Clinical Science (2014) 126, 545–556 (Printed in Great Britain) doi: 10.1042/CS20130272

Involvement of proteinase activated receptor-2in the vascular response to sphingosine1-phosphateFiorentina ROVIEZZO∗, Antonella DE ANGELIS†, Luana DE GRUTTOLA∗, Antonio BERTOLINO∗, Nikol SULLO†,

Vincenzo BRANCALEONE‡, Mariarosaria BUCCI∗, Raffaele DE PALMA§, Konrad URBANEK†,

Bruno D’AGOSTINO†, Angela IANARO∗, Raffaella SORRENTINO∗ and Giuseppe CIRINO∗

∗Dipartimento di Farmacia, Universita di Napoli Federico II, Napoli, Italy

†Dipartimento di Medicina Sperimentale, Sezione di Farmacologia L. Donatelli, Seconda Universita degli Studi di Napoli, Napoli, Italy

‡Dipartimento di Chimica, Universita degli Studi della Basilicata, Pontenza, Italy

§Dipartimento di Internistica Clinica e Sperimentale, Seconda Universita degli Studi di Napoli, Napoli, Italy

Abstract

S1P (sphingosine 1-phosphate) represents one of the key latest additions to the list of vasoactive substances that

modulate vascular tone. PAR-2 (proteinase activated receptor-2) has been shown to be involved in cardiovascular

function. In the present study, we investigated the involvement of PAR-2 in S1P-induced effect on vascular tone. The

present study has been performed by using isolated mouse aortas. Both S1P and PAR-2 agonists induced

endothelium-dependent vasorelaxation. L-NAME (NG-nitro-L-arginine methyl ester) and wortmannin abrogated the

S1P-induced vasorelaxatioin, while significantly inhibiting the PAR-2-mediated effect. Either ENMD1068, a PAR-2

antagonist, or gabexate, a serine protease inhibitor, significantly inhibited S1P-induced vasorelaxation. Aortic

tissues harvested from mice overexpressing PAR-2 displayed a significant increase in vascular response to S1P as

opposed to PAR-2-null mice. Immunoprecipitation and immunofluorescence studies demonstrated that S1P1

interacted with PAR-2 and co-localized with PAR-2 on the vascular endothelial surface. Furthermore, S1P

administration to vascular tissues triggered PAR-2 mobilization from the plasma membrane to the perinuclear area;

S1P-induced translocation of PAR-2 was abrogated when aortic rings were pre-treated with ENMD1068 or when

caveolae dysfunction occurred. Similarly, experiments performed in cultured endothelial cells (human umbilical vein

endothelial cells) showed a co-localization of S1P1 and PAR2, as well as the ability of S1P to induce PAR-2

trafficking. Our results suggest that S1P induces endothelium-dependent vasorelaxation mainly through S1P1 and

involves PAR-2 transactivation.

Key words: aorta, nitric oxide, protease-activated receptor-2 (PAR-2), sphingosine 1-phosphate (S1P), vascular tone

INTRODUCTION

S1P (sphingosine 1-phosphate) is a phosphorylated product of

sphingosine, the core structure of a lipid class termed sphingo-

lipids [1–3]. S1P has been found to exert a diverse set of physiolo-

gical and pathophysiological responses in mammalian tissues

through the activation of heterotrimeric G-proteins [4,5]. So far,

five independent S1P receptor subtypes have been identified and

termed S1P1–S1P5. The isoforms S1P1, S1P2 and S1P3 are mainly

expressed in blood vessels, vascular endothelial cells and smooth

muscle cells [6–8]. S1P and S1P receptors have critical effects on

Abbreviations: DAPI, 4′,6-diamidino-2-phenylindole; eNOS, endothelial nitric oxide synthase; HUVEC, human umbilical vein endothelial cell; IL, interleukin; L-NAME, NG -nitro-L-arginine

methyl ester; LPS, lipopolysaccharide; NOS, nitric oxide synthase; PAR-2, proteinase activated receptor-2; PE, phenylephrine; PI3K, phosphoinositide 3-kinase; PTX, pertussis toxin;

qPCR, quantitative real-time PCR; S1P, sphingosine 1-phosphate; vWF, von Willebrand factor.

