Experimental Parasitology 126 (2010) 135–145

Contents lists available at ScienceDirect

Experimental Parasitology

journal homepage: www.elsevier .com/locate /yexpr

Leishmania major: Disruption of signal peptidase type I and its consequenceson survival, growth and infectivity

Tahereh Taheri a,b, Ali-Hatef Salmanian b, Elham Gholami a, Fatemeh Doustdari a, Farnaz Zahedifard a,Sima Rafati a,*

a Molecular Immunology and Vaccine Research Lab, Pasteur Institute of Iran, Tehran, Iranb National Institute of Genetic Engineering and Biotechnology, Tehran, Iran

a r t i c l e i n f o

Article history:Received 15 November 2009Received in revised form 9 April 2010Accepted 14 April 2010Available online 22 April 2010

Keywords:Signal peptidase type ILeishmania majorHomologous recombinationGene disruption

0014-4894/$ - see front matter � 2010 Elsevier Inc. Adoi:10.1016/j.exppara.2010.04.009

* Corresponding author. Fax: +98 21 66465132.E-mail addresses: s_rafati@yahoo.com, sima-rafatis

a b s t r a c t

Leishmania major (L. major) signal peptidase type I (SPase I) is an endopeptidase encoded by a single-copygene. In all organisms, SPase I is responsible for removing the signal peptide from secretory pre-proteinsand releasing mature proteins to cellular or extra-cellular space. In this study, the role of SPase I in L.major is investigated by gene deletion using homologous recombination (HR). The null mutant of SPaseI was not possible to create, suggesting that SPase I is an essential gene for parasite survival.

The obtained heterozygote mutant by disrupting one allele of SPase I in L. major showed significantlyreduced level of infectivity in bone marrow-derived macrophages. In addition, the heterozygote mutantsare unable to cause cutaneous lesion in susceptible BALB/c mice. This is the first report showing thatSPase I may have an important role in Leishmania infectivity, e.g. in differentiation and survival ofamastigotes. Apparently, the SPase I expression is not essential for in vitro growth of the parasite.

� 2010 Elsevier Inc. All rights reserved.

1. Introduction

Parasites of the genus Leishmania are intracellular protozoawhich are transmitted to mammalian host by the bite of infectingsand flies and causing the disease known as leishmaniasis. It is amajor public health problem in many countries including Iran(Noazin et al., 2008). According to WHO/TDR report, leishmaniasisis one of the three most important infectious diseases which ur-gently need an effective vaccine or proper treatment with reason-able cost and less side effects (Remme et al., 2002). In sand fly, theparasites are in promastigote form having slender shape with sin-gle flagella. After transmission to mammalian host and engulfingby macrophages, the parasites are transformed and multiplied inacidic parasitophorous vacuoles as round-shaped amastigoteswithout flagella. Despite trying different vaccination strategies,no vaccine is now available against this disease. Since there aremany genes with currently unknown functions in Leishmania, iden-tifying essential genes involved in biosynthesis and metabolic pro-cesses could be helpful for finding an effective vaccine ortreatments against this disease.

Since 1990, functional analysis of several genes in Leishmaniahave been accomplished by reverse genetic tools (Clayton, 1999).Several reports have shown that some of these genes act as essen-tial elements in different aspects such as growth, survival, differen-

ll rights reserved.

y@pasteur.ac.ir (S. Rafati).

tiation and infectivity of other cells such as macrophages. In L.mexicana, cysteine proteinases (Denise et al., 2006; Reithingeret al., 2007; Williams et al., 2006), cdc2-related kinase (CRK1)(Mottram et al., 1996a), GDP-mannose pyrophosphorylase(GDPMP) (Garami and Ilg, 2001), thymidine kinase (Thiel et al.,2008) and mitogen-activated protein (MAP) kinase (Bengs et al.,2005; Erdmann et al., 2006; Morales et al., 2007; Wiese, 1998),in L. major, dihydrofolate reductase thymidylate synthetase(DHFR/TS) (Cruz et al., 1991, 1993), lipophosphoglycan (LPG)(Spath et al., 2003; Uzonna et al., 2004), thymidine kinase (Thielet al., 2008) and leishmanolysin (gp63) (Denise et al., 2006; Joshiet al., 1998), in L. donovani, typanothione reductase (Tovar et al.,1998), centrin (Selvapandiyan et al., 2004, 2001), ornithine decar-boxylase (Jiang et al., 1999) and A2 (Zhang and Matlashewski,1997) have been reported as essential genes. Majority of thesegenes have unknown function in these parasites.

In the present study, the role of signal peptidase type I (SPase I)gene in survival, growth and infectivity of L. major is evaluated bydisrupting the gene through homologous recombination (HR). Inall living cells, the majority of secretory proteins are synthesizedas pre-proteins with an extra 15–30-amino acid sequence namedsignal peptide (SP) (Dalbey et al., 1997; Paetzel et al., 2002). Duringor after translocation, SP is cleaved off by SPase I that is located onthe luminal side of cytoplasmic membrane of prokaryotes or endo-plasmic reticulum (ER) membrane in eukaryotes (Caulfield et al.,1989) and mature proteins are released to their final destinationin cellular or extra-cellular space. SPases I are highly conserved

136 T. Taheri et al. / Experimental Parasitology 126 (2010) 135–145

among different organisms from bacteria to higher eukaryotes(Paetzel et al., 2000) and the higher degree of conservation hasbeen shown in five domains of amino acid sequence (Paetzelet al., 2000, 2002). Type I SPase is a membrane-bound endopepti-dase and is responsible for processing of non-lipoproteins (Paetzelet al., 2002). Most bacteria have a single-copy of SPase I gene that isessential for cell viability (Paetzel et al., 2000, 2002). Due to essen-tial function of SPase I and accessibility of its active site on the out-er membrane leaflet, this enzyme is noted as an interesting targetfor a novel antibacterial drug (Paetzel et al., 2000).

Little is known about the function of SPase I in eukaryotes but inprokaryotes this enzyme plays a key role to cleave the signal pep-tide and subsequent folding of the mature protein into its activeform (Paetzel et al., 2000, 2002). SPase I in eukaryotic cells formsa protein complex named signal peptidase complex (SPC) (Paetzelet al., 2002). In yeast, SPC contains four polypeptides that two ofthem are essential for cell viability (De La Rosa et al., 2004). Adefective signal peptide in human coagulation factor X, inhibitthe cleavage reaction by SPase for exporting the protein from thecell (Dalbey et al., 1997). In bacteria, inhibition of SPase I leads tothe intracellular accumulation of pre-proteins in the cell mem-brane and cell death (Paetzel et al., 2000) or incorrect localizationor degradation of the mature protein. In bacteria, virulence factorswhich are secreted into extra-cellular space or attached to the cellsurface, are important elements for uptake and multiplication inhost (Bonnemain et al., 2004; Lammertyn et al., 2004). It has beenshown that in Listeria monocytogenes, regulation of SPase I expres-sion control the production of virulence factors (Raynaud andCharbit, 2005).

Recently, we have identified the SPase I gene in both L. major(Lmjsp, Genebank accession number AY129954) and L. infantum(Linsp, Genebank accession number AY129955) (Rafati et al.,2004). It is as a single-copy gene and the nucleotide sequence anal-ysis showed similarity with other eukaryotic and prokaryotic SPas-es I (Rafati et al., 2004). At the amino acid level, L. major SPase Ishares high identity with SPase I of Escherichia coli. Sequence align-ment indicated that the highest similarities belong to five con-served regions denoted as A–E which are present in all knowntype I SPases (Rafati et al., 2004). There is no data available to showthe role of this gene in Leishmania species. Our previous studieshave shown the immunogenic potential of SPase I by measuringthe humoral responses of cutaneous and visceral leishmaniasiscases against recombinant SPase I (rSP) (Rafati et al., 2004). Also,we demonstrated that different vaccination regimen using SPaseI induces parasite-specific Th1 response and elicits partial protec-tion against L. major infectious challenge (Rafati et al., 2006). Re-cently, SPase I has been identified in Plasmodium falciparum as anintron-less and a single-copy gene (Sharma et al., 2005). The detec-tion of SPase I is new in parasite and needs to be explored by study-ing different roles of this gene and its relation with vital elementsin parasite life that are required for intracellular survival. The aimof present study is to investigate the role of SPase I in different as-pects such as survival, growth and infectivity of L. major.

