Localization and domain characterization of Arabidopsis ...

Journal of Experimental Botany Vol 58 No 1516 pp 4373ndash4386 2007

doi101093jxberm304

RESEARCH PAPER

Localization and domain characterization of Arabidopsisgolgin candidates

Maita Latijnhouwers1 Trudi Gillespie1dagger Petra Boevink1 Verena Kriechbaumer2Dagger Chris Hawes2sect and

Claudine M Carvalho2

1 Plant Pathology Programme Scottish Crop Research Institute Invergowrie Dundee DD2 5DA UK2 School of Life Sciences Oxford Brookes University Headington Oxford OX3 BP UK

Received 20 September 2007 Revised 30 October 2007 Accepted 31 October 2007

Abstract

Golgins are large coiled-coil proteins that play a role

in tethering of vesicles to Golgi membranes and in

maintaining the overall structure of the Golgi appara-

tus Six Arabidopsis proteins with the structural char-

acteristics of golgins were isolated and shown to

locate to Golgi stacks when fused to GFP Two of

these golgin candidates (GC1 and GC2) possess

C-terminal transmembrane (TM) domains with similar-

ity to the TM domain of human golgin-84 The C-termini

of two others (GC3GDAP1 and GC4) contain con-

served GRAB and GA1 domains that are also found in

yeast Rud3p and human GMAP210 GC5 shares simi-

larity with yeast Sgm1p and human TMF and GC6 with

yeast Uso1p and human p115 When fused to GFP the

C-terminal domains of AtCASP and GC1 to GC6

localized to the Golgi showing that they contain Golgi

localization motifs The N-termini on the other hand

label the cytosol or nucleus Immuno-gold labelling

and co-expression with the cis Golgi Q-SNARE

Memb11 resulted in a more detailed picture of the sub-

Golgi location of some of these putative golgins Using

two independent assays it is further demonstrated that

the interaction between GC5 the TMF homologue and

the Rab6 homologues is conserved in plants

Key words Arabidopsis AtGRIP AtCASP GDAP1 Golgi

golgin Rab

Introduction

The Golgi apparatus in eukaryotic cells processes andsorts proteins carbohydrates and lipids It consists ofstacks of membrane-bounded cisternae that receive cargofrom the endoplasmic reticulum (ER) In general thematerial enters the stack on the cis side and movesthrough the stack to the trans side The mode of transportwithin the stack is still a matter of debate and variousmodels have been put forward to describe it (reviewed inMironov et al 2005) Processed cargo eventually entersthe trans-Golgi andor the trans-Golgi network (TGN) anetwork of tubules on the trans-side of the Golgi appa-ratus where it is packaged into vesicles and delivered tothe correct destination

The Golgi apparatus in plants and animals have much incommon although a number of striking differences can bedistinguished whereas in mammals the Golgi stacks aregenerally arranged side-by-side in a perinuclear ribbonthe plant Golgi apparatus consists of numerous individualmotile stacks dispersed throughout the cytoplasm In manycell types the plant Golgi stacks move in close proximityto the ER network and their motility is dependent on actin(Boevink et al 1998 Brandizzi et al 2002 Saint-Joreet al 2002)

The factors that determine the Golgi structure and thecohesiveness of the cisternae in plants are largely un-known The structural organization of the mammalianGolgi apparatus on the other hand has received consider-able attention in recent years The so-called golgins haveemerged as a family of proteins with a distinct role inmaintaining Golgi structure They form part of a Golgi

Present address Department of Mathematics and Natural Sciences University of Stavanger Stavanger 4036 Norwayy Present address IMPACT Confocal Microscope Facility School of Biomedical Sciences University of Edinburgh George Square Edinburgh EH8 9XD UKz Present address Faculty of Health and Wellbeing Sheffield Hallam University Howard Street Sheffield S1 1WB UK Present address Federal University of Vicxosa BIOAGRO Vicxosa ndash MG 36571 000 Brazilsect To whom correspondence should be addressed chawesbrookesacuk

ordf The Author [2008] Published by Oxford University Press [on behalf of the Society for Experimental Biology] All rights reservedFor Permissions please e-mail journalspermissionsoxfordjournalsorg

Dow

nloaded from httpsacadem

icoupcomjxbarticle5815-164373455267 by guest on 09 Septem

ber 2022

matrix that remains after detergent extraction a structurereferred to as the Golgi lsquoskeletonrsquo (Seemann et al 2000)Golgins are large proteins with extensive coiled-coildomains predicted to adopt long rod-like conformations(reviewed in Gillingham and Munro 2003 Short et al2005) Depletion of the golgins GM130 p115 or golgin-84 by RNAi resulted in Golgi fragmentation into ministacks in mammalian cells (Diao et al 2003 Sohda et al2005 Puthenveedu et al 2006) showing that golginsare important for maintaining Golgi structure How theseproteins control Golgi organization remains largely un-determined and much about the functions of these proteinsremains unknown However it is clear that they play arole in vesicle tethering In vitro vesicle docking assayshave revealed the need for p115 GM130 and Giantin for coatprotein complex I (COPI) vesicle binding to Golgi mem-branes (Sonnichsen et al 1998) Furthermore golgin-84and CASP were reported to be involved in tetheringto Golgi cisternae of a subpopulation of COPI vesiclespresumed to be involved in retrograde transport to the ER(Malsam et al 2005)

A small group of golgins are integral membraneproteins inserted into the membrane by means of aC-terminal transmembrane (TM) domain The majority ofgolgins however are peripheral membrane proteins some-times recruited to the correct membrane through interac-tion with members of the Rab ADP-ribosylation factor(ARF) or ARF-like (ARL) families of small GTPasesA C-terminal domain called GRIP which is present infour human and one yeast golgin interacts with GTP-bound ARL1 and is necessary for Golgi localization ofthese golgins (Panic et al 2003 Setty et al 2003) MostGRIP domain golgins locate to the trans-Golgi or theTGN A second Golgi-targeting domain distantly relatedto the GRIP domain is present in the yeast golgin Rud3pIt binds ARF1 and is named GRIP-related ARF-binding(GRAB) domain The GRAB domain is also found in themammalian golgin GMAP210 (Gillingham et al 2004)The most C-terminal coiled-coil domain of the humangolgin TMF (TATA element modulatory factor) wasshown to bind the three known human isoforms of Rab6but not Rab1 (Fridmann-Sirkis et al 2004) The yeasthomologue of TMF Sgm1p also binds to the Rab6homologue YPT6 (Siniossoglou and Pelham 2001) Twomammalian golgins GM130 and Golgin-45 need proteinscalled Golgi reassembly stacking proteins (GRASPs) forassociation with membranes which themselves are in-dispensable for Golgi structure (Shorter et al 1999Wang et al 2003)

The first plant golgin AtGRIP was identified basedon the presence of a C-terminal GRIP domain (Gilsonet al 2004) An AtGRIPndashGFP fusion protein locates toGolgi stacks in tobacco epidermal cells and the GRIPdomain interacts with an Arabidopsis ARL1 homologue(Latijnhouwers et al 2005a Stefano et al 2006)

Furthermore an Arabidopsis protein with homology tothe mammalian golgin CASP was identified and namedAtCASP It was shown to target GFP to Golgi stacks inboth tobacco and monkey cells (Renna et al 2005)Recently a protein with a domain showing similarityto the GRAB domain was isolated and named GDAP1(Matheson et al 2007) GDAP1 was shown to locate toGolgi stacks and additional ARF1-labelled structures andto interact with Arabidopsis ARF1 AtGRIP AtCASPand GDAP1 are putative plant golgins based on theirdomain structures and their Golgi localization A numberof additional Arabidopsis proteins have previously beenreferred to as potential golgins based on sequence simi-larity with mammalian or yeast golgins (Gillingham et al2002 2004 Fridmann-Sirkis et al 2004 Latijnhouwerset al 2005b) Moreover Rose et al (2004) observedthat the domain organizations of three Arabidopsis coiled-coil proteins (including AtCASP) were comparable tothose of the mammalian golgins CASP and golgin-84

In this report the localization and domain characteriza-tion of six putative Arabidopsis golgins are describedThe GFP fusions of all of these proteins co-localize withfluorescent Golgi markers and five are detected as fluores-cent rings around the Golgi stacks Two of these proteinspossess C-terminal TM domains and share similarity withthe mammalian protein golgin-84 whereas two others (oneof which is GDAP1) are characterized by C-terminal GRABdomains The remaining two proteins share regions ofsignificant similarity with the mammalian golgins TMF andp115 respectively It is demonstrated for all six of theseputative golgins that the Golgi targeting domains areC-terminal Using immuno-gold labelling a first indicationfor the spatial distribution in the Golgi stack of three of theArabidopsis golgins has been obtained Finally yeast two-hybrid experiments and an in vitro binding assay show thattwo Arabidopsis Rab6 homologues interact with theC-terminus of GC5 the Arabidopsis TMF homologue