Correspondence: Professor Giuseppe Cirino (email cirino@unina.it).

morphogenesis and embryonic development of the vasculature as

well as of the heart [2]. S1P has direct vasoactive effect both on

isolated vessel and in vivo [7,9]. eNOS (endothelial nitric oxide

synthase) activation is a common feature of the S1P response in

vascular endothelial cells [9,10]. Indeed, S1P induces vascular

relaxation by activating eNOS via a pertussis toxin-sensitive G

protein-coupled receptor pathway [9–13]. In addition, S1P pro-

tects endothelial cells from apoptosis or programmed cell death

and promotes endothelial cell survival, proliferation and mi-

gration by activating the PI3K (phosphoinositide 3-kinase)/Akt

pathway [8–11]. The ability of S1P to transactivate heterologous

www.clinsci.org 545

Clin

ical

Sci

ence

ww

w.c

linsc

i.org

F. Roviezzo and others

receptors triggered by vascular endothelial growth factor, platelet

derived growth factor, epidermal growth factor and a membrane-

bound protease named MT-SP1 (membrane-type serine protease

1) has also been demonstrated [14–19].

PARs (proteinase-activated receptors) are a family of seven-

transmembrane G-protein-coupled receptors [20]. PARs are ac-

tivated through an unique mechanism of proteolysis that involves

cleavage at a specific site, different for each receptor, unmasking

a new N-terminal that acts as a tethered ligand [20,21]. At the

present stage, four subtypes of PARs have been characterized:

PAR-1, PAR-3 and PAR-4 selectively activated by thrombin and

PAR-2 that is activated by trypsin, tryptase, tissue factor, Factor

VII and Factor X. PAR-2 has been shown to be involved in cardi-

ovascular function [20]. Functional studies have shown that activ-

ation of the receptor by using a small agonist peptide derived from

the tethered ligand sequence (PAR-2AP) causes an endothelium-

dependent vasodilatation that involves NO and prostanoids [22–

24]. Subsequent studies have clearly shown that PAR-2 is ex-

pressed both in the human endothelial and smooth muscle cells

[25]. Systemic administration of PAR-2AP in both rats and mice

causes hypotension [23–25]. Interestingly, in humans in vivo

PAR-2AP also causes vasodilatation [26]. Unlike PAR-1, PAR-

2 expression in endothelial cells is up-regulated by inflammat-

ory stimuli such as TNFα (tumour necrosis factor α), bac-

terial endotoxin [LPS (lipopolysaccharide)] and IL (interleukin)-

1α [26–30]. Likewise, LPS administration to rats increases

PAR-2 expression on both endothelium and smooth muscle

cells, which translates into an increased relaxation to PAR–2AP

[26,27].

Several lines of evidence suggest a tight link between pro-

teases and sphingolipids [31–34]. This interaction has been

widely investigated for PAR-1, where it has been demonstrated a

specific interaction between PAR-1 and S1P3 [35]. Since PAR-2 is

involved in vascular homoeostasis [27–30], we have investigated

if PAR-2 also interacts with S1P.

MATERIALS AND METHODS

Reagents

SIP and ENMD-1068 were purchased from Enzo Life Sciences;

gabexate mesilate, wortmannin, trypsin, DAPI, PTX (pertussis

toxin) and a rabbit polyclonal anti-vWF (von Willebrand factor)

antibody were purchased from Sigma; W146 was purchased

from Avanti Polar Lipids; the antibody to PAR-2 (SAM-11) was

purchased from Santa Cruz Biotechnology; the anti-(phospho-

eNOS) polyclonal antibody and rabbit anti-eNOS antibody were

purchased from Calbiochem; and the antibody to S1P1 was pur-

chased from Exalpha Biologicals. All salts used for Krebs solu-

tion preparation were purchased from Carlo Erba Reagenti. The

PAR-2 agonist peptide (SLIGRL-NH2) was a gift from Professor

V. Santagada and G. Caliendo (Dipartimento di Chimica Farma-

ceutica e Tossicologica, Universita di Napoli “Federico II”, Na-

poli, Italy); normal donkey serum and donkey anti-(mouse IgG)

and anti-(rabbit IgG) secondary antibodies were from Jackson

ImmunoResearch; fluorescein-conjugated Griffonia simplicifolia

lectin I was purchased from Vector Laboratories (CA, U.S.A.)

