Llama single-domain antibodies directed against nonconventional epitope of tumor

Llama single-domain antibodies directed againstnonconventional epitopes of tumor-associatedcarcinoembryonic antigen absent from nonspecificcross-reacting antigenGhislaine Behar1,2,*, Patrick Chames1,2,�, Isabelle Teulon2,3, Amelie Cornillon1,2, Faisal Alshoukr2,4,5,Francoise Roquet2,6, Martine Pugniere2,6, Jean-Luc Teillaud2,7,8,9, Anne Gruaz-Guyon2,4,5,Andre Pelegrin2,3 and Daniel Baty1,2,�

1 CNRS, Laboratoire d’Ingenierie des Systemes Macromoleculaires, Marseille, France

2 CNRS, Groupement de Recherche Immunociblage des Tumeurs, Marseille, France

3 INSERM, Centre de Recherche en cancerologie de Montpellier, Universite Montpellier, France

4 INSERM, Centre de Recherche Biomedicale Bichat-Beaujon, Paris, France

5 Universite Denis Diderot-Paris 7, France

6 CNRS, Universite Montpellier 1, France

7 INSERM, Centre de Recherche des Cordeliers, Paris, France

8 Universite Pierre et Marie Curie – Paris 6, France

9 Universite Paris Descartes, France

Keywords

carcinoembryonic antigen; CEACAM5;

nonspecific cross-reacting antigen; phage

display; single domain antibodies

Correspondence

D. Baty, INSERM, U624, Stress Cellulaire,

Marseille, France

Fax: +33 4 91 82 60 83

Tel: +33 4 91 82 88 33

E-mail: [email protected]

Present addresses

*UMR6204, CNRS, Universite de Nantes,

France

�INSERM, U624, Stress Cellulaire,

Marseille, France

Database

The nucleotide sequences in this study have

been submitted to the GenBank database

under the accession numbers ABS29543

(C3), ABS29544 (C17), ABS29545 (C25),

ABS29546 (C43) and ABS29547 (C44)

(Received 18 December 2008, revised

20 April 2009, accepted 15 May 2009)

doi:10.1111/j.1742-4658.2009.07101.x

Single-domain antibodies (sdAbs), which occur naturally in camelids, are

endowed with many characteristics that make them attractive candidates as

building blocks to create new antibody-related therapeutic molecules. In

this study, we isolated from an immunized llama several high-affinity

sdAbs directed against human carcinoembryonic antigen (CEA), a heavily

glycosylated tumor-associated molecule expressed in a variety of cancers.

These llama sdAbs bind a different epitope from those defined by current

murine mAbs, as shown by binding competition experiments using immu-

nofluorescence and surface plasmon resonance. Flow cytometry analysis

shows that they bind strongly to CEA-positive tumor cells but show no

cross-reaction toward nonspecific cross-reacting antigen, a highly CEA-

related molecule expressed on human granulocytes. When injected into

mice xenografted with a human CEA-positive tumor, up to 2% of the

injected dose of one of these sdAbs was found in the tumor, despite rapid

clearance of this 15 kDa protein, demonstrating its high potential as a

targeting moiety. The single-domain nature of these new anti-CEA IgG

fragments should facilitate the design of new molecules for immunotherapy

or diagnosis of CEA-positive tumors.

Structured digital abstractl MINT-7042030: C3 (genbank_protein_gi:152143600) binds (MI:0407) to CEA (uniprotkb:

P06731) by surface plasmon resonance (MI:0107)l MINT-7045726: C17 (genbank_protein_gi:152143602) binds (MI:0407) to CEA (uniprotkb:


P06731) by surface plasmon resonance (MI:0107)

Abbreviations

CDR, complementarity determining region; CEA, carcinoembryonic antigen; FITC-GAM, fluorescein isothiocyanate goat anti-mouse Ig; NCA,

nonspecific cross-reacting antigen; sCEA, soluble carcinoembryonic antigen; sdAb, single-domain antibody; SPR, surface plasmon resonance.

FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS 3881

http://mint.bio.uniroma2.it/mint/search/interaction.do?interactionAc=MINT-7042030

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&id=152143600

http://www.ebi.ac.uk/ontology-lookup/?termId=MI:0407

http://www.ebi.uniprot.org/entry/P06731












Introduction

Cancer immunotherapy, either active, i.e. based on

the stimulation of specific anti-tumor responses with

tumor-associated antigens ⁄peptides as the immunizing

materials, or passive, i.e. based on the injection of

mAbs, is now delivering an increasing amount of

encouraging data. Notably, several mAbs have been

approved for therapeutic use over the last decade.

Antibody engineering makes it possible to design new

molecules capable of increasing the efficiency of anti-

body-based therapies. Since the discovery that func-

tional heavy-chain gamma-immunoglobulins lacking

light chains occur naturally in the Camelidae [1], sev-

eral groups have reported the isolation of single-

domain antibodies (sdAbs) consisting of the variable

domain of these heavy chain antibodies, also named

VHH [2]. These minimal antibody domains are

endowed with a large number of properties that make

them very attractive for antibody engineering. Despite

the reduced size of their antigen-binding surface,

VHH domains exhibit affinities similar to those of

conventional mAbs and are also capable of binding

small molecules as haptens [3,4]. Strikingly, they often

use complementarity determining region (CDR) 3

longer than the one of VH domains, which allow

them to bind otherwise difficult-to-reach epitopes

within the cavities on the antigen surface. Conse-

quently, these fragments can recognize epitopes inac-

cessible to conventional antibodies and are a good

source of enzyme inhibitors [5]. Most importantly, the

single-domain nature of VHH permits the amplifica-

tion and subsequent straightforward cloning of the

corresponding genes, without requiring an artificial

linker peptide (as for single-chain Fv fragments) or

bi-cistronic constructs (as for Fab fragments). This

feature allows direct cloning of large sdAb repertoires

from immunized animals, without the need to be con-

cerned by the usual disruption of VH ⁄VL pairing

faced when generating scFv and Fab fragment

libraries. The sdAb format is also likely responsible

for the high production yield obtained when these

domains or sdAb-based fusion molecules are

expressed. A number of sdAb and sdAb-derived

molecules has been produced in large amounts in

prokaryotic [6] and eukaryotic [7,8] cell lines, and in

plants [9]. Moreover, VHH fragments show exquisite

refolding capabilities and amazing physical stability

[10]. Last, but not least, the genes encoding VHH

show a large degree of homology with the VH3

subset family of human VH genes [11], which might

confer low antigenicity in humans, a very attractive

feature for immunotherapeutic approaches. Taken

together, these data make VHH excellent candidates

to engineer multispecific or multifunctional proteins

for immunotherapy [12].