Materials and methods

Construction of expression plasmids

Standard molecular techniques were used as described in Ausubelet al (1999) Primers were obtained from MWG Biotech (Ebers-berg Germany) or from Invitrogen (Paisley UK) Restrictionenzymes were from New England Biolabs (Herts UK) ExpandHiFi polymerase (Roche Basel Switzerland) or Phusion highfidelity DNA polymerase (New English Biolabs) were used forPCR All PCR products were sequenced using the Big DyeTerminator v31 cycle sequencing kit (Applied Biosystems FosterCity USA) Full length sequences for GC6 GC1 GC5 GC2 GC4and GC3 were submitted to GenBank (accession numbersEU249327 to EU249332) The BLAST algorithm (httpwwwncbinlmnihgovblast) or (httpwwwArabidopsisorgBlast) was usedfor similarity searches CLUSTALW (httpnpsa-pbilibcpfrcgi-binnpsa_automatplpagefrac14npsa_clustalwhtml Pole BioInformatiqueLyonnais) was used to align Arabidopsis proteins with proteins fromother organisms and to obtain similarity or identity values

4374 Latijnhouwers et al

Dow



ber 2022

Total RNA from an Arabidopsis Col-0 cell suspension culture orfrom Arabidopsis Col-0 leaves or flower buds was used in a firststrand cDNA synthesis reaction (Superscript III Invitrogen PaisleyUK) using an oligo dT20 primer The cDNAs of AtGRIP AtCASPand GC1 to GC6 were amplified from this cDNA pool usingforward and reverse primers corresponding to the 5 end and the 3ends of the open reading frames respectively The sequencepreceding the start codon in the forward primers was AGGCGCGC-CAAAA where the AscI site is underlined The reverse primerextension following the stop codon was AAAAAAGCGGC-CGCGCC with the NotI sequence underlined Using the AscIand NotI sites the cDNAs were cloned into pENTR-1a-MCS(Latijnhouwers et al 2005a) From pENTR-1a-MCS the cDNAswere transferred to the binary vectors pMDC83 and pMDC43(Curtis and Grossniklaus 2003) using the Gateway cloning systemfollowing instructions provided by the manufacturer (InvitrogenPaisley UK) In pMDC83 Gateway recombination sites precedethe mGFP5 gene (Haseloff et al 1997) whereas in pMDC43 theyare situated at the 3 of the mGFP5 gene YFP-Memb11 has beendescribed previously by Chatre et al (2005) To construct GFP-cGC1 GFP-cGC2 GFP-GRAB3 GFP-GRAB4 GFP-cGC5 andGFP-cGC6 C-terminal fragments were amplified from the re-spective cDNAs using the forward primers TCACGCCAGGAG-CATACAG (cGC1) ACTGAAGTGGAAATTGAAC (cGC2)ATGACAAGGCTCAATAGAAT (GRAB3) ATGACAAGGCT-CAATAGAAT (GRAB4) CAAGCTTCTCTTGATTCTTCAG(cGC5) and TATAGTCGGCCAAAAAGTG (cGC6) respectivelyThe primer sequences were again preceded by AGGCGCGC-CAAAA and were used in combination with the reverse primerspreviously used to amplify the full-length cDNAs The C-terminalfragments were cloned into pENTR-1a-MCS using the Asc1 andNot1 sites and transferred to pMDC43 using the Gateway system

To create nGC6EYFPcGC6 a fragment encoding amino acids1ndash389 of GC6 was amplified using the XbaI site-containing forwardprimer CTCTAGAACTAGTATGGATTTGGCATCC and TGG-ATCCTGATCTCGGGATGTGGGA with a BamHI site as thereverse primer The second fragment corresponding to the aminoacids 390ndash925 was amplified using CGGATCCTCTAGAAGAT-GATGTTCA containing a BamHI site and the reverse primerTGAGCTCTCAGTCTTCTTCAGA containing a SacI site Thestop codon of EYFP (Clontech Moutain View USA) was removedand the EYFP sequence was inserted into GC6 using newly createdBamH1 sites The resulting fragment was cloned into the binaryvector pVKH18-En6 (Batoko et al 2000) using the XbaI andSacI sites

RabH1b RabH1c RabD1 and RabD2A (Rutherford and Moore2002) were amplified with forward primers containing BamH1 sitesand reverse primers containing HindIII sites The PCR fragments ofRabH1b RabH1c RabD1 and RabD2A were inserted into theBamH1 and HindIII sites of pRP265 (Smith and Johnson 1988) tocreate fusion proteins with GST cGC5 and GRAB3 were insertedinto the BamH1 and HindIII sites of pQE-30 (Qiagen HildenGermany) to fuse it with the six-histidine tag For the yeast two-hybrid assay cDNAs were amplified using primers containingSma1 sites The PCR fragments were digested with SmaI andinserted into pGBKT7 (BD Biosciences Clontech Moutain ViewUSA) for fusions to the GAL4 binding domain (GBD) and intopGADT7-Rec for fusions to the GAL4 activation domain (GAD)

Transient expression in plants

Wild-type Nicotiana tabacum plants and N tabacum line CB137plants were grown in a greenhouse at 22 C (day temperature) and18 C (night temperature) with a minimum of 16 h light Eachconstruct was transformed into Agrobacterium tumefaciens GV3101or AGL1 by electroporation or heat shock Agrobacterium expres-

sion was performed as described previously (Latijnhouwers et al2005a) In brief overnight Agrobacterium cultures were centrifuged(6 min 2600 g) and the pellets resuspended in 5 ml (10 mM MgCl210 mM MES pH 56 150 lM acetosyringone) The bacterialsuspension was diluted with the same buffer to adjust the inoculumconcentration to the final OD600 value (see figure legends)Infiltrations were performed as described in Batoko et al (2000)For experiments requiring co-infection of more than one constructbacterial strains containing the constructs were mixed prior to theleaf infiltration with the inoculum of each mixed construct adjustedto the required final OD600

Confocal imaging

Imaging was conducted on a Leica TCS-SP2 AOBS using an HCXAPO 633090w water dipping lens GFP was imaged using 488nm excitation and its emission was collected from 500ndash520 nmor from 500ndash510 nm if imaged in combination with YFP FormRFP excitation at 561 nm was used and emission collected at600ndash620 nm The excitation wavelength for YFP was 514 nm andits emission was recorded at 535ndash545 nm GFP and mRFP wereimaged simultaneously whereas GFP and YFP or YFP and mRFPwere imaged sequentially using a line by line mode The optimalpinhole diameter was maintained at all times Post-acquisitionimage processing was done using Photoshop 80 software (AdobeSystems Incorporated USA)

High-pressure freezing and immuno-gold labelling

2 mm diameter discs from expressing leaves were taken using adisposable biopsy punch (Stiefel Laboratories Ltd Wooburn GreenUK) and placed in an aluminium sample holder Prior to cappingthe sample holder the sample was covered with MES buffer Pairsof holders were clamped together and samples were immediatelyfrozen using a BAL-TEC HPM 010 high-pressure freezer

Freeze-substitution was carried out in a Reichert AFS (LeicaVienna Austria) freeze-substitution system Sample holders weresplit open under liquid nitrogen and placed into plastic porousspecimen pots containing the substitution medium (05 uranylacetate in 100 ethanol) previously frozen in liquid nitrogenPlastic specimen pots were put into a universal aluminium containeronto the surface of the frozen substitution medium and transferredinto the Reichert AFS precooled to ndash160 C Sample temperaturewas increased to ndash85 C over 5 h Freeze-substitution was carriedout by slowly warming the samples at 1 C per hour to ndash20 CSamples were rinsed in cold ethanol and after careful removalfrom the sample holders embedded stepwise in LR White mediumresin (Agar Scientific Stansted Essex England) over one weekPolymerization was under UV light for 24 h at ndash20 C and foranother 24 h at 0 C

Ultrathin sections were cut with a RMC Powertome XL ultra-microtome (RMC Tucson Arizona USA) and collected onformvar-coated 300 mesh hexagon copper grids (Agar ScientificStansted Essex England)

