Isolation of Ty1-copia retrotransposon in myrtle genomeand development of S-SAP molecular marker

Pasqualina Woodrow • Giovanni Pontecorvo •

Loredana F. Ciarmiello

Received: 23 March 2011 / Accepted: 17 June 2011 / Published online: 2 July 2011

� Springer Science+Business Media B.V. 2011

Abstract Long terminal repeat (LTR)-retrotransposons

are mobile genetic elements that are ubiquitous in plants

and constitute a major portion of their nuclear genomes.

LTR- retrotransposons possess unique properties that make

them appropriate for investigating relationships between

populations, varieties and closely related species. Myrtus

communis L. is an evergreen shrub growing spontaneously

throughout the Mediterranean area. Accessions show sig-

nificant variations for agriculturally important traits, so the

development of specific molecular markers for conserva-

tion and characterization of myrtle germplasm is desirable

to conserve biodiversity. In this study, we isolated the first

retrotransposon Ty1-copia-like element (Tmc1) in Myrtus

communis L. genome and used this as a molecular marker.

We successfully employed the S-SAP marker system to

specifically characterize four myrtle accessions belonging

to different areas in the province of Caserta (Italy). The

high level of polymorphism detected in isolated LTRs,

make Tmc1 a good molecular marker for this species. Our

findings confirm that retrotransposon-based molecular

markers are particularly valuable tools for plant molecular

characterization studies.

Keywords Biodiversity assessment � LTRs � S-SAP �Ty1-copia retrotransposon

Introduction

Myrtle (Myrtus communis L.) is a diploid evergreen shrub

(2n = 22) belonging to the family of Myrtaceae. Myrtle is

one of the most important plants that grow spontaneously

throughout of the Mediterranean countries, including Tur-

key, Greece, Italy, Algeria, Tunisia, and Morocco [1]. In

Italy it grows along the coast and in the inner hills and it is

found especially on the islands, where it is one of the most

characteristic species.

This species is economically important for production of

essential oils from leaves and liqueur from fruits. Essential

oils are gaining remarkable interest for their potential

multipurpose use as antioxidant, antibacterial, and anti-

septic agents; the essential oil obtained from the leaves was

used in the past to treat lung disorders [2]. Since 2005, Italy

has developed a program of genetic improvement, which

allowed it to select over 40 cultivars.

Molecular markers have revolutionized the genetic

analysis of crop plants, where they play a vital role in

linkage analysis, physical mapping, quantitative trait locus

(QTL) analysis, marker-assisted selection and map-based

cloning. However, the usefulness of any given marker

system depends on the species under study and the chosen

application. Several DNA based markers have been

developed to detect polymorphisms [3, 4].

Over the last 15 years retrotransposon-based markers

have been developed for crop species and trees across the

plant kingdom, as well as for fungi and insects [5]. Ret-

rotransposons are ubiquitous in plant genomes [6–9]. They

are distributed as interspersed repetitive sequences

throughout the length of all host chromosomes [10]. Their

ubiquitous nature and their activity in creating genomic

diversity by stably integrating large DNA segments into

dispersed chromosomal loci make these elements ideal for

P. Woodrow � G. Pontecorvo (&)

Department of Life Science, II University of Naples,

Via Vivaldi, 43, 81100 Caserta, Italy

e-mail: giovanni.pontecorvo@unina2.it

L. F. Ciarmiello

C.R.A.-Fruit Tree Research Unit, Via Torrino, 3,

81100 Caserta, Italy

123

Mol Biol Rep (2012) 39:3409–3418

DOI 10.1007/s11033-011-1112-8

development as molecular markers. They are classified into

two major families, based on the presence or absence of

long-terminal repeats (LTRs) at the transposon ends [11].

Retrotransposons move to new chromosomal locations via

an RNA intermediate that is converted into extrachromo-

somal DNA by the encoded reverse transcriptase/RNaseH

enzymes prior to reinsertion into the genome. Integration

sites shared between germplasm accessions are highly

likely to have been present in their last common ancestor.

Therefore, retrotransposon insertional polymorphisms can

help establish pedigrees and phylogenies as well as serve as

biodiversity indicators.

As retrotransposition is thought to be more or less ran-

dom with respect to the region of insertion, insertions at

exactly the same location appear unlikely. Thus, as

opposed to reversible changes in DNA sequence compo-

sition, insertion events of retrotransposons have been

claimed to be homoplasy-free phylogenetic markers with

minimal noise from reversal or parallel events: species,

which share an insertion at a particular locus are grouped

together on the tree and all species that lack the insertion

are considered basal to this clade [5, 12].

In contrast, microsatellites, SNPs and methods relying

on gain or loss of restriction sites suffer from a lack of

temporal directionality in the changes they detect, resulting

in the problem of homoplasy [5]. Several systems for

identifying transposon insertion sites have been developed

[13].

The sequence-specific amplification polymorphism

(S-SAP) approach is the most popular transposon based

molecular marker method at the present time [3, 14, 15].

The S-SAP marker approach is similar to that of AFLPs

in that genomic DNA is digested with restriction enzymes,

enzyme-specific adapters are ligated to the restriction

products and the resulting fragments are PCR-amplified

[16]. The final step differs between the two approaches:

AFLP uses two different adapter specific primers carrying

selective bases to reduce the number of amplified marker

bands to a manageable level; S-SAP uses a single adapter-

specific primer, together with a transposon-specific, label-

led primer with selective base(s) on the 30-end [16].