Carcinoembryonic antigen (CEA or CEACAM5), a

member of the immunoglobulin supergene family, is a

heavily glycosylated protein involved in cell adhesion

and normally produced by fetal gastrointestinal tis-

sues. It was first described by Gold and Freedman in

1965 [13] as a high-molecular mass glycoprotein

(� 180 kDa) found in colonic tumors and fetal colon,

but not in normal adult colon; its expression has

since been described in almost all tumors (> 95%)

including rectum, breast, lung, liver, pancreas, stom-

ach, thyroid and ovarian tumors. Nonspecific cross-

reacting antigen (NCA or CEACAM6) is a highly

related member of the same CEACAM family. CEA

and NCA polypeptides have extracellular domains,

some with cysteine-linked loops, that share extensive

amino acid sequence homology (� 78% overall) with

each other and appear similar to other immunoglobu-

lin superfamily members. A major difference between

the two apoproteins is the presence of a single loop-

domain in NCA, compared with three tandemly

repeated loop-domains in CEA. Comparisons between

the extracellular domains of CEA and NCA show

that the N-terminal and adjacent loop-domains of

each apoprotein have high sequence homology (85–

90%). Consequently, many mAbs raised against CEA

also bind with high affinity to NCA. CEA has been

extensively chosen as the target for directed cancer

therapies aimed at selectively destroying cells express-

ing this tumor antigen but sparing normal cells.

Based on a large body of evidence indicating that

CEA is associated with the growth and metastasis of

cancers [14], this tumor marker represents an interest-

ing model target with which to monitor the efficacy

of sdAb-based multifunctional molecules.

As a first step towards the generation of new CEA-

targeted therapeutic molecules, we generated a panel

l MINT-7046473: C43 (genbank_protein_gi:152143606) binds (MI:0407) to CEA (uniprotkb:


P06731) by surface plasmon resonance (MI:0107)

CEA-specific single domain antibodies G. Behar et al.

3882 FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS











of llama-derived sdAbs capable of binding with high

affinity to CEA. Importantly, we were able to select

CEA-specific sdAbs showing no cross-reaction with

NCA that is expressed on several normal cell types,

including granulocytes. Moreover, these sdAbs do not

bind to known epitopes recognized by monoclonal

murine anti-CEA IgGs. Thus, these sdAbs represent

versatile tools to generate potent antibody-based

molecules for cancer therapy.

Results

Isolation of sdAbs against CEA

A male llama was immunized subcutaneously five times

with 250 lg recombinant purified soluble CEA (sCEA)

per injection. A library of 106 clones was obtained by

RT-PCR amplification and cloning of VHH genes, using

RNA purified from llama peripheral blood cells. A clas-

sic issue with anti-CEA IgGs is their high tendency to

cross-react with the highly related NCA receptor. To

increase the chance of selecting a diverse panel of sdAbs

against CEA, two antigen immobilization methods were

used. Recombinant human sCEA was either directly

immobilized by adsorption onto plastic (immunotubes)

(Method A), or indirectly immobilized on magnetic

beads via a biotin ⁄ streptavidin system (Method B) (see

Material and Methods).

After one round of affinity selection, 48 clones ran-

domly picked from each output were assayed by

phage-ELISA for binding to biotinylated sCEA

immobilized on streptavidin plates. All clones picked

from the output of Method A were positive, whereas

only 61% from Method B were positive. Conse-

quently, two more rounds were performed for Method

B, which ultimately led to 100% of binders by phage

ELISA.

Sequence analysis of the 48 clones picked from

Method A (round 1) revealed that three highly related

antibodies, displaying identical residues in their CDRs,

dominated the population. Sequence analysis of the 48

clones picked at random from method B (rounds 1–3)

revealed that the output included five sdAbs, namely

C3, C17, C25, C43 and C44. C44 was the clone domi-

nating the output of Method A.

Interestingly, the amino acid alignment (Fig. 1)

showed that sdAbs C3, C17, C25 and C43 are likely

clonally related, despite the presence of a relatively

high number of differences scattered all along the gene.

CDR3 of C3, C25 and C43 are very similar, suggesting

use of the same D gene. C17 shows very similar CDR1

and CDR2, but a rather different CDR3. Interestingly,

CDR1 and CDR3 of clone C44 are totally unrelated

to CDR1 and CDR3 of the other sdAbs. In all cases,

the presence of an arginine at position 50 (Fig. 1) con-

firmed the Camelidae nature of these sdAbs. All of

them belong to subfamily VHH2 [15].

Affinity determination by surface plasmon

resonance

To further characterize these sdAbs, the corresponding

cDNA were cloned into the expression vector pPelB55-

PhoA’ [16], allowing efficient production and purifica-

tion of the molecules. SdAbs harboring a hexahistidine

tag at the C-terminus were produced in the periplasm

of Escherichia coli and purified by immobilized ion

metal-affinity chromatography. Final yields were in the

range 5–10 mgÆL culture)1 for all clones. SDS ⁄PAGE

analysis demonstrated a satisfying degree of purity

(> 95%, data not shown). Pure sdAbs were then indi-

rectly immobilized on BIAcore sensorchips and their

affinity for soluble CEA determined. As shown in

Table 1, all sdAbs exhibited a good affinity for sCEA,

with a KD ranging from 3 to 32 nm.

Specificity analysis by flow cytometry

Flow cytometry was used to determine whether the

selected sdAbs specifically bind to CEA+, but not

Fig. 1. Amino acid sequences of

CEA-specific sdAbs. The IMGT numbering

[33] is shown. The localization of

frameworks (FR1 to FR4) and CDRs are

indicated. Dashes indicate sequence

identity.

G. Behar et al. CEA-specific single domain antibodies


CEA), cells and to examine if any cross-reaction with

NCA could be detected.

sdAbs were assayed by flow cytometry for binding

to colon cancer MC38 cells (CEA) NCA)), or to

transfected MC38 cells expressing either CEA or NCA

(kindly provided by F.J. Primus, Vanderbilt University

Medical Center, Nashville, TN, USA). Cells from the

CEA+ colon cancer cell line LS174T, as well as from

freshly purified human granulocytes that display NCA

but not CEA, were also tested.

Fig. 2. Flow cytometry analysis of sdAb C17 and C44 binding to MC38 cells expressing CEA or NCA. Purified sdAbs were incubated with

colon cancer MC38 cells (negative control), with transfected CEA+ or NCA+ MC38 cells, with CEA+ colon cancer LS174T cells or with freshly

purified human granulocytes that express NCA but not CEA. Bound sdAbs were detected with a monoclonal anti-c-myc IgG followed by

FITC-labeled F(ab¢)2 goat anti-mouse IgG (H+L). Mouse mAbs 35A7 (CEA specific) and 192 (binding to an epitope common to CEA and NCA)

were used as controls. C3, C25 and C43 sdAb profiles (not shown) were identical to those of sdAb C17, demonstrating binding to CEA but

not NCA, in contrast to sdAb C44, which binds to both molecules. x-axis, log of fluorescence intensity; y-axis, number of events.

Table 1. Kinetic and affinity constants of the binding of soluble carcinoembryonic antigen (sCEA) to CEA-specific sdAbs immobilized via

monoclonal anti-(c-myc) 9E10 on CM5 microchips. A Langmuir 1 : 1 model was used to fit six different sCEA concentrations. No binding of

sCEA on immobilized 9E10, mass transport or rebinding effect was observed. v2, statistical value for describing the closeness of the fit. Val-

ues of v2 < 10% of the Rmax are usually acceptable. RU, relative units.