For immunolabelling sections were incubated by floating thegrids on droplets of phosphate buffered saline (PBS) pH 7containing 50 mM glycine for 15 min to inactivate residual freealdehyde groups They were then incubated with blocking solutionfor goat gold conjugates (PBS pH 74 5 BSA 01 CWFSgelatine 5 normal serum 10 mM sodium azide) (AurionWageningen Netherlands) for 1 h and equilibrated by washing onIGL buffer (PBS pH 74 01 BSA-c 01 Tween-20) threetimes for 5 min They were then transferred to anti-GFP antiserum(ab290 AbCam Cambridge UK) diluted 12000 in IGL buffer for1 h at room temperature The diluted antiserum had been pre-absorbed overnight with approximately 1 mg Nicotiana tabacum

Characterization of Arabidopsis golgins 4375

Dow



ber 2022

protein extract (frozen ground leaf tissue washed in acetone) atroom temperature The grids were washed six times for 5 min withIGL buffer and incubated on secondary antibody (goat anti-rabbitIgG antibody conjugated with 15 nm gold Amersham BiosciencesBuckinghamshire UK) diluted 150 in IGL buffer for 2 h withgentle agitation The grids were extensively washed in IGL buffer(3 times 5 min) PBS (3 times 5 min) 01 M phosphate buffer(2 times 5 min) and ddH2O (5 times 2 min) and dried Sectionswere stained with uranyl acetate followed by lead citrate andexamined under a Phillips CM10 transmission electron microscopeThe specificity and reliability of the immuno-gold labelling weretested by two negative controls either the primary antiserum wasomitted to test for unspecific labelling of the goat anti-rabbit IgGantibodyndashgold conjugate or sections from untransformed controlleaves (ie lacking GFP) were used to test the specificity of theprimary antiserum

Yeast 2-hybrid analysis and affinity chromatography

Yeast strain AH109 was sequentially transformed with a pGBKT7bait vector and a pGADT7-Rec prey vector using a lithium acetatemethod (Gietz et al 1995) Colonies were selected on syntheticplates lacking histidine tryptophan leucine and adenine for up to 7 dPositive yeast transformants were replated on plates containingX-a-gal (Clontech) to test the expression of the reporter geneMEL1

For in vitro binding studies GST fusion proteins were producedin E coli JM109 cells bound to glutathione sepharose beads(Sigma Aldrich Gillingham UK) purified and loaded with GDP orGTPcS (Sigma Aldrich) as previously described (Gillingham et al2004) Affinity chromatography was carried out as described byLatijnhouwers et al (2005a) A lysate was prepared of E coliJM109 expressing a His6-tagged protein The lysate was incubatedwith sepharose-bound GST fusion proteins in the presence of GDPor GTPcS for 2 h at 4 C The interacting proteins were eluted inelution buffer [(20 mM Tris pH 80 15 M NaCl 2 mM EDTA5 mM b-mercaptoethanol and 1 mM of the opposite nucleotide(GTPcS or GDP)]

The eluates were analysed on SDS-PAGE and blotted ontonitrocellulose (Schleicher and Schuell Dassel Germany) Westernblots were probed with an anti-His6 or anti-GST antibodiesconjugated with HRP (Sigma Aldrich) in (PBS 01 Tween 205 milk powder) and developed using the ECL detection system(Amersham biosciences Buckinghamshire UK)

Results

Six putative Arabidopsis golgins

cDNAs of six large coiled-coil proteins from Arabidopsiswere amplified from Arabidopsis cell culture or leafcDNA and fused to the 3rsquo end of the mGFP5 gene(Haseloff et al 1997) in binary vectors The proteins hadpreviously been noted to share sequence similarity withgolgins from mammals and yeast (Gillingham et al 20022004 Fridmann-Sirkis et al 2004 Latijnhouwers et al2005b) although the regions of significant similarity weremainly confined to specific domains (Table 1) To saveconfusion the proteins were arbitrarily named GC1 toGC6 (for Golgin Candidate 1 to 6) One of them GC3has recently been named GDAP1 by Matheson et al(2007) The six GFP fusion proteins were expressed in

tobacco CB137 epidermal cells using infiltration of asuspension of Agrobacterium tumefaciens carrying theappropriate construct (agroinfiltration) The tobacco lineCB137 stably expresses the signal anchor sequence of arat sialyl transferase fused to mRFP (ST-mRFP) as a Golgimarker (Fig 1I Latijnhouwers et al 2005a) GFP-fusionsof the previously characterized putative Arabidopsis gol-gins AtGRIP and AtCASP were included for comparison(Renna et al 2005 Latijnhouwers et al 2005a)

The AtGRIP and AtCASP fusions both co-located withST-mRFP as was reported previously (Fig 1A B) GC3GDAP1 had previously been shown to co-locate withanother Golgi marker ERD2 (Boevink et al 1998Matheson et al 2007) and thus its co-localization withST-mRFP confirms the Golgi localization of this protein(Fig 1E) GC1 2 4 5 and 6 also labelled the sameorganelles as ST-mRFP suggesting that they too are Golgiproteins At high magnification GFP-AtCASP GFP-GC1and GFP-GC2 were observed as green fluorescent ringsaround the ST-mRFP-fluorescent bodies (Fig 1BndashD)When these fusion proteins were expressed at high levelsGolgi stacks were sometimes observed to aggregate intolarge clusters (results not shown) GFP-GC3GDAP1 andGFP-GC4 displayed similar rings around the Golgi stacksbut were also detected on structures that did not co-locatewith ST-mRFP (Fig 1E F arrows) In the case of GC3GDAP1 these non-Golgi structures have been studied inmore detail (Matheson et al 2007) They were shown tobe identical to ARF1-GFP-labelled structures that can budfrom the Golgi and that can also be stained by the stryryldye FM4-64 suggesting that it concerns a post-Golgicompartment (Stefano et al 2006 Xu and Scheres 2005Matheson et al 2007) GFP-GC5 similarly appeared asrings around Golgi stacks but a relatively high level ofGFP fluorescence was also detected in the cytoplasm(Fig 1G) GFP-GC6 concentrated on one side of the ST-mRFP-labelled Golgi body (Fig 1H) In the case of GFP-GC6 only a minority of cells showed Golgi labellingpresumably reflecting the sensitivity of location to

Table 1 Putative Arabidopsis golgins described in the text

Name ORFnumbera

Length(aa)

Sequencesimilarity(putativehumanhomologue)

Region of highestsequence similaritywith putativehuman or yeasthomologue

GC1 At2g19950 715 golgin-84 TMb

GC2 At1g18190 668 golgin-84 TMGC3 GDAP1 At3g61570 712 GMAP210 GRAB GA1GC4 At2g46180 725 GMAP210 GRAB GA1GC5 At1g79830 956 TMF C-terminal predicted

coiled-coil domainGC6 At3g27530 915 p115 N-terminal (globular)

domain

a The Arabidopsis Information Resource at httpwwwArabidopsisorgb TM frac14 transmembrane domain


Dow



ber 2022

expression levels Most cells accumulated the GFP-fusionprotein in large structures that appeared to be membrane-bounded frequently rounded and sometimes elongated inshape (see Supplementary data Fig S1 at JXB online) Itwas not possible to assess the nature of these structures andit is speculated that they are either involved in degradationof a surplus of the GFP-GC6 fusion protein or are formedfrom aggregated Golgi GFP-GC1 to GFP-GC5 were alsoexpressed in wild-type tobacco leaves in the presence of

ST-YFP (transient expression) and the co-labelling patternswere the same as the ones described for ST-mRFP (resultsnot shown)

AtGRIP located to Golgi stacks regardless of whether itwas fused to the N-terminus or the C-terminus of GFP(Latijnhouwers et al 2005a) By contrast when AtCASPand GC1 to GC5 were fused to the N-terminus of GFPtheir labelling patterns were reminiscent of cytoplasmiclabelling In the case of GC3-GFP and GC4-GFP large

Fig 1 GC1 to GC5 are Golgi-localized large coiled-coil proteins Confocal images of GFP-AtGRIP GFP-AtCASP and GFP-GC1 to GFP-GC6(shown in green) expressed in tobacco CB137 leaf epidermal cells expressing ST-mRFP (shown in magenta) Agrobacterium suspensions wereinfiltrated at OD600frac1401 Left images show the signal from the green channel Right images show mixed green and magenta channels (A) GFP-AtGRIP (B) GFP-AtCASP (C) GFP-GC1 (D) GFP-GC2 (E) GFP-GC3GDAP1 (F) GFP-GC4 (G) GFP-GC5 (H) GFP-GC6 (I) ST-mRFP onlyArrowheads indicate non-Golgi structures in (E) and (F) Scale barfrac141 lm