2. Materials and methods

2.1. Parasite

L. major Friedlin strain MHOM/IL/81 was used in all experi-ments. The parasites were isolated from footpad lesions of infectedBALB/c mice and routinely cultivated in M199 media (Sigma,Germany) supplemented with 10% heat-inactivated fetal calf ser-um (HI-FCS, Gibco, UK), 40 mM HEPES, 2 mM L-glutamine,0.1 mM adenosine, 0.5 lg/ml hemin and 50 lg/ml gentamicin (allfrom Sigma, Germany) at 26 �C. After 2–3 passages, log-phase

promastigotes were used for transfection. For in vitro bone mar-row-derived macrophage infectivity assay as well as in vivo infec-tion, stationary-phase promastigotes were used.

2.2. Construction of replacement vectors

We used two vectors for gene replacement in Leishmania, pX63-NEO and pX63-HYG which contain resistance gene to neomycin,and hygromycin B, respectively (both vectors were kindly providedby Dr. Stephen M. Beverley, Harvard Medical School, Boston, USA).The 50 (50F) and the 30 flanking (30F) regions of the Lmjsp wereamplified by PCR from L. major genomic DNA using specific primerscontaining XhoI and BglII restriction site (underlined), respectively,as indicated: Forward 50F (50FF): 50-AGAAGCGACGACTCGAGGCC-30,Reverse 50F (50FR): 50-CCCTCTCGAGTTCTTCACGGGA-30, Forward 30F(30FF): 50-TGCTAGATCTTTGCTGGGAGTGAATGGATATGTG-30, Re-verse 30F (30FR): 50-GGTTAGATCTACTTCGCCCGAATCGAGGTTCT-30.The amplification program for 50F segment was: 95 �C, 5 min;59 �C, 2 min; 72 �C, 3 min for one cycle, followed by 25 cycles of95 �C, 1 min; 59 �C, 2 min; 72 �C, 1 min, and an extension at 72 �Cfor 15 min. Similar amplification program was used for 30 flankingregion except the annealing temperature increased to 63 �C.

PCR products were separated on 0.8% agarose gels, purifiedusing the QIAquick Gel extraction kit (Qiagen, Germany), and con-firmed by sequencing. 50F was digested with XhoI and ligated intoXhoI site of both linerized vectors. Then purified 30F was digestedwith BglII and cloned into pX63–50F-NEO and pX63–50F-HYG inthe same site. The obtained two recombinant plasmids namedpX63–50F-NEO-30F and pX63–50F-HYG-30F have antibiotic-resis-tance genes located between 50F and 30F regions of SPase I thatare required for double crossover homologous recombination.The presence and correct orientation of both inserted fragmentswere confirmed by restriction enzyme mapping and overlappedsequencing.

A DNA fragment from recombinant plasmids containing theantibiotic-resistance gene (Neomycin and Hygromycin B) flankedby 50 and 30F sequences was used for transfection. Both vectorswere digested with KpnI and SalI to produce the linear replace-ment fragments (50F-NEO-30F and 50F-HYG-30F, termed NEOr andHYGr cassettes). The fragments were purified from the gel (PCRclean-up system, Promega, USA) before electroporation.

2.3. Cell culture and parasite transfection

Mid-log-phase wild-type (WT) promastigotes were harvestedby centrifugation (3000 rpm, 10 min, 4 �C), washed 2 times inPBS (8 mM Na2HPO4, 1.75 mM KH2PO4, 0.25 mM KCl, 137 mMNaCl; pH 7.2) and resuspended in cold electroporation buffer(EPB: 21 mM HEPES, 137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4,6 mM glucose; pH 7.5) to a final density of 4.0 � 107 parasites/ml(Robinson and Beverley, 2003). Three hundred microliter of para-site suspension was mixed with 5–10 lg of linearized DNA in0.2 cm electroporation cuvette (Bio-Rad, USA) and stored on icefor 10 min, then electroporated once or twice at 450 V, 500 lFusing Bio-Rad Gene Pulser Ecell (USA) device. Electroporated cellswere kept in the liquid media in absence of antibiotic for 24 h priorto selection. To identify the resistant clones, transfected parasiteswere centrifuged (3000 rpm, 10 min, 4 �C) and plated ontosemi-solid M199 media containing 1% noble agar in presenceof 15 lg/ml G418 (Geneticin, Gibco, UK). Single isolated clones(Dspase::NEO/SPase) were cultured in liquid medium in presenceof 12.5 lg/ml G418. After the second round of transfection, bothof G418 and hygromycine B (Sigma, Germany) were used at12.5 lg/ml for homozygote clonal selection. In each experiment,wild-type parasites electroporated without DNA were used as neg-ative or mock control.

T. Taheri et al. / Experimental Parasitology 126 (2010) 135–145 137

To obtain growth rate, parasites were cultured in absence orpresence of different concentration of G418 or hygromycin B. Thenthe parasites were counted each 24 h by Neubauer hemocytometerwith microscope. Also, parasites were assay morphologically bymeasurement of its length with Nikon microscope E200, ACT-1software, Digital sight Camera.

2.4. Genotypes confirmation of mutant parasite

Genomic DNA isolated from log-phase promastigotes usingDNeasy Blood & Tissue kit (Qiagen, Germany). To check the pres-ence of neomycin-resistance gene in mutants and also to make aprobe, specific internal primers of neomycin-resistance gene wereused (Forward Neo: 50-TAGGATCCATCGGCCATTGAACA-30; ReverseNeo: 50-TTAAGCTTGCGATACCGTAAAGCA-30) (LeBowitz et al.,1990).

PCR and Southern blot analysis were performed to confirm thecorrect integration of the antibiotic-resistance gene into SPase Isite. For Southern blot analysis, genomic DNA from mutant parasiteand wild-type were digested with HindIII and BamHI and sepa-rated on a 0.8% agarose gel. DNA fragments were transferred ontoa positively charged nylon membrane (Roche, Germany). A NEOr

probe was generated by labeling the PCR product with digoxigenin(DIG) according to the instructions of the manufacturer (Roche,Germany). Hybridization and detection of signals were carriedout according to the standard method (Sambrook and Russell,2001).

Presence of antibiotic-resistance gene was confirmed by PCRand using specific primers forward and reverse Neo (as describedabove) in Dspase::NEO/SPase mutant and forward Hyg: 50-TAGGATCCATATGTCCTGCGGGTA-30 and reverse Hyg: 50-TTAAGCTTATGTTGGCGACCTCGT-30 primers in Dspase::HYG/SPase mutant.To confirm correct orientation of the integrated antibiotic resistantcassette by PCR, two set of primers were used. In the first set, bothforward (150F: 50-GGGTGTTGGCGAAAGGAAAGC-30) and reverse(130R: 50-GCACGAGCGGAATGTATCGG-30) primers anneal to se-quences outside of the targeted segment on the genome. In theother set, forward primer (130F:50AAAGAGCTCGACGCGAGTGCAG30) is designed for a sequence within the NEO/DHFR gene, whilethe reverse primer (130R) anneals outside of the targeted segment.

2.5. Detection of SPase I gene mRNA

Total RNA from log-phase parasites were isolated using RNeasyMini kit (Qiagen, Germany). The quality of the RNA samples wasassessed by denaturing agarose gel electrophoresis. cDNA was syn-thesized from 2 lg of total RNA using the Omniscript kit (Qiagen,Germany) with oligo-dT primers. The cDNA was PCR amplifiedwith specific primer of SPase I gene (Forward: 50-ATAAGATCTCCACCATGCGCGAGCACATTGACACGC-30; Reverse: 50-TATAGATCTTTACAGCTCCTGTGTGGAGGAC-30).

2.6. Western blot analysis of SPase I protein

Western blot was performed as described previously (Rafatiet al., 2004). Briefly, 106 wild-type or 6 � 106 mutant parasiteswere harvested by centrifugation (1500g, 10 min, 4 �C) and in lysisbuffer (140 mM NaCl, 1.5 mM MgCl2, 0.5% NP40 and 10 mM Tris–Cl; pH 8.6). The pellet of parasites and recombinant SPase I(200 ng/lane) separated by 15% SDS–PAGE and transferred to nitro-cellulose membrane (Protean, Schleicher & Schuell, Germany). Spe-cific polyclonal anti-SP antibody was raised in rabbit and used asfirst Ab at a 1:100 dilutions; horse radish peroxidase-conjugatedanti-rabbit IgG diluted at a1:2500 was used as second antibody.

2.7. In vitro studies using bone marrow-derived macrophage infection

Bone marrow cells were isolated from femurs of naïve BALB/cmice and grown in RPMI 1640 supplemented with 10% HI-FCS,10 mM HEPES, 2 mM L-glutamine and 50 lg/ml gentamicin, con-taining 30% supernatant from L929 cells, 1 mM Sodium Pyruvate(Invitrogen, USA) and 0.1% 2-mercapto-ethanol (Sigma, Germany).The cells were incubated at 37 �C for 7 days in order to have ahomogenous population of mature bone marrow-derivedmacrophages.