Here we isolated the first partial retrotransposon Ty1-

copia in Myrtus communis L. and we successfully used it as

a molecular marker by employing of the S-SAP marker

system to specifically identify of four Myrtus communis L.

accessions.

Materials and methods

Genomic DNA extraction

Field collected young leaves were frozen in liquid nitrogen

until their use. Genomic DNA was isolated from four

Myrtus communis L. accessions belonging to distinct geo-

graphical areas of Caserta province (Italy): Caiazzo, Castel

Morrone, Castel Volturno and Durazzano. Extractions, in

triplicate, were performed using 1 g of fresh leaf tissues for

each plant, by the CTAB procedure of Doyle and Doyle

[17], and purified with the ICRISAT DNA extraction

procedure [18] to improve the DNA quality. DNA quality

and quantity were determined spectrophotometrically and

by electrophoresis on 1% agarose gel stained by ethidium

bromide [19].

Isolating, cloning and sequencing of RNaseH-LTR

fragments

To isolate RNaseH-LTR sequences, we used the Pearce

protocol [20]. Partially restricted DNA (EcoRI for 2 h) was

ligated to adaptors [Adat1-Adat2 (Table 1)] overnight at

4�C. From a 109 dilution of the restriction-ligation reac-

tion, 1 ll was taken as template for a 20 ll PCR, con-

taining 12.5 pmol RH primer, 12.5 pmol of EcoRI adaptor

primers (Table 1), 1.5 mM MgCl2, 200 lL dNTPs, 1U

of Hot-star Taq DNA Polymerase (Qiagen). Cycling

Table 1 S-SAP adaptors and primer sequences

Type Primer/adaptor name Sequence 50 ? 30

S-SAP retrotransposon primers (position in LTR sequence) Tmc1-LTR (663-683) GCCTGATAGATCGACACTAA

Tmc2-LTR (345-365) TTTGTGGTGACCACCGCGCC

S-SAP adaptors Double-stranded EcoRI adaptor Adat1 (P)-ATTCGAGGATAGGCTTTGGG

Adat2 CCCAAAGCCTATCCTCG

S-SAP adaptor primers (restriction site) EcoRI CCCAAAGCCTATCCTCGAATTC

EcoRI?C CCCAAAGCCTATCCTCGAATTCC

EcoRI?T CCCAAAGCCTATCCTCGAATTCT

EcoRI?A CCCAAAGCCTATCCTCGAATTCA

EcoRI?G CCCAAAGCCTATCCTCGAATTCG

3410 Mol Biol Rep (2012) 39:3409–3418

123

conditions were those specified by Pearce et al. [21], with

minor changes, consisting of a denaturation step at 95�C

for 15 min, followed by 30 cycles at 94�C for 1 min, 60�C

for 1 min, 72�C for 1 min, with a final extension of 10 min.

The amplified fragments were purified and cloned using

pGEM-T easy cloning Kit (Promega).

Cloning was performed by mixing 3 ll of amplified

product with 50 ng of pGEM-T Easy Vector, 3U T4 DNA

ligase, and 19 ligation buffer in 10 ll volume. The ligation

product was cleaned with sec-butanol and precipitated with

ethanol. The sample was resuspended in 10 ll of 0.59

Tris–EDTA and used to transform Escherichia coli cells.

Twelve positive clones were sequenced using ABI 377

automated DNA sequencer (Applied Biosystems).

DNA sequence analysis

Nucleotide sequences data were analyzed and compared to

the GenBank-NCBI databases using the BLAST network

service (http://www.ncbi.nlm.nih.gov/BLAST/) and CEN-

SOR software to find conserved domains in Repbase, a

database of repetitive elements (http://www.girinst.org/

censor) [22].

Multiple sequences alignments were performed using

AliBee—Multiple Alignment 2.0 (http://www.genebee.

msu.su/services/malign_reduced.html) with Clustal W

algorithm [23] from the DDBJ Homology Search system

(http://www.ddbj.nig.ac.jp).

Sequence-specific amplification polymorphisms

procedure (S-SAP)

The S-SAP procedure was performed as described by

Waugh et al. [24] with the following modifications. Total

genomic DNA (2 lg) of M. communis for each accession

(Castel Volturno, Castel Morrone, Durazzano, Caiazzo)

was digested with EcoRI restriction enzyme (20 U)

(Roche) for 2 h at 37�C in a final volume of 50 ll. The

digested DNA samples were incubated at 80�C for 20 min

to inactivate the restriction enzyme. For ligation, 10 ll of

the restriction reaction was added to a mixture containing

T4 DNA ligase (1U, Roche), 1 mM ATP in 10 mM Tris–

HCL (pH 7.5), 10 mM MgAc, 50 mM KAc, to which

40 pmol EcoRI phosphorylated adaptors were added

(Table 1). The reaction mix was incubated overnight at

4�C and then pre-amplified, using 12.5 pmol of LTR pri-

mer (Tmc1-LTR and Tmc2-LTR for Tmc1 and Tmc2 ret-

rotransposon, respectively) and EcoRI primer (without

selective nucleotide primers) complementary to the adap-

tor sequences (Table 1), in a final volume of 20 ll con-

taining 12.5 pmol of each primer, 1.5 mM MgCl2, 200

lL dNTPs, 1U of Hot-star Taq DNA Polymerase (Qia-

gen). The PCR conditions were as follows: denaturation

step at 95�C for 15 min, followed by 30 cycles at 94�C for

1 min, 60�C for 1 min, 72�C for 1 min, with a final

extension of 10 min. Selective amplification was per-

formed with primer pairs containing one of the selective

nucleotides on the adapter primers named EcoRI?A,

EcoRI?C, EcoRI?G, EcoRI?T in combination with

specific LTR primer (Tmc1-LTR and Tmc2-LTR, alterna-

tively) (Table 1). The amplified fragments were separated

on 6.5% denaturant polyacrylamide sequencing gels

(20 9 30 9 0.04 cm).