Dow



ber 2022

aggregates were also observed (results not shown) GFP-GC6 and GC6-GFP showed the same combination ofGolgi labelling in some cells and the previously describedlarge structures in others In addition EYFP (a GFPderivative with high quantum yield) was inserted betweenamino acid no 389 and 390 of GC6 (nGC6EYFPcGC6)The nGC6EYFPcGC6 fusion protein again resulted inthe same labelling patterns as GFP-GC6 (Golgi stacks andlarge unidentified structures) Co-expression of this con-struct with ST-mRFP also showed a similar distribution ofYFP fluorescence on one side of the ST-labelled Golgistacks (see Supplementary data Fig S2 at JXB online)

GC1 to GC6 share sequence similarity withmammalian and yeast golgins

Figure 2 is a schematic representation of the domainstructures of AtGRIP AtCASP and GC1 to GC6Arabidopsis large coiled-coil domain proteins have beenannotated in the Arabicoil database (wwwcoiled-coilorgArabidopsis Rose et al 2004) The positions and sizesof the predicted coiled-coil domains in the golgins werederived from this database and drawn to scale Thesequences of our GC1 and GC5 cDNA clones showedthat the splicing patterns giving rise to the correspondingmature mRNAs differed from those reported in TheArabidopsis Information Resource (TAIR) database

(wwwArabidopsisorg) In the case of GC1 four splicingevents differed between our sequence and the sequencein the database and in GC5 only one was different Theprogramme Paircoil (httppaircoil2csailmitedu) was usedto predict positions and sizes of the coiled-coil domains inGC1 and GC5

AtGRIP possesses a C-terminal GRIP domain sharingup to 50 identity with GRIP domains from four humangolgins (Gilson et al 2004) AtCASP shows 32 overallamino acid identity to human CASP and has a singleC-terminal TM domain (Renna et al 2005) Two TMprediction programmes DAS-domain prediction (Cserzoet al 1997) and TMPRED (Hofmann and Stoffel 1992)predicted that GC1 and GC2 similarly possess singleC-terminal TM domains These TM domain are 50 and46 identical respectively to the TM domain of humangolgin-84 and GC1 and GC2 have the same predictedmembrane topology as golgin-84 (Fig 3A) The align-ments of the full-length proteins are presented in Supple-mentary Fig S3 at JXB online GC1 and GC2 share 17overall identity and 56 similarity Short regions in theC-termini of GC3GDAP1 and GC4 are 32 and 30identical respectively to the C-terminal GRAB domainof the human golgin GMAP210 (Fig 3B) Downstreamof the GRAB domain in both GC3 and GC4 a secondmotif was detected called the GRAB-associated 1 (GA1)

Fig 2 Domain distribution in eight putative Arabidopsis golgins Diagram showing eight putative Arabidopsis golgins with predicted coiled-coilregions and additional domains Numbers indicate first and last amino acids of the full-length proteins and the first residue of the C-terminalfragments cGC1 cGC2 GRAB3 GRAB4 cGC5 and cGC6 respectively Additional domains are as indicated in the figureˇ indicates the site inGC6 where EYFP was inserted


Dow



ber 2022

motif This motif is also conserved in the GRAB domainproteins from other organisms (Gillingham et al 2004)GC3 and GC4 are 70 identical at the protein level Themost C-terminal predicted coiled-coil domain of GC5shows sequence similarity to the C-terminus of humanTMF (32 amino acid identity in the C-terminal 109amino acids) This region is also conserved in the yeastgolgin Sgm1p and single proteins from Neurospora crassaand Drosophila melanogaster (Fridmann-Sirkis et al2004 Fig 3C) Finally the N-terminus of GC6 shows40 amino acid identity with human p115 (Fig 3D) TheN-terminus of p115 is predicted to be a globular domain toan otherwise rod-like structure (Sapperstein et al 1995)As is the case in both human p115 and yeast Uso1p thisdomain is followed by two regions of coiled-coil in GC6A region similar to the short C-terminal acidic domainfound in p115 and Uso1p can also be distinguished in GC6but it contains fewer acidic amino acids and is thereforeless distinct (Sapperstein et al 1995)

The C-terminal domains of GC1 to GC6 targetGFP to the Golgi

According to Misumi et al (2001) the predominant Golgi-localization signal in human golgin-84 resides in the

C-terminal domain encompassing the TM domain andapproximately 100 amino acids preceding the TM do-main C-terminal domains of GC1 (amino acids 558ndash715)and GC2 (amino acids 508ndash668) comprising the TMdomains and 100ndash115 amino acids upstream were fusedto the C-terminus of GFP The resulting fusion proteinsGFP-cGC1 and GFP-cGC2 both co-located with ST-mRFP in CB137 epidermal cells and labelled ring-shapedstructures around Golgi bodies Their labelling patternswere indistinguishable from the corresponding GFP-labelledfull-length proteins (Fig 4A B) although at high expres-sion levels GFP-cGC2 accumulated on small structures ofunidentified nature (Fig 4C) The GC1 and GC2 N-termini(amino acids 1ndash558 for GC1 and 1ndash508 for GC2) fusedto the C-terminus of GFP resulted in cytoplasmic labellingas well as labelling of the nucleus in the case of the GC2N-terminus (see Supplementary data Fig S4 at JXB online)

The GRAB domain-containing C-termini of yeast Rud3pand human GMAP210 provide the Golgi-localizationsignal for these proteins (Gillingham et al 2004) To testif the localization signals in GC3GDAP1 and GC4 alsoreside in the C-terminus fusion proteins with GFP wereprepared of the C-terminal 161 and 169 amino acids ofGC3GDAP1 and GC4 respectively The resulting fusionproteins were named GFP-GRAB3 and GFP-GRAB4 and

Fig 3 Alignments of conserved domains from GC1 to GC6 with those of golgins from Homo sapiens Drosophila melanogaster Caenorabditiselegans Neurospora crassa and Saccharomyces cerevisiae (A) Alignment of predicted TM domains from GC1 and GC2 with TM domains fromgolgin-84 (NCBI accession AAD09753) and homologues from D melanogaster (Q8SZ63) and C elegans (P90970) (B) Alignment of predictedGRAB and GA1 domains from GC3GDAP1 and GC4 with corresponding domains from S cerevisiae Rud3p (NP_014859) H sapiens GMAP210(CAA73095) and a homologue from D melanogaster (FlyBase symbol CG33206-PB) (C) Alignment of C-terminal predicted coiled-coil domainfrom GC5 with corresponding domains from H sapiens TMF (P82094) S cerevisiae Sgm1p (NP_012668) and homologues from N crassa(CAB97305) and D melanogaster (FlyBase (httpflybasebioindianaedu) symbol CG4557-PA) (D) Alignment of N-terminus of GC6 withN-termini from H sapiens p115 (NP_003706) homologues from D melanogaster (NP_572417) C elegans (NP_502593) and S cerevisiae Uso1p(NP_010225)


Dow



ber 2022

encompass the conserved GRAB and GA1 domains Thefusion proteins were expressed in tobacco CB137 epidermalcells and both labelled ring-like structures that co-locatedwith ST-mRFP (Fig 4D E) Additional fluorescentstructures were detected that did not co-locate with ST-mRFP similar to those observed with full-lengthGFP-GC3GDAP1 and GFP-GC4 The N-terminal domainof GC3GDAP (amino acids 1ndash551) showed cytoplasmiclabelling whereas in the case of GC4 (amino acids 1ndash556)the fluorescence was predominantly found in the nucleus(see Supplementary data Fig S4 at JXB online) TheC-terminal 139 amino acids of GC5 (cGC5) containingthe region of similarity with human TMF and yeast Sgm1ptargeted GFP to Golgi stacks and to the cytoplasm againshowing very similar fluorescence to the correspondingfull-length protein GFP-GC5 (Fig 4F) Fluorescence was

observed in the cytoplasm and around the nucleus with theN-terminus of GC6 (amino acids 1ndash817) fused to GFP (seeSupplementary data Fig S4 at JXB online) The C-terminal225 amino acids of GC6 encompass the region that corre-sponds to the region in human p115 which binds Rab1 andis responsible for Golgi targeting This part of GC6 wasfused to the C-terminus of GFP and the fusion proteinshowed the same distribution as full-length GFP-GC6 (Fig4G) some cells with clear Golgi labelling and others withlarge irregularly-shaped GFP-fluorescent structures

Sub-Golgi localization of Arabidopsis golgins relativeto YFP-Memb11

To characterize further which regions of the Golgi stackswere labelled with the GFP-tagged golgin candidates the