Then, cells were cultured at a density of 104 cells/well in com-plete RPMI medium 1640 and incubated at 37 �C in 5% CO2 for24 h to allow them to attach to the plate. In order to infect MQ,the stationary-phase L. major promastigotes from WT and threeclones of Dspase::NEO/SPase mutant were added at the ratio of10:1 (parasites to macrophages). To assure and increase the con-tact between parasites and macrophages, the plates were centri-fuged at moderate speed (900 rpm, 5 min, 4 �C). The cultureswere washed well (8 times) by PBS after 4 h of incubation in orderto exclude free parasites. Then they were cultivated for three days.Infected MQs were stained with Hoechst 33258 (Acros, USA) orDiff-Quick solution (Switzerland). In order to stain the nuclei ofboth macrophages and parasites in addition to kinetoplasts of par-asites, the macrophages attached to the coverslips were fixed at 6,24, 48 and 72 h post-infection with 4% paraformaldehyde andstained with 0.5 lg/ml Hoechst 33258 stain in Mowiol (Calbio-chem, Germany) followed by air drying.

Rapid staining with Diff-Quick solution was also performed atdifferent time courses post-infection. The coverslips were observedusing a light or Epi-fluoresence microscope (Nikon, Japan) withexcitation wavelength of 350 nm. Exactly 100 macrophages wereexamined in each coverslip and the percentage of infected macro-phages and the mean number of parasites per macrophages wasdetermined. All the experiments for each parasite sample wereperformed duplicate at different time points. The experimentswere also performed using the mouse macrophage cell line RAW264.7.

2.8. In vivo infection studies using susceptible BALB/c mice

In three independent experiments, each time ten BALB/c miceper group were infected subcutaneously in the hind footpad with2 � 106 or 3 � 107 stationary promastigotes of either wild-typeor Dspase::NEO/SPase mutant parasites. In two groups, lesion size(thickness and diameter) of infected and non-infected footpadwas measured using a metric caliper weekly.

Then, mice were sacrificed at different periods (2, 4 and 8 weekspost-infection) and tissues including spleen, lymph node and foot-pad were isolated from each group (two mice per group at eachspecific periods) and examined for presence of parasites by cultur-ing in M199 media supplemented with 10% HI-FCS.

2.9. Quantification of parasite by Real-time PCR

To confirm the presence and quantification of parasite, differenttissues such as spleen, lymph node and footpad were isolated frommice infected with mutant or wild-type L. major parasite (two miceper group) at different time periods after infection. Genomic DNAfrom �10 mg of spleen or whole footpad was extracted with QIA-amp DNA mini kit (Qiagen, Germany). A real-time PCR reactionwas performed using 1 lg of the extracted genomic DNA, 5 pmolof RV1 (Forward: 50-CTTTTCTGGTCCCGCGGGTAGG-30) and RV2(Reverse: 50-CCACCTGGCCTATTTTACACCA-30) primers (Lachaudet al., 2002) and 12.5 ll Qiagen QuantiFast SYBR Green mastermix (Qiagen, Germany) in total volume of 25 ll with the followingamplification program: 95 �C for 10 min, 25 cycles of 95 �C for 15 s,

138 T. Taheri et al. / Experimental Parasitology 126 (2010) 135–145

60 �C for 20 s, and 72 �C for 40 s in an Applied Biosystem 7500 realtime system. Genomic DNA of wild-type L. major and normalmouse footpad were used as positive and negative controls, respec-tively. The wild-type genomic DNA was used in dilution seriescorresponding to 0.1–105 parasites to draw the standard curve.PCR reaction with primers specific for the antibiotic-resistancegene was also performed to confirm the presence of parasite intissue.

2.10. Statistical analysis

The data are presented as means ± SD. Statistical analysis be-tween two groups was determined by Student’s t-test using SPSSsoftware. Differences were considered significant when p < 0.05.

3. Results

3.1. Plasmid construction for replacement of Lmsp alleles

In contrast to prokaryotes, Leishmania is mostly diploid organ-ism (aneuploidy observed in some chromosomes) (Cruz et al.,1991, 1993; Gruber et al., 2008), so we have to use a two-stepstransfection strategy with two different antibiotic-resistancegenes, pX63-NEO and pX63-HYG. In both obtained recombinantvectors, pX63-50F-NEO-30F and pX63-50F-HYG-30F, each antibi-otic-resistance gene is flanked by the two flanking regions in directorientation of Lmjsp locus which allows replacement of the SPase Igene by HR. Fig. 1A shows enzymatic map of SPase I locus in wild-type and mutant parasites after gene replacement.

3.2. Generation of L. major mutant parasite

For the first round of transfection, wild-type parasites weretransfected with linearized 50F-NEO-30F (�5.1 kb). Eight colonieswere selected for further analysis and transferred to liquid mediacontaining 15 lg/ml G418 and kept under antibiotic-selectionpressure. To insure the presence of neomycin-resistance (NEOr)gene in mutant parasites, both PCR (data not shown) and Southerndot blot hybridization were done using a neomycin-resistance spe-cific probe, amplified from NEOr gene in pX63-NEO plasmid. As it isdemonstrated in Fig. 1B, presence of NEOr gene in genomic DNA ofthree of clones was confirmed in contrast to wild-type L. major.

In the first round of transfection, we expected that one allele ofSPase I was disrupted by NEO construct replacement using the 50F-NEO-30F cassette. To generate double mutants, 50F-HYG-30F frag-ment was used to target the second allele of SPase I. Three distinctheterozygote (Dspase::NEO/SPase) clones were chosen for secondround of transfection using the linearized HYG cassette (�5.2 kb).To find the homozygote clones, selection was performed onsemi-solid medium supplemented with both G418 and hygromy-cin B. Addition of both antibiotics was required to insure that thesecond allele of SPase I was replaced by hygromycin-resistancegene. However, despite of several attempts, colonies resistant toboth drugs were not obtained.

In the next step, Dspase::HYG/SPase mutants were obtained byelectroporating linearized 50F-HYG-30F fragment into wild-type L.major. Only six single clones were detected on the semi-solid platecontaining M199 and hygromycin B antibiotic. The presence ofhygromycin-resistance gene in genomic DNA of mutants was con-firmed by PCR (data not shown). But due to an unknown reason, inthree distinct experiments, they were unable to proliferate in theliquid media containing different concentration of hygromycin B.In contrast, the Dspase::NEO/SPase mutants multiplied in higherconcentration of G418 without any significant effect on parasitegrowth.

3.3. Genotypic analysis of mutant parasites for antibiotic geneintegration

In order to verify the complete SPase I ORF replacement by NEOr

gene through homologous recombination, we analyzed genomicDNA of Dspase::NEO/SPase mutants by Southern blot analysis andpart of neomycin-resistance gene used as probe.

After the first round of transfection, genomic DNA from wild-type and also several clones of Dspase::NEO/SPase mutants was di-gested with BamHI/HindIII and hybridized with the Dig-labeledNEOr probe (Fig. 1C). The obtained results showed that in contrastto wild-type genomic DNA, neomycin probe hybridized to a 4.8-kbfragment in all mutant parasites (Fig. 1C, lanes 2, 3 and 4). Accord-ing to the restriction map, presence of the 4.8-kb band only for het-erozygote genomic DNA confirms the integration of neomycincassette into the SPase I locus, as expected. Similar to Dot blot anal-ysis, there is no hybridization of NEOr probe with wild-type geno-mic DNA (Fig. 1C, lane 5).

Replacement of one allele of SPase I in both types of mutant,Dspase::NEO/SPase and Dspase::HYG/SPase, was verified further byPCR using different primer sets as described in Section 2. The firstset (130F and 130R) is designed in a way that makes the amplifica-tion possible only when HR is occurred. The 2.2-kb amplicon is ob-served in heterozygotes (Fig. 1D, lanes 2 and 3 present Dspase::NEO/SPase mutant and Dspase::HYG/SPase, respectively) as expected butwild-type genomic has no specific amplified band (Fig. 1D, lane 4).

Antibiotic specific integration was confirmed by second primerset using primers 150F and 130R. Fig. 1E shows 5.5-kb ampliconrepresenting NEOr (Fig. 1E, lane 2), HYGr integration (Fig. 1E, lane3) and a positive band of 3.5-kb in wild-type (Fig. 1E, lane 4). Ex-pected size of PCR products indicates that one allele of SPase I genewas replaced by the fragment containing NEOr gene.