Samples were then run at 80 V for 18 h in 19 TBE

buffer and transferred to nylon membrane (Hybond-N?,

Amersham) under standard conditions. For filter hybrid-

izations, we used the Tmc1 fragment (only LTR sequence)

obtained by PCR amplification, purified by agarose gel

electrophoresis and Dig-labelled by random priming

(Roche). Hybridizations were carried out (25 ng/ml of

digoxigenin-labeled DNA) at 65�C overnight and visual-

ized by immuno-staining colorimetric. S-SAP analysis was

performed on three different biological samples for each

accessions and each performed in triplicate.

Polymorphic S-SAP bands were selected, excised from

gels using a razor blade and re-suspended in 100 ll of

water. DNA was eluted from the bands by boiling for

15 min, salt-precipitated and re-suspended in 10 ll of

sterile water. A 5 ll-sample was then used as DNA tem-

plate in PCR amplification using the S-SAP conditions

and primers described above. Amplification products

were separated on 1.5% agarose gels, eluted cloned and

sequenced.

The uniqueness of each polymorphic S-SAP band was

tested by PCR. Primers (sequence available upon request)

were designed on the flanking genomic regions of clones

sequenced. Direct PCRs were performed using flanking

sequence primers in combination with Tmc1-LTR primer.

In each case DNA providing the S-SAP band was tested

against other DNA accessions.

The uniqueness of Tmc1 insertion was indicated when a

PCR product was obtained only in DNA from the corre-

sponding accession. All new insertions were named as

follows: the letter indicates the type of accession

(CV = Castel Volturno, D = Durazzano, C = Caiazzo,

CM = Castel Morrone); the number identified polymor-

phic copies of S-SAP bands.

SNP-PCR strategy

For each investigated accession, one specific nucleotide

position in LTR-D1 and LTR-CV1 clones was tested. For-

ward primers harbouring the population-specific nucleotide

at the 30 end and reverse common primers for each popu-

lation were designed. Moreover, primer sequences for

internal control (control 1 and control 2, primers) were

Mol Biol Rep (2012) 39:3409–3418 3411

123

constructed on initial sequence of 30 LTR Tmc1. Melting

temperature (Tm) calculations were performed with Oligo

Calc: Oligonucleotide Properties Calculator server (http://

www.basic.northwestern.edu/biotools/oligocalc.html).

Based on the modified PCR protocol previously

described by Newton and colleagues [25], SNPs PCRs

were performed in a volume of 50 ll containing approxi-

mately 80 ng genomic DNA, 1.5 mM of each dNTP

(Roche), 1 lM of each primer and 1U of Taq DNA poly-

merase in 10 mM Tris/HCl pH 8.3, 2.5 mM MgCl2(Roche). Control 1 (50-GTTGGAGTTGGCGAATACTTG-

30) and control 2 (50-TCGTTAGTTCATACTTCGATTT-

30) primers were included in all reactions. The PCR cycling

program consisted of a preliminary denaturation at 94�C

for 4 min, followed by 35 cycles of 30 s at 94�C, 45 s at 50

or 66�C, and 30 s at 72�C with a final extension step of

7 min at 72�C. Then, PCR products were electrophoresed

on 2% agarose gels and visualized in presence of 0.5 lg/ml

ethidium bromide.

Results and discussion

Isolation of LTR sequences from Myrtus communis

Isolating LTR sequences requires amplification between a

conserved region in the adjacent LTR sequence and a

flanking genomic DNA [20]. Using degenerate RNase H

primers designed on two conserved motifs of RNase H

domains (TKHIDVR and ADIFTK) and restriction-site

specific adaptors, we successfully amplified the putative

Ty1-copia RNaseH-LTR regions from M. communis.

Degenerated primers (RH1 and RH2) are derived from

consensus sequences of Tnt1 [26], Tto1 [27], Ta1-3-like

[28] and Silvia [29]. Different fragments were amplified

and seven of these (the most intense bands) were cloned

into the pGEM-T vector. 12 positive clones were

sequenced using ABI 377 automated DNA sequencer

(Applied Biosystems). The deduced amino acid sequences

of 12 clones were compared with other retrotransposons

reported in plants deposited in GenBank database and

analyzed using CENSOR software [22]. Sequences were

compared to the consensus RNaseH region [21] and only 2

sequences showed clear similarity to RNaseH domain of

Ty1-copia retrotransposons, while no other sequences

revealed the presence of RNase H. In particular, these two

clones were scanned for the following features: the con-

served ARTKIEVD and ADIFTK RNaseH domains, a stop

codon, a polypurine tract (PPT), an inverted terminal repeat

(IR) and a complete putative 30 LTR sequence (data not

shown). We named these two LTR retrotransposon

sequences Tmc1 and Tmc2, (Transposon, Myrtus commu-

nis) (a.n FR692046-FL693379).