Experimental animals

The study was carried out in 6–8-week-old male CD1 mice

(Charles River breeding Laboratories); mice overexpressing

PAR-2 (PAR2tg) and PAR-2 null mice (PAR2ko) were provided

by Professor Lungarella (Faculty of Medicine, University of Si-

ena, Siena, Italy). Detailed descriptions of the mice can be found

in the Supplementary Materials and methods section as http://

www.clinsci.org/cs/126/cs1260545add.htm). Mice were housed

in a controlled environment and provided with standard rodent

chow and water.

Animal care was in compliance with Italian regulations on

protection of animals used for experimental and other scientific

purposes (D.M. 116192) as well as with the EEC regulations (O.J.

of E.C. L 358/1 12/18/1986).

Vasomotor reactivity studies

Mice were anaesthetized with isofluorane (5 %) followed by ex-

sanguination. The adequacy of anaesthesia was monitored by lack

of twitch after foot pinch. Aortas were carefully removed and

dissected free from connective tissue. Aortic rings were used for

functional studies in an isolated organ bath filled with oxygenated

Krebs’ solution at 37 ◦C, linked to isometric force transducers

(Fort 10; World Precision Instrument). Concentration-dependent

response curves to S1P (1×10− 8–3×10− 5 mol/l) were cumulat-

ively obtained following submaximal contractions in response to

PE (phenylephrine) in the presence or absence of endothelium.

S1P-induced vasorelaxation was assessed in the presence of (i)

PTX (that uncouples the receptor from its Gi-protein; 1 mg/l);

(ii) L-NAME (NG-nitro-L-arginine methyl ester) [aNOS (nitric

oxide synthase) inhibitor; 10− 4 mol/l] and wortmannin (PI3K

inhibitor; 10− 7 mol/l); (iii) a specific S1P1 receptor antagonist

(W146; 10 µmol/l); and (iv) a monoclonal anti-PAR-2 primary

antibody (SAM-11) [36] at a 1:1000 dilution. This antibody is

directed to N-terminal amino acids 37–50, where the extracellular

cleavage site of PAR-2 is located.

Preliminary experiments were performed in order to define

the optimal concentrations of inhibitor used. The inhibitor con-

centrations used do not affect PE-induced contraction.

PAR-2 activation was evaluated by using: (i) trypsin, that

causes proteolytic activation of PAR-2; and (ii) PAR-2AP

(SLIGRL-NH2), the N-terminal receptor sequence, that acts as a

‘tethered’ ligand. PAR-2 activation was pharmacologically mod-

ulated by using specific inhibitors such as: (i) a serine protease

inhibitor, gabexate mesilate (10 µmol/l); (ii) a PAR-2 antagonist

(ENMD-1068; 100 µmol/l) [36]; (iii) wortmannin (10− 7 mol/l);

and (iv) SAM-11 (1:1000 dilution) [36]. In another set of exper-

iments, we tested the effect of: (i) gabexate mesilate or ENMD-

1068 on S1P-induced vasorelaxation; and (ii) W146 or PTX on

PAR-2AP-induced vasorelaxation.