Fig 4 The Golgi-targeting signals of GC1 to GC6 are located in the C-termini Confocal images of the C-termini of GC1 to GC6 fused to GFP(shown in green) expressed in tobacco CB137 epidermal cells expressing ST-mRFP (shown in magenta) Agrobacterium suspensions were infiltratedat OD600frac1401 Left images show the signal from the green channel Right images show mixed green and magenta channels (A) GFP-cGC1(B) GFP-cGC2 (C) GFP-cGC2 high level of expression (D) GFP-GRAB3 (E) GFP-GRAB4 (F) GFP-cGC5 (G) GFP-cGC6 Arrowheads indicatenon-Golgi structures in (D) and (E) Scale barfrac141 lm


Dow



ber 2022

fusion proteins were co-expressed with a fusion protein ofthe Arabidopsis Q-SNARE Memb11 (Chatre et al 2005)and YFP The human and yeast homologues of Memb11(called Membrin and Bos1 respectively) are cis GolgiSNARE proteins (Hay et al 1997) It has been shownthat overexpression of YFP-Memb11 in tobacco epider-mal cells causes ERD2 the Arabidopsis homologue of theHKDEL receptor (Hay et al 1997) to redistribute to theER (Chatre et al 2005) This effect was not found withother SNARE-XFP fusion proteins Memb11 is thereforemost likely involved in processes related to transport atthe ERndashGolgi interface or cis Golgi (Chatre et al 2005)High magnification images of YFP-Memb11 in CB137plants suggested that its location overlaps with but doesnot fully coincide with ST-mRFP (Fig 5H) Furthermoreit has previously been shown that it locates to the opposite

side of the stack to AtGRIP-GFP in a ST-mRFPYFP-Memb11AtGRIP-GFP triple labelled cell (Latijnhouwerset al 2005a) This led to the suggestion that AtGRIP is atrans-Golgi or TGN protein When GFP-AtCASP andGFP-GC1 to GFP-GC5 were co-expressed with YFP-Memb11 in tobacco CB137 epidermal cells triple-labelledGolgi were detected in cells expressing low levels of each ofthe three fluorescent proteins YFP-Memb11 was detectedprecisely in the centre of the rings formed by GFP-AtCASPand GFP-GC1 to GFP-GC5 (Fig 5AndashF) In the case ofGFP-AtCASP and GFP-GC1 to GC4 the GFP and YFPsignals both located slightly to one side of the area labelledby ST-mRFP (especially clear in the insets to Fig 5B andD) This localization of AtCASP and GC1 to GC4 relativeto Memb11 clearly differs from that of AtGRIP indicatingthat they locate to a different part of the Golgi to the GRIP

Fig 5 GFP fluorescence of AtCASP and GC1 to GC5 surrounds YFP-Memb11 fluorescence Confocal images of GFP-AtCASP and GFP-GC1 toGFP-GC5 (green) co-expressed with YFP-Memb11 (blue) in tobacco CB137 expressing ST-mRFP (red) Agrobacterium suspensions of GFP-CASPand GFP-GC1 to GFP-GC5 were infiltrated at OD600frac1401 YFP-Memb11 was infiltrated at OD600frac14005 Left images show the signal from the mixedgreen and blue channels Right images show mixed green blue and red channels (A) GFP-AtCASP+YFP-Memb11 (B) GFP-GC1+YFP-Memb11(C) GFP-GC2+YFP-Memb11 (D) GFP-GC3GDAP1+YFP-Memb11 (E) GFP-GC4+YFP-Memb11 (F) GFP-GC5+YFP-Memb11 (G) AtGRIP-GFP+YFP-Memb11 (Latijnhouwers et al 2005a) (H) YFP-Memb11+ST-mRFP Scale barfrac142 lm scale bar insetsfrac1405 lm


Dow



ber 2022

domain protein most likely the cis Golgi area Due to thefainter Golgi fluorescence of GFP-GC5 and the higher levelof fluorescence in the cytoplasm its location relative toST-mRFP was difficult to discern

AtGRIP AtCASP and GC1 are localized byimmuno-gold labelling

To study the location of three of the eight putativeArabidopsis golgins in more detail tobacco leaves

expressing AtGRIP-GFP GFP-CASP and GFP-GC1were high-pressure frozen and labelled with an anti-GFPantibody and a gold-conjugated secondary antibody Inthe case of AtGRIP the gold label was predominantlyfound in trans-Golgi cisternae and on vesicular or tubularstructures adjoining the trans-Golgi presumably the TGN(see Fig 6AndashD for representative images) In GFP-AtCASP(Fig 6E F) and GFP-GC1 (Fig 6G H) expressing cellsgold label was mainly detected in the often bulbous

Fig 6 Immuno-gold labelling shows AtGRIP on the trans Golgi and TGN and AtCASP and GC1 on the cisternal rims Electron micrographsshowing sections of high-pressure frozen tobacco epidermal cells infiltrated expressing AtGRIP-GFP GFP-AtCASP or GFP-GC1 by agroinfiltrationThe sections were incubated with anti-GFP and gold-labelled secondary antibody (AndashD) AtGRIP-GFP arrows indicate structures that likelycorrespond to the TGN (EndashF) GFP-AtCASP (G H) GFP-GC1 Scale barfrac1403 lm


Dow



ber 2022

margins of the cisternae No gold label was foundassociated with Golgi stacks in control leaves

The C-terminus of GC5 interacts with Rab6 GTPasehomologues

The C-terminal domain of the yeast golgin Sgm1p interactswith the yeast Rab6 homologue Ypt6p which recruitsSgm1p to Golgi membranes (Siniossoglou and Pelham2001) TMF the human homologue of Sgm1p binds thethree human Rab6 isoforms but not Rab1 (Fridmann-Sirkis et al 2004) To investigate whether the interactionbetween TMF and Rab6 is conserved in Arabidopsisthe C-terminus of GC5 and the two Arabidopsis Rab6homologues RabH1b and RabH1c (Bednarek et al 1994Rutherford and Moore 2002) were used in a yeast two-hybrid assay cGC5 was fused to the Gal4-binding domain(GBD-cGC5) and both Rab6 homologues were fused to the

Gal4-activation domain (GAD-RabH1b and GAD-RabH1crespectively) The test showed a clear interaction betweencGC5 and both RabH1b and RabH1c (Fig 7A) Bycontrast GBD-cGC5 did not interact with the Rab1homologue RabD2a (Batoko et al 2000) nor did theC-terminus of GC3GDAP1 (GRAB3) interact with any ofthe three GAD-Rab proteins Next RabH1b and RabH1cwere fused to glutathione-S-transferase (GST) and cGC5to a six histidine tag GST-RabH1b and GST-RabH1c wereimmobilized on glutathione agarose and incubated with anEscherichia coli lysate of a strain producing His6-cGC5The interacting proteins were eluted separated on SDS-PAGE and detected using an anti-His6 antibody onwestern blot His6-cGC5 showed a strong interaction withboth GST-RabH1b and GST-RabH1c and the interactionswere equally efficient in the presence of GDP and GTP(Fig 7B) No binding was detected between His6-cGC5

Fig 7 RabH1b and RabH1c interact with the C-terminus of GC5 (A) Results of yeast two-hybrid analysis Yeast cells were first transformed withGBD-cGC5 or GBD-GRAB3 and subsequently with GAD-RabH1b GAD-RabH1c or GAD-RabD2A and plated on plates lacking tryptophanleucine and adenine The presence of two interacting partners allows hydrolysis of X-a-gal resulting in a blue reaction product GBDfrac14GAL4 bindingdomain GADfrac14GAL4 activation domain (B) Western blot of total lysate of E coli strains expressing His6-cGC5 or His6-GRAB3 (lys) and ofproteins that bound to GST-RabH1b GST-RabH1c GST-RabD1 and GST-RabD2A GST proteins were preloaded with GDP or the non-hydrolysable analogue of GTP GTPcS Bound proteins were eluted in elution buffer with the opposite nucleotide and applied to SDS-PAGE TheWestern blot was probed with an anti-His6 antibody (C) Western blot of total lysates of E coli strains expressing GST-RabH1b GST-RabH1c GST-RabD1 or GST-RabD2a showing that similar quantities of GST fusion protein were immobilized onto GST-sepharose The western blot wasincubated with an anti-GST antibody (Sigma)


Dow



ber 2022

and GST-fusions of the two Rab1 homologues RabD1and RabD2A (Fig 7B) Again a His6-tagged version ofGRAB3 failed to interact with any of the four GST-taggedRab proteins