Translated amino acid sequence comparisons from each

clone with RNase H sequences of the Ty1-copia retro-

transposons previously reported in both monocotyledon

and dicotyledon plant species (a.n. AC198009-D83003-

AC241300-FJ705357.1) showed a moderate (71–78%)

level of amino acid conservation.

S-SAP marker development in M. communis

Retrotransposons have found wide application in plant

genetics and with the exponential increase in retrotrans-

poson nucleotide sequences deposited in GenBank many

efficient tools in the field of so-called ‘‘transposon dis-

play’’, able to highlight the insertional profile have been

developed. Therefore, retrotransposon insertional poly-

morphisms can help establish pedigrees and phylogenies

[3] as well as serve as biodiversity indicators. Here we

analyzed, the extent of retrotransposon-related variability

in the genomes of wild genotypes of myrtle belonging to

distinct geographical areas in the Caserta province. We

have designed an anchor primer in the LTR sequence near

to the external terminus orientated towards the 30 end for

S-SAP analysis. Thus, DNA fingerprints of four myrtle

accessions were obtained using two specific primers con-

structed on the LTR region of Tmc1 and Tmc2 elements in

combination with four selective EcoRI primers (for a total

of 10 primer combinations for each accession) (Fig. 1;

Table 1).

Two LTR-derived primers named Tmc1-LTR and Tmc2-

LTR (Table 1) were selected for the final S-SAP analysis

based on the result of a pre-screening S-SAP assay to select

the most optimal primer combinations.

We have analyzed three plants for each accession. For

each plant, S-SAP assays were performed in triplicate and

identical patterns were observed (data not shown) indicat-

ing the absence of intra-accession polymorphisms.

The combinations with Tmc2-LTR primer did not pro-

duce enough polymorphic bands for a good marker system

(data not shown), indicating a low polymorphism in the

myrtle genome, whereas the combinations with Tmc1-LTR

primer generated a characteristic profiling for each popu-

lation. Each S-SAP polymorphic band concatenates a

region at the 30LTR of the target retrotransposon and the

unique ‘host’ genomic sequence in which each Tmc1 ret-

rotransposon copy is embedded. The clear and different

profiles produced in all samples showed that Tmc1 is

present in all myrtle accessions studied. This suggests that

Tmc1 has been integrationally active within these groups of

accessions since their divergence from the last common

ancestor. Once a retrotransposon is stably integrated into a

genomic location it is inherited in a Mendelian manner.

S-SAP-based polymorphism may result from transposi-

tional activity of retroelements and/or polymorphisms in

3412 Mol Biol Rep (2012) 39:3409–3418

123

the restriction site, as reported for AFLP and some

restriction fragment length polymorphisms [30].

The EcoRI?T primer combination generated a low

S-SAP profile compared with other EcoRI primer combi-

nations that gave a highly discriminating profile, with an

excellent degree of reproducibility (Fig. 2; Table 2).

Thirty-four polymorphic S-SAP bands were scored

using EcoRI?G, EcoRI?A, EcoRI?C and EcoRI primer

combinations. The results are showed in Fig. 2 and sum-

marized in the Table 2. The size of the S-SAP product

detected ranged from 200 to 1200 nucleotides. Slightly

small products (approx. 150 and 250 in size) were ampli-

fied with all primer combinations (Fig. 2). LTR sequence

of Tmc1 element was used as a probe in S-SAP Southern

blot analysis (high stringency). The high polymorphisms

observed in the four myrtle accessions may be the result of

high copy number of the intact retrotransposon related to

Tmc1 element or different copy number of the LTRs

themselves.

This hypothesis is supported by the small products (less

of 250 bp) and as Tmc1 LTR sequence does not contain

sites for the restriction enzyme EcoRI, such products may

be due to a member of Tmc1 family (Fig. 2).

We identified unique bands (present in only one acces-

sion) and non-unique bands (present in more than one

accessions). The non-unique polymorphic bands in more

Fig. 1 Isolation of S-SAP fragments containing Tmc1-Tmc2 retro-

transposon LTR sequences. Genomic DNA is partially digested with

EcoRI restriction enzyme. Adaptors are then ligated and PCR carried

out with a Tmc1-LTR and Tmc2-LTR primers (arrows) each of which

are used in combination with different selective primer combinations

EcoRI?X (A, T, C, G). The squares indicate the two RNaseH gene

conserved motifs. Lines indicate RNaseH-LTR regions of Tmc1 and

Tmc2 retrotransposon isolated with a Pearce protocol [21]

Fig. 2 S-SAP profiles of Tmc1retrotransposon with different

selective primer combinations:

Tmc1-LTR/EcoRI?A; Tmc1-LTR/EcoRI?T; Tmc1-LTR/

EcoRI?C; Tmc1-LTR/

EcoRI?G; Tmc1-LTR/

EcoRI?0. Lanes: C, D, CV,

CM, genomic DNA from

Caiazzo, Durazzano, Castel

Volturno and Castel Morrone

acessions, respectively. Circles

indicate polymorphic bands

eluted for each accession

Mol Biol Rep (2012) 39:3409–3418 3413

123

than one population is not surprising because the acces-

sions used in this study are closely related and are confined

to a small geographical area.