3.4. Morphological features of the mutant parasites

Light microscopy analysis shows that Dspase::NEO/SPase het-erozygote mutants are different in shape and size in compare tothe wild-type parasites. Majority of promastigotes have a roundshape body with short flagellum. In spit of its morphologicalchanges, there is no effect on promastigote multiplication. Mostof the Dspase::NEO/SPase heterozygote promastigotes have a sizerange from 1.75 to 4 lm and an average length of 2.6 ± 0.45 lm,while wild-type parasites have a size range from 4.40 to 12 lmand an average length of 6.48 ± 1.2 lm. Fig. 2A shows wild-typeand mutant parasites. The size of wild-type and mutant promastig-otes was measured and compared daily. During 5 days, size ofwild-type parasites increased as expected, but decreased in thecase of mutants (Fig. 2B). At 5th day in the culture media, majorityof wild-type parasites had lengths from 5 to 8 lm, whereas about70% of mutant parasites had lengths from 2 to 3 lm (Fig. 2C). In alltested clones, normal shape and size of mutants were not recov-ered even after long term incubation without antibiotic pressure(data not shown).

3.5. Antibiotic resistance in heterozygote mutant parasites

The heterozygote Dspase::NEO/SPase mutant parasites weretested for their sensitivity to different concentration of G418 rang-ing from 10 to 30 lg/ml. Different mutant clones and wild-typeparasite with defined count (�2 � 106 parasites) were cultured inliquid media with different concentrations of G418 or withoutantibiotic. The viable parasites were counted daily up to 4 days.Fig. 2D indicates that wild-type L. major is very sensitive even tolowest concentration of G418 (10 lg/ml). It is worth mentioningthat wild-type strain is able to persist in the presence of drug upto two days and then the number of live parasites decreased

A

B C

D E

1 2 3 4 5

1-Wild-type

3-Δspase::HYG/SPase

2-Δspase::NEO/SPase

5’F SPase 3’F

3588 bp

HindIII 130R150F

HindIII

2218 bp

5409 bp

4836 bp

150F 130R5’F DHFR/NEO 3’F

BamHI130F

Probe

2224 bp

5565 bp

150F 130R5’F DHFR/HYG 3’F

130F

Fig. 1. (A) Schematic representation of the wild-type SPase I locus before and after HR. (1) The SPase I genomic locus in wild-type L. major. (2) The SPase I gene locus replacedby either NEOr (2) or HYGr (3) through HR in Dspase::NEO/SPase and Dspase::HYG/SPase mutants, respectively. The restriction enzyme sites, location of primers and expectedsize of PCR fragments are shown under each map. (B) Dot Southern blot analysis of Dspase::NEO/SPase mutant parasites. In upper section, the dot blot of three clones including1, 2 and 3 of mutant parasites are shown. The wild-type and no DNA as negative controls are demonstrated in lower section. (C) Southern blot analysis of genomic DNA.Genomic DNA derived from L. major wild-type and three clones (1, 2 and 3) of Dspase::NEO/SPase mutant parasite were digested with BamHI and Hind III and hybridized withNEOr gene as probe. Lane 1 is the DNA molecular weight marker. Lanes 2–4 are, three distinct Dspase::NEO/SPase mutants. Lane 5 is L. major wild-type parasite as control.Similarly, five other clones have same pattern as clones 1, 2 and 3 using NEOr gene as probe (data not shown). (D and E) Confirmation of HR by PCR analysis of mutantparasites: in Fig. D, two clones were tested using similar primers denoted as 130F and 130R. Lanes 2 and 3 represent the expected band of �2.2 kb in both Dspase::NEO/SPaseand Dspase::HYG/SPase mutant parasites but not in the wild-type as shown in lane 4. Lane 1 is molecular marker of DNA. In Fig. E the homologous recombination has beenconfirmed by primers denoted as 150F and 130R. In lanes 2 and 3, the �5.5 kb amplified fragment confirmed the presence of the antibiotic casset in expected site in bothDspase::NEO/SPase and Dspase::HYG/SPase mutant parasites. Lane 4 represents a �3.5 kb DNA wild-type parasite.

T. Taheri et al. / Experimental Parasitology 126 (2010) 135–145 139

dramatically. In contrast, in spite of increasing G418 antibiotic con-centration up to 30 lg/ml, there is no changes or decreases in thegrowth of mutant parasites. To analyze the stability of neomycin-resistance gene, different mutant clones were grown for at least30 passages in absence of the drug. PCR analysis with neomycin-specific primers showed that neomycin-resistance gene was main-tained after several passages in the presence or absence of G418(Fig. 2F). In this figure, lanes 2–8 represent the PCR reaction withNEOr specific primers of seven different mutant clones which dem-onstrate the stability of NEOr gene in several generations, in con-trast to wild-type that had no amplification (lane 9). Comparisonof the sensitivity of the Dspase::NEO/SPase heterozygote mutantsand wild-type parasites to G418 reflects the incorporation of the

NEOr genes into the SPase I locus. Moreover, the growth rate of mu-tants did not undergo any change in higher concentration of G418,indicating the expression and stability of neomycin-resistancegene in genome.

In the case of Dspase::HYG/SPase mutants, even at the presenceof very low concentration of hygromycin B (3 lg/ml) there is noparasite growth as it is shown in Fig. 2E. Similar to wild-type strain,the mutant parasites could not grow in the presence of higher con-centration of hygromycin B (12 lg/ml). It is worth mentioning thatthe Dspase::HYG/SPase mutants were able to grow on semi-solidmedia containing hygromycin B (12.5 lg/ml), but they could notgrowth in liquid media containing similar amount of antibioticdue to unknown reason.

Size of parasite (μm)1-2 2.1-3 3.1-4 4.1-5 5.1-6 6.1-7 7.1-8 8.1-9 9.1-10 10-11 11-12

Num

ber

of p

aras

ite (

%)

0

10

20

30

40

50

60

70

spase::NEO/SPaseWild-type

Days0 1 2 3 4 5 6

Size

of

para

site

(μ m

)

1

2

3

4

5

6

7

8

9

spase::NEO/SPaseWild-type

Num

ber

of p

aras

ite (

x106 )

0

10

20

30

40

50

601 day 2 day 3 day 4 day

No 10 20 30

Antibiotic (μg/ml)

Wild-type spase::NEO/SPase

No 10 20 30Antibiotic (μg/ml)

A

B

D E

F 1 2 3 4 5 6 7 8 9 10

500 bp

Δ spase::NEO/SPaseWild-typea b

Num

ber

of p

aras

ite (

x106

)

0

10

20

30

40

501 day 2 day 3 day 4 day

Wild-type spase::HY G/SPase

No 3 6 12

Antibiotic (μg/ml)

No 3 6 12

Antibiotic (μg/ml)

C

Fig. 2. Morphology comparison between wild-type and heterozygote mutant parasites. (A) The differences in size and flagella length between wild-type and Dspase::NEO/SPase mutant parasites using light microscopic. The mutant parasites are smaller (mean ± SD) than wild-type strain (mean ± SD). (B) The differences in size during five days ofcultivation. Size of both wild-type and Dspase::NEO/SPase mutant parasite were measured every day. The size of wild-type increased as expected but, in the case of mutantparasite, it is almost constant with slightly decreased during the last two days of cultivation. (C) Presents the size distribution in wild-type and mutant parasites. Microscopicobservation show that more than 60% of Dspase::NEO/SPase mutant parasites have about 2–3 lm in length and a size range from 1.75 to 4 lm with an average length of2.6 ± 0.45 lm; while wild-type have the size range between 4.40 and 12 lm and an average length of 6.48 ± 1.2 lm. (D) The parasites growth in the presence of differentconcentration of antibiotic. Growth of Dspase::NEO/SPase mutant parasites in the presence or absence of various concentrations of G418 which indicates the capacity ofmutant parasites to be alive in the presence of higher concentration of G418. (E) The growth comparison of Dspase::HYG/SPase mutant and wild-type parasites in the presenceor absence of different concentrations of hygromycin B. Parasites show an unexpected growth decrease even at low concentrations of the antibiotics. The data revealedunexpected growth decrease of the mutant parasites at the presence of the lowest level of antibiotics. The data shows means ± SD of 4 different mutant clones as well as wild-type (data are shown in duplicate). (F) The stability of the Dspase::NEO/SPase mutants in medium without G418 after long periods of cultivation (30 passages). A �550 bpbands in lanes 2–8 confirmed the presence of NEOr gene in different mutants clones and lanes 9 and 10 show the absence of this gene in wild-type parasite as well as notemplate used as control. DNA size marker is shown in lane 1. The PCR performed using NEOr forward and reverse primers (named as forward and reverse Neo) as described inSection 2.