Single-domain antibody ka · 105 (1ÆMs)1) kd · 10)3 (1Æs)1) KD (nM) Rmax (RU) v2

C44 8.21 ± 0.040 2.64 ± 0.004 3.20 236 3.00

C43 1.78 ± 0.019 1.83 ± 0.002 10.30 284 0.55

C25 1.13 ± 0.014 3.60 ± 0.004 31.7 292 0.30

C17 1.56 ± 0.014 1.30 ± 0.002 8.30 254 0.22

C3 1.24 ± 0.014 1.68 ± 0.002 13.6 254 0.30



Figure 2 shows that C17 sdAb efficiently binds to

CEA-expressing cells (MC38–CEA+ and LS174T) but

not to NCA+ human granulocytes. C3, C25 and C43

sdAb binding profiles were identical to that of C17

sdAb (data not shown). By contrast, sdAb C44 was

also capable of binding to MC38–NCA+ cells and to

human granulocytes, whereas all other sdAbs did not

show any binding to these cells. C44 sdAb is therefore

recognizing an epitope shared by CEA and NCA, in

contrast to C3, C17, C25 and C43, which are strictly

specific for CEA. Monoclonal antibodies that either

bind both CEA and NCA (mAb 192) or only CEA

(mAb 35A7) were used as controls (Fig. 2).

Competitive inhibition of antibody binding to

LS174T cells

To further characterize the binding properties of sdAbs

C3, C17, C25, C43 and to investigate whether different

CEA epitopes were recognized by these antibodies,

binding competition experiments were performed using

cells from the CEA-expressing cell line LS174T. Cells

were incubated with trace amounts of 125I-labeled

sdAb C17 (0.4 nm) in the presence of increasing con-

centrations of unlabeled sdAbs. As shown in Fig. 3,

sdAbs C25, C3 and C43 were able to compete with

C17, indicating that these sdAbs bind to overlapping

epitopes or to the same epitope. Moreover, sdAb IC50

is in the nm range for three of the four sdAbs (C3,

1.6 ± 0.4 nm; C17, 7.8 ± 1.3 nm; C43, 5.2 ± 0.3 nm).

Only sdAb C25 exhibits a significantly lower apparent

affinity (59.1 ± 0.6 nm). These values obtained from

cell-binding experiments are in good agreement with

surface plasmon resonance (SPR) data (Table 1),

except for sdAb C3 (KD = 13.6 nm). This difference

might be because of a different conformation and ⁄orglycosylation of the sdAb epitope on cell-displayed

CEA and on recombinant sCEA immobilized on

sensor chips.

Epitope analysis by surface plasmon resonance

Most CEA-specific mAbs available to date can be clas-

sified into five categories (Gold 1-5) according to their

epitope [17]. To determine if one or more of these epi-

topes was recognized by the CEA-specific sdAbs (C3,

C17, C25, C43), a qualitative SPR-based sandwich

assay was used. sdAbs were first captured via their

c-myc tag on the CM5 sensorchip surface coated with

the monoclonal anti-c-myc IgG 9E10 to favor a good

exposition of the captured sdAbs. Recombinant sCEA

was then injected and captured by the sdAbs. Subse-

quently, one of the five Gold mAbs recognizing one of

the five Gold epitopes was injected. Under these condi-

tions, binding of the Gold mAb indicates that its cor-

responding epitope is not blocked by the capturing

sdAb. All Gold mAbs were tested against all CEA-

specific sdAbs. Sensorgrams obtained with sdAb C17

are shown in Fig. 4A. All sdAb and Gold mAb combi-

nations led to efficient binding of Gold mAb to the

captured sCEA, demonstrating that none of the five

Gold epitopes is recognized by the CEA-specific

sdAbs. All five anti-CEA Gold IgGs were able to bind

captured sCEA, whereas an irrelevant mAb (mouse

anti FccRIII) did not. As a positive of competition, a

version of the sdAb used for CEA capture but devoid

of the c-myc tag was injected instead of Gold mAbs.

No increase in signal was obtained, showing that com-

petition can be efficiently demonstrated between these

molecules in our assay. An irrelevant sdAb [anti-(HIV-

1 NEF) devoid of c-myc tag] injected at the same

concentration was used as a negative control.

Moreover, in a reverse scheme, all sdAbs were able

to bind to recombinant sCEA captured on the chip via

Gold mAbs covalently immobilized on CM5 sensor-

chip. Figure 4B shows the results obtained with the

mAb 35A7 as an example.

Epitope analysis by flow cytometry

The absence of competition between gold mAbs and

sdAbs was confirmed using nonrecombinant cell-

Fig. 3. Competitive inhibition of antibody binding to LS174T cells.

Competition between 125I-labeled sdAb C17 (0.4 nM) and increasing

amounts of unlabeled sdAb C17 (square), sdAb C25 (triangle), sdAb

C3 (circle) and sdAb C43 (diamond) for binding on LS174T cells

(5 · 106 cellsÆmL)1). Each point is the mean of triplicate determina-

tions of a representative experiment ± SEM, unless smaller than

the point as plotted. Nonspecific binding was evaluated in the pres-

ence of an excess of unlabeled sdAb C17 (2 · 10)7M).



surface displayed CEA by flow cytometry. CEA-

expressing cells were first incubated with very high

concentrations (up to 2190 nm) of sdAb C17 devoid of

the c-myc tag. After 1 h of incubation, subsaturating

concentrations of either gold mAbs or c-myc-tagged

sdAb C17 or C43 (30-70 nm as determined in a previ-

ous flow cytometry experiment, data not shown) were

added to the wells. After an additional 1 h of incuba-

tion, bound gold mAbs and c-myc-tagged sdAbs were

revealed. As shown in Fig. 5, the presence of a large

excess (more than two orders of magnitude) of untag-

ged sdAb C17 did not interfere with the binding of

gold mAbs, but completely inhibited the binding of

c-myc-tagged sdAb C17 or sdAb C43 that bind to the

same epitope (see above). These results confirmed that

these sdAbs do not bind to any of the epitopes recog-

nized by gold mAbs.

In vivo localization

To analyze the behavior of sdAbs against CEA under

more physiological conditions, immunocompromised

mice were xenografted with LS174T cancer cells. Once

tumors were established (i.e., day 7), radiolabeled

sdAb C17 (displaying the highest affinity as measured

by SPR) was injected and the biodistribution was

monitored.

A fast blood clearance was observed, as assessed by

the low residual blood radioactivity 6 h after injection

[0.30 ± 0.06% of the injected dose per gram %

IDÆg)1 ± SEM)]. Activity uptake was observed pri-

marily in kidneys (7.4 ± 0.4% IDÆg)1 3 h post injec-

tion and 4.8 ± 0.6% IDÆg)1 at 6 h post injection).

Three hours after injection, 1.9 ± 0.1% of the injected

dose was localized in the tumor. This was at least two-

fold higher than the radioactivity found in blood, liver

and major organs except kidneys, and was 3.5- and

5-fold higher than the radioactivity found in bones

and leg muscles, respectively (Fig. 6). Six hours after

injection, the increased clearance resulted in higher

tumor-to-normal tissue uptake ratios for all these

organs, reaching a ratio of 10 in the case of muscles.

Discussion

As a first step toward the construction of multispeci-

fic and ⁄or multivalent molecules aiming at redirecting

immune cells such as T cells or NK cells to tumor

cells, we isolated sdAbs able to bind to CEA (or

CEACAM5), a tumor marker used in cancer diagno-

sis and immunotherapy. We used phage display to

select binders from one sdAb library derived from

peripheral blood mononuclear cells isolated from an

immunized llama. Interestingly, two selection methods

led to strikingly different outputs. Selection by

panning on recombinant sCEA directly adsorbed on

plastic allowed the isolation of a single family of

highly related sdAbs that dominated the selected pop-

ulation only after a single round of selection. How-

Fig. 4. Epitope analysis by surface plasmon resonance (BIAcore).