Western blot analysis

Western blot analysis for eNOS and phospho-eNOS was per-

formed on aortic tissues incubated with S1P (10− 6 mol/l) or

546 C© The Authors Journal compilation C© 2014 Biochemical Society

S1P/PAR-2 cross-talk and vascular function

Figure 1 S1P and PAR-2AP induce endothelium-mediated vessel relaxation

(A) Cumulative administration of S1P on PE-contracted aortic rings causes a concentration- and endothelium-dependentrelaxation. (B) Quantitative PCR demonstrates the presence of S1P1, S1P2 and S1P3 receptors in mouse aorta. (C)Incubation with both W146 (10 µmol/l), an S1P1 antagonist, and (D) PTX (1 mg/l), which specifically uncouples S1P1 fromits Gi -protein, significantly inhibits S1P induced vasorelaxation. (E) Cumulative administration of PAR-2AP (SLIGRL-NH2), apeptide that mimics the tethered ligand exposed following PAR-2 proteolytic activation, induces endothelium- dependentvasorelaxation. (F) Incubation of aortic tissues with PTX, prior to PAR-2AP challenge, does not modify the relaxation. Dataare expressed as means +

− S.E.M., n = 6/group. ∗∗∗P < 0.001 compared with its vehicle.

PAR-2AP (10− 6 mol/l). In another set of experiments aortic tis-

sues were pre-treated with wortmannin (10− 7 mol/l). Details are

described in the Supplementary Materials and methods section.

Immunoprecipitation

Aortic tissues or HUVECs (human umbilical vein endothelial

cells) were used for S1P1 immunoprecipitation and PAR-2 co-

precipitation was monitored. The isotype control antibody was

used as negative control. Details are described in the Supplement-

ary Materials and methods section.

Immunofluorescence

Aortic rings or HUVECs untreated or stimulated with S1P

(1 µmol/l) or trypsin (3 units/ml) were rinsed with PBS and fixed

with phosphate-buffered formalin. In another set of experiments

aortic rings were incubated with ENMD-1068 (100 µmol/l;

10 min) or filipin (1 mg/l; 30 min at 37) prior to adding S1P

www.clinsci.org 547

F. Roviezzo and others

Figure 2 S1P and PAR-2AP induce vasorelaxation by activating eNOS via the PI3K/Akt pathway

(A) S1P-induced relaxation is abrogated by both L-NAME (100 µmol/l) and wortmannin (10− 7 mol/l). (B) L-NAME or wort-mannin significantly inhibit PAR-2AP-induced relaxation. All data are shown as means +

− S.E.M., n = 6/group. ∗∗∗P < 0.001

compared with its vehicle. (C) Representative Western blots of eNOS or Akt phosphorylation in aortic rings incubated withboth S1P (10− 6 mol/l) and PAR-2AP (10− 6 mol/l) without or with wortmannin (W; 10− 7mol/l). Histograms indicate therelative densitometry compared with total eNOS protein. Data are expressed as means +

− S.E.M., n = 6/group. ∗∗P < 0.01

compared with vehicle. V, vehicle.

(1 µmol/l). Filipin treatment disrupted caveolar structures, alter-

ing the physical distribution of the cholesterol in the membrane

by forming filipin–cholesterol complexes [37]. Tissues were fixed

in formalin, embedded in paraffin and cut into sections of 4 µm in

thickness. Details are described in the Supplementary Materials

and methods section.

mRNA quantification by qPCR (quantitative

real-time PCR)

S1P receptor mRNA was determined by qPCR. Details are de-

scribed in the Supplementary Materials and methods section.

Calculations and statistical analysis

All results are expressed as means +− S.E.M. and n indicates the

number of animals from which tissues were harvested. Relaxa-

tions (expressed as percentage of contraction) were determined

for each individual concentration–response curve by non-linear

regression analysis. The concentration–response curves of the

different groups were compared by ANOVA for repeated meas-

urements followed by Bonferroni correction. When appropriate,

unpaired Student’s t test was used. A value of P < 0.05 was con-

sidered significant.

RESULTS

S1P and PAR-2AP induce endothelium-dependent

vasorelaxation

Cumulative administration of S1P to aortic rings caused a

concentration-dependent vasorelaxation. The S1P effect was

endothelium-dependent since its removal abrogates S1P-induced

548 C© The Authors Journal compilation C© 2014 Biochemical Society

S1P/PAR-2 cross-talk and vascular function

Figure 3 S1P-induced vasorelaxation involves PAR-2 activation

(A) Cumulative administration of trypsin, that activates PAR-2 through a proteolytic mechanism, induces aortic relaxation.Trypsin-induced vasorelaxation is significantly inhibited by previous incubation with gabexate (10 µmol/l), a serine proteaseinhibitor, or ENMD-1068 (100 µmol/l), a specific PAR-2 antagonist. (B) PAR-2AP-induced relaxation is significantly reducedby incubation with ENMD-1068, but is not affected by gabexate. (C) Both ENMD-1068 and gabexate inhibit S1P-inducedvasorelaxation. (D) ENMD-1068 significantly inhibits SEW-2871 (an S1P1 agonist)-induced relaxation. Data are expressedas means +