All thirty-four S-SAP polymorphic bands were eluted

and sequenced after re-amplification from the polyacryl-

amide gel. Uniqueness of Tmc1 polymorphic bands was

tested by direct PCR performed using the Tmc1-LTR pri-

mer and primers designed in each flanking genomic

sequence.

The results showed that only 21 of 34 polymorphic

bands selected corresponded to Tmc1 copies. The remain-

ing 13 bands were aspecific products due to background of

technical problems inherent to S-SAP assay.

In an attempt to evaluate the utility of Tmc1 as molec-

ular marker, we conducted a PCR survey to detect pres-

ence/absence of the polymorphic bands in related myrtle

accessions (Table 3).

To determine the nature of the flanking sequences each

one of them was used as a query in BLASTN, BLASTX

and TBLASTX searches of sequence databases at the

NCBI. Analysis of flanking sequences revealed that two of

the twenty-nine polymorphic bands named LTR-D1 and

LTR-CV1 (a.n. FR692047-FR692048 respectively) derived

from genomes of Durazzano and Castel Volturno acces-

sions were formed of a 50 and 30LTR sequence, which

surround the internal RNaseH partial sequence (76 bp in

Durazzano and 181 bp in Castel Volturno).

Retroelements are often found as solo LTRs as shown

by Vicient et al. [31] and Devos et al. [32]. Generation of

solo LTRs through illegitimate intra-element recombina-

tion is considered a possible mechanism acting against the

trend for retrotransposon-driven genome expansion

[33, 34].

A further mechanism is the net deletion of complete

elements caused by illegitimate recombination between

homologous retrotransposons at different genomic loca-

tions [35]. Probably, the two clones were generated by a

recombination event between two LTRs in the same Tmc1

sequence that have the same polarity but are at different

locations.

Recombination can commonly take place between the

two LTRs bordering an element leading to the deletion of

the internal sequence [36, 37]. Solo-LTRs are evidence that

genome length expansion is reversible and is not a ‘‘one-

way ticket to genome obesity’’ [38].

LTR-D1 and LTR-CV1 clones showed a high level of

identity (98%). Restriction sites performed with Webcutter

2.0 program (http://rna.lundberg.gu.se/cutter2/) reveal the

EcoRI site at different positions owing to C/G transversion

events (Fig. 3). Since LTR-D1 and LTR-CV1 polymorphic

bands identified from Durazzano and Castel Volturno

genome respectively show no flanking sequences, we uti-

lized to characterize these two accessions two SNPs loca-

ted in different positions within two LTR clones that

generate two new EcoRI restriction sites (Fig. 3). We

performed a SNP-PCR using a specific primer for each

accessions that contain at 30 ends the nucleotide polymor-

phic in conjunction with a common primer (common for

Durazzano and Castel Volturno accessions) (Fig. 4b). To

verify that samples were no degraded, we have performed a

90 bp internal control corresponding to a small region in

the 30 LTR sequence of Tmc1 retroelement. Specific

primers 30-OH terminal mismatches were refractory to

extension by the DNA polymerase lacking in 30-exonu-

cleolytic proofreading activity [39–41], thus probably

prohibiting hybridization of the specific primer on template

DNA from other accessions. The results showed that only

in the Durazzano and Castel Volturno genomes were

observed the product of amplification corresponding to the

fragment contained the SNP. Instead, no product was

observed when the accession-specific primers were applied

to Castel Morrone and Caiazzo genomes (Fig. 4a). A 90 bp

internal control was generated in all PCR amplifications. In

conclusion, we showed that these SNPs, presents in LTR-

D1 and LTR-CV1 clones can provide useful molecular

markers for a ulterior authentication of Durazzano and

Castel Volturno genomes.

Four Tmc1 insertions out of nineteen polymorphic bands

are located within repetitive sequences that showed simi-

larities to Ty1-copia retroelements identified in other plants

Table 2 Number of the Tmc1polymorphic bands on a total

polymorphic bands, for each

myrtle accession

Combination primers Accession plants

C.V. C.M. C. D.

Number of Tmc1 polymorphic

bands/total polymorphic bands

Tmc1-LTR/EcoRI 2/3 1/1 2/2 2/2

Tmc1-LTR/EcoRI?A 1/2 3/5 3/3 2/2

Tmc1-LTR/EcoRI?T 0 0 0 0

Tmc1-LTR/EcoRI?C 2/2 1/1 4/5 4/4

Tmc1-LTR/EcoRI?G 1/1 0 0 1/1

3414 Mol Biol Rep (2012) 39:3409–3418

123

Table 3 Presence (?) or absence (-) of Tmc1 polymorphic bands in myrtle accessions and nature of flanking restriction site