(A) c-myc-tagged sdAbs were captured on an anti-c-myc IgG-coated

CM5 chip. sCEA was injected (curves a) or not (curves b), followed

by injection of one of the Gold mAbs. The dissociation of sdAbs

from 9E10 was corrected by subtraction of a control flow cell

coated with 9E10 and injected with sdAbs only. Sensorgrams

obtained with sdAb C17 are shown as an example. Irr mAb, irrele-

vant mAb (mouse anti-FccRIII). As a positive control of competition,

sdAb C17 devoid of the c-myc tag was injected after CEA capture.

The absence of binding demonstrates that the epitope of this sdAb

was efficiently blocked by the binding of the immobilized sdAb. An

irrelevant sdAb (anti HIV-1 NEF) injected at the same concentration

was used as a negative control (irr sdAb). (B) sCEA (curves a) or

buffer (curves b) were injected on Gold mAb-coated CM5 chips,

followed by an injection of different sdAbs.



ever, the epitope recognized by these antibodies is

also present on a highly related molecule, nonspecific

cross-reacting antigen (NCA or CEACAM6) that

shares the same Ig domain-based structure with CEA

and displays a high percentage of sequence homology.

By contrast, a selection based on biotinylated sCEA

captured on streptavidin-coated magnetic beads led to

only 61% binders after a single round and two more

rounds of selection were needed to reach 100% bind-

ers. Unlike the first method, the output of this selec-

tion was more diverse. This method yielded

antibodies belonging to the family selected by pan-

ning on coated sCEA, but also made it possible to

isolate several other clones displaying very similar

CDR1 and CDR2, but more diverse CDR3, suggest-

ing use of the same VHH gene but different D genes.

Flow cytometry analyses demonstrated that these

sdAbs bind specifically to CEA expressed on cancer

cells but do not cross-react with NCA. These anti-

bodies were not present in the output of the panning

method, despite very similar affinities for the antigen,

in the nm range, as determined by SPR. One can

hypothesize that the conformational changes resulting

from the adsorption of CEA on plastic are either

denaturing the epitope recognized by the second

family of sdAbs or are favoring the display of the

epitope recognized by the first family, leading to a

large presence of this latter family during the selec-

tion process.

As expected for llama VHHs, the sequences of the

CEA-specific sdAbs are homologous to human IGHV3

subgroup genes (C3, 79% homology to IGHV3-23;

C17, 68% homology to IGHV3-74; C25, 69% homol-

ogy to IGHV3-48; C43, 69% homology to IGHV3-13).

The most divergent sequences between the four llama

sdAbs and human IGHV3 are localized in the CDRs,

Fig. 5. Epitope analysis by flow cytometry. CEA-expressing cells were preincubated with a large excess of untagged sdAb C17 (competitor).

Subsaturating concentrations (30–70 nM) of Gold mAbs or c-myc tagged C17 and C43 were then added to the mix. After washing, bound

Gold mAbs or c-myc tagged sdAbs were detected by flow cytometry. Solid black histograms, isotype control. Solid gray histograms indicate

the absence of competitor. Black lines indicate the presence of competitor.



and in the former VL and CH1 interfaces (residues 40,

42, 49, 50 and residues 15 and 96, respectively). More-

over, the selected llama sdAbs belong to subfamily

VHH2 [15]. As described earlier for VHH belonging to

this family, CDR3 from these four sdAbs do not con-

tain an additional disulfide bond and do not exceed

the mean CDR3 length of classical VH, in contrast to

most camel VHH [18].

Of note is that that none of these antibodies binds

to one of the Gold epitopes. These essentially nonover-

lapping epitopes have been defined by analyzing the

binding specificities of 52 monoclonal anti-CEA IgGs

and define five antigenic regions recognized by murine

mAbs [17]. In this study, the only four mAbs not bind-

ing to these five regions were directed against carbo-

hydrate epitopes, suggesting that the rest of the CEA

surface does not elicit antibodies. Epitope analysis

performed on recombinant sCEA using SPR or on

the surface of living cells demonstrated that the sdAbs

target overlapping epitopes and might even share a

unique epitope, because it could be anticipated by the

high degree of homology of their CDRs. Interestingly,

this is not one of the Gold epitopes because no compe-

tition was observed between Gold mAbs and the

sdAbs, as demonstrated both by SPR on soluble CEA

and flow cytometry experiments on cell-displayed

CEA. This new epitope, not found on NCA, is there-

fore not easily detected by murine mAbs. This finding

supports a previous study showing that sdAbs have a

tendency to bind to epitopes usually invisible to other

mAbs, such as cavities, and are a rich source of

enzyme inhibitors [19]. In the case of CEA, a heavily

glycosylated molecule, one can also hypothesize that

the oligosaccharide chains can hinder the access of

some regions of the polypeptide to large molecules

such as mAbs (150 kDa) but not to very compact

sdAb (13 kDa). However, it should be reminded that

the sdAbs were selected as phage–sdAbs, which implies

that the large phage particle did not prevent binding

of the sdAbs to this epitope.

IC50 values calculated from cell-surface competition

experiments and KD values measured by SPR are in

the nm range for sdAbs C17, C3 and C43, demonstrat-

ing that these sdAbs, selected against a recombinant

ectodomain of CEA can efficiently bind their antigen

when displayed at the cell surface of human tumor

cells. The high affinities of the selected sdAbs, which

compares favorably with conventional mAbs despite

their monovalency, should allow an efficient in vivo

targeting of tumor cells expressing CEA. To verify this

hypothesis, we conducted an in vivo localization experi-

ment in LS174T-xenografted nude mice with sdAb

C17, which binds to CEA with the highest affinity as

measured by SPR. Blood clearance of this sdAb was

fast because low blood radioactivity was observed as

early as 6 h after injection. This result is in agreement

with the sdAb blood half-life that has been estimated

to be 20–40 min in mice [20,21]. Despite this rapid

blood clearance and the monovalent nature of the

sdAb excluding an avidity effect, almost 2% of the

injected dose accumulates in tumor tissues (fivefold

higher than in muscle tissues), which compares well

with the results of Cortez-Retamozo et al. [22]. These

authors injected LS174T-xenografted mice with a

CEA-specific sdAb fused to beta-lactamase and 2.8%

of the total injected dose was found in the tumor 6 h

after injection, despite a blood half-life expected to be

significantly higher for this 45 kDa construct than for

sdAb C17 (13 kDa). In this study, 3 h after injection,

7% IDÆg)1 were found in kidneys, which decreased to

5% at 6 h post injection. This renal accumulation

is expected for very small molecules such as sdAbs

(13-15 kDa). Ultrafiltration of low molecular mass

proteins and subsequent uptake by proximal tubular

cells followed by lysosomal degradation leads to the

intracellular accumulation of radioactivity. It is

Fig. 6. Biodistribution of sdAb against CEA C17 injected in xeno-

grafted mice. Nude mice subcutaneously xenografted with tumor

cells LS174T were injected in the tail vein with 10 pmol of 125I-

labeled sdAb C17. After 3 h (black bars) and 6 h (open bars), mice

were anesthetized and killed. Blood, organs and tumor masses

were weighed and the radioactivity counted. Results are expressed

as the ratio between tumor uptake and organ uptake (mean ± -

SEM, n = 3). Injected doses were corrected by subtraction of non-

injected and subcutaneously injected material. Bl, blood; Lu, lung;

Li, liver; Sp, spleen; Si, small intestine; Co, colon; Ki, kidney; Mu,

muscle; Bo, bone.



expected that systemic administration of basic amino

acids may reduce renal retention of radioiodinated

sdAbs because it is efficient in lowering kidney uptake

of antibody fragments [22a]. The low activity accre-

tion observed in other organs led to tumor-to-organ

radioactivity uptake ratios of at least 2 (range 2–5) 3 h

after injection and 3 (range 3–9) at 6 h after injection.