− S.E.M., n = 6/group. ∗∗P < 0.01 and ∗∗∗

P < 0.001 compared with its vehicle. U, units.

vasodilatation (Figure 1A). Mouse aortas mainly express three

S1P receptor subtypes, namely S1P1, S1P2 and S1P3 with S1P1

being expressed most (Figure 1B). The main role of S1P1 has

been confirmed by functional experiments. Indeed, incubation

with W146, a specific antagonist of S1P1, abrogated S1P-induced

vasorelaxation (Figure 1C). S1P-mediated vasorelaxation was

PTX-sensitive as well (Figure 1D).

Similarly, PAR-2AP caused an endothelium-dependent re-

laxation (Figure 1E). Unlike S1P, incubation with PTX did not

modify PAR-2AP-induced vasodilatation (Figure 1F). These data

imply that both signals originate from independently engaged re-

ceptors.

S1P and PAR-2 induce relaxation by activating

eNOS

Endothelium removal abrogates both S1P- and PAR-2AP-

induced vascular relaxation, implying a role for endothelium-

derived mediators. In order to evaluate the contribute of NO,

we used L-NAME. The NOS inhibitor L-NAME abrogated S1P-

induced relaxation (Figure 2A) and significantly inhibited PAR-

2AP-induced vasorelaxation (Figure 2B). In order to gain fur-

ther insights into the NO pathway, we evaluated the effect of

wortmannin, an inhibitor of PI3K activity. S1P-induced vasore-

laxation was abrogated by wortmannin (Figure 2A). Similarly,

wortmannin caused a significant inhibition of PAR-2AP-induced

vasorelaxation (Figure 2B). Western blot analysis showed that

both S1P and PAR-2AP increased eNOS phosphorylation, which

was reversed by wortmannin pre-treatment (Figure 2C).

Aortic tissue challenged with S1P displayed a significant Akt

phosphorylation as well. Conversely, PAR-2AP did not.

Gabexate and ENMD-1068 inhibit S1P1- mediated

vasorelaxation

Next, we performed experiments by using specific antagonists of

PAR-2 and S1P1 in order to evaluate an interaction between these

receptors. PAR-2 activation was evaluated by using: (i) trypsin,

which causes proteolytic activation of PAR-2; or (ii) PAR-2AP, the

N-terminal receptor sequence, which acts as a ‘tethered’ ligand.

www.clinsci.org 549

F. Roviezzo and others

Cumulative administration of trypsin induced a concentration-

dependent vasorelaxation (Figure 3A). Both gabexate, a ser-

ine protease inhibitor, and ENMD-1068, a selective antagonist

of PAR-2, significantly inhibited trypsin-induced vasorelaxation

(Figure 3A). Conversely, ENMD-1068 but not gabexate inhibited

PAR-2AP-induced vasorelaxation (Figure 3B).

Incubation of aortic rings with gabexate or ENMD-1068 signi-

ficantly inhibited S1P-induced relaxation too (Figure 3C). These

data suggest that S1P may promote PAR-2 activation. This hypo-

thesis was supported further by the finding that ENMD-1068 sig-

nificantly inhibited SEW-2871 (S1P1 selective agonist)-induced

relaxation (Figure 3D).

In another set of experiments, we also tested the effects of

these inhibitors on S1P- and PAR-2-induced signalling. In par-

ticular, we performed a Western blot analysis study on aortic

tissues exposed in vitro to S1P or PAR-2AP, in the presence or

absence of antagonists, e.g. W146 or ENMD-1068 respectively.