140 T. Taheri et al. / Experimental Parasitology 126 (2010) 135–145

T. Taheri et al. / Experimental Parasitology 126 (2010) 135–145 141

3.6. Gene expression of SPase I in wild-type and Dspase::NEO/SPasemutant parasites

Expression of SPase I was studied by RT-PCR and Western blotanalysis. cDNA from wild-type and mutant strains were used inRT-PCR reaction with SPase-specific primers. As it is shown inFig. 3A, the amplification of a �550 bp band in cDNA of heterozy-gote mutant promastigotes as well as wild-type L. major confirmedthe presence of SPase I and its expression in both strains asexpected.

To confirm that SPase I gene is expressed as protein product inthe heterozygote mutant as well as wild-type L. major as a control,Western blot analysis were performed using cell lysates frompromastigotes. As it is shown in Fig. 3B, anti-SPase was able to rec-ognize the 20 kDa protein band corresponding to SPase in bothheterozygote mutant and wild-type parasites. Recombinant SPase(rSPase) was used as a control. The 16 kDa protein in rSPase wasdetected by anti-SPase (Rafati et al., 2004). The obtained data isconsistent with RT-PCR of heterozygotes mutant.

3.7. Comparison of in vitro infectivity potential of Dspase::NEO/SPaseheterozygote and wild-type parasites

Bone marrow-derived macrophages isolated from healthy micewere used to analyze the effect of SPase I disruption on the infec-tivity potential and intracellular survival of L. major. The cells wereinfected with stationary-phase of Dspase::NEO/SPase heterozygotes(three clones) and wild-type strains of L. major. Stained infectedcells were examined by microscope and the cells were countedat four different time periods post-infection. In Hoechst stained in-fected cells, the parasite nuclei and kinetoplasts were distinctly ob-served by the Epi-fluoresence microscope as shown in Fig. 4A. As itcan be seen in Fig. 4B, at 6 h post-infection, the mutant parasiteswere able to bind and enter macrophages efficiently, albeit at alower level than WT parasites (85.33 ± 19.50 and 99.33 ± 1.15%,respectively). At this period, there is no significant difference inthe number of macrophages infected with WT and mutant para-sites. During the first 2 days after infection, the Dspase::NEO/SPasemutants were able to infect macrophages, but the total number ofinfected cells was lower in comparison with wild-type parasites(Fig. 4B). In fact, there were no significant differences in the per-centages of infected macrophages during 6, and 24 h post-infection(p > 0.05). Interestingly, the percentage of infected macrophageswith mutant parasites decreased dramatically at 72 h after infec-tion (7.33 ± 1.5% versus 75 ± 7.01%, p < 0.001). Our data showedthat heterozygote parasites are capable of intra macrophage sur-

1 2 3 4

500

1 2 3

20 kDa 16 kDa

A B

Fig. 3. Expression analysis of SPase I in Dspase::NEO/SPase heterozygote mutant andwild-type parasites. (A) The RT-PCR analysis using cDNA of wild-type (lane 2) andmutant parasites (lane 3) with SPase I specific primers. The amplified 550 bp bandindicates mRNA SPase I expression in both strains. Lane 2 is wild-type L. major andlane 3 is the heterozygote mutant L. major. In lane 4, PCR reaction was done withRNA template as a negative control to detect any possible DNA contamination. Lane1 shows molecular size marker. (B) SPase I expression in parasites as determined byWestern blot analysis. Lysates from both Dspase::NEO/SPase mutant parasites (lane1) and wild-type (lane 2) were separated on 15% SDS–PAGE and transferred ontothe membrane. The SPase I was detected using polyclonal anti-rabbit SPaseantiserum as a �20-kDa protein. Lane 1 is a heterozygote Dspase::NEO/SPase mutantand lane 2 is the wild-type L. major (both revealed a 20 kDa band); lane 3 is thepurified recombinant SPase I (16 kDa).

vival up to 48 h after infection, but the percentage of infected mac-rophages declined rapidly by 72 h after infection (Fig. 4B).

The total number of parasites per 100 macrophages was alsorecorded during different time courses. As it is indicated inFig. 4C, the parasite count was significantly lower in mutants incomparison with WT at 6 h after infection (657.66 ± 130.8 and1324 ± 392.09, respectively). The difference between the mutantparasite counts and the WT was more pronounced at 72 h afterinfection (12 ± 1.41 versus 344 ± 24.04, P < 0.05). It is worthmentioning that total number of parasites inside MQs declineddifferently in both cases. In the case of WT parasite, at 6 h post-infection the total number was 1324 ± 392.09 and at the end ofexperiment (72 h) was 344 ± 24.04 (decline rate is 3.6). Consistentwith this result, WT of L. major LV39 showed decreasing in per-centage of cells infected and number of amastigotes within during3 days post-infection (Zhang et al., 2009). However in the mutantparasites, the decline rate is 60 (total number at 6 h is657.66 ± 130.8 and at 72 h is 12 ± 1.41). Therefore, this data sug-gested that most of the mutant parasites were unable to survive in-side the MQs and were eliminated 16� faster than WT parasites(Fig. 4C).

We also obtained similar level of infectivity with RAW 264.7cell line and peritoneal macrophages (data not shown). It seemsthat the lack of one allele of SPase I has direct influence on parasiteloads in macrophages. This result suggests that SPase I may have animportant role in L. major survival as well as its replication withinMQ.

3.8. Comparison of in vivo infectivity potential of Dspase::NEO/SPaseheterozygote mutant and wild-type parasites

To corroborate the results obtained in bone-marrow-derivedmacrophages, we examined the ability of heterozygote mutantpromastigotes to cause infection in susceptible BALB/c mice. Twogroups of BALB/c mice were infected with either Dspase::NEO/SPase mutant or wild-type parasites. Mice infected with wild-typeL. major started to develop lesions after 4–5 weeks as expectedand footpad swelling increased dramatically. In contrast, the mu-tant parasites failed to induce detectable cutaneous lesions inthe footpads of infected mice even after six months post-infection(Fig. 5A). In order to recover the virulent parasites, stationary-phase parasites were injected subcutaneously into footpad ofBALB/c mice. At different time points (2, 4 and 8 weeks), the in-fected spleens and lymph nodes were cultured in complete mediawith or without any antibiotic, but no live and motile parasiteswere detected. We could not isolate any parasite from the injec-tion sites (footpad) and no swelling or inflammation was observedin footpad infected with mutant parasites. For more detailed anal-ysis, Real-time PCR was performed at 2 and 8 weeks post-infectionusing spleen and footpad of mice and no parasite was detected(data not shown).

In addition, we tried to quantify and compare the number ofparasites in footpads at 48 h intervals in days 1 to 12 post-infec-tion. Genomic DNA from two groups of mice was extracted fromfootpads to perform parasite burden quantification by Real-timePCR as shown in Fig. 5B. Differences between the two groups weresignificant at different time periods under study (p < 0.05). The to-tal number of parasites in wild-type infected mice stayed almostconstant in contrast to mutant infected mice which showed a grad-ual decrease at the end of the second week.

4. Discussion

Signal peptidase type I (SPase I) in L. major strain Friedlin belongsto serine peptidase, Clan SF, Family S26A, located in chromosome

A

B

C

B

Infected macrophage with wild-type

Infected macrophage with Δspase::NEO/SPase

Mice macrophage

1a

2b

1b 1c

2a 2c

6 24 48 720

50

100

150 WTspase::NEO/SPase

**

Hours after infection

Infe

cted

mac

hrop

hage

s (%

)

6 24 48 720

500

1000

1500

2000 WTspase::NEO/SPase

*

*

Hours after infection

Tot

alr

of a

mas

tigo

tes

per

100

MQ

Fig. 4. In vitro infection study of bone marrow-derived macrophages with Dspase::NEO/SPase mutants and wild-type parasites. (A) The BALB/c mice bone marrow-derivedmacrophages infected with wild-type and Dspase::NEO/SPase mutants. At different time period after infection cells were stained by Hoechst dye and the numbers ofkinetoplast or amastigotes were counted with fluorescence or light microscope with a 1000� magnification. Left column shows the naive macrophage, middle columnpresents macrophages infected with wild-type L. major and right column demonstrates the macrophages infected with Dspase::NEO/SPase mutant parasites. Upper row showsmacrophages 4 h after infection, and lower row represents macrophages stained with Hoechst dye after 24 h post-infection. (B) The percentage of bone marrow-derivedmacrophages infected with wild-type or three individual clones of Dspase::NEO/SPase mutant parasites. After 6, 24, 48 and 72 h, the macrophages were fixed and stained withHoechst dye. The total number of macrophages and infected macrophages were counted. Data were presented as the means ± SD. Similar results were obtained in anotherindependent experiment *p < 0.05. (C) The total number of parasites within 100 bone marrow-derived macrophage cells at different time after infection. The experimentswere performed in duplicate and data were presented as the means ± SD. Similar results were obtained in another independent experiment *p < 0.05.