Overall, sdAb C17 showed an expected biodistribu-

tion profile, demonstrating its utility as a CEA+

tumor-targeting molecule.

In conclusion, the specificity, affinity and single-

domain structure of the new CEA-specific sdAbs

isolated here make them very attractive candidates to

build, together with sdAbs targeting receptors such as

CD16 (FccRIII) [23] or other activating receptors or

radiolabeled haptens [4], new multivalent and ⁄ormultispecific molecules with superior characteristics for

immunotherapy or radioimmunotherapy.

Material and methods

Llama immunization

A young adult male llama (Lama glama) was immunized

subcutaneously at days 1, 30, 60, 90 and 120 with 250 lgrecombinant human soluble CEA extracellular domain

(sCEA) produced as previously described [24]. Sera were

collected 15 days prior to each injection to follow the

immune response against the immunogen.

VHH library construction

Blood samples (100 mL) were taken 15 days after each of the

three latest immunizations and peripheral blood mononu-

clear cells were isolated by Ficoll-Histopaque-1077 (Sigma-

Aldrich, St. Louis, MO, USA) discontinuous gradient

centrifugation. Total RNA was isolated by acid guanidinium

thiocyanate ⁄ phenol ⁄ chloroform extraction [25] and synthesis

of the cDNA was performed with Superscript II reverse

transcriptase (GibcoBRL, Gaithersburg, MD, USA) using

primer CH2FORTA4 [26]. A first PCR was performed using

an equimolar mixture of four backward primers originally

designed to anneal on human VH genes (5¢ VH1–Sfi:

5¢-CATGCCATGACTCGCGGCCCAGCCGGCCATGGC

CCAGGTGCAGCTGGTGCAGTCTGG-3¢; 5¢ VH2–Sfi:


CCAGGTCACCTTGAAGGAGTCTGG-3¢; 5¢ VH3–Sfi:


CGAGGTGCAGCTGGTGGAGTCTGG-3¢; 5¢ VH4–Sfi:


CCAGGTGCAGCTGCAGGAGTCGGG-3¢) and one for-

ward primer (CH2FORTA4). These primers allow the ampli-

fication of two bands corresponding two the VH + CH1 +

hinge + part of CH2 gene fragment of traditional antibodies

or the VHH + hinge + part of CH2 gene fragment of

HcAbs. Using the gel-purified (Qiaquick gel extraction kit;

Qiagen, Hilden, Germany) lower band as the template, VHH

genes were re-amplified using an equimolar mixture of the

four backward primers (5¢ VH1 to 4-Sfi) and 3¢ VHH–Not

primer (5¢-CCACGATTCTGCGGCCGCTGAGGAGACR

GTGACCTGGGTCC-3¢) containing SfiI and NotI restric-

tion enzyme sites. Resulting VHH fragments were purified

from 1% agarose gel, digested with SfiI and NotI and ligated

into pHEN1 phagemid [27] digested with SfiI and NotI. The

ligated material was transformed into TG1 E. coli electro-

poration-competent cells (Stratagen, Miami, FL, USA). Cells

were plated on 2YT ⁄ ampicillin (100 lgÆmL)1) ⁄ glucose (2%)

agar plates. Colonies (106) were scraped from the plates with

2YT ⁄ ampicillin (100 lgÆmL)1) ⁄ glucose (2%), and stored at

)80 �C in the presence of 20% glycerol. Because llamas were

hyperimmunized, a library containing a million of different

clone can be considered as representative.

Selection of phage–sdAbs

Selections were performed as described previously [28].

Briefly, 10 lL of the library was grown in 50 mL of

2YT ⁄ ampicillin (100 lgÆmL)1) ⁄ glucose (2%) at 37 �C to

an D600 of 0.5. Five milliliters of the culture were then

infected with 2 · 1010 M13KO7 helper phage for 30 min

at 37 �C without shaking. The culture was centrifuged for

10 min at 3000 g. The bacterial pellet was resuspended

in 25 mL of 2YT ⁄ ampicillin (100 lgÆmL)1) ⁄kanamycine

(25 lgÆmL)1), and incubated for 16 h at 30 �C with

shaking (270 rpm). The culture was then centrifuged for

20 min at 3000 g and one-fifth of the volume of 20%

PEG 6000, 2.5 m NaCl was added to the supernatant and

incubated for 1 h on ice to precipitate phage particles.

The solution was then centrifuged for 15 min at 3000 g at

4�C and the phage-containing pellet was re-suspended with

1 mL of NaCl ⁄Pi.

Phage were selected using either immunotubes coated with

recombinant sCEA [24] (10 lgÆmL)1 in NaCl ⁄Pi, overnight

4 �C) or biotinylated sCEA and streptavidin-coated para-

magnetic beads (Dynabeads M-280; Dynal Biotech, Oslo,

Norway). Recombinant sCEA was biotinylated using a bio-

tin protein-labeling kit according to the manufacturer’s

instructions (Roche, Basel, Switzerland). Two hundreds

microliters of beads were mixed with 1 mL NaCl ⁄Pi contain-

ing 2% skimmed milk powder (NaCl ⁄Pi ⁄ 2% milk) for

45 min at room temperature in a siliconized Eppendorf tube.

Beads were washed with NaCl ⁄Pi ⁄ 2% milk using a magnetic

particle concentrator and resuspended with 250 lLNaCl ⁄Pi ⁄ 2% milk. We added 200 lL of biotinylated sCEA

and the solution was gently rotated for 30 min at room tem-

perature; 150, 75 and 25 nm of biotinylated sCEA were used

for the first, second and third rounds of selection, respec-

tively. We then added 450 lL of the phage preparation

(1012 pfu), preincubated for 1 h in 500 lL NaCl ⁄Pi ⁄ 2% milk.



The mixture was rotated for 3 h at room temperature and

washed five times with 800 lL NaCl ⁄Pi ⁄ 4% milk, five times

with 800 lL NaCl ⁄Pi containing 0.1% Tween and five times

with 800 lL NaCl ⁄Pi. Every five washes, the mixture was

transferred to a new siliconized tube. Phage fixed on sCEA-

coated beads were resuspended with 200 lL NaCl ⁄Pi and

incubated without shaking with 1 mL of log-phase TG1 cells

and plated on 2YT ⁄ ampicillin (100 lgÆmL)1) ⁄ glucose (2%)

in 243 · 243 mm dishes (Nalgene Nunc, Roskilde, Den-

mark). Some isolated colonies were grown overnight in mi-

crotiter plate containing 200 lL 2YT ⁄ ampicillin

(100 lgÆmL)1) ⁄ glucose (2%) and stored at )80 �C after the

addition of 15% glycerol (masterplates). The remaining colo-

nies were harvested from the plates, suspended in 2 mL

2YT ⁄ ampicillin (100 lgÆmL)1) ⁄ glucose (2%) and used for

phage production for the next round of selection.