Insertion Myrtus communis accessions Nature of flanking sequence

C.V. C.M. C. D. BLASTx research

Tmc1-D1 – – – ? Sequence coding hypothetical protein LOC100251485

Tmc1-D2 – – – ? No significant hit

Tmc1-D3 – – – ? No significant hit

Tmc1-D4 – – – ? No significant hit

Tmc1-CV1 ? – – – No significant hit

Tmc1-CV2 ? – – – Sequence coding disease resistance protein XP002519369.1

Tmc1-CV3 ? – – – Sequence coding hypothetical protein LOC100263766

Tmc1-CV6 ? – – – Repetitive DNA sequence

Tmc1-CV7 ? – – – Repetitive DNA sequence

LTR-D1 – – – ? –

LTR-CV1 ? – – – –

Tmc1-CM1 – ? – – No significant hit

Tmc1-CM2 – ? – – Sequence coding disease resistance protein AAU89656.1

Tmc1-CM3 – ? – – No significant hit

Tmc1-CM4 – ? – – No significant hit

Tmc1-C1 – – ? – No significant hit

Tmc1-C2 – – ? – No significant hit

Tmc1-C3 – – ? – No significant hit

Tmc1-C4 – – ? – No significant hit

Tmc1-C5 – – ? – Copia-like retrotransposon insert in POL region

Tmc1-C6 – – ? – Copia-like retrotransposon insert in reverse transcriptase

Fig. 3 Nucleotide alignment of Tmc1, LTR-D1 and LTR-CV1 clones. Arrows indicated the presence of EcoRI cutter site in different position

within LTR-D1 and LTR-CV1 sequence. Two clones have been aligned on the 30LTR of Tmc1 element

Mol Biol Rep (2012) 39:3409–3418 3415

123

(Table 3). It is known, in fact, that retroelements tend to

aggregate in other retrotransposon-related sequences and

these nested insertions reduce active copy number, because

the so-formed multimers cannot fully transpose [42].

Although the meaning of nested insertion is not under-

stood. One possible explanation is that targeting retro-

transposons into non-essential retrotransposonic sequences

helps minimize deleterious mutations from transposition

[42]. Alternatively, insertion in coding regions could be

subsequently counter-selected by evolutionary processes.

Eleven insertions did not reveal any significant identity

to known sequences (Table 3). The absence of significant

hits for these sequences is probably due to the poor rep-

resentation of information for the myrtle genome within

available databases.

Results through BLASTx research showed that four

insertions are located within sequences coding resistance

protein belonging to the NBS-LRR family (Table 3). This

is surprising considering that it is a TE inserted in a genic

region with a high frequency.

Insertion sites within resistance gene is consistent with

the model for gene space in papilionoids recently proposed

by Bertioli et al. [43]. This model suggests that gene space

may be divided into two broadly defined components: more

conserved regions which tend to have low retrotransposon

densities are relatively stable during evolution and have

higher densities of evolutionary conserved genes; variable

regions that tend to have high retrotransposon densities,

and whose frequent restructuring may fuel the evolution of

plant disease resistance genes and perhaps other multigenic

families.

Insertions of Tmc1 within NBS-LRR genes may be tol-

erated because these resistance (R) genes are members of a

multigenic family and extra gene copies compensate for any

allelic deficiencies from a mutational insertion. Further-

more, homologous copies of a gene mutated by retrotrans-

poson insertions can provide or not a normal expression

pattern although there may be a dosage dependent effect.

Examples of associations between retrotransposon and

plant genes as well as of their impact on gene structure and

function and potential use as promoter sequences have been

found [44–49]. The transposition into gene-rich regions in

their natural host may be a general feature of copia-like

retrotransposons, as this has also been shown for the rice

Tos17 active element [50] and for copia-like elements of

Arabidopsis. In the rice genome Hayashi and Yoshida [45]

reported that a LTR retrotransposon named Renovator

contributed to the evolution of the resistance gene Pit which

confers race-specific resistance against the fungal pathogen

Magnaporthe grisea. Their results suggested that transpo-

son-mediated transcriptional activation may play an

important role in the refunctionalization of additional

‘‘sleeping’’ R genes in the plant genomes.

Conclusions

Retrotransposons have found wide application as molecular

markers in studies of plant genetics. With the increase of

retrotransposon accessions available to GenBank many

efficient techniques have developed in the field of ‘‘trans-

poson display’’. These techniques highlight the insertion

profile and indirectly the transposition of an mobile

element.

In this study we analyzed the intra-specific variability of

four myrtle accessions using retrotransposon as molecular

markers in SSAP analysis. The results showed that Tmc1 is

a good molecular marker for myrtus intra-specific authen-

tication. Tmc1 marker may provide an important means to

identify and select Myrtus communis.

This identification could be useful to isolate myrtle

clonal plants with more biologically active substances.

Acknowledgments The authors are grateful to Dr. Joseph Sepe

(University of Maryland University College), for improving the

manuscript. Sequence data from this article have been deposited with

the GenBank Data Library under Accession Nos. [FR692046-

FR692055] [FR692058-FR692069][FL693379].

Fig. 4 SNP-PCR strategy. a Lanes: M, molecular mass markers;

CVa, Da, CMa, Ca, amplification PCR products obtained from the

Durazzano, Castel Volturno, Caiazzo and Castel Morrone genomes

with the LTR-D1/Tmc1 primer combinations, respectively (600 bp

SNP- PCR products; 90 bp-internal control); CVb, Db, CMb, Cb,

amplification PCR products obtained from the Durazzano, Castel

Volturno, Caiazzo and Castel Morrone genomes with the LTR-CV1/

Tmc1 primer combinations, (372 bp SNP-PCR products; 90 bp-

internal control). b Sequences of primers used in this strategy

(mutated nucleotides are in boldface)