142 T. Taheri et al. / Experimental Parasitology 126 (2010) 135–145

Lmjchr8, LmjF08.0450, 543 bp (www.genedb.org) and encoded aprotein with 180 amino acids. Leishmania type I SPase likesother bacteria and eukaryotic, is a transmembrane protein and hasfive conserved domains named as A–E possessing specific function.Domain A with hydrophobic amino acids residing in the membrane-spanning regions of SP, domain B is likely positioned near themembrane surface and may involve in catalysis. There is a conservedRGD motif in domain C and domain E possess His-Arg sequencewhich are conserved in the mitochondrial SPase enzyme (Rafatiet al., 2004).

The purpose of this study was to evaluate the role of spase I ingrowth, differentiation and infectivity of L. major by gene disrup-tion. Due to essential role of SPase I, it seems that homozygousknockouts Leishmania is not able to survive. Considering thesefacts, our study could result in one of the two potential Leishmaniastrains. In the first case, a viable null mutant strain is obtained bycomplete gene replacement of the two alleles, which indicates thatSPase I is not an essential gene in Leishmania. In the other case,which seemed more likely, null mutants would not be viable, sug-gesting that SPase I is absolutely an essential gene.

1 day 3 day 5 day 7 day 9 day 12 day

Para

site

qua

ntity

(L

og)

1e-1

1e+0

1e+1

1e+2

1e+3

1e+4

1e+5

1e+6

1e+7

1e+8

spase::NEO/SPase Wild-type

A

B

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

0

5

10

15WT

spase::NEO/SPase

Weeks

Foot

pad

swel

ling

Fig. 5. (A) Footpad swelling of BALB/c mice after infecting with L. major stationary-phase promastigotes of wild-type and Dspase::NEO/SPase mutant. Monitoring offootpad was continued at least up to six month after infection. Animals whichreceived the WT parasites were sacrificed due to large lesion development. (B) Real-time PCR quantification of parasite load at different time periods after infectionGenomic DNA from footpad of infected mice was prepared every 2 days up to12 days post-infection. The conserved kinetoplastid minicircle Leishmania DNA wasamplified using RV1 and RV2 primers. As expected, the parasite load in miceinfected with wild-type was high during this period but in mice infected withDspase::NEO/SPase mutant parasites it gradually decreased. Reaction was carriedout as duplicate and error bars indicate the standard deviation of the mean.

T. Taheri et al. / Experimental Parasitology 126 (2010) 135–145 143

Here we demonstrated that one of the two alleles of SPase I genein L. major was successfully removed, but so far we have not beenable to generate the null mutants despite several attempts, whichsupports the idea that SPase I seem to be an essential gene forLeishmania survival and growth.

In addition, our data indicated that hygromycin B (an aminogly-coside that inhibits mRNA translation) has toxic effect on growth ofDspase::HYG/SPase mutant L. major in liquid media. Similar obser-vation has been reported on Saccharomyces servisiae. It has beenshown that depletion of ubiquitin in mutant strain of S. servisiae re-sulted in hygromycin B sensitivity and over expression of ubiquitinrescue cell growth in the presence of hygromycin B (Hanna et al.,2003). Also, some mutants in yeast such as luv1, the resulted calci-neurin and vps mutants are highly sensitive to hygromycin B (Con-boy and Cyert, 2000).

In this study, we observed that the heterozygote mutant prom-astigotes had morphological differences in comparison to wild-type promastigotes. The Dspase::NEO/SPase mutants have unusualphenotype consisting of short (mean ± SD, 2.6 ± 0.45 versus6.48 ± 1.2) and round-shaped cell bodies. This is the first report

about effect of L. major SPase I on morphology and size so that dis-ruption of one allele of SPase I gene resulted in morphologicalchanges in promatigotes.

Differentiation of promastigote-to-amastigote is a vital eventfor survival of the organisms within the mammalian cells. Duringthis stage, parasites undergo a set of morphological and biochem-ical changes such as expression of some Leishmania stage-specificgenes (McKean et al., 2001; Sacks et al., 1990) in order to adaptto new environment (Rosenzweig et al., 2008). Some proteinsbelonging to metabolic pathways are essential for parasite survivalinside mammalian macrophages (Rosenzweig et al., 2008). Due tospecial living condition of amastigote form such as higher temper-ature (37 �C) and acidic environment (pH 5), the parasite under-goes up- and down-regulation of specific proteins which couldhelp their survival (Rosenzweig et al., 2008). In this study, weshowed that the obtained heterozygote mutants of L. major wereprobably unable to complete their life cycle, and consequentlywere not able to transform into amastigote form. It seems thatthe full activity of both alleles is required for L. major infectivity.Although it is a matter of speculation, but SPase I could have a rolein amastigote differentiation, proliferation, and infectivity of para-site directly or in combination with other proteins such as LPGwhich are well-known for their important role in Leishmania infec-tion (Kebaier et al., 2006). It has been shown that mutant prom-astigotes that lack LPG are delivered more quickly to lysosomesand are killed by macrophages (Spath et al., 2003) It is not yet clearwhich molecule(s) are essential for parasite survival inside themammalian macrophages and promastigote-to-amastigote transi-tion certainly involves ordered changes in protein expression.(Rosenzweig et al., 2008). Disruption of secretory virulence genesor its secretory pathway could create a major defect in parasite lifein the host cell such as macrophages.

Recently it has been reported that the activity of SPase I inP. falciparum is regulated by phosphorylation and Ca2+-dependentprotein kinase C. In addition, down-regulation of SPase by dsRNAalters the morphology of parasite and declines parasite growth(Tuteja et al., 2008). Furthermore, there are other reports on therole of protein kinases in L. mexicana which control the flagellalength through autophosphorylation (Wiese et al., 2003) and areinvolved in differentiation and proliferation of parasite (Erdmannet al., 2006). In L. mexicana, disruption of MAP kinase (LmxMKKand LmxMPK3 genes) causes a reduction in the flagella length (Erd-mann et al., 2006; Wiese et al., 2003). Also, deletion of the Thymi-dine kinase (tk) gene in L. major results in round-shaped cells, witha short flagellum and reduced cell size (Thiel et al., 2008). In Try-panosoma cruzi, LYT1 null mutant parasites generated by gene tar-geting show morphological abnormalities (Zago et al., 2008).

In spite of SPase I expression in heterozygote mutant parasites,they were unable to induce cutaneous lesions even six monthspost-infection in BALB/c mice. This data were consistent with ourobservation in in vitro cultured MQ. The results show that probablythe obtained Dspase::NEO/SPase mutants are unable to differentiatefrom promastigote to amastigote. Unfortunately, there are not en-ough tools to be used in order to know whether promastigotes ofmutant parasite undergoes transformation into amastigotes. It isknown that, when infections are initiated with promastigotes,these parasites transform within parasitophorous vacuoles (PVs)into amastigotes over a period of 24–72 h and express stage-spe-cific molecules that can serve as virulence factors. A notable exam-ple of a stage-specific virulence factor is the LPG molecule which isexpressed on the surface of the promastigote form, but is mini-mally expressed on the amastigote form (Ilgoutz and McConville,2001). LPG is strongly down-regulated in amastigotes. Anotherexample is A2 which is as an amastigote stage-specific gene familyand is up-regulated in amastigote (only in the case of L. donovaniand L. infantum but not in L. major). It is clear that each species

144 T. Taheri et al. / Experimental Parasitology 126 (2010) 135–145

of Leishmania have specific characteristic and this may influence onmacrophage infectivity and survival rate. As it is demonstrated, thenumber of infected macrophages in the case of mutants and WTparasites were almost similar at 6 h post-infection but the totalnumber of parasites per 100 macrophages was different. In addi-tion, the number of mutant parasites was gradually decreased dur-ing 48 h and eliminated rapidly 72 h after infection. Persistence ofintracellular parasite is directly related to the differentiation of thepromastigote to amastigote form. In L. donovani, promastigote toamastigotes differentiation occurs during 25–120 h post-infection(Myler and Fazel, 2008).