ELISA screening of phage–sdAb

A 96-well plate replicator was used to replicate the mas-

terplates in 120 lL of fresh broth. Colonies were grown

for 2 h at 37 �C under shaking (400 rpm) and 35 lL2YT ⁄ ampicillin (100 lgÆmL)1) ⁄ glucose (2%) containing

2 · 109 M13KO7 helper phage were added to each well

and incubated for 30 min at 37 �C without shaking. The

plate was centrifuged for 10 min at 1200 g and the bacte-

rial pellet was suspended in 150 lL 2YT ⁄ ampicillin

(100 lgÆmL)1) ⁄ kanamycine (25 lgÆmL)1) and grown for

16 h at 30 �C under shaking (400 rpm). Phage-containing

supernatants were tested for binding to sCEA by ELISA.

Briefly, biotinylated sCEA (5 lgÆmL)1) was coated on

streptavidin 96-well microplates (BioBind assembly strepta-

vidin coated; Thermo Fischer Scientific, Waltham, MA,

USA) saturated with NaCl ⁄Pi ⁄ 2% milk. Fifty microliters

of phage supernatant were added to 50 lL NaCl ⁄Pi ⁄ 4%milk and incubated for 2 h at room temperature in the

ELISA microplate. Bound phage were detected with a per-

oxidase-conjugated monoclonal anti-M13 mouse IgG (GE

Healthcare, Munich, Germany). Reading was performed

at A405. DNA of positive phage (A405 three times above

the blank) was sequenced using abi prism� bigdye�Terminators (Applied Biosystems, Foster City, CA, USA).

SdAb production and purification

Selected clones were sequenced and amplified by PCR using

primers 5¢ pJF–VH3–Sfi (CTTTACTATTCTCACGGCCA

TGGCGGCCGAGGTGCAGCTGGTGG) and 3¢ c-myc–

6His ⁄HindIII (CCGCGCGCGC CAAGACCCAAGCTTG

GGCTARTGRTGRTGRTGRTGRTGTGCGGCCCCAT

TCAGATC) to add the HindIII site for further cloning, a

hexahistidine tag for purification and the c-myc tag for

detection. For production of clones without the c-myc tag,

the PCR amplification was performed using primers

5¢ pJF–VH3–Sfi and 3¢ 6His ⁄HindIII (CCGCGCGCGCC

AAGACCCAAGCTTGGGCTACTAGCTCCCGTGGTG

ATGGTGGTGATGTGAGGAGACAGTGACCTG).

PCR fragments were cloned into the pPelB55PhoA¢ [16]

vector between the SfiI and HindIII sites. E. coli K12 strain

TG1 was used to produce the sdAb-tagged fragments. An

inoculum was grown overnight at 30 �C in 2YT medium sup-

plemented with 100 lgÆmL)1 ampicillin and 2% glucose.

Four hundred milliliters of fresh medium were inoculated to

obtain an D600 of 0.1, and bacteria were grown at 30 �C to

an D600 of 0.5–0.7 and induced with 100 lm isopropyl thio-b-d-galactoside for 16 h. The cells were harvested by centrifu-

gation at 4200 g for 10 min at 4 �C. The cell pellet was

suspended in 4 mL of cold TES buffer (0.2 m Tris ⁄HCl, pH

8.0; 0.5 mm EDTA; 0.5 m sucrose), and 160 lL lysozyme

(10 mgÆmL)1 in TES buffer) was added. The cells were then

subjected to osmotic shock by the addition of 16 mL of cold

TES diluted 1 : 2 with cold H2O. After incubation for 30 min

on ice, the suspension was centrifuged at 4200 g for 40 min

at 4 �C. The supernatant was incubated with 150 lL DNase

I (10 mgÆmL)1) and MgCl2 (5 mm final) for 30 min at room

temperature. The solution was dialyzed against 50 mm

sodium acetate pH 7.0, 0.1 m NaCl, for 16 h at 4 �C. sdAbs

were purified by TALON metal-affinity chromatography

(Clontech, Mountain View, CA, USA) and concentrated by

ultrafiltration with Amicon Ultra 5000 MWCO (Millipore,

Billerica, MA, USA). The protein concentration was deter-

mined spectrophotometrically using a protein assay kit (Bio-

Rad Laboratories, Hercules, CA, USA).

Affinity measurements

Kinetic parameters were determined by real-time SPR

using a BIACORE 3000 apparatus. Monoclonal anti-c-

myc IgG 9E10 was covalently immobilized (3300 RU) on

a flow cell of CM5 sensor chip (Biacore AB, Uppsala,

Sweden) with EDC ⁄NHS activation according to the

manufacturer’s instructions. A control flow cell surface

was prepared with the same treatment but without anti-

body. All analyses were performed at 25 �C, at a flow

rate of 30 lgÆmL)1 and using HBS-EP (Biacore AB;

10 mm Hepes pH 7.4, 150 mm NaCl, 3.4 mm EDTA and

0.005% Biacore� surfactant) as running buffer. Each

sdAb was injected (90 lL) at a concentration of

50 lgÆmL)1 in HBS-EP over 3 min and followed by a

90 lL injection of sCEA at six different concentrations

(0.19–6.2 lgÆmL)1). A 400 s dissociation step was applied

before a pulse of 5 mm HCl to regenerate the flow cell

surfaces between each run. The absence of direct sCEA

binding to 9E10 was assessed. The control sensorgram

obtained by injection of sdAb only on the 9E10 flow cell

was subtracted from all other sensorgrams to compensate

for sdAb dissociation from 9E10 mAb. Resulting senso-

grams were fitted to a Langmuir 1 : 1 binding isotherm

model and errors on ka and kd were calculated using

biaevaluation 3.2 software.



Immunofluorescence assays

The CEA-positive human colon carcinoma LS174T cell line

was obtained from the American Type Culture Collection

(Rockville, MD, USA). The murine colon carcinoma MC38

cells either transfected with human CEA (MC38–CEA cell

line) or with human NCA (MC38–NCA cell line) were

kindly provided by F.J. Primus (Vanderbilt University

Medical Center, Nashville, TN, USA) [29]. These cells were

cultured in Dulbecco’s modified Eagle’s medium (Gibco

Laboratories, Lyon, France) supplemented with 10%

heat-inactivated fetal bovine serum (Gibco Laboratories),

l-glutamine (300 lgÆmL)1), fungizone (0.25 lgÆmL)1), strep-

tomycin (100 lgÆmL)1), penicillin G (100 UnitsÆmL)1) and

geneticin (0.5 mgÆmL)1). These cells are adherent and grow

as monolayers at 37 �C in a humidified 5% CO2 incubator.