3416 Mol Biol Rep (2012) 39:3409–3418

123

References

1. Canhoto JM, Lopes ML, Cruz GS (1999) Somatic embryogenesis

and plant regeneration in myrtle (Myrtaceae). Plant Cell Tiss Org

Cult 57:13–21

2. Serce S, Ercisli S, Sengul M, Gunduz K, Orhan E (2010) Anti-

oxidant activities and fatty acid composition of wild grown

myrtle (Myrtus communis L.) fruits. Pharmacogn Mag 6:9–12

3. Schulman AH (2007) Molecular marker to assess genetic diver-

sity. Euphytica 158:313–321

4. Varshney RK, Graner A, Sorrells ME (2005) Genomic-assisted

breeding for crop improvement. Trends Plant Sci 10:621–630

5. Kalendar R, Flavell A, Ellis THN, Sjakste T, Moisy C, Schulman

AH (2011) Analysis of plant diversity with retrotransposon-based

molecular markers. Heredity 106:520–530

6. Flavell AJ, Dunbar E, Anderson R, Pearce SR, Hartley R,

Kumar A (1992) Ty1-copia group retrotransposons are ubiqui-

tous and heterogeneous in higher plants. Nucleic Acids Res

20:3639–3644

7. Flavell AJ, Smith DB, Kumar A (1992) Extreme heterogeneity of

Ty1-copia group retrotransposons in plants. Mol Gen Genomics

231:233–242

8. Kunze R, Saedler H, Lonnig WE (1997) Plant transposable ele-

ments. Adv Bot Res 27:331–469

9. Voytas DF, Cummings MP, Konieczny A, Ausubel FM, Roder-

mel SR (1992) Copia-like retrotransposons are ubiquitous among

plants. Proc Natl Acad Sci USA 89:7124–7128

10. Casacuberta JM, Santiago N (2003) Plant LTR-retrotransposons

and MITEs: control of transposition and impact on the evolution

of plant genes and genomes. Gene 311:1–11

11. Boeke JD, Corces V (1989) Transcription and reversetranscrip-

tion of retrotransposons. Annu Rev Microbiol 43:403–434

12. Kaiser VB, van Tuinen M, Ellegren H (2007) Insertion events

of CR1 retrotransposable elements elucidate the phylogenetic.

Branching order in galliform birds. Mol Biol Evol 24(1):

338–347

13. Grzebelus D (2006) Transposon insertion polymorphism as a new

source of molecular markers. J Fruit Ornam Plant Res 14(Suppl

1):21–29

14. Porceddu A, Albertini E, Barcaccia G, Marconi G, Bertoli FB,

Veronesi F (2002) Development of S-SAP markers based on an

LTR-like sequence from Medicago sativa L. Mol Gen Genomics

267:107–114

15. Queen RA, Gribbon BM, James C, Jack P, Flavell AJ (2004)

Retrotransposon-based molecular markers for linkage and genetic

diversity analysis in wheat. Mol Gen Genomics 271:91–97

16. Syed NH, Flavell AJ (2006) Sequence-specific amplification

polymorphisms (S-SAPs): a multi-locus approach for analyzing

trasposon insertions. Nat Protoc 1:2746–2752

17. Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for

small quantities of fresh leaf tissue. Phytochem Bull 19:11–15

18. Sharma KK, Lavanya M, Anjaiah V (2000) A method for isola-

tion and purification of peanut genomic DNA suitable for ana-

lytical applications. Plant Mol Biol Rep 18:393a–393h

19. Sambrook J, Frithsch EF, Maniatis T (1989) Molecular cloning: a

laboratory manual, 2nd edn. Cold Spring Harbour Lab, Cold

Spring Harbour

20. Pearce SR, Knox M, Ellis TH, Flavell AJ, Kumar A (2000) Pea

Ty1-copia group retrotransposons: transpositional activity and

use as markers to study genetic diversity in Pisum. Mol Gen

Genet 263(6):898–907

21. Pearce SR, Stuart-Rogers C, Knox MR, Kumar A, Noel Ellis TH,

Flavell AJ (1999) Rapid isolation of plant Ty1-copia group ret-

rotransposon LTR sequences for molecular marker studies. Plant

J 19:711–717

22. Jurka J, Klonowski P, Dagman V, Pelton P (1996) Censor—a

program for identification and elimination of repetitive elements

from DNA sequences. Comput Chem 20:119–121

23. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W:

improving the sensitivity of progressive multiple sequence

alignment through sequence weighting, positions-specific gap

penalties and weight matrix choice. Nucleic Acid Res 22:

4673–4680

24. Waugh R, McLean K, Flavell AJ, Pearce SR, Kumar A, Thomas

BB, Powell W (1997) Genetic distribution of Bare-1-like retro-

transposable elements in the barley genome revealed by

sequence-specific amplification polymorphisms (S-SAP). Mol

Gen Genet 253:687–694

25. Newton CR, Heptinstall LE, Summers C, Super M, Schwarz M,

Anwar R, Graham A, Smith JC, Markham AF (1989) Amplifi-

cation refractory mutation system for prenatal diagnosis and

carrier assessment in cystic fibrosis. Lancet 2:1481–1483

26. Grandbastien MA, Lucas H, More JB, Mhiri C, Vernhettes S,

Casacuberta JM (1997) The expression of the tobacco Tnt1 is

linked to the plant defence responses. Genetica 100:241–252

27. Hirochika H, Otsuki H, Yoshikawa M, Otsuki Y, Sugimoto K,

Takeda S (1996) Autonomous transposition of the tobacco ret-

rotransposon Tto1 in rice. Plant Cell 8:725–734

28. Theologis A, Ecker JR, Palm CJ, Federspiel NA, Kaul S, White O

et al (2000) Sequence and analysis of chromosome 1 of the plant

Arabidopsis thaliana. Nature 408:816–820

29. Guyot R, Cheng X, Su Y, Cheng Z, Schlagenhauf E, Keller B,

Ling HQ (2005) Complex organization and evolution of the

tomato pericentromeric region at the FER gene locus. Plant

Physiol 138:1205–1215

30. Sarwat M, Das S, Srivastava PS (2010) Estimation of genetic

diversity and evaluation of relatedness through molecular markers

among medicinally important trees: Terminalia arjuna, T. chebulaand T. bellerica. Mol Biol Rep. doi:10.1007/s11033-010-0649-2