Discussion

This study is a clear example of how the availability ofsequence information for the complete Arabidopsis ge-nome can accelerate the discovery of new genes andproteins Similarity searches using the BLAST algorithmallowed putative plant homologues to be identified forGolgi-associated structural proteins of the golgin familypresent in other organisms The golgins are large proteinsthat consist predominantly of poorly-conserved coiled-coilregions Fortunately many of them possess additionaldomains that show higher sequence conservation acrosskingdoms The first putative Arabidopsis golgin for exam-ple was identified based on the presence of a conservedGRIP domain (Gilson et al 2004 Latijnhouwers et al2005a) The human genome contains four such GRIPdomain golgins whereas AtGRIP is the only one presentin the Arabidopsis genome The second plant golginAtCASP shows high sequence conservation in itsC-terminal TM domain and some overall sequence conser-vation In addition to CASP the human genome includes atleast two additional golgins with C-terminal TM domainsgiantin and golgin-84 (reviewed in Short et al 2005)Giantin has so far only been found in mammals and nopossible homologues were detected in Arabidopsis Bycontrast BLAST searches revealed two different Arabidopsisproteins possessing TM domains with significant similarityto the golgin-84 TM domain In the absence of evidence forthem being functional golgin-84 homologues the choicewas made to name them golgin candidates (GC1 and GC2)Although both have orthologues in the rice genome theGC1 orthologue has been inactivated by means of a retro-transposon insertion into the gene (Latijnhouwers et al2005b) As is the case with golgin-84 the GRAB domaingolgins Rud3p and GMAP210 occurring as single proteinsin yeast and humans respectively have two putativehomologues in Arabidopsis One of these was recentlyshown to target GFP to the Golgi and to interact withARF1-GFP (Matheson et al 2007) This protein wasnamed GRIP-related ARF1-binding domain-containingArabidopsis protein 1 (GDAP1) GC3GDAP1 and GC4share 70 similarity and they may exist as a result of a geneduplication event (Latijnhouwers et al 2005b) TMF andp115 (yeast orthologues of Sgm1p and Uso1p respectively)both exist as single proteins and similarity searches onlyidentified single proteins for each of them in the Arabidop-sis genome It is likely that the current group of eightputative Arabidopsis golgins is still incomplete In factPatel et al (2005) identified a novel Golgi-associatedcoiled-coil protein in tomato and tobacco called WAP1

which interacts with WPP domain-containing proteins andwhich may be a plant-specific golgin The human genomeharbours a large group of additional golgins among whichGM130 Bicaudal and Golgin-45 are either absent inArabidopsis or very poorly conserved and therefore notdetected by conventional similarity-searching algorithmsThese differences may reflect and become important inunderstanding the differences in the mammalian and plantGolgi apparatus

The golgin AtGRIP had previously been proposed tolocate to the trans-Golgi or TGN based on the observationthat AtGRIP-GFP located to the opposite side ofa ST-mRFP-labelled Golgi stack to the cis Golgi SNAREYFP-Memb11 (Latijnhouwers et al 2005a) By contrastGFP-AtCASP GFP-GC1 GFP-GC2 GFP-GC3 andGFP-GC4 located to the same side of the Golgi as YFP-Memb11 suggesting that they are cis or medial Golgiproteins It was decided to perform immuno-gold labellingof AtGRIP-GFP overexpressing tobacco leaves using ananti-GFP antibody to get a better though not yet fullydecisive idea of its distribution This resulted in thepreferential labelling of the trans-Golgi reinforcing theidea that AtGRIP like GRIP domain proteins in mammalsand yeast is a trans-Golgi or TGN golgin Immuno-goldlabelling of GFP-AtCASP and GFP-GC1 using the anti-GFP antiserum showed preferential labelling in thebulbous outer rims of cisternae This pattern may explainwhy they are detected as rings when imaged under theconfocal microscope However from these images itcould not be assessed with certainty whether there waspreferential labelling of cis or medial cisternae BecauseGFP-GC2 GFP-GC3 and GFP-GC4 are also detected asring structures with YFP-Memb11 located in the centre ofthe rings it is predicted that they too are located tocisternal rims

The human TMF is a trans-Golgi protein and humanp115 locates to the cis Golgi Whether or not the putativeArabidopsis TMF and p115 homologues GC5 and GC6respectively are in the same sub-Golgi compartment totheir mammalian counterparts is the subject of our currentinvestigations In mammals p115 binds the golginsgiantin and GM130 to form a complex that may tetherCOPII or COPI vesicles to the Golgi (Sztul and Lupashin2006) Since both giantin and GM130 seem to be absentin Arabidopsis identifying the function of GC6 and itsinteraction partners is extremely important for elucidatingplant Golgi tethering processes In many cells expressionof the GC6 constructs resulted in the formation of largeaggregates Whether these are protein aggregates due tooverexpression of the construct or represent clumpedGolgi due to the tethering nature of GC6 has still to beascertained

Small GTPases play key roles in all aspects of vesicletrafficking The yeast two-hybrid and the in vitro bindingassays detected a clear interaction between the C-terminus


Dow



ber 2022

of GC5 and RabH1b and RabH1c The interactions wereindependent of the nucleotide status of RabH1b andRabH1c which is in agreement with the results for theinteraction between human TMF and the human threeRab6 isoforms (Fridmann-Sirkis et al 2004) Rab6 inmammalian cells is located to the trans Golgi or TGNSince the interaction between TMF and Rab6 is conservedin plant cells it seems likely that GC5 is localized to andinvolved in protein sorting in the trans Golgi or TGN

In summary this study has revealed considerable over-lap between plants and other organisms with regard togolgin structure and localization but has also highlightedseveral intriguing differences Considering the majororganizational differences between the static Golgi rib-bons found in animal cells and the dispersed motile Golgistacks in plants there is a high probability that golgins arein part responsible for this structural diversity Thereforefurther characterization of the proteins presented in thispaper including their function in maintenance of the plantGolgi structure will contribute to a better understandingof the organization of the plant Golgi apparatus

Supplementary data

Supplementary data can be found at JXB onlineFig S1 shows the large fluorescent structures fre-

quently observed on expression of GFP-GC6 the p115homologueFig S2 demonstrated Golgi labelling with a GC6 con-

struct with EYFP inserted between amino acids 389 and390Fig S3 shows the alignments of the full-length proteins

GC1 to GC6 with orthologues from other organismsFig S4 demonstrates cytoplasmic expression of N-

terminal domain fusions of the golgins

Acknowledgements

We are grateful to Patrick Moreau (University of Bordeaux) for theYFP-Memb11 construct Dr Mark Curtis and the University ofZurich are acknowledged for the pMDC vectors Roger Y Tsienfor making the mRFP construct available and Federica Brandizzifor the creation of the ST-mRFP plants The Scottish ExecutiveEnvironment and Rural Affairs Department (SEERAD) and theBiotechnology and Biological Sciences Research Council (BBSRCgrant P20269) are acknowledged for their financial support

References

Ausubel F Brent R Kingston RE Moore JG Seidman JGSmith JA Struhl JG 1999 Current protocols in molecularbiology New York John Wiley

Batoko H Zheng HQ Hawes C Moore I 2000 A Rab1 GTPaseis required for transport between the endoplasmic reticulumand Golgi apparatus and for normal Golgi movement in plantsThe Plant Cell 12 2201ndash2218

Bednarek SY Reynolds TL Schroeder M Grabowski RHengst L Gallwitz D Raikhel NV 1994 A small GTP-bindingprotein from Arabidopsis thaliana functionally complements theyeast Ypt6 null mutant Plant Physiology 104 591ndash596

Boevink P Oparka K Santa Cruz S Martin B Betteridge AHawes C 1998 Stacks on tracks the plant Golgi apparatustraffics on an actinER network The Plant Journal 15 441ndash447

Brandizzi F Snapp EL Roberts AG Lippincott-Schwartz JHawes C 2002 Membrane protein transport between theendoplasmic reticulum and the Golgi in tobacco leaves is energy-dependent but cytoskeleton-independent evidence from selectivephotobleaching The Plant Cell 14 1293ndash1309

Chatre L Brandizzi F Hocquellet A Hawes C Moreau P2005 Sec22 and Memb11 are v-SNAREs of the anterogradeendoplasmic reticulum-Golgi pathway in tobacco leaf epidermalcells Plant Physiology 139 1244ndash1254

Cserzo M Wallin E Simon I von Heijne G Elofsson A 1997Prediction of transmembrane alpha-helices in prokaryotic mem-brane proteins the dense alignment surface method ProteinEngineering 10 673ndash676