Immunofluorescence assays were performed by incubating

5 · 105 indicator cells with sdAbs (10 lgÆmL)1) for 30 min

on ice. sdAbs binding to MC38, MC38–CEA, MC38–NCA,

LS174T cell lines and human granulocytes were then

revealed by incubation with the monoclonal anti-c-myc

9E10 IgG (10 lgÆmL)1) followed by incubation with

fluorescein isothiocyanate (FITC)-labeled F(ab)¢2 goat

anti-mouse IgG (H+L) (FITC-GAM) antibodies (Jackson

ImmunoResearch Laboratories, West Grove, PA, USA).

Human granulocytes were purified as described previously

[30].

sdAb iodination

sdAb C17 (0.5 nmol in 50 lL NaCl ⁄Pi) was iodinated with

Na125I (18.5 MBq) using iodogen [31] for 20 min at 4 �C.Ten microliters of 1 mm dl-tyrosine pH 7.4 was added to

the solution and the mix was incubated for a further 5 min.

The iodinated antibody was purified by gel-permeation

chromatography on a PD 10 column (Sephadex G-25, GE

Healthcare, Waukesha, WI, USA).

Cell-binding experiments

Cell-binding experiments were performed on cells from the

LS174T colon carcinoma cell line (ATCC). We incubated

150 lL of 125I-labeled sdAb C17 (4 · 10)10m final concen-

tration, specific activity: 5 · 1017 cpmÆmol)1) with 100 lLof cell suspension (5 · 106 cellsÆmL)1 final) in binding med-

ium [modified Eagle’s medium with Earle’s salts (GIBCO-

Invitrogen-France), 0.2% BSA] in the presence of increas-

ing concentrations of unlabeled sdAb (100 lL in binding

medium). After 2.5 h under shaking, 100 lL of the suspen-

sions were centrifuged in triplicate for 30 s through a phth-

alate mixture [32]. An aliquot of supernatant and the cell

pellet from each tube were counted (three experiments,

each in triplicate). The non-specific binding was evaluated

in the presence of an excess of unlabelled sdAb C17

(2 · 10)7m).

IC50 values and statistics were calculated with graphpad

prism� (GraphPad Software, Inc. San Diego, CA, USA)

using a one-site competition nonlinear regression analysis.

Epitope mapping by SPR and flow cytometry

In a first set of experiments, epitope mapping of sdAbs and

Gold mAbs (B17, CE25, 35A7, B93, 192) [17] was carried

out by SPR at a flow rate of 20 lgÆmL)1. First, each sdAb

(50 lgÆmL)1) was injected on 9E10 mAb immobilized

(11 000 RU) on a CM5 sensorchip. Second, 60 lL of sCEA

antigen (25 lgÆmL)1) were injected and, third, one of the

Gold mAbs was injected (10 lgÆmL)1). An irrelevant sdAb

devoid of c-myc tag [anti-(HIV-1 NEF)] was also used as

negative control. As a competition control, the sdAb used

for CEA capture was produced without a c-myc tag and

tested for its ability to bind to the captured CEA. The

9E10-coupled surface was regenerated with 10 lL of 5 mm

HCl and the process was repeated to test the ability of each

Gold mAb to bind sCEA once this molecule had been

bound to a given sdAb. The absence of binding of the dif-

ferent Gold mAbs to the 9E10 mAb alone or to the sdAbs

in absence of sCEA, as well as the absence of binding of an

irrelevant antibody to the captured sCEA (mouse anti-

FccRIII) was verified.

The absence of competition between the sdAbs and

Gold mAbs for binding to CEA in its normal environ-

ment was also assessed by flow cytometry. Briefly, MC38–

CEA cells (5 · 105Æwell)1) were preincubated with various

concentrations (from 2 lm to 3 nm) of sdAb C17 (devoid

of c-myc tag) for 1 h on ice in NaCl ⁄Pi + 1% BSA.

Gold mAbs or sdAb C17 or sdAb C43 were then directly

added in the wells at subsaturating concentrations (30–

70 nm, determined in a previous experiment) and cells

were incubated on ice for an additional hour. After

washing, bound Gold mAbs were stained using FITC–

GAM (10 lgÆmL)1) and sdAb C17 (with c-myc tag) was

stained using mAb 9E10 (10 lgÆmL)1) followed by FITC–

GAM.

In vivo localization

All in vivo experiments were performed in compliance with

the French guidelines for experimental animal studies.

Female HSD athymic nude-Foxn1nu 8–9 weeks old (Har-

lan, Gannat, France) were engrafted by subcutaneous

injection of 2 · 106 LS174T human colorectal carcinoma

cells in the flank. Biodistribution studies were performed

13–15 days later. Mice were injected intravenously in the

tail vein with 125I-labeled sdAb C17 (10 pmol in 100 lLNaCl ⁄Pi 0.2% BSA) and killed at 3 and 6 h post injection.

Blood, organs and tumors were collected, the two latter

were weighted and radioactivity in the samples was deter-

mined. Injected doses were corrected for losses by subtrac-

tion of non-injected and subcutaneously injected material



(remaining in the animal tail) from the total dose. All stud-

ies were performed with groups of three mice. Results were

expressed as the mean percentage of injected dose per gram

of tissue ± SEM.

Acknowledgements

We would like to thank Martine Chartier, Jallane

Abdelhak and Sandra Mendes for their excellent

technical assistance, Sophie Siberil and Agnes Grou-

let for preliminary work. We are grateful to Dr J.

Barbet for fruitful discussions. We also thank Chris-

tiane and Bernard Guidicelli for generously providing

a llama for immunization. This work was supported

by CNRS, INSERM, the Association pour la

Recherche sur le Cancer (ARC), the Canceropole

Ile-de-France and by the GDR N�2352 CNRS

‘Tumor immuno-targeting’.

References

1 Hamers-Casterman C, Atarhouch T, Muyldermans S,

Robinson G, Hamers C, Songa EB, Bendahman N &

Hamers R (1993) Naturally occurring antibodies

devoid of light chains. Nature 363, 446–448.

2 Muyldermans S (2001) Single domain camel antibod-

ies: current status. J Biotechnol 74, 277–302.

3 Spinelli S, Frenken LG, Hermans P, Verrips T, Brown

K, Tegoni M & Cambillau C (2000) Camelid heavy-

chain variable domains provide efficient combining

sites to haptens. Biochemistry 39, 1217–1222.

4 Alvarez-Rueda N, Behar G, Ferre V, Pugniere M,

Roquet F, Gastinel L, Jacquot C, Aubry J, Baty D,

Barbet J et al. (2007) Generation of llama single-

domain antibodies against methotrexate, a prototypi-

cal hapten. Mol Immunol 44, 1680–1690.

5 Lauwereys M, Arbabi Ghahroudi M, Desmyter A,

Kinne J, Holzer W, De Genst E, Wyns L & Muylder-

mans S (1998) Potent enzyme inhibitors derived from

dromedary heavy-chain antibodies. EMBO J 17, 3512–

3520.

6 Pant N, Hultberg A, Zhao Y, Svensson L, Pan-Ham-

marstrom Q, Johansen K, Pouwels PH, Ruggeri FM,

Hermans P, Frenken L et al. (2006) Lactobacilli

expressing variable domain of llama heavy-chain anti-

body fragments (lactobodies) confer protection against

rotavirus-induced diarrhea. J Infect Dis 194, 1580–1588.