31. Vicient CM, Suoniemi A, Anamthawat-Jonsson K et al (1999)

Retrotransposon BARE-1 and its role in genome evolution in the

genus Hordeum. Plant Cell 11:1769–1784

32. Devos KM, Brown JKM, Bennetzen JL (2002) Genome size

reduction through illegitimate recombination counteracts genome

expansion in Arabidopsis. Genome Res 12:1075–1079

33. Shirasu K, Schulman AH, Lahaye T, Schulze-Lefert P (2000) A

contiguous 66 kb barley DNA sequence provides evidence for

reversible genome expansion. Genome Res 10:908–915

34. Bennetzen JL, Ma J, Devos KM (2005) Mechanisms of recent

genome size variation in flowering plants. Ann Bot (Lond)

95:127–132

35. Vitte C, Bennetzen JL (2006) Analysis of retrotransposon struc-

tural diversity uncovers properties and propensities in angiosperm

genome evolution. Proc Natl Acad Sci USA 103:17638–17643

36. Vitte C, Panaud Q (2005) LTR retrotransposons and flowering

plant genome size: emergence of the increase/decrease model.

Cytogenet Genome Res 110:91–107

37. Vitte C, Panaud O (2003) Formation of Solo-LTRs through

unequal homologous recombination counterbalances amplifica-

tions of LTR retrotransposons. Mol Biol Evol 20:528–540

38. Kumar A, Bennetzen JL (1999) Plant retrotransposons. Annu Rev

Genet 33:479–532

39. Newton CR, Graham A, Heptinstall LE, Powell SJ, Summers C,

Kalsheker N, Smith JC, Markham AF (1989) Analysis of any

point mutation DNA. The amplification refractory mutation sys-

tem (ARMS). Nucleic Acids Res 17:2503–2516

40. Ciarmiello LF, Piccirillo P, Pontecorvo G, De Luca A, Kafantaris

I, Woodrow P (2011) A PCR based SNPs marker for specific

characterization of English walnut (Juglans regia L.) cultivars.

Mol Biol Rep 38(2):1237–1249

Mol Biol Rep (2012) 39:3409–3418 3417

123

41. Wang H, Sun H, Kwon W-S, Jin H, Yang D-C (2010) A PCR-

based SNP marker for specific authentication of Korean ginseng

(Panax ginseng) cultivar ‘‘Chunpoong’’. Mol Biol Rep 37:

1053–1057

42. Voytas DF (1996) Retroelements in genome organization. Sci-

ence 274(5288):737–738

43. Bertioli D, Moretzsohn M, Madsen LH et al (2009) An analysis

of synteny of Arachis with Lotus and Medicago sheds new light

on the structure, stability and evolution of legume genomes. BMC

Genomics 10:45

44. Woodrow P, Pontecorvo G, Ciarmiello LF, Fuggi A, Carillo P

(2011) Ttd1a promoter is involved in DNA-protein binding by

salt and light stresses. Mol Biol Rep 38:3787–3794. doi:

10.1007/s11033-010-0494-3

45. Hayashi K, Yoshida H (2009) Refunctionalization of the ancient

rice blast disease resistance gene Pit by the recruitment of a

retrotransposon as a promoter. Plant J 57:413–425

46. Le QH, Melayah D, Bonnivard E, Petit M, Grandbastien MA

(2007) Distribution dynamics of the Tnt1 retrotransposon in ta-

bacco. Mol Genet Genomics 278:639–651

47. Lenoir A, Lavie L, Prieto JL, Goubely C, Cote JC, Pelissier T,

Deragon JM (2001) The evolutionary origin and genomic orga-

nization of SINEs in Arabidopsis thaliana. Mol Biol Evol 18:

2315–2322

48. White SE, Habera LF, Wessler SR (1994) Retrotransposons in the

flanking regions of normal plant genes: a role for copia-like

elements in the evolution of gene structure and expression. Proc

Natl Acad Sci USA 91:11792–11796

49. Woodrow P, Pontecorvo G, Fantaccione S, Kafantaris I, Fuggi A,

Parisi D, Carillo P (2010) Polymorphism of a new Ty1-copiaretrotransposon in durum wheat under salt and light stresses.

Theor Appl Genet 121:311–322

50. Miyao A, Tanaka K, Murata K, Sawaki H, Takeda S, Abe K,

Shinozuka Y, Onosato K, Hirochika H (2003) Target site speci-

ficity of the Tos17 retrotransposon shows a preference for

insertion within genes and against insertion in retrotransposon

rich regions of the genome. Plant Cell 15:1771–1780

3418 Mol Biol Rep (2012) 39:3409–3418

123