Curtis MD Grossniklaus U 2003 A gateway cloning vector setfor high-throughput functional analysis of genes in planta PlantPhysiology 133 462ndash469

Diao A Rahman D Pappin DJ Lucocq J Lowe M 2003 Thecoiled-coil membrane protein golgin-84 is a novel rab effectorrequired for Golgi ribbon formation Journal of Cell Biology 160201ndash212

Fridmann-Sirkis Y Siniossoglou S Pelham HR 2004 TMF isa golgin that binds Rab6 and influences Golgi morphology BMCCell Biology 5 18

Gietz RD Schiestl RH Willems AR Woods RA 1995 Studieson the transformation of intact yeast cells by the LiAcSS-DNAPEG procedure Yeast 11 355ndash360

Gillingham AK Munro S 2003 Long coiled-coil proteins andmembrane traffic Biochimica et Biophysica Acta 1641 71ndash85

Gillingham AK Pfeifer AC Munro S 2002 CASP thealternatively spliced product of the gene encoding the CCAAT-displacement protein transcription factor is a Golgi membraneprotein related to giantin Molecular Biology of the Cell 133761ndash3774

Gillingham AK Tong AH Boone C Munro S 2004 TheGTPase Arf1p and the ER to Golgi cargo receptor Erv14pcooperate to recruit the golgin Rud3p to the cis-Golgi Journal ofCell Biology 167 281ndash292

Gilson PR Vergara CE Kjer-Nielsen L Teasdale RD Bacic AGleeson PA 2004 Identification of a Golgi-localized GRIP domainprotein from Arabidopsis thaliana Planta 219 1050ndash1056

Haseloff J Siemering KR Prasher DC Hodge S 1997 Removalof a cryptic intron and subcellular localization of greenfluorescent protein are required to mark transgenic Arabidopsisplants brightly Proceedings of the National Academy of SciencesUSA 94 2122ndash2127

Hay JC Chao DS Kuo CS Scheller RH 1997 Protein interactionsregulating vesicle transport between the endoplasmic reticulum andGolgi apparatus in mammalian cells Cell 89 149ndash158

Hofmann K Stoffel W 1992 PROFILEGRAPH an interactivegraphical tool for protein sequence analysis Computer AppliedBioscience 8 331ndash337

Latijnhouwers M Hawes C Carvalho C Oparka KGillingham AK Boevink P 2005a An Arabidopsis GRIPdomain protein locates to the trans-Golgi and binds the smallGTPase ARL1 The Plant Journal 44 459ndash470

Latijnhouwers M Hawes C Carvalho C 2005b Holding it alltogether Candidate proteins for the plant Golgi matrix CurrentOpinion in Plant Biology 8 632ndash639


Dow



ber 2022

Malsam J Satoh A Pelletier L Warren G 2005 Golgin tethersdefine subpopulations of COPI vesicles Science 307 1095ndash1098

Matheson LA Hanton SL Rossi M Latijnhouwers MStefano G Renna L Brandizzi F 2007 Multiple roles ofADP-ribosylation factor1 in plant cells include spatially regulatedrecruitment of coatomer and elements of the Golgi matrix PlantPhysiology 143 1615ndash1627

Mironov AA Beznoussenko GV Polishchuk RS Trucco A 2005Intra-Golgi transport A way to a new paradigm Biochimica etBiophysica Acta Molecular Cell Research 1744 340ndash350

Misumi Y Sohda M Tashiro A Sato H Ikehara Y 2001 Anessential cytoplasmic domain for the Golgi localization of coiled-coil proteins with a COOH-terminal membrane anchor Journal ofBiological Chemistry 276 6867ndash6873

Panic B Whyte JR Munro S 2003 The ARF-like GTPases Arl1pand Arl3p act in a pathway that interacts with vesicle-tetheringfactors at the Golgi apparatus Current Biology 13 405ndash410

Patel S Brkljacic J Gindullis F Rose A Meier I 2005 Theplant nuclear envelope protein MAF1 has an additional locationat the Golgi and binds to a novel Golgi-associated coiled-coilprotein Planta 222 1028ndash1040

Puthenveedu MA Bachert C Puri S Lanni F Linstedt AD2006 GM130 and GRASP65-dependent lateral cisternal fusionallows uniform Golgi-enzyme distribution Nature Cell Biology 8238ndash248

Renna L Hanton SL Stefano G Bortolotti L Misra VBrandizzi F 2005 Identification and characterization ofAtCASP a plant transmembrane Golgi matrix protein PlantMolecular Biology 58 109ndash122

Rose A Manikantan S Schraegle SJ Maloy MAStahlberg EA Meier I 2004 Genome-wide identification ofArabidopsis coiled-coil proteins and establishment of the ARABI-COIL database Plant Physiology 134 927ndash939

Rutherford S Moore I 2002 The Arabidopsis Rab GTPasefamily another enigma variation Current Opinion in PlantBiology 5 518ndash528

Saint-Jore CM Evins J Batoko H Brandizzi F Moore IHawes C 2002 Redistribution of membrane proteins betweenthe Golgi apparatus and endoplasmic reticulum in plants isreversible and not dependent on cytoskeletal networks The PlantJournal 29 661ndash678

Sapperstein SK Walter DM Grosvenor AR Heuser JEWaters MG 1995 p115 is a general vesicular transport factorrelated to the yeast endoplasmic reticulum to Golgi transport

factor Uso1p Proceedings of the National Academy of SciencesUSA 92 522ndash526

Seemann J Jokitalo E Pypaert M Warren G 2000 Matrixproteins can generate the higher order architecture of the Golgiapparatus Nature 407 1022ndash1026

Setty SR Shin ME Yoshino A Marks MS Burd CG 2003Golgi recruitment of GRIP domain proteins by Arf-likeGTPase 1 is regulated by Arf-like GTPase 3 Current Biology13 401ndash404

Short B Haas A Barr FA 2005 Golgins and GTPases givingidentity and structure to the Golgi apparatus Biochimica etBiophysica Acta 1744 383ndash395

Shorter J Watson R Giannakou ME Clarke M Warren GBarr FA 1999 GRASP55 a second mammalian GRASP proteininvolved in the stacking of Golgi cisternae in a cell-free systemEMBO Journal 18 4949ndash4960

Siniossoglou S Pelham HR 2001 An effector of Ypt6p binds theSNARE Tlg1p and mediates selective fusion of vesicles with lateGolgi membranes EMBO Journal 20 5991ndash5998

Smith DB Johnson KS 1988 Single-step purification of poly-peptides expressed in Escherichia coli as fusions with glutathioneS-transferase Gene 67 31ndash40

Sohda M Misumi Y Yoshimura S Nakamura N Fusano TSakisaka S Ogata S Fujimoto J Kiyokawa N Ikehara Y2005 Depletion of vesicle-tethering factor p115 causes mini-stacked Golgi fragments with delayed protein transportBiochemical and Biophysical Research Communications 3381268ndash1274

Sonnichsen B Lowe M Levine T Jamsa E Dirac-Svejstrup BWarren G 1998 A role for giantin in docking COPI vesicles toGolgi membranes Journal of Cell Biology 140 1013ndash1021

Stefano G Renna L Hanton SL Chatre L Haas TABrandizzi F 2006 ARL1 plays a role in the binding of theGRIP domain of a peripheral matrix protein to the Golgiapparatus in plant cells Plant Molecular Biology 61 431ndash449

Sztul E Lupashin V 2006 Role of tethering factors in secretorymembrane traffic American Journal of Physiology-Cell Physiol-ogy 290 C11ndashC26

Xu J Scheres B 2005 Dissection of Arabidopsis ADP-RYBOSY-LATION FACTOR 1 function in epidermal cell polarity ThePlant Cell 17 525ndash536

Wang YZ Seemann J Pypaert M Shorter J Warren G 2003A direct role for GRASP65 as a mitotically regulated Golgistacking factor EMBO Journal 22 3279ndash3290


Dow



ber 2022

matrix that remains after detergent extraction a structurereferred to as the Golgi lsquoskeletonrsquo (Seemann et al 2000)Golgins are large proteins with extensive coiled-coildomains predicted to adopt long rod-like conformations(reviewed in Gillingham and Munro 2003 Short et al2005) Depletion of the golgins GM130 p115 or golgin-84 by RNAi resulted in Golgi fragmentation into ministacks in mammalian cells (Diao et al 2003 Sohda et al2005 Puthenveedu et al 2006) showing that golginsare important for maintaining Golgi structure How theseproteins control Golgi organization remains largely un-determined and much about the functions of these proteinsremains unknown However it is clear that they play arole in vesicle tethering In vitro vesicle docking assayshave revealed the need for p115 GM130 and Giantin for coatprotein complex I (COPI) vesicle binding to Golgi mem-branes (Sonnichsen et al 1998) Furthermore golgin-84and CASP were reported to be involved in tetheringto Golgi cisternae of a subpopulation of COPI vesiclespresumed to be involved in retrograde transport to the ER(Malsam et al 2005)