7 Frenken LG, van der Linden RH, Hermans PW, Bos

JW, Ruuls RC, de Geus B & Verrips CT (2000) Isola-

tion of antigen specific llama VHH antibody fragments

and their high level secretion by Saccharomyces cerevisi-

ae. J Biotechnol 78, 11–21.

8 Bazl MR, Rasaee MJ, Foruzandeh M, Rahimpour A,

Kiani J, Rahbarizadeh F, Alirezapour B & Moham-

madi M (2007) Production of chimeric recombinant

single domain antibody–green fluorescent fusion

protein in Chinese hamster ovary cells. Hybridoma

(Larchmt) 26, 1–9.

9 Ismaili A, Jalali-Javaran M, Rasaee MJ, Rahbarizadeh

F, Forouzandeh-Moghadam M & Memari HR (2007)

Production and characterization of anti-(mucin

MUC1) single-domain antibody in tobacco (Nicotiana

tabacum cultivar Xanthi). Biotechnol Appl Biochem 47,

11–19.

10 Dumoulin M, Conrath K, Van Meirhaeghe A, Meers-

man F, Heremans K, Frenken LG, Muyldermans S,

Wyns L & Matagne A (2002) Single-domain antibody

fragments with high conformational stability. Protein

Sci 11, 500–515.

11 Su C, Nguyen VK &Nei M (2002) Adaptive evolution

of variable region genes encoding an unusual type of

immunoglobulin in camelids.Mol Biol Evol 19, 205–

215.

12 Conrath KE, Lauwereys M, Galleni M, Matagne A,

Frere JM, Kinne J, Wyns L & Muyldermans S (2001)

Beta-lactamase inhibitors derived from single-domain

antibody fragments elicited in the camelidae. Antimic-

rob Agents Chemother 45, 2807–2812.

13 Gold P & Freedman SO (1965) Specific carcinoembry-

onic antigens of the human digestive system. J Exp

Med 122, 467–481.

14 Hammarstrom S (1999) The carcinoembryonic antigen

(CEA) family: structures, suggested functions and

expression in normal and malignant tissues. Semin

Cancer Biol 9, 67–81.

15 Harmsen MM, Ruuls RC, Nijman IJ, Niewold TA,

Frenken LG & de Geus B (2000) Llama heavy-chain

V regions consist of at least four distinct subfamilies

revealing novel sequence features. Mol Immunol 37,

579–590.

16 Le Calvez H, Green JM & Baty D (1996) Increased

efficiency of alkaline phosphatase production levels in

Escherichia coli using a degenerate PelB signal

sequence. Gene 170, 51–55.

17 Hammarstrom S, Shively JE, Paxton RJ, Beatty BG,

Larsson A, Ghosh R, Bormer O, Buchegger F, Mach

JP, Burtin P et al. (1989) Antigenic sites in carcino-

embryonic antigen. Cancer Res 49, 4852–4858.

18 Muyldermans S, Atarhouch T, Saldanha J, Barbosa

JA & Hamers R (1994) Sequence and structure of VH

domain from naturally occurring camel heavy chain

immunoglobulins lacking light chains. Protein Eng 7,

1129–1135.

19 De Genst E, Silence K, Decanniere K, Conrath K,

Loris R, Kinne J, Muyldermans S & Wyns L (2006)

Molecular basis for the preferential cleft recognition

by dromedary heavy-chain antibodies. Proc Natl Acad

Sci USA 103, 4586–4591.



20 Holliger P & Hudson PJ (2005) Engineered antibody

fragments and the rise of single domains. Nat Biotech-

nol 23, 1126–1136.

21 Coppieters K, Dreier T, Silence K, de Haard H,

Lauwereys M, Casteels P, Beirnaert E, Jonckheere

H, Van de Wiele C, Staelens L et al. (2006) Format-

ted anti-tumor necrosis factor alpha VHH proteins

derived from camelids show superior potency and

targeting to inflamed joints in a murine model of

collagen-induced arthritis. Arthritis Rheum 54, 1856–

1866.

22 Cortez-Retamozo V, Backmann N, Senter PD, Wer-

nery U, De Baetselier P, Muyldermans S & Revets H

(2004) Efficient cancer therapy with a nanobody-based

conjugate. Cancer Res 64, 2853–2857.

22a Behr TM, Goldenberg DM & Becker W (1998) Redu-

cing the renal uptake of radiolabeled antibody frag-

ments and peptides for diagnosis and therapy: present

status, future prospects and limitations. Eur J Nucl

Med 25, 201–212.

23 Behar G, Siberil S, Groulet A, Chames P, Pugniere M,

Boix C, Sautes-Fridman C, Teillaud JL & Baty D

(2008) Isolation and characterization of anti-Fc-

{gamma}RIII (CD16) llama single-domain antibodies

that activate natural killer cells. Protein Eng Des Sel

21, 1–10.

24 Terskikh A, Mach JP & Pelegrin A (1993) Marked

increase in the secretion of a fully antigenic recombi-

nant carcinoembryonic antigen obtained by deletion of

its hydrophobic tail. Mol Immunol 30, 921–927.

25 Chomczynski P & Sacchi N (1987) Single-step

method of RNA isolation by acid guanidinium thio-

cyanate–phenol–chloroform extraction. Anal Biochem

162, 156–159.

26 Arbabi Ghahroudi M, Desmyter A, Wyns L, Hamers

R & Muyldermans S (1997) Selection and identifica-

tion of single domain antibody fragments from camel

heavy-chain antibodies. FEBS Lett 414, 521–526.

27 Hoogenboom HR, Griffiths AD, Johnson KS, Chi-

swell DJ, Hudson P & Winter G (1991) Multi-subunit

proteins on the surface of filamentous phage: method-

ologies for displaying antibody (Fab) heavy and light

chains. Nucleic Acids Res 19, 4133–4137.

28 Chames P, Hoogenboom HR & Henderikx P (2002)

Selection of antibodies against biotinylated antigens.

Methods Mol Biol 178, 147–157.

29 Mizobata S, Tompkins K, Simpson JF, Shyr Y &

Primus FJ (2000) Induction of cytotoxic T cells and

their antitumor activity in mice transgenic for carcino-

embryonic antigen. Cancer Immunol Immunother 49,

285–295.

30 Vely F, Gruel N, Moncuit J, Cochet O, Rouard H,

Dare S, Galon J, Sautes C, Fridman WH & Teillaud

JL (1997) A new set of monoclonal antibodies against

human Fc gamma RII (CD32) and Fc gamma RIII

(CD16): characterization and use in various assays.

Hybridoma 16, 519–528.

31 Salacinski PR, McLean C, Sykes JE, Clement-Jones

VV & Lowry PJ (1981) Iodination of proteins, glyco-

proteins, and peptides using a solid-phase oxidizing

agent, 1,3,4,6-tetrachloro-3 alpha, 6 alpha-diphenyl

glycoluril (Iodogen). Anal Biochem 117, 136–146.

32 Dower SK & Segal DM (1981) C1q binding to anti-

body-coated cells: predictions from a simple multiva-

lent binding model. Mol Immunol 18, 823–829.

33 Lefranc MP (2003) IMGT, the international

ImMunoGeneTics database. Nucleic Acids Res 31,

307–310.



Llama single-domain antibodies directed against nonconventional epitope of tumor

Documents

Transcript of Llama single-domain antibodies directed against nonconventional epitope of tumor