Although it needs further investigation, the lack of even one al-lele of SPase I could have influence on parasite infectivity in bothin vitro and in vivo conditions. Therefore, factors involved in thedifferentiation are associated, directly or indirectly, with the activ-ity of SPase I enzyme and has a critical role in amastigote persis-tency in MQ but not for parasite entry. Furthermore, this couldbe a convincing reason that the observed attenuation or loss ofinfectivity is not due to high passages during generation of mu-tants in our experiment.

It is important to mention that the reduction of SPase I expres-sion has little or no effect on promastigote growth. Although itneeds more investigation to find the exact reason, the impairedinfectivity of mutants could probably be a consequence of highersensitivity to complement-mediated lysis. Similar results has beenobtained about other genes such as cdc2-related kinase (crk1) thatis a single-copy gene in L. major and is essential for survival of par-asite as the generation of crk1 knockout was not possible (Mottramet al., 1996a). In addition, BALB/c mice infected with MAP kinasekinase (LmxMKK) null mutants showed delay in lesion develop-ment (Wiese et al., 2003). Furthermore, it has been shown thatL. donovani Centrin deletion leads to failure in cell division andcytokinesis in an eukaryotic cell but has no effect on the growthof the promastigote (Selvapandiyan et al., 2004). Although, itrequires further investigation but up to now it was not possibleto return normal morphology and infectivity by complementationassay using episomal copy of SPase I (data not shown).

It has been shown that E. coli has one SPase type I gene in itsgenome and the deduced enzyme is essential for processing of allsecretory proteins (van Roosmalen et al., 2004). But, in otherorganisms that have more than one copy of SPase I, such as Bacillussubtilis and Streptomyces lividans, none of them is essential by itself(van Roosmalen et al., 2004). The SipV and SipT double mutantstrains of B. subtilis show impairment in sporulation and cellgrowth (Stephenson et al., 2003). Removing of SipV revealed its rolein motility and inhibition from cell autolysis (Chu et al., 2002). Inthe case of archeal, SPase I is shown to be required for the flagella-tion (Bardy and Jarrell, 2003). In bacteria, virulence factors areeither secreted into the extra-cellular environment or attachedto the cell surface and help to entering the eukaryotic hosts(Lammertyn et al., 2004; Raynaud and Charbit, 2005). It has beenshown that in L. monocytogenes expression regulation of SPase Icontrols to produce its virulence factors (Bonnemain et al., 2004).

In addition, we could not recover avirulent mutant parasitesfrom different tissues of infected mice. Probably, one allele of SPaseI gene is sufficient for viability and replication of promastigotein vitro culture but not enough for in vivo survival and infectivity.Similar to our results, there are other reported genes such asL. mexicana null mutants of GDP-mannose pyrophosphorylase(GDPMP) gene which were not able to infect macrophages in cul-ture media and mice (Garami and Ilg, 2001). Similarly, down-reg-ulation of gp63, a surface zinc protease in promastigotes, withantisense RNA causes a reduction in parasite burden and delaysthe lesion development (Thiakaki et al., 2006). In contrast, it is re-ported that cysteine proteinase B, which acts as a virulence factor,is not required for in vitro growth and differentiation (Mottram

et al., 1996b). Another example is L. major Dlpg2 null mutant whichfailed to generate disease in vivo.

In conclusion, the obtained data showed for the first time thatL. major SPase type I is an essential gene for parasite, and has animportant role in survival of the parasite inside macrophages.SPase I is a key intermediate in the synthesis of secreted proteinsin cells of different species. However, further investigations areneeded to fully understand the underlying mechanisms.

Acknowledgments

We thank Dr. Ketty Soteriadou and Dr. Gerald Spaeth for theirhelpful advice. In addition the technical support by PascalePescher, Shima Safayian, Hiva Azizi and Shahram Alizadeh arehighly acknowledged. We also thank Amir Mizbani for Englishrevision of the paper. This work was financially supported byGrants from Pasture Institute of Iran (ID. No. 271) and WHO/TDR(ID No. A80229).

References

Bardy, S.L., Jarrell, K.F., 2003. Cleavage of preflagellins by an aspartic acid signalpeptidase is essential for flagellation in the archaeon Methanococcus voltae.Molecular Microbiology 50, 1339–1347.

Bengs, F., Scholz, A., Kuhn, D., Wiese, M., 2005. LmxMPK9, a mitogen-activatedprotein kinase homologue affects flagellar length in Leishmania mexicana.Molecular Microbiology 55, 1606–1615.

Bonnemain, C., Raynaud, C., Reglier-Poupet, H., Dubail, I., Frehel, C., et al., 2004.Differential roles of multiple signal peptidases in the virulence of Listeriamonocytogenes. Molecular Microbiology 51, 1251–1266.

Caulfield, M.P., Duong, L.T., Baker, R.K., Rosenblatt, M., Lively, M.O., 1989. Syntheticsubstrate for eukaryotic signal peptidase. Cleavage of a synthetic peptide analogof the precursor region of preproparathyroid hormone. The Journal of BiologicalChemistry 264, 15813–15817.

Chu, H.H., Hoang, V., Kreutzmann, P., Hofemeister, B., Melzer, M., Hofemeister, J.,2002. Identification and properties of type I-signal peptidases of Bacillusamyloliquefaciens. European Journal of Biochemistry 269, 458–469.

Clayton, C.E., 1999. Genetic manipulation of kinetoplastida. Parasitology Today 15,372–378.

Conboy, M.J., Cyert, M.S., 2000. Luv1p/Rki1p/Tcs3p/Vps54p, a yeast protein thatlocalizes to the late Golgi and early endosome, is required for normal vacuolarmorphology. Molecular Biology of the Cell 11, 2429–2443.

Cruz, A., Coburn, C.M., Beverley, S.M., 1991. Double targeted gene replacement forcreating null mutants. Proceedings of the National Academy of Sciences USA 88,7170–7174.

Cruz, A.K., Titus, R., Beverley, S.M., 1993. Plasticity in chromosome number andtesting of essential genes in Leishmania by targeting. Proceedings of theNational Academy of Sciences USA 90, 1599–1603.

Dalbey, R.E., Lively, M.O., Bron, S., van Dijl, J.M., 1997. The chemistry andenzymology of the type I signal peptidases. Protein Science 6, 1129–1138.

De La Rosa, J.M., Gonzalez, J.M., Gutierrez, F., Ruiz, T., Rodriguez, L., 2004.Characterization of Candida albicans orthologue of the Saccharomycescerevisiae signal-peptidase-subunit encoding gene SPC3. Yeast 21, 883–894.

Denise, H., Poot, J., Jimenez, M., Ambit, A., Herrmann, D.C., et al., 2006. Studies on theCPA cysteine peptidase in the Leishmania infantum genome strain JPCM5. BMCMolecular Biology 7, 42.

Erdmann, M., Scholz, A., Melzer, I.M., Schmetz, C., Wiese, M., 2006. Interactingprotein kinases involved in the regulation of flagellar length. Molecular Biologyof the Cell 17, 2035–2045.

Garami, A., Ilg, T., 2001. Disruption of mannose activation in Leishmania mexicana:GDP-mannose pyrophosphorylase is required for virulence, but not for viability.The EMBO Journal 20, 3657–3666.

Gruber, A., Durham, A.M., Huynh, C., del Portillo, H.A. (Eds.), 2008. Bioinformatics inTropical Disease Research: A Practical and Case-Study Approach. NationalLibrary of Medicine (US), NCBI, Bethesda, MD.

Hanna, J., Leggett, D.S., Finley, D., 2003. Ubiquitin depletion as a key mediator oftoxicity by translational inhibitors. Molecular and Cell Biology 23, 9251–9261.

Ilgoutz, S.C., McConville, M.J., 2001. Function and assembly of the Leishmaniasurface coat. International Journal for Parasitology 31, 899–908.

Jiang, Y., Roberts, S.C., Jardim, A., Carter, N.S., Shih, S., et al., 1999. Ornithinedecarboxylase gene deletion mutants of Leishmania donovani. The Journal ofBiological Chemistry 274, 3781–3788.

Joshi, P.B., Sacks, D.L., Modi, G., McMaster, W.R., 1998. Targeted gene deletion ofLeishmania major genes encoding developmental stage-specific leishmanolysin(GP63). Molecular Microbiology 27, 519–530.

Kebaier, C., Uzonna, J.E., Beverley, S.M., Scott, P., 2006. Immunization withpersistent attenuated Delta lpg2 Leishmania major parasites requires adjuvantto provide protective immunity in C57BL/6 mice. Infection and Immunity 74,777–780.