These experiments confirmed the presence of two signalling path-

ways downstream, since neither ENMD-1068 blocked S1P sig-

nalling nor W146 blocked PAR-2 (Supplementary Figure S1 at

http://www.clinsci.org/cs/126/cs1260545add.htm).

In order to acquire additional information, aortic rings were

incubated with SAM-11, an antibody that recognizes the ex-

tracellular cleavage site involved in PAR-2 activation. SAM-11

inhibits trypsin-induced vasorelaxation (Figure 4A) but did not

affect either S1P- or PAR-2AP-mediated relaxation (Figures 4B

and 4C).

In order to assess the specific involvement of PAR-2 in S1P1-

mediated relaxation, we tested the action of: (i) a selective PAR-1

antagonist on S1P-induced vasorelaxation; and (ii) ENMD-1068

or W146 on PAR-1AP-induced vasorelaxation. We found that

RWJ 56110 (PAR-1 antagonist) did not affect S1P-mediated

relaxation (Supplementary Figure S2 at http://www.clinsci.

org/cs/126/cs1260545add.htm); neither ENMD-1068 nor W146-

modulated PAR-1AP-induced vasorelaxation (Supplementary

Figure S2).

S1P differently affects vascular tone in aortas

harvested from PAR-2tg and PAR-2ko mice

The results obtained suggest that S1P vascular effects are par-

tially mediated by PAR-2. To address this issue we performed

additional experiments on aortic rings isolated from PAR-2tg

or PAR-2ko mice. As expected PAR-2AP-induced relaxation of

isolated aorta was significantly increased in PAR-2tg mice (Fig-

ure 5A), whereas it was abrogated in PAR-2ko mice (Figure 5A).

Similarly, S1P-induced relaxation of aortic rings harvested from

PAR-2tg mice was significantly increased compared with PAR-

2ko mice (Figure 5B). To gain further insight into the role of

PAR-2 in enhancing S1P-induced vasorelaxation, a pharmacolo-

gical modulation was performed in PAR-2tg mice. Aortic rings

were incubated with the S1P1 antagonist W146 prior to adding

S1P. S1P-induced vasodilatation was abrogated by W146. This

result indicates that the effect of S1P on vascular tone is also

mediated through an interaction with S1P1 receptor in PAR-2tg

mice (Figure 5C). Conversely, W146 did not modify PAR-2AP-

induced vasorelaxation in PAR-2tg mice (Figure 5D).

Figure 4 S1P-induced relaxation is not affected by SAM-11

Pre-treatment of aortic rings with SAM-11, an antibody that recog-nizes the extracellular cleavage site involved in PAR-2 activation, in-hibits trypsin-induced vasorelaxation (A), but does not affect eitherPAR-2AP- (B) and S1P- (C) induced relaxation. Data are expressed asmeans +

− S.E.M., n = 6/group. ∗∗∗P < 0.001 compared with vehicle. U,

units.

S1P promotes PAR-2 trafficking

On the basis of the results described above, we suggest that

PAR-2 transactivation by S1P occurs and it is mediated by S1P1.

This functional interaction between S1P1 and PAR-2 is further

demonstrated by co-immunoprecipitation and immunofluores-

cence studies. Aortic tissue was used for S1P1 immunoprecip-

itation and PAR-2 co-precipitation was monitored. As shown in

Figure 6(A), S1P1 co-precipitates PAR-2. Similarly, an immun-

ofluorescence study performed on aortic rings highlighted S1P1

and PAR-2 co-localization in endothelium aortic vessel (Fig-

ure 6B). In order to demonstrate that this physical interaction

550 C© The Authors Journal compilation C© 2014 Biochemical Society

S1P/PAR-2 cross-talk and vascular function

Figure 5 S1P-induced vasorelaxation in PAR-2tg and PAR-2ko mice

Aortic rings harvested from PAR-2tg mice show a significant increased vasorelaxant effect in response to PAR-2AP (A)and S1P (B). Conversely, aortic rings harvested from PAR-2ko mice show an impaired response to PAR-2AP (A) and S1P(B). Incubation of aortic rings with W146 (10 µmol/l) harvested from PAR-2tg mice significantly inhibits S1P-inducedvasorelaxation (C), whereas it does not affect PAR-2AP-mediated relaxation (D). Data are expressed as means +