A small group of golgins are integral membraneproteins inserted into the membrane by means of aC-terminal transmembrane (TM) domain The majority ofgolgins however are peripheral membrane proteins some-times recruited to the correct membrane through interac-tion with members of the Rab ADP-ribosylation factor(ARF) or ARF-like (ARL) families of small GTPasesA C-terminal domain called GRIP which is present infour human and one yeast golgin interacts with GTP-bound ARL1 and is necessary for Golgi localization ofthese golgins (Panic et al 2003 Setty et al 2003) MostGRIP domain golgins locate to the trans-Golgi or theTGN A second Golgi-targeting domain distantly relatedto the GRIP domain is present in the yeast golgin Rud3pIt binds ARF1 and is named GRIP-related ARF-binding(GRAB) domain The GRAB domain is also found in themammalian golgin GMAP210 (Gillingham et al 2004)The most C-terminal coiled-coil domain of the humangolgin TMF (TATA element modulatory factor) wasshown to bind the three known human isoforms of Rab6but not Rab1 (Fridmann-Sirkis et al 2004) The yeasthomologue of TMF Sgm1p also binds to the Rab6homologue YPT6 (Siniossoglou and Pelham 2001) Twomammalian golgins GM130 and Golgin-45 need proteinscalled Golgi reassembly stacking proteins (GRASPs) forassociation with membranes which themselves are in-dispensable for Golgi structure (Shorter et al 1999Wang et al 2003)

The first plant golgin AtGRIP was identified basedon the presence of a C-terminal GRIP domain (Gilsonet al 2004) An AtGRIPndashGFP fusion protein locates toGolgi stacks in tobacco epidermal cells and the GRIPdomain interacts with an Arabidopsis ARL1 homologue(Latijnhouwers et al 2005a Stefano et al 2006)

Furthermore an Arabidopsis protein with homology tothe mammalian golgin CASP was identified and namedAtCASP It was shown to target GFP to Golgi stacks inboth tobacco and monkey cells (Renna et al 2005)Recently a protein with a domain showing similarityto the GRAB domain was isolated and named GDAP1(Matheson et al 2007) GDAP1 was shown to locate toGolgi stacks and additional ARF1-labelled structures andto interact with Arabidopsis ARF1 AtGRIP AtCASPand GDAP1 are putative plant golgins based on theirdomain structures and their Golgi localization A numberof additional Arabidopsis proteins have previously beenreferred to as potential golgins based on sequence simi-larity with mammalian or yeast golgins (Gillingham et al2002 2004 Fridmann-Sirkis et al 2004 Latijnhouwerset al 2005b) Moreover Rose et al (2004) observedthat the domain organizations of three Arabidopsis coiled-coil proteins (including AtCASP) were comparable tothose of the mammalian golgins CASP and golgin-84

In this report the localization and domain characteriza-tion of six putative Arabidopsis golgins are describedThe GFP fusions of all of these proteins co-localize withfluorescent Golgi markers and five are detected as fluores-cent rings around the Golgi stacks Two of these proteinspossess C-terminal TM domains and share similarity withthe mammalian protein golgin-84 whereas two others (oneof which is GDAP1) are characterized by C-terminal GRABdomains The remaining two proteins share regions ofsignificant similarity with the mammalian golgins TMF andp115 respectively It is demonstrated for all six of theseputative golgins that the Golgi targeting domains areC-terminal Using immuno-gold labelling a first indicationfor the spatial distribution in the Golgi stack of three of theArabidopsis golgins has been obtained Finally yeast two-hybrid experiments and an in vitro binding assay show thattwo Arabidopsis Rab6 homologues interact with theC-terminus of GC5 the Arabidopsis TMF homologue

Materials and methods

Construction of expression plasmids

Standard molecular techniques were used as described in Ausubelet al (1999) Primers were obtained from MWG Biotech (Ebers-berg Germany) or from Invitrogen (Paisley UK) Restrictionenzymes were from New England Biolabs (Herts UK) ExpandHiFi polymerase (Roche Basel Switzerland) or Phusion highfidelity DNA polymerase (New English Biolabs) were used forPCR All PCR products were sequenced using the Big DyeTerminator v31 cycle sequencing kit (Applied Biosystems FosterCity USA) Full length sequences for GC6 GC1 GC5 GC2 GC4and GC3 were submitted to GenBank (accession numbersEU249327 to EU249332) The BLAST algorithm (httpwwwncbinlmnihgovblast) or (httpwwwArabidopsisorgBlast) was usedfor similarity searches CLUSTALW (httpnpsa-pbilibcpfrcgi-binnpsa_automatplpagefrac14npsa_clustalwhtml Pole BioInformatiqueLyonnais) was used to align Arabidopsis proteins with proteins fromother organisms and to obtain similarity or identity values


Dow



ber 2022







Confocal imaging








Dow



ber 2022






Results






Name ORFnumbera

Length(aa)






domain



Dow



ber 2022






Dow



ber 2022








Dow



ber 2022








Dow



ber 2022







Dow



ber 2022





Dow



ber 2022







Dow



ber 2022







Dow



ber 2022


Discussion







Dow



ber 2022



Supplementary data






Acknowledgements


References






















Dow



ber 2022



























Dow



ber 2022







Confocal imaging








Dow



ber 2022






Results






Name ORFnumbera

Length(aa)






domain



Dow



ber 2022






Dow



ber 2022








Dow



ber 2022








Dow



ber 2022







Dow



ber 2022





Dow



ber 2022







Dow



ber 2022







Dow



ber 2022


Discussion







Dow



ber 2022



Supplementary data






Acknowledgements


References






















Dow



ber 2022



























Dow



ber 2022






Results






Name ORFnumbera

Length(aa)






domain



Dow



ber 2022






Dow



ber 2022








Dow



ber 2022








Dow



ber 2022







Dow



ber 2022





Dow



ber 2022







Dow



ber 2022







Dow



ber 2022


Discussion







Dow



ber 2022



Supplementary data






Acknowledgements


References






















Dow



ber 2022



























Dow



ber 2022






Dow



ber 2022








Dow



ber 2022








Dow



ber 2022







Dow



ber 2022





Dow



ber 2022







Dow



ber 2022







Dow



ber 2022


Discussion







Dow



ber 2022



Supplementary data






Acknowledgements


References






















Dow



ber 2022



























Dow



ber 2022








Dow



ber 2022








Dow



ber 2022







Dow



ber 2022





Dow



ber 2022







Dow



ber 2022







Dow



ber 2022


Discussion







Dow



ber 2022



Supplementary data






Acknowledgements


References






















Dow



ber 2022



























Dow



ber 2022








Dow



ber 2022







Dow



ber 2022





Dow



ber 2022







Dow



ber 2022







Dow



ber 2022


Discussion







Dow



ber 2022



Supplementary data






Acknowledgements


References






















Dow



ber 2022



























Dow



ber 2022







Dow



ber 2022





Dow



ber 2022







Dow



ber 2022







Dow



ber 2022


Discussion







Dow



ber 2022



Supplementary data






Acknowledgements


References






















Dow



ber 2022



























Dow



ber 2022





Dow



ber 2022







Dow



ber 2022







Dow



ber 2022


Discussion







Dow



ber 2022



Supplementary data






Acknowledgements


References






















Dow



ber 2022



























Dow



ber 2022







Dow



ber 2022







Dow



ber 2022


Discussion







Dow



ber 2022



Supplementary data






Acknowledgements


References






















Dow



ber 2022



























Dow



ber 2022







Dow



ber 2022


Discussion







Dow



ber 2022



Supplementary data






Acknowledgements


References






















Dow



ber 2022



























Dow



ber 2022


Discussion







Dow



ber 2022



Supplementary data






Acknowledgements


References






















Dow



ber 2022



























Dow



ber 2022



Supplementary data






Acknowledgements


References






















Dow



ber 2022



























Dow



ber 2022



























Dow



ber 2022

Localization and domain characterization of Arabidopsis ...

Documents

Transcript of Localization and domain characterization of Arabidopsis ...