T. Taheri et al. / Experimental Parasitology 126 (2010) 135–145 145

Lachaud, L., Marchergui-Hammami, S., Chabbert, E., Dereure, J., Dedet, J.P., Bastien,P., 2002. Comparison of six PCR methods using peripheral blood for detection ofcanine visceral leishmaniasis. The Journal of Clinical Microbiology 40, 210–215.

Lammertyn, E., Van Mellaert, L., Meyen, E., Lebeau, I., De Buck, E., et al., 2004.Molecular and functional characterization of type I signal peptidase fromLegionella pneumophila. Microbiology 150, 1475–1483.

LeBowitz, J.H., Coburn, C.M., McMahon-Pratt, D., Beverley, S.M., 1990. Developmentof a stable Leishmania expression vector and application to the study of parasitesurface antigen genes. Proceedings of the National Academy of Sciences USA 87,9736–9740.

McKean, P.G., Denny, P.W., Knuepfer, E., Keen, J.K., Smith, D.F., 2001. Phenotypicchanges associated with deletion and overexpression of a stage-regulated genefamily in Leishmania. Cellular Microbiology 3, 511–523.

Morales, M.A., Renaud, O., Faigle, W., Shorte, S.L., Spath, G.F., 2007. Over-expressionof Leishmania major MAP kinases reveals stage-specific induction ofphosphotransferase activity. International Journal for Parasitology 37, 1187–1199.

Mottram, J.C., McCready, B.P., Brown, K.G., Grant, K.M., 1996a. Gene disruptionsindicate an essential function for the LmmCRK1 cdc2-related kinase ofLeishmania mexicana. Molecular Microbiology 22, 573–583.

Mottram, J.C., Souza, A.E., Hutchison, J.E., Carter, R., Frame, M.J., Coombs, G.H.,1996b. Evidence from disruption of the lmcpb gene array of Leishmaniamexicana that cysteine proteinases are virulence factors. Proceedings of theNational Academy of Sciences USA 93, 6008–6013.

Myler, P.J., Fasel, N., 2008. Leishmania: After the Genome. Caister Academic Press, p.306.

Noazin, S., Modabber, F., Khamesipour, A., Smith, P.G., Moulton, L.H., et al., 2008.First generation leishmaniasis vaccines: a review of field efficacy trials. Vaccine26, 6759–6767.

Paetzel, M., Dalbey, R.E., Strynadka, N.C., 2000. The structure and mechanism ofbacterial type I signal peptidases. A novel antibiotic target. PharmacologyTherapeutics 87, 27–49.

Paetzel, M., Karla, A., Strynadka, N.C., Dalbey, R.E., 2002. Signal peptidases. ChemicalReviews 102, 4549–4580.

Rafati, S., Ghaemimanesh, F., Zahedifard, F., 2006. Comparison of potentialprotection induced by three vaccination strategies (DNA/DNA, Protein/Proteinand DNA/Protein) against Leishmania major infection using Signal Peptidasetype I in BALB/c mice. Vaccine 24, 3290–3297.

Rafati, S., Salmanian, A.H., Taheri, T., Masina, S., Schaff, C., et al., 2004. Type I signalpeptidase from Leishmania is a target of the immune response in humancutaneous and visceral leishmaniasis. Molecular and Biochemical Parasitology135, 13–20.

Raynaud, C., Charbit, A., 2005. Regulation of expression of type I signal peptidases inListeria monocytogenes. Microbiology 151, 3769–3776.

Reithinger, R., Dujardin, J.C., Louzir, H., Pirmez, C., Alexander, B., Brooker, S., 2007.Cutaneous leishmaniasis. The Lancet Infectious Diseases 7, 581–596.

Remme, J.H., Blas, E., Chitsulo, L., Desjeux, P.M., Engers, H.D., et al., 2002. Strategicemphases for tropical diseases research: a TDR perspective. Trends inParasitology 18, 421–426.

Robinson, K.A., Beverley, S.M., 2003. Improvements in transfection efficiency andtests of RNA interference (RNAi) approaches in the protozoan parasiteLeishmania. Molecular and Biochemical Parasitology 128, 217–228.

Rosenzweig, D., Smith, D., Opperdoes, F., Stern, S., Olafson, R.W., Zilberstein, D.,2008. Retooling Leishmania metabolism: from sand fly gut to humanmacrophage. The FASEB Journal 22, 590–602.

Sacks, D.L., Brodin, T.N., Turco, S.J., 1990. Developmental modification of thelipophosphoglycan from Leishmania major promastigotes duringmetacyclogenesis. Molecular and Biochemical Parasitology 42, 225–233.

Sambrook, J., Russell, D., 2001. Molecular Cloning – A Laboratory Manual, third ed.Cold Spring Harbor Laboratory Press.

Selvapandiyan, A., Debrabant, A., Duncan, R., Muller, J., Salotra, P., et al., 2004.Centrin gene disruption impairs stage-specific basal body duplication and cellcycle progression in Leishmania. The Journal of Biological Chemistry 279,25703–25710.

Selvapandiyan, A., Duncan, R., Debrabant, A., Bertholet, S., Sreenivas, G., et al., 2001.Expression of a mutant form of Leishmania donovani centrin reduces the growthof the parasite. The Journal of Biological Chemistry 276, 43253–43261.

Sharma, S., Pradhan, A., Chauhan, V.S., Tuteja, R., 2005. Isolation andcharacterization of type I signal peptidase of different malaria parasites.Journal of Biomedicine and Biotechnology 2005, 301–309.

Spath, G.F., Garraway, L.A., Turco, S.J., Beverley, S.M., 2003. The role(s) oflipophosphoglycan (LPG) in the establishment of Leishmania major infectionsin mammalian hosts. Proceedings of the National Academy of Sciences USA 100,9536–9541.

Stephenson, S., Mueller, C., Jiang, M., Perego, M., 2003. Molecular analysis of Phrpeptide processing in Bacillus subtilis. Journal of Bacteriology 185, 4861–4871.

Thiakaki, M., Kolli, B., Chang, K.P., Soteriadou, K., 2006. Down-regulation of gp63level in Leishmania amazonensis promastigotes reduces their infectivity in BALB/c mice. Microbes and Infection 8, 1455–1463.

Thiel, M., Harder, S., Wiese, M., Kroemer, M., Bruchhaus, I., 2008. Involvement of aLeishmania thymidine kinase in flagellum formation, promastigote shape andgrowth as well as virulence. Molecular Biochemical Parasitology 158, 152–162.

Tovar, J., Wilkinson, S., Mottram, J.C., Fairlamb, A.H., 1998. Evidence thattrypanothione reductase is an essential enzyme in Leishmania by targetedreplacement of the tryA gene locus. Molecular Microbiology 29, 653–660.

Tuteja, R., Pradhan, A., Sharma, S., 2008. Plasmodium falciparum signal peptidase isregulated by phosphorylation and required for intra-erythrocytic growth.Molecular and Biochemical Parasitology 157, 137–147.

Uzonna, J.E., Spath, G.F., Beverley, S.M., Scott, P., 2004. Vaccination withphosphoglycan-deficient Leishmania major protects highly susceptible micefrom virulent challenge without inducing a strong Th1 response. Journal ofImmunology 172, 3793–3797.

van Roosmalen, M.L., Geukens, N., Jongbloed, J.D., Tjalsma, H., Dubois, J.Y., et al.,2004. Type I signal peptidases of Gram-positive bacteria. Biochimica etBiophysica Acta 1694, 279–297.

Wiese, M., 1998. A mitogen-activated protein (MAP) kinase homologue ofLeishmania mexicana is essential for parasite survival in the infected host. TheEMBO Journal 17, 2619–2628.

Wiese, M., Kuhn, D., Grunfelder, C.G., 2003. Protein kinase involved in flagellar-length control. Eukaryotic Cell 2, 769–777.

Williams, R.A., Tetley, L., Mottram, J.C., Coombs, G.H., 2006. Cysteine peptidases CPAand CPB are vital for autophagy and differentiation in Leishmania mexicana.Molecular Microbiology 61, 655–674.

Zago, M.P., Barrio, A.B., Cardozo, R.M., Duffy, T., Schijman, A.G., Basombrio, M.A.,2008. Impairment of infectivity and immunoprotective effect of a LYT1 nullmutant of Trypanosoma cruzi. Infection and Immunity 76, 443–451.

Zhang, W.W., Matlashewski, G., 1997. Loss of virulence in Leishmania donovanideficient in an amastigote-specific protein, A2. Proceedings of the NationalAcademy of Sciences USA 94, 8807–8811.