− S.E.M.,n = 6/group. ∗∗∗

P < 0.001.

also has a functional counterpart, we evaluated by immunofluor-

escence PAR-2 trafficking (Figure 6C). Within the cell, PAR-2

was mostly detected at the plasma membrane (Figure 6C, right

panel). Upon agonist activation PAR-2 was prominently detec-

ted in the peripheral and perinuclear location [38]. As expected,

trypsin caused mobilization of PAR-2 from the cell surface to the

perinuclear location in aortic tissues (Figure 6C, left panel). S1P

stimulation (Figure 6C, middle panel) produced a similar effect

since PAR-2 is prominently detected within the cell cytosol, in a

perinuclear localization.

S1P transactivation of PAR-2 requires

cholesterol-rich membranes

It has been demonstrated previously that in vascular endothe-

lium cholesterol rich membranes, including lipid rafts and cave-

olae, are important sites for GPCR (G-protein-coupled receptor)-

mediated transactivation and signal transduction. The interac-

tion of the S1P1 with caveolin-1 inhibits endothelial signalling

through the S1P pathway, even as the targeting of S1P1 to

caveolae facilitates the interactions of this receptor with lig-

ands and effectors that are also targeted to caveolae. The

S1P1 interaction with caveolin-1 was evaluated through im-

munoprecipitation studies on aortic tissues. As shown in Fig-

ure 7(A), S1P1 co-precipitated caveolin-1. In order to eval-

uate the role played by lipid rafts/caveolae [39–41], we in-

cubated aortic rings with filipin. Treatment with filipin signi-

ficantly inhibited S1P-induced vasorelaxation (Supplementary

Figure S3 at http://www.clinsci.org/cs/126/cs1260545add.htm).

Filipin markedly reduced S1P-induced translocation of PAR-2

(Figure 7B, middle panel) in comparison with the samples treated

with S1P in the absence of filipin (Figure 7B, left panel), Simil-

arly, when aortic tissues were incubated with ENMD-1068 (Fig-

ure 7B, right panel), a significant reduction in PAR-2 trafficking

www.clinsci.org 551

F. Roviezzo and others

Figure 6 S1P induces PAR-2 trafficking in aortic tissues

(A) S1P1 was immunoprecipitaed and immunoblotted with antibody against PAR-2. (B) The expression of PAR-2 and S1P1

in tissue sections is shown by fluorescence microscopy. Co-expression of PAR-2 (left panel, green) and S1P1 (middle panel,red) is apparent in several cells in the vessel wall. The right panel shows the merge of the left and middle panels. Endothelialcells are labelled with an anti-CD31 antibody (white). Nuclei are stained with DAPI (4′,6-diamidino-2-phenylindole) (blue).(C) The immunolabelling for PAR-2 is shown in aortic rings incubated with trypsin (3 units/ml; 10 min) or S1P (1 µmol/l;10 min). The areas in the rectangles are illustrated at higher magnification in the lower panels. In the samples exposed totrypsin (left panels) or S1P (middle panels), the increased accumulation of PAR-2 (green, arrows) is visible in the cytoplasmof the endothelial cells (lectin I, red). In control tissue (right panels), PAR-2 is present mostly at the cell membrane level(arrowheads).The subcellular localization is better visible in the insets. Nuclei are stained with DAPI (blue).

occured following S1P challenge. Taken together, these data sug-

gest a key role for the endothelium in the cross-talk between S1P1

and PAR-2.

Finally, we tested whether this signalling pathway was detect-

able in a human cellular model. To this end, we studied cultured

endothelial cells (HUVECs). We observed the co-precipitation of

S1P1 and PAR-2 (Figure 8A) and the co-expression of S1P1 (Fig-

ure 8B, upper panels, red) and PAR-2 (Figure 8B, middle panels,

green). By evaluating, through immunofluorescence, PAR-2 traf-

ficking we demonstrate that