated to exhibit �-secretase activity [13].

Alternatively, A�PP can be cleaved by �- and �-secretases (amyloidogenic pathway), giving rise toA� peptides, the major component of senile plaquespresent in the brain of patients with Alzheimer’s dis-ease (AD), as well as to a membrane-bound C-terminalfragment (CTF-�) and a soluble ectodomain derivativesA�PP� [14, 15]. The �-site cleavage constitutes therate-limiting step in A� generation and is catalyzed bythe �-site A�PP cleaving enzyme-1 (BACE1) [16].

The shift of A�PP processing in favor to the amy-loidogenic pathway appears to be a key event in thepathogenesis of AD [17]. Among the factors that reg-ulate proteolytic processing of A�PP, neurotrophins,and in particular nerve growth factor (NGF), playa significant role [1, 18]. Nerve growth factor, the pro-totypic growth factor for neurons, promotes the growthand survival of cholinergic neurons of the basal fore-brain [19], the degeneration of which is among thefirst pathological features of AD [17]. Abnormal NGFsignaling has been implicated in the onset of AD (forreview, see [17, 18]); NGF deprivation activates theamyloidogenic pathway and induces apoptosis in PC12differentiated cells [20] or cultured hippocampal neu-rons [21], and aged anti-NGF transgenic mice developan AD-like phenotype, including increased productionof A� peptides and formation of senile plaques [22].

Another link between NGF and A�PP has also beenestablished; PC12 cells, as well as neuronal cells in cul-ture, upregulate A�PP expression when treated withNGF [23–25] and NGF has been shown to act on theA�PP promoter [25, 17]. Moreover, it has been shownthat NGF induces sA�PP� secretion from PC12 cells[25, 27, 28] and that sA�PP� mediates the effectsof NGF on neurite outgrowth [29, 30]. Nevertheless,given that NGF also upregulates the expression ofA�PP, it remains unclear whether sA�PP� secretioninduced by NGF is the result of a shift of A�PP pro-cessing towards the �-secretase pathway.

In order to address this question, we used PC12cells that have been commonly used in studies con-cerning NGF signaling and A�PP processing, since

they express both NGF receptors—the high affinityTropomyosin related kinase A receptor (TrkA) andthe low affinity pan-neurotrophin receptor p75NTR—aswell as significant levels of A�PP. Consistent withprevious reports, we demonstrate herein that expo-sure to NGF resulted in an increased secretion ofthe neurotrophic sA�PP� from PC12 cells. The lattereffect appears to be attributed to a TrkA-mediated shiftof A�PP processing toward the �-secretase pathway,since in PC12 cells lacking TrkA, NGF treatment failedto induce sA�PP� secretion in the culture medium.Most importantly, in the present study we provide evi-dence that NGF regulates the expression of �- and�-secretases; when exposed to NGF, PC12 cells mod-erately down-regulated BACE1 mRNA and proteinlevels, and upregulated (via phosphoinositide kinase-3(PI3K) signaling pathway) ADAM17, and to a greaterextent, MMP9 mRNA and protein levels. Finally,we demonstrate that MMP9 plays a significant rolein NGF-mediated secretion of sA�PP�, since phar-macological inhibition of its activity or MMP9-genesilencing resulted in significantly reduced levels ofsA�PP� secretion from NGF-treated PC12 cells.

MATERIAL AND METHODS

Cell cultures

The parental rat pheochromocytoma PC12 cells,as well as PC12 cells lacking TrkA receptor (cloneNNR5) were cultured in RPMI 1640 medium contain-ing 2 mM L-glutamine, 15 mM HEPES, 100 units/mlpenicillin, 0.1 mg/ml streptomycin, 10% fetal bovineserum and 5% horse serum and maintained at 5%CO2 and 37◦C. Cells were sub-cultured twice a week,whereas the medium was changed every two days.All culture media were purchased from Biochrom AG(Berlin, Germany).

Before exposure to NGF, cells were sub-culturedand allowed to attach overnight. Subsequently, the cellswere washed with serum-free medium and incubatedin serum-free medium (control) or serum-free mediumcontaining 100 ng/ml NGF (Sigma, St Louis, USA) fora time-period ranging from 5 min to 24 h depending onthe type of experiment.

Pharmacological inhibition

PI3K inhibitors wortmannin and LY294002 werepurchased from Cell Signaling Technology (Beverly,MA, USA), whereas the gelatinase inhibitor SB-3CT, a highly efficient and selective mechanism-based

A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA 707

inhibitor of gelatinases [31, 32], from Chemicon(Temecula, CA, USA). In PI3K inhibition studies,PC12 cells were sub-cultured, allowed to attachovernight, washed with serum-free medium, pre-incubated for 1 h in serum-free medium containing1 �M wortmannin or 50 �M LY294002 and finallyincubated for 6 h in serum-free medium containing100 ng/ml NGF and 1 �M wortmannin or 100 ng/mlNGF and 50 �M LY294002, respectively. In gelatinaseinhibition studies, PC12 cells were treated as previ-ously, but three different concentrations of the SB-3CTinhibitor (1 �M, 2.5 �M, and 5 �M) were used.

MMP9 silencing by siRNA

To silence MMP9 expression we used HPGenomeWide siRNA kit from Qiagen. Cells weretransfected with siRNA targeting the indicatedsequence or negative control siRNA using the RNAi-Fect as the transfection reagent. The sequence ofsiRNA targeting the MMP9 sequence 5′-TTCGACGGCAAGGATGGTCTA-3′ was designated by Qiagen.Transfections were performed according to the manu-facturer’s instructions. Briefly, PC12 cells were platedat a density of 6 × 104 cells/12-well plates. After 24 h,cells were transfected with 2 �g of MMP9 siRNAor with a non-targeting siRNA sequence, as negativecontrol, 12 �l of RNAiFect and allowed to culturefor a 24-h recovery period. Cells were then washedwith serum-free medium and incubated in serum-freemedium containing 100 ng/ml NGF for 24 h.

Immunoblotting

Immunoblotting was performed on cell lysates orconditioned media. In case of detection of phosphory-lated protein, cells were lysed in a buffer containing20 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA,100 nM NaF, 1 mM NaVO4, 1 mM PMSF, 1%TritonX-100 in addition to a cocktail of protease inhibitors(Sigma). Alternatively, cells were lysed in 25 mMTris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1%Tri-ton X-100 containing the same cocktail of proteaseinhibitors. Cellular protein content was determinedby the Bradford assay (Thermo Scientific, Rockford,USA).

Equal amounts of cell extracts or conditioned media,the volume of which was adjusted according to the cellnumber obtained at harvest, were subjected to SDS-PAGE under reducing conditions on 10%, 15%, or20% polyacrylamide gels, depending on the molec-ular mass of the proteins under examination. After

electrophoresis, the resolved proteins were trans-ferred to Hybond-ECL nitrocellulose membrane (GEHealthcare, Buckinghamshire, UK) by electroblotting.Subsequently, membranes were saturated for 1 h atroom temperature with 5% non-fat milk and 0.1%Tween-20 in TBS and incubated overnight at 4ºC in5% non-fat milk/TBS containing the primary antibodyin the appropriate dilution. The following day, mem-branes were washed in TBS, incubated for 1 h at roomtemperature in 5% non-fat milk/TBS containing theappropriate HRP-conjugated secondary antibody (GEHealthcare), washed in TBS and finally developedusing the SuperSignal West Pico ChemiluminescentSubstrate (Thermo Scientific). Each sample was testedin duplicate and samples obtained from three or fourindependent experiments were used for analysis.

Antibodies

The monoclonal antibody 6E10 (Covance,Emerville, CA, USA) [9] is directed against amino-acids 1–16 of human A� peptide and was used in adilution 1 : 1000 for the detection of full length A�PP,and of the A�PP proteolytic fragments sA�PP� andCTF-�. This antibody has been also used for the detec-tion of murine full length A�PP and its proteolyticfragments [20]. The R1(57) anti-A�PP C-terminalrabbit antibody [33], used in a dilution 1 : 2000, wasa kind gift of Dr. S. Efthimiopoulos (University ofAthens, Athens, Greece). The anti-BACE (M-83,raised against BACE of mouse origin) and the anti-ADAM17 (H-100, raised against ADAM17 of humanorigin) rabbit polyclonal antibodies were purchasedfrom Santa Cruz Biotechnology, Inc. (Santa Cruz, CA,USA) and used in a dilution 1 : 500 for the detectionof BACE1 [34] and ADAM17 [35], respectively.Rabbit primary antibodies against phospho-JNK1/2(Thr183/Tyr185) [36], JNK1/2, phosho-Akt (Ser478) [37], and ERK1/2, as well as mouse primaryagainst phosho-ERK1/2 (Thr202/tyr204) [38] andAkt all used in a dilution 1 : 2000, were from CellSignaling Technology. Finally, the mouse anti-�tubulin antibody (diluted 1 : 5000) was from Sigmaand the rabbit polyclonal antibody against MMP9[39] (diluted 1 : 2000) was purchased from Chemicon.All secondary antibodies HRP-conjugated were alsopurchased by Chemicon and used at 1 : 1000 dilution.

Densitometric analysis

Densitometric analysis of immunoblotting imageswas performed using the image processing softwareBioprofil Vilber Loumart.

708 A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA

Quantitative reverse transcriptase polymerasechain reaction (QRT-PCR)

Cell cultures were washed in PBS and total RNAwas extracted using the Trizol Reagent (Invitrogen,Carlsbad, CA, USA) according to the manufacturer’sprotocol. Absorbance at 260 nm was used to quan-tify RNA yield. Subsequently, one microgram of totalRNA was reverse transcribed to cDNA by the ImProIIreverse transcriptase (Promega, Madison, WI, USA)using oligo (dt)20 as primers (Metabion, Martinsried,Germany).

Quantitative PCR was performed by real-time PCRusing the Brilliant II SYBR Green QPCR Master Mix(Stratagene, CA, USA). PCR reactions with a totalvolume of 30 �L contained 1 �L cDNA, the primers(Metabion) of the gene of interest at the appropri-ate concentration and the SYBR Green QPCR mastermix. For each of the gene-specific primers, opti-mization was carried out prior to the experiment toconfirm that no non-specific amplification signal wasproduced.

Real time PCR was carried out in the MX3000Pinstrument (Stratagene) and the specificity of theproduced amplification product was confirmed byexamination of the dissociation curves (a single peakindicated that a single DNA sequence was amplifiedduring the real time PCR). Each sample was tested intriplicates and samples obtained from four independentexperiments were used for analysis of relative geneexpression. The housekeeping gene �-actin was usedas an internal control, and gene-specific mRNA expres-sion was normalized against �-actin expression usingthe MxPro Software (Stratagene). Primer sequencesare summarized in Table 1.

Statistical analysis

For all parameters examined, three or four inde-pendent experiments (each in duplicate) were usedfor analysis. The effect of treatment on the differ-ent parameters examined was assessed using one way

ANOVA with treatment as independent factor. Bonfer-roni pos hoc analysis was performed where applicable.Significance was defined as p < 0.05. All statisticalanalyses were performed using the SPSS software(Release 10.0.1, SPSS, Chicago, IL, USA).

RESULTS

AβPP expression and processing in naive PC12cells upon exposure to NGF

As previously described [25], PC12 cells expressthree A�PP isoforms: A�PP770, A�PP751, andA�PP695 (Fig. 1A). Treatment of PC12 cells withNGF for 24 h appeared to have no significant effect onthe expression levels of A�PP770 and A�PP751; nev-ertheless, the latter treatment resulted in a statisticallysignificant ∼30% reduction of the A�PP695 pro-tein levels (Fig. 1A; one way ANOVA: F(1,7) = 9.133,p < 0.05). In order to examine whether NGF has anyeffect on A�PP processing towards either the �-secretase or the �-secretase pathway [1], we firstanalyzed the ratio between CTF-� and CTF-�,the membrane-bound C-terminal fragments generatedupon �- and �-secretase cleavage of the A�PP pro-tein, respectively. As shown in Fig. 1B, 24-h treatmentwith NGF resulted in a statistically significant ∼50%increase in the CTF-�/CTF-� ratio (one way ANOVA:F(1,6) = 34.295, p < 0.01), suggesting a shift towardsthe non-amyloidogenic pathway. Consistently, whenthe levels of CTF-� (generated by the �-cleavageof A�PP) and those of sA�PP� (generated upon �-secretase cleavage) were examined, we observed thatcompared to their controls, PC12 cells exposed toNGF for 24 h displayed a statistically significant ∼50%reduction of CTF-� levels (Fig. 1C; one way ANOVA:F(1,7) = 27.075, p < 0.01) and a statistically significant5.5-fold increase of sA�PP� release in the culturemedium (Fig. 1D; one way ANOVA: F(1,7) = 130.308,p < 0.001). Taken together, our observations suggestthat NGF shifts A�PP processing towards the �-secretase (non-amyloidogenic) pathway.

Table 1Primer sequences used in real time PCR

Gene Forward primer 5′–3′ Reverse primer 5′–3′

ADAM10 GCCTATGTCTTCACGGACCG TGCCAGACCAAGAACACCATCADAM17 ACTCTGAGGACAGTTAACCAAACC AGTAAAAGGAGCCAATACCACAAGBACE1 GCTCTCCTGAGAGAAGCCAC CCTGGGTGTAGGGCACATA�-ACTIN ACAGCTTCACCACCACAGCTGA GAGGTCTTTACGGATGTCAACGTCRt MMP9 AAGCCTTGGTGTGGCACGAC TGGAAATACGCAGGGTTTGC

A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA 709

A

C D

B

Fig. 1. Treatment of PC12 cells with NGF resulted in a reduced expression of the isoform A�PP695 and a shift of A�PP processing in favor ofthe non-amyloidogenic pathway. A–C) Equal amounts of total protein from lysates of PC12 cells cultured for 24 h in the absence (control) orpresence of 100 ng/ml NGF, were analyzed on 10% (A), 15% (C) or 20% (B) SDS-PAGE and immunoblotted with the monoclonal antibody 6E10to detect A�PP (A) and CTF-� (C) or polyclonal antibody R157 to detect both CTF-� and CTF-� (B). To ensure equal loading membranes werere-probed against tubulin. D) To detect sA�PP�, conditioned media from PC12 cells cultured under the same conditions were analyzed on 10%SDS-PAGE and immunoblotted with the monoclonal antibody 6E10. The volume of conditioned medium loaded per lane was adjusted accordingto cell numbers obtained at harvest. Note that exposure to NGF for 24 h led to a significant decrease in A�PP695 protein levels and a significantincrease of the CTF-�/CTF-� ratio, concomitant with a significant decrease of CTF-� protein levels and a significant increase in sA�PP� releasein the culture medium. Quantification of the results was performed by scanning densitometry. Bars in graphs depict mean ± SEM. *p < 0.05,**p < 0.01, ***p < 0.001.

710 A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA

Treatment of PC12 cells with NGF leads to alteredexpression of α- and β-secretases

To further explore the possibility that NGF shiftsA�PP processing towards the �-secretase pathway, wefirst examined the transcriptional levels of A�PP pro-cessing enzymes in PC12 cells cultured for 24 h in theabsence or presence of NGF, by using a quantitativeRT-PCR approach. As shown in Fig. 2A and B, theabove treatment led to statistically significant changesin the mRNA levels of most secretases examined; morespecifically, it resulted in a ∼40% decrease of BACE1mRNA (one way ANOVA: F(1,7) = 847.390, p < 0.001),as well as in a ∼2-fold increase of ADAM17 (one wayANOVA: F(1,7) = 1992.649, p < 0.001) and a ∼10-foldincrease of MMP9 mRNA levels (one way ANOVA:F(1,7) = 169.847, p < 0.001). Under these conditions,no significant change in ADAM10 mRNA levels wasobserved.

Given that changes in mRNA levels are not alwaysreflected at the protein level, we next examined the pro-tein levels of all secretases, whose transcription wasaltered in PC12 cells treated for 24 h with NGF. PC12cells cultured under the same conditions displayeda small (∼12%), but statistically significant reductionof BACE1 protein levels (Fig. 2C; one way ANOVA:F(1,5) = 9.223, p < 0.05), but no statistically significantchange in ADAM17 protein levels (Fig. 2D). In con-trast, a statistically significant ∼3.5 fold increase inthe secretion of MMP9, both the latent and the activeform, was observed upon the same treatment (Fig. 2E;one way ANOVA: F(1,7) = 59.720, p < 0.001); the latterincrease was also reflected in the enhanced gelati-nolytic activity of pro-MMP9 detected in the culturemedium of PC12 cells treated as previously (data notshown). Taken together, our results so far suggest thatin PC12 cells, NGF modulates the expression of A�PPprocessing enzymes and thus shifts A�PP processingin favor of the �-secretase pathway.

Time-course analysis of the non-amyloidgeniceffects of NGF in PC12 cells

To further explore the non-amyloidogenic effects ofNGF in PC12 cells, we performed a time-course analy-sis of sA�PP� release in the culture medium, as well asof the expression and release of �-secretases ADAM17and MMP9. As shown in Fig. 3A, a statistically sig-nificant increase of sA�PP� release in the presenceof NGF was evident at all time point examined; from2 until 24 h post-exposure (one way ANOVA: F(1,7)

ranging from 7.232 to 124.425, in all cases p < 0.05).Compared to untreated controls in PC12 cells exposedto NGF, MMP9 release in the culture medium appearedsignificantly increased only after 6 h of treatment(Fig. 3B; one way ANOVA: F(1,7) = 26.511, p < 0.01)and this statistically significant increase was main-tained until the latest time-point examined, i.e., 24 h(Fig. 3B; one way ANOVA: F(1,7) = 59.720, p < 0.001).In contrast, ADAM17 protein levels, although unal-tered at 2 h post-exposure, were significantly increasedupon treatment with NGF for 4 h (one way ANOVA:F(1,5) = 60.357, p = 0.001 and data not shown) or 6hours (one way ANOVA: F(1,7) = 69.956, p < 0.001);nevertheless, this increase was not maintained in longertreatments (Fig. 3C), suggesting a rather rapid turnoverof the protein.

NGF shifts AβPP processing in favor of theα-secretase pathway through TrkA-mediatedsignaling

It is well established that NGF exerts its effectsthrough binding to its receptors [1]. Hence, we nextexamined whether the observed non-amyloidogeniceffects of NGF are mediated through TrkA or p75NTR

signaling by initially assessing the levels of phosphory-lated Akt, Erk1/2 and JNK1/2 in PC12 cells incubatedin the absence or presence of NGF for time-periodsranging from 5 min to 24 h after exposure; the lat-ter time point being used in our previous analysis.As shown in Fig. 4, treatment of PC12 cells withNGF led to significantly increased levels of phos-phorylated Akt (Fig. 4A; one way ANOVA: F(1,5)ranging from 24.151 to 48.066, in all cases p < 0.01)and phosphorylated Erk1/2 (Fig. 4B; one way ANOVA:F(1,5) ranging from 11.423 to 45.030, in all casesp < 0.05), evident as early as 5 min after administra-tion of NGF and maintained until the latest time-pointexamined, i.e., after 24 h. In contrast, no such effectwas observed on the levels of phosphorylated JNK1/2(Fig. 3C) suggesting that the observed NGF effects aremediated through binding to its high affinity receptorTrkA.

To further explore this possibility, we used a PC12subclone (NNR5) that expresses A�PP and p75NTR –but not TrkA-receptors (data not shown). Consistentwith our hypothesis, treatment of NNR5 cells withNGF for 24 hours failed to increase sA�PP� pro-tein levels in the culture medium (Fig. 4D). Overall,our observations suggest that TrkA mediates the non-amyloidogenic effects of NGF.

A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA 711

4

3

2

1

02

0

1

2

3

4

0

1

2

3

4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34

A

B

C D E

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 2 4 6 8 101214161820222426283032343638

20.0

0.5

1.0

1.5

2.0

4 6 8 10 12 14 16 18 20 22 24 26 28 3032

Fig. 2. Treatment of PC12 cells with NGF resulted in altered expression of A�PP processing enzymes. A) Amplification plots from representativeQRT-PCR experiments performed to detect the expression of A�PP processing enzymes BACE1, ADAM10, ADAM17, and MMP9 in PC12cells cultured for 24 h in the absence or presence of 100 ng/ml NGF. In all plots, light grey lines represent the amplification of the referencegene �-actin, whereas dark lines indicate the amplification of the gene of interest in the absence (circles) or presence (squares) of NGF. B)Quantification of QRT-PCR experiments (mean ± SEM) performed with the MxPro software. In all cases the mRNA levels of the secretaseexamined were normalized to �-actin mRNA levels of the same sample. Note that upon 24-h exposure to NGF, PC12 cells significantly down-regulated BACE1 expression and upregulated that of ADAM17 and to a greater extent that of MMP9. C and D) Equal amounts of total proteinfrom lysates of PC12 cells cultured as above were analyzed on 10% SDS-PAGE and immunoblotted with polyclonal antibodies specific forBACE1 (C) and ADAM17 (D). To ensure equal loading membranes were re-probed against tubulin. E) To detect MMP9, conditioned mediafrom PC12 cells cultured under the same conditions were analyzed on 10% SDS-PAGE and immunoblotted with a polyclonal antibody specificfor MMP9. The volume of conditioned medium loaded per lane was adjusted according to cell numbers obtained at harvest. Note that, consistentwith changes in mRNA levels, a statistically significant decrease of BACE1 and a statistically significant increase of MMP9 protein levels wereobserved. Interestingly, no statistically significant change was observed in ADAM17 protein levels. Quantification of the results in C to E wasperformed by scanning densitometry. In all cases, bars in graphs depict mean ± SEM. *p < 0.05, ***p < 0.001.

712 A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA

A

B

C

Fig. 3. Time-course analysis of the non-amyloidogenic effects ofNGF in PC12 cells. A and B) Conditioned media from PC12 cellscultured in the absence (control) or presence of 100 ng/ml NGF for 2,6, and 24 h were analyzed on 10% SDS-PAGE and immunoblottedwith the monoclonal antibody 6E10 (A) or a polyclonal antibodyspecific for MMP9 (B), in order to detect sA�PP� and MMP9release, respectively. The volume of conditioned medium loaded perlane was adjusted according to cell numbers obtained at harvest. C)Equal amounts of total protein from lysates of PC12 cells culturedunder the above conditions were analyzed on 10% SDS-PAGE andimmunoblotted with a polyclonal antibody specific for ADAM17.To ensure equal loading membranes were re-probed against tubulin.Note that sA�PP� release was significantly increased in the presenceof NGF at all time-points examined. MMP9 release appeared signif-icantly increased only after 6 h exposure to NGF, and this increasewas maintained until the latest time-point examined. ADAM17 pro-tein levels were significantly increased at 6 h post-exposure to NGF,but this increase was not maintained after 24 h. Quantification ofthe results was performed by scanning densitometry. Bars in graphsdepict mean ±SEM. *p < 0.05, **p < 0.01, ***p < 0.001.

NGF upregulates the expression of α-secretasesADAM17 and MMP9 via PI3K/Akt signalingpathway

To confirm the signaling pathway involved inNGF-induced �-secretase A�PP processing, we nextexamined the effect of PI3K/Akt signaling pathwayinhibition on the expression levels of �-secretasesADAM17 and MMP9, as well as on sA�PP� releasein the culture medium of PC12 cells. In order to avoidproblems arising from the relatively short half-life ofthe inhibitors used, we chose to perform our inhibitionstudies in PC12 cells after 6 h of treatment withNGF, a time-point during which we clearly observedchanges in the expression levels of all proteins ofinterest. As shown in Fig. 5, in NGF-treated PC12cells inhibition of Akt-phosphorylation by adminis-tration of either wortmannin or LY294002 (Fig. 5A)resulted in significantly decreased ADAM17 [Fig. 5B;one-way ANOVA (treatment effect): F(3,11) = 7.062,p < 0.05 and Bonferroni post hoc] and MMP9 proteinlevels [Fig. 5C; one-way ANOVA (treatment effect):F(3,11) = 36.746, p < 0.001 and Bonferroni post hoc] –in lysates and conditioned media, respectively – thatwere similar to those observed in NGF-untreated PC12cells. A similar result was also observed in sA�PP�release in the culture medium [Fig. 5D; one-wayANOVA (treatment effect): F(3,11) = 53.218, p < 0.001and Bonferroni post hoc]. Thus, it appears that NGFupregulates expression of �-secretases ADAM17 andMMP9 via the PI3K/Akt signaling pathway.

MMP9 participates in the non-amyloidogeniceffect of NGF

The dramatic and sustained increase of MMP9expression and release observed upon NGF treatmentsuggests that this metalloproteinase holds a signifi-cant role in the non-amyloidogenic effects of NGF.In order to test this hypothesis, we examined the lev-els of sA�PP� in the culture medium of PC12 cellsincubated for 6 h in the absence of NGF, in the pres-ence of NGF alone or in the presence of NGF and thegelatinase inhibitor SB-3CT at various concentrations.As shown in Fig. 6A compared to NGF-untreated con-trols, only PC12 cells treated with NGF alone or NGFand 1 �M SB-3CT displayed significantly increasedsA�PP� release in the culture medium; furthermore,compared to PC12 cells exposed to NGF only, PC12cells exposed to NGF in the presence of 1 �M SB-3CTdisplayed a statistically significant ∼35% reductionin the secretion of sA�PP� in the culture medium

A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA 713

A

B

C D

Fig. 4. In PC12 cells NGF exerts its non-amyloidogenic effects through binding to TrkA. A–C) Equal amounts of total protein from lysates ofPC12 cells cultured in the absence or presence of 100 ng/ml NGF from 5 min to 24 h were analyzed on 10% SDS-PAGE and immunoblottedwith antibodies specific for phosphorylated Akt (A), phosphorylated Erk1/2 (B) or phosphorylated JNK1/2 (C). To ensure equal loading,membranes were re-probed against Akt, Erk1/2, or JNK1/2, respectively. Note that incubation with exogenously administered NGF peptideleads to a sustained activation of TrkA, but not p75NTR, mediated signaling pathways. Quantification of the results was performed by scanningdensitometry and bars in graphs depict mean ± SEM. D) Conditioned media from NNR5 cells (lacking TrkA expression) cultured in the absence(control) or presence of 100 ng/ml NGF for 24 h were analyzed on 10% SDS-PAGE and immunoblotted with the monoclonal antibody 6E10, inorder to detect sA�PP� release. The volume of conditioned medium loaded per lane was adjusted according to cell numbers obtained at harvest.Note than in the absence of TrkA receptor, NGF treatment had no effect on sA�PP� release in the culture medium. *p < 0.05, **p < 0.01.

[one way ANOVA (treatment effect): F(4,14) = 69.885,p < 0.001 and Bonferonni post-hoc].

To further explore MMP9 involvement in NGF-induced sA�PP� release, we followed an alternative

approach in order to inhibit MMP9 activity, that ofgene silencing by siRNA transfection. Consistent withour pharmacological studies, we observed that com-pared to PC12 controls transfected with a non-targeting

714 A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA

A B

C D

E

Fig. 5. NGF upregulates ADAM17 and MMP9 expression in PC12 cells via activation of the PI3K/Akt signaling pathway. A and B) Equalamounts of total protein from lysates of PC12 cells cultured for 6 h in the absence of NGF (control), in the presence of 100 ng/ml NGF aloneor in the presence of 100 ng/ml NGF and a PI3K inhibitor (1 �M wortmannin or 50 �M LY294002) were analyzed on 10% SDS-PAGE andimmunoblotted with polyclonal antibodies specific for phosphorylated Akt (A) or ADAM17 (B). To ensure equal loading membranes were re-probed against Akt or tubulin, respectively. C and D) To detect MMP9 and sA�PP� release, conditioned media from PC12 cells cultured underthe same conditions were analyzed on 10% SDS-PAGE and immunoblotted with a polyclonal antibody specific for MMP9 or the monoclonalantibody 6E10, respectively. The volume of conditioned medium loaded per lane was adjusted according to cell numbers obtained at harvest.Note that, inhibition of Akt phosporylation by administration of both PI3K inhibitors (A) blocked the NGF-induced upregulation of ADAM17protein levels and the NGF-induced increase of MMP9 and sA�PP� release in the culture medium. Quantification of the results was performedby scanning densitometry; bars in graphs depict mean ± SEM. *p < 0.05, ***p < 0.001.

siRNA, PC12 cells transfected with the siRNA target-ing the MMP9 gene displayed an ∼80% reduction ofMMP9 protein levels (Fig. 6B), and most importantlya statistically significant ∼30% reduction of sA�PP�levels (Fig. 6C; one way ANOVA: F(1,5) = 93,938,p < 0.001) in the culture medium after 24-h expo-sure to NGF. Taken together, the above observationssuggest that MMP9 participates in TrkA-mediatednon-amyloidogenic effects of NGF.

DISCUSSION

Accumulating evidence over the last decades sug-gests that NGF plays a pivotal role in regulating A�PPprocessing, and disruption of NGF signaling is con-sidered among the factors involved in the etiologyof AD; NGF deprivation activates the amyloidogenicpathway of A�PP processing and induces apoptosis indifferentiated PC12 cells [20] or hippocampal neurons[21]. More importantly, transgenic mice expressing

antibodies neutralizing NGF (AD11 anti-NGF mice)develop an AD-like phenotype including deposition ofA�, intracellular neurofibrillary tangles, and markedcholinergic depletion [22], and studies in a mousemodel of Down’s syndrome have established a linkbetween altered NGF retrograde transport and A� pro-duction [40].

Although the effect of NGF deprivation (or of abnor-mal NGF signaling) on A�PP processing is beingintensively studied (for a review, see [18]), little isknown about the physiological role of NGF in thesame process. In most studies concerning the effectsof NGF on A�PP expression and processing, NGFadministration has been shown to increase both A�PPexpression and sA�PP� release, a rather confoundingresult, since increased A�PP expression could accountfor the increased sA�PP� release [23, 24, 26, forreview, see 1]. In the present study, we demonstratethat in naıve PC12 cells, NGF indeed shifts A�PPprocessing towards the non-amyloidogenic pathway;naıve PC12 cells treated with NGF up-regulated the

A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA 715

A B C

Fig. 6. MMP9 contributes to NGF-induced sA�PP� release in PC12 cells. A) Conditioned media from PC12 cells cultured for 6 h in the absenceof NGF (control), in the presence of 100 ng/ml NGF alone, or in the presence of 100 ng/ml NGF and the gelatinase inhibitor SB-3CT at differentconcentration (1, 2.5, or 5 �M) were analyzed on 10% SDS-PAGE and immunoblotted with the monoclonal antibody 6E10, to detect sA�PP�.Note, that in all concentrations used, treatment with SB-3CT resulted in a statistically significant decrease of NGF-induced sA�PP� release.B and C) Conditioned media from PC12 cells transfected with a non-targeting siRNA (control) or an siRNA targeting the MMP9 gene andincubated for 24 h in the presence of 100 ng/ml NGF were analyzed on 10% SDS-PAGE and immunoblotted with a polyclonal antibody specificfor MMP9 (B) or the monoclonal antibody 6E10 (C) in order to detect MMP9 or sA�PP� protein levels, respectively. Note that compared toPC12 cells transfected with the non-targeting siRNA, in MMP9 siRNA transfected PC12 cells 24-h exposure to NGF resulted in significantlydecreased levels of sA�PP� release. In all cases the volume of conditioned medium loaded per lane was adjusted according to cell numbersobtained at harvest and quantification of the results was performed by scanning densitometry. Bar graphs depict mean ± SEM. **p < 0.01,***p < 0.001.

expression of enzymes with �-secretase activity (i.e.,ADAM17 and MMP9), down-regulated the expressionof the �-secretase BACE1 and displayed an increase inthe CTF-�/CTF-� ratio, all pointing to a shift in favorof the �-secretase cleavage of the A�PP protein. Con-sistent with previous studies (for a review, see [1]),increased levels of sA�PP�, the soluble N-terminalfragment generated by �-secretase cleavage, were alsoobserved in the culture medium of NGF-treated PC12cells; nevertheless this increase could not be attributedto changes in A�PP expression, since there was noincrease, but instead a decrease of A�PP695 proteinlevels.

The effects of NGF on A�PP expression and pro-cessing observed in the present study appeared tobe mediated by its high affinity receptor TrkA. InNGF-treated PC12 cells there was a rapid and sus-tained phosphorylation of Akt and ERK1/2, a cellularresponse to TrkA activation, but no activation of thep75NTR-mediated JNK signaling pathway. Moreover,PC12 cells lacking TrkA, but not p75NTR, expres-sion (NNR5 subclone) failed to increase sA�PP�release in response to NGF; the latter finding is consis-tent with previous studies showing reduced sA�PP�release upon inhibition of ERK1/2 activation [41,42]. In that context it is worth mentioning that in

the series of experiments described here, PC12 cellswere cultured in the presence of mature NGF, favoringTrkA-mediated signaling, as opposed to immature pro-NGF that has been shown to bind preferentially to thep75NTR and trigger cell death [43, 44]. Interestingly,Rossner and colleagues [25] have shown that A�PPmRNA levels are preferentially stimulated via NGFbinding to p75NTR, whereas selective activation of theTrkA receptor results in decreased A�PP mRNA lev-els, a finding consistent with the decreased A�PP695protein levels observed in the present study.

Most importantly, herein we provide evidence thatNGF modulates the expression of A�PP processingenzymes. In PC12 cells, 24-h treatment with NGFresulted to a modest down-regulation in the expressionof the �-secretase BACE1, evident both at the mRNAand protein level. Consistently, it has been shown thatNGF produces a slight decrease in �-cleavage of A�PPthrough binding to TrkA, whereas NGF binding top75NTR leads to the opposite effect; a switch fromTrkA to p75NTR signalling results in increased amy-loidogenic processing of A�PP [45, 46]. Furthermore,we show that upon the same treatment, PC12 cellsselectively upregulated the transcription of enzymeswith �-secretase activity and more specifically thatof ADAM17 and MMP9, but not the transcription of

716 A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA

ADAM10. To our knowledge, there is no previousreport concerning the effects of NGF on the expres-sion of �-secretases. Nevertheless, and consistent withour observations, previous studies have shown thattreatment with NGF results in an increase of MMP9gelatinolytic activity in PC12 cells [47], as well as ina TrkA-mediated increase of MMP9 expression andrelease in bronchial [48] and vascular [49] smoothmuscle cells.

Interestingly, a time-point analysis at the proteinlevel revealed a differential up-regulation of ADAM17and MMP9 in NGF-treated PC12 cells. More specif-ically, compared to controls, in PC12 cells exposedto NGF, ADAM17 protein levels appeared slightly,but not significantly, elevated after 2 h, this increasereached significance at 4 (data not shown) and 6 hpost-exposure, but it was not maintained at longertreatments (i.e., after 24 h). The latter observation, incombination with the increased ADAM17 mRNA lev-els observed upon a 24-h treatment with NGF, point to arather rapid turnover of this protein. On the other hand,MMP9 release in the culture medium of NGF-treatedPC12 cells first appeared significantly increased ata later time-point that is after 6 h; nevertheless thisincrease was maintained until the longest time-pointexamined. It should be noted that compared to con-trols, in the culture medium of PC12 cells exposed toNGF, sA�PP� levels were significantly elevated at alltime points examined; this increase was also evidentafter 2 h of exposure to NGF, a time-point where nosignificant changes in ADAM17 or MMP9 protein lev-els were observed. It is possible that slight changes ofADAM17 protein levels, which may be significant butfailed to reach significance due to the limitations of theimmunoblotting assay, may account for the increasedA�PP �-secretase cleavage observed after 2 h; alterna-tively other proteases not examined in the present studymight be involved in these TrkA-mediated NGF effectson A�PP processing. In any case, taken together, ourresults so far suggest that the TrkA-mediated non-amyloidogenic effects of NGF in PC12 cells arise fromthe modulation of the expression of A�PP processingenzymes, both the down-regulation of the �-secretaseBACE1 and the upregulation of �-secretases, such asADAM17 and MMP9.

The NGF-induced upregulation of ADAM17 andMMP9 expression, which was observed in the presentstudy, appeared to be dependent on PI3K/Akt-mediated signaling. Compared to PC12 cells treatedwith NGF alone, PC12 cells treated with NGF inthe presence of a PI3K inhibitor (either wortmanninor LY294002) failed to increase ADAM17 expres-

sion and MMP9 release in the culture medium 6 hafter exposure; reduced ADAM17 and MMP9 pro-tein levels were also evident among PC12 culturedwith NGF in the presence of wortmannin for 4 h (datanot shown). However it remains to be substantiatedwhether NGF acts directly or indirectly in order toupregulate the expression of ADAM17 and/or MMP9.In this context, it is worth noting that in human umbili-cal vein-derived endothelial cells NGF induces MMP2expression through PI3K/Akt signaling pathway andAP-2 transcription factor [50].

It should be noted that of all the A�PP processingenzymes studied in NGF-treated PC12 cells, MMP9appeared to undergo the greatest change of expres-sion which was sustained throughout the time courseexamined. Treatment of PC12 cells with NGF for 24 hresulted in over 10-fold increase of MMP9 mRNA lev-els and over 4-fold increase in the secretion of both thelatent and active forms of the enzyme, suggesting thatthis metalloproteinase plays a significant role in thenon-amyloidogenic effects of NGF. It is well estab-lished that MMP9 displays an A�-degrading activity;this metalloproteinase is able to degrade synthetic A�[51, 52] and A� fibrils in vitro, as well as compactamyloid plaques in situ [53], whereas mice lackingthe expression of MMP9 display elevated basal A�levels [52]. Consistently, compared to their untreatedcontrols, in NGF-treated PC12 cells A� levels inthe culture medium were markedly reduced (data notshown).

We have previously reported [13] that MMP9 isinvolved in receptor-mediated sA�PP� release, sug-gesting that in addition to its A� degrading activity, itcan also display an �-secretase activity. In the presentstudy, we provide evidence that in PC12 cells MMP9actively participates in NGF-induced sA�PP� release;inhibition of MMP9 function by either administrationof the gelatinase inhibitor SB-3CT or gene silencingresulted in reduced levels of sA�PP� release fromPC12 cells cultured in the presence of NGF for 6 or24 h, respectively. It should be noted that sA�PP�release from NGF-treated PC12 cells reached levelssimilar to those displayed by untreated controls, onlywhen incubated with a rather high concentration of SB-3CT, known to inhibit also ADAM17, suggesting thatMMP9 and ADAM17 are involved, albeit to a differ-ent extent, in the non amyloidogenic effects of NGF inPC12 cells.

Along the same lines it is noteworthy that a series ofprevious studies have shown that in PC12 cells MPP9activity [47] and sA�PP� release [25, 27, 28] are bothincreased upon NGF administration and are both criti-

A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA 717

cally involved in NGF-induced neurite outgrowth [29,30, 47]. Based on the data presented herein, it appearsthat the latter effect of MMP9 is mediated at leastin part through its �-secretase activity. Nevertheless,in view of the origin and neoplastic nature of PC12cells, it remains to be substantiated whether MMP9could have a similar function in the brain in vivo.However, it is intriguing that an analogous situationis emerging from studies in the brain; apart from therole of NGF [54, 55], accumulating evidence duringthe past few years suggests that sA�PP� and MMP9are critically involved in neuronal plasticity. It hasbeen shown recently that sA�PP� promotes neuriteoutgrowth and spine formation/maintenance in neu-ronal cultures in vitro and in vivo [56, 57] and thatendogenous secreted sA�PP� is critically involved inhippocampal synaptic plasticity and spatial memory[58]. Likewise, recent studies revealed that MMP9,which is expressed normally at low levels in the brainand is released in response to enhanced neuronalactivity (for a review, see [59]), participates in spineremodeling [60] and plays a significant role in synap-tic plasticity in the hippocampus [60–63] and cortex[64], as well as in hippocampus-dependent cognitiveprocesses [61, 63]. Whether MMP9 exerts its actionsin the brain at least in part through increasing sA�PP�remains unknown, however based on the data presentedherein this possibility merits further examination.

Taken together the data presented in the presentstudy suggest that in PC12 cells NGF shifts A�PPprocessing towards the �-secretase pathway throughbinding to TrkA receptor. This is the result of boththe inhibition of the �-secretase BACE1 and the PI3K-mediated induction of the well established �-secretaseADAM17 and to a greater extent of MMP9. Finally wedemonstrate that MMP9 actively participates in NGF-induced sA�PP� release, suggesting that this enzymehas a potential role as �-secretase under certain condi-tions.

DISCLOSURE STATEMENT

Authors’ disclosures available online (http://www.j-alz.com/disclosures/view.php?id=729).

REFERENCES

[1] Rossner S, Ueberham U, Schliebs R, Perez-Polo JR, Bigl V(1998) The regulation of amyloid precursor protein meta-bolism by cholinergic mechanisms and neurotrophin receptorsignaling. Prog Neurobiol 56, 541-569.

[2] Apelt J, Schliebs R, Beck M, Rossner S, Bigl V (1997) Expres-sion of amyloid precursor protein mRNA isoforms in rat brain

is differentially regulated during postnatal maturation and bycholinergic activity. Int J Dev Neurosci 15, 95-112.

[3] Schmechel DE, Goldgaber D, Burkhart DS, Gilbert JR,Gajdusek DC, Roses AD (1988) Cellular localization of mes-senger RNA encoding amyloid-beta-protein in normal tissueand in Alzheimer disease. Alzheimer Dis Assoc Disord 2,96-111.

[4] Panegyres PK (2001) The functions of the amyloid precursorprotein gene. Rev Neurosci 12, 1-39.

[5] Small DH, Nurcombe V, Reed G, Clarris H, Moir R,Beyreuther K, Masters CL (1994) A heparin-binding domainin the amyloid protein precursor of Alzheimer’s disease isinvolved in the regulation of neurite outgrowth. J Neurosci14, 2117-2127.

[6] Furukawa K, Sopher BL, Rydel RE, Begley JG, Pham DG,Martin GM, Fox M, Mattson MP (1996) Increased activity-regulating and neuroprotective efficacy of alpha-secretase-derived secreted amyloid precursor protein conferred by aC-terminal heparin-binding domain. J Neurochem 67, 1882-1896.

[7] Meziane H, Dodart JC, Mathis C, Little S, Clemens J, PaulSM, Ungerer A (1998) Memory-enhancing effects of secretedforms of the beta-amyloid precursor protein in normal andamnestic mice. Proc Natl Acad Sci U S A 95, 12683-12688.

[8] Lammich S, Kojro E, Postina R, Gilbert S, Pfeiffer R,Jasionowski M, Haass C, Fahrenholz F (1999) Constitutiveand regulated alpha-secretase cleavage of Alzheimer’s amy-loid precursor protein by a disintegrin metalloprotease. ProcNatl Acad Sci U S A 96, 3922-3927.

[9] Postina R, Schroeder A, Dewachter I, Bohl J, Schmitt U, KojroE, Prinzen C, Endres K, Hiemke C, Blessing M, Flamez P,Dequenne A, Godaux E, van Leuven F, Fahrenholz F (2004)A disintegrin-metalloproteinase prevents amyloid plaque for-mation and hippocampal defects in an Alzheimer diseasemouse model. J Clin Invest 113, 1456-1464.

[10] Buxbaum JD, Liu KN, Luo Y, Slack JL, Stocking KL,Peschon JJ, Johnson RS, Castner BJ, Cerretti, Black RA(1998) Evidence that tumor necrosis factor alpha convertingenzyme is involved in regulated alpha-secretase cleavage ofthe Alzheimer amyloid protein precursor. J Biol Chem 273,27765-27767.

[11] Kim ML, Zhang B, Mills IP, Milla ME, Brunden KR, LeeVM (2008) Effects of TNFalpha-converting enzyme inhibi-tion on amyloid beta production and APP processing in vitroand in vivo. J Neurosci 28, 12052-12061.

[12] Postina R (2008) A closer look at alpha-secretase. CurrAlzheimer Res 5, 179-186.

[13] Talamagas AA, Efthimiopoulos S, Tsilibary EC, Figueiredo-Pereira ME, Tzinia AK (2007) Abeta(1-40)-induced secretionof matrix metalloproteinase-9 results in sAPPalpha release byassociation with cell surface APP. Neurobiol Dis 28, 304-315.

[14] Estus S, Golde TE, Younkin SG (1992) Normal processing ofthe Alzheimer’s disease amyloid beta protein precursor gener-ates potentially amyloidogenic carboxyl-terminal derivatives.Ann N Y Acad Sci 674, 138-148.

[15] DeStrooper B, Annaert W (2000) Proteolytic processing andcell biological functions of the amyloid precursor protein.J Cell Sci 113, 1857-1870.

[16] Cai H, Wang Y, McCarthy D, Wen H, Borchelt DR, PriceDL, Wong PC (2001) BACE1 is the major beta-secretase forgeneration of Abeta peptides by neurons. Nat Neurosci 4,233-234.

[17] Schindowski K, Belarbi K, Buee L (2008) Neurotrophic fac-tors in Alzheimer’s disease: role of axonal transport. GenesBrain Behav 7, 43-56.

718 A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA

[18] Calissano P, Matrone C, Amadoro G (2010) Nerve growthfactor as a paradigm of neurotrophins related to Alzheimer’sdisease. Dev Neurobiol 70, 372-383.

[19] Yuen EC, Howe CL, Li Y, Holtzman DM, Mobley WC (1996)Nerve growth factor and the neurotrophic factor hypothesis.Brain Dev 18, 362-368.

[20] Matrone C, Di Luzio A, Meli G, D’Aguanno S, Severini C,Ciotti MT, Cattaneo A, Calissano P (2008) Activation of theamyloidogenic route by NGF deprivation induces apoptoticdeath in PC12 cells. J Alzheimers Dis 13, 81-96.

[21] Matrone C, Ciotti MT, Mercanti D, Marolda R, CalissanoP (2008) NGF and BDNF signaling control amyloidogenicroute and Abeta production in hippocampal neurons. ProcNatl Acad Sci U S A 105, 13139-13144.

[22] Capsoni S, Ugolini G, Comparini A, Ruberti F, Berardi N,Cattaneo A (2000) Alzheimer-like neurodegeneration in agedanti-nerve growth factor transgenic mice. Proc Natl Acad SciU S A 97, 6826-6831.

[23] Villa A, Latasa MJ, Pascual A (2001) Nerve growth factormodulates the expression and secretion of beta-amyloid pre-cursor protein through different mechanisms in PC12 cells.J Neurochem 77, 1077-1084.

[24] Mobley WC, Neve RL, Prusiner SB, McKinley MP (1988)Nerve growth factor increases mRNA levels for the prionprotein and the beta-amyloid protein precursor in developinghamster brain. Proc Natl Acad Sci U S A 85, 9811-9815.

[25] Rossner S, Ueberham U, Schliebs R, Perez-Polo JR, Bigl V(1998) p75 and TrkA receptor signaling independently regu-late amyloid precursor protein mRNA expression, isoformcomposition, and protein secretion in PC12 cells. J Neu-rochem 71, 757-766.

[26] Nishimura I, Takazaki R, Kuwako K, Enokido Y, YoshikawaK (2003) Upregulation and antiapoptotic role of endogenousAlzheimer amyloid precursor protein in dorsal root ganglionneurons. Exp Cell Res 286, 241-251.

[27] Ge YW, Lahiri DK (2002) Regulation of promoter activity ofthe APP gene by cytokines and growth factors: implicationsin Alzheimer’s disease. Ann N Y Acad Sci 973, 463-467.

[28] Rossner S, Ueberham U, Schliebs R, Perez-Polo JR, BiglV(1999) Regulated secretion of amyloid precursor protein byTrkA receptor stimulation in rat pheochromocytoma-12 cellsis mitogen activated protein kinase sensitive. Neurosci Lett271, 97-100.

[29] Milward EA, Papadopoulos R, Fuller SJ, Moir RD, SmallD, Beyreuther K, Masters CL (1992) The amyloid proteinprecursor of Alzheimer’s disease is a mediator of the effects ofnerve growth factor on neurite outgrowth. Neuron 9, 129-137.

[30] Luo JJ, Wallace MS, Hawver DB, Kusiak JW, WallaceWC (2001) Characterization of the neurotrophic interactionbetween nerve growth factor and secreted alpha-amyloid pre-cursor protein. J Neurosci Res 63, 410-420.

[31] Fisher JF, Mobashery S (2010) Mechanism-based profiling ofMMPs. Methods Mol Biol 622, 471-487.

[32] He ZJ, Huang ZT, Chen XT, Zou Z (2009) Effects of matrixmetalloproteinase 9 inhibition on the blood brain barrier andinflammation in rats following cardiopulmonary resuscita-tion. Chin Med J (Engl) 122, 2346-2351.

[33] Fotinopoulou A, Tsachaki M, Vlavaki M, Poulopoulos A,Rostagno A, Frangione B, Ghiso J, Efthimiopoulos S (2005)BRI2 Interacts with Amyloid Precursor Protein (APP) andRegulates Amyloid � (A�) Production. J Biol Chem 280,30768-30772.

[34] Hirata-Fukae C, Sidahmed EH, Gooskens TP, Aisen PS,Dewachter I, Devijver H, Van Leuven F, Matsuoka Y (2008)Beta-site amyloid precursor protein-cleaving enzyme-1

(BACE1)-mediated changes of endogenous amyloid beta inwild-type and transgenic mice in vivo. Neurosci Lett 435,186-189.

[35] Wang Y, Herrera AH, Li Y, Belani KK, Walcheck B (2009)Regulation of mature ADAM17 by redox agents for L-selectinshedding. J Immunol 182, 2449-2457.

[36] Kujime K, Hashimoto S, Gon Y, Shimizu K, Horie T (2000)p38 mitogen-activated protein kinase and c-jun-NH2-terminalkinase regulate RANTES production by influenza virus-infected human bronchial epithelial cells. J Immunol 164,3222-3228.

[37] Fos C, Salles A, Lang V, Carrette F, Audebert S, Pastor S,Ghiotto M, Olive D, Bismuth G, Nunes JA (2008) ICOS lig-ation recruits the p50alpha PI3K regulatory subunit to theimmunological synapse. J Immunol 181, 1969-1977.

[38] Bolshakov VY, Carboni L, Cobb MH, Siegelbaum SA,Belardetti F (2000) Dual MAP kinase pathways mediateopposing forms of long-term plasticity at CA3-CA1 synapses.Nat Neurosci 3, 1107-1112.

[39] Christopoulos TA, Papageorgakopoulou N, Theocharis DA,Aletras AJ, Tsiganos CP, Papadas TA, Mastronikolis NS,Goumas P, Vynios DH (2004) Diagnostic and classificationvalue of metalloproteinases in squamous human laryngealcarcinoma. Int J Oncol 25, 481-485.

[40] Salehi A, Delcroix JD, Belichenko PV, Zhan K, Wu C, VallettaJS, Takimoto-Kimura R, Kleschevnikov AM, Sambamurti K,Chung PP, Xia W, Villar A, Campbell WA, Kulnane LS, NixonRA, Lamb BT, Epstein CJ, Stokin GB, Goldstein LS, MobleyWC (2006) Increased App expression in a mouse model ofDown’s syndrome disrupts NGF transport and causes cholin-ergic neuron degeneration. Neuron 51, 29-42.

[41] Mills J, Laurent Charest D, Lam F, Beyreuther K, Ida N,Pelech SL, Reiner PB (1997) Regulation of amyloid precur-sor protein catabolism involves the mitogen-activated proteinkinase signal transduction pathway. J Neurosci 17, 9415-9422.

[42] Canet-Aviles RM, Anderton M, Hooper NM, Turner AJ,Vaughan PF (2002) Muscarine enhances soluble amyloid pre-cursor protein secretion in human neuroblastoma SH-SY5Yby a pathway dependent on protein kinase C(alpha), src-tyrosine kinase and extracellular signal-regulated kinase butnot phospholipase C. Brain Res Mol Brain Res 102, 62-72.

[43] Friedman WJ (2000) Neurotrophins induce death of hip-pocampal neurons via the p75 receptor. J Neurosci 20,6340-6346.

[44] Lee R, Kermani P, Teng KK, Hempstead BL (2001) Regu-lation of cell survival by secreted proneurotrophins. Science294, 1945-1948.

[45] Costantini C, Weindruch R, Della Valle G, Puglielli L (2005)A TrkA-to-p75NTR molecular switch activates amyloid beta-peptide generation during aging. J Biochem 391, 59-67.

[46] Capsoni S, Tiveron C, Vignone D, Amato G, Cattaneo A(2010) Dissecting the involvement of tropomyosin-relatedkinase A and p75 neurotrophin receptor signaling in NGFdeficit-induced neurodegeneration. Proc Natl Acad Sci U S A107, 12299-12304.

[47] Shubayev VI, Myers RR (2004) Matrix metalloproteinase-9 promotes nerve growth factor-induced neurite elongationbut not new sprout formation in vitro. J Neurosci Res 77,229-239.

[48] Dagnell C, Kemi C, Klominek J, Eriksson P, Skold CM,Eklund A, Grunewald J, Olgart Hoglund C (2007) Effects ofneurotrophins on human bronchial smooth muscle cell migra-tion and matrix metalloproteinase-9 secretion. Transl Res 150,303-310.

A. Fragkouli et al. / NGF Favors α-Secretase Cleavage of AβPP via TrkA 719

[49] Faisal Khan KM, Falcone DJ, Kraemer R (2002) Nervegrowth factor activation of Erk-1 and Erk-2 induces matrixmetalloproteinase-9 expression in vascular smooth musclecells. J Biol Chem 277, 2353-2359.

[50] Park MJ, Kwak HJ, Lee HC, Yoo DH, Park IC, Kim MS,Lee SH, Rhee CH, Hong SI (2007) Nerve growth factorinduces endothelial cell invasion and cord formation by pro-moting matrix metalloproteinase-2 expression through thephosphatidylinositol 3-kinase/Akt signaling pathway and AP-2 transcription factor. J Biol Chem 282, 30485-30496.

[51] Backstrom JR, Lim GP, Cullen MJ, Tokes ZA (1996) Matrixmetalloproteinase-9 (MMP-9) is synthesized in neurons of thehuman hippocampus and is capable of degrading the amyloid-beta peptide (1-40). J Neurosci 16, 7910-7919.

[52] Yin KJ, Cirrito JR, Yan P, Hu X, Xiao Q, Pan X, BatemanR, Song H, Hsu FF, Turk J, Xu J, Hsu CY, Mills JC,Holtzman DM, Lee JM (2006) Matrix metalloproteinasesexpressed by astrocytes mediate extracellular amyloid-betapeptide catabolism. J Neurosci 26, 10939-10948.

[53] Yan P, Hu X, Song H, Yin K, Bateman RJ, Cirrito JR, XiaoQ, Hsu FF, Turk JW, Xu J, Hsu CY, Holtzman DM, LeeJM (2006) Matrix metalloproteinase-9 degrades amyloid-betafibrils in vitro and compact plaques in situ. J Biol Chem 281,24566-24574.

[54] Conner JM, Franks KM, Titterness AK, Russell K, MerrillDA, Christie BR, Sejnowski TJ, Tuszynski MH (2009) NGFis essential for hippocampal plasticity and learning. J Neurosci29, 10883-10889.

[55] Houeland G, Romani A, Marchetti C, Amato G, Capsoni S,Cattaneo A, Marie H (2010) Transgenic mice with chronicNGF deprivation and Alzheimer’s disease-like pathology dis-play hippocampal region-specific impairments in short- andlong-term plasticities. J Neurosci 30, 13089-13094.

[56] Young-Pearse TL, Chen AC, Chang R, Marquez C, SelkoeDJ (2008) Secreted APP regulates the function of full-lengthAPP in neurite outgrowth through interaction with integrinbeta1. Neural Dev 3, 15.

[57] Lee KJ, Moussa CE, Lee Y, Sung Y, Howell BW, Turner RS,Pak DT, Hoe HS (2010) Beta amyloid-independent role ofamyloid precursor protein in generation and maintenance ofdendritic spines. Neuroscience 169, 344-356.

[58] Taylor CJ, Ireland DR, Ballagh I, Bourne K, Marechal NM,Turner PR, Bilkey DK, Tate WP, Abraham WC (2008)Endogenous secreted amyloid precursor protein-alpha reg-ulates hippocampal NMDA receptor function, long-termpotentiation and spatial memory. Neurobiol Dis 31, 250-260.

[59] Michaluk P, Kaczmarek L (2007) Matrix metalloproteinase-9in glutamate-dependent adult brain function and dysfunction.Cell Death Differ 14, 1255-1258.

[60] Wang XB, Bozdagi O, Nikitczuk JS, Zhai ZW, Zhou Q,Huntley GW (2008) Extracellular proteolysis by matrixmetalloproteinase-9 drives dendritic spine enlargement andlong-term potentiation coordinately. Proc Natl Acad Sci U S A105, 19520-19525.

[61] Nagy V, Bozdagi O, Matynia A, Balcerzyk M, Okulski P,Dzwonek J, Costa RM, Silva AJ, Kaczmarek L, Huntley GW(2006) Matrix metalloproteinase-9 is required for hippocam-pal late-phase long-term potentiation and memory. J Neurosci26, 1923-1934.

[62] Bozdagi O, Nagy V, Kwei KT, Huntley GW (2007) In vivoroles for matrix metalloproteinase-9 in mature hippocampalsynaptic physiology and plasticity. J Neurophysiol 98, 334-344.

[63] Nagy V, Bozdagi O, Huntley GW (2007) The extracellularprotease matrix metalloproteinase-9 is activated by inhibitoryavoidance learning and required for long-term memory. LearnMem 14, 655-664.

[64] Okulski P, Jay TM, Jaworski J, Duniec K, Dzwonek J,Konopacki FA, Wilczynski GM, Sanchez-Capelo A, MalletJ, Kaczmarek L (2007) TIMP-1 abolishes MMP-9-dependentlong-lasting long-term potentiation in the prefrontal cortex.J Biol Psychiatry 62, 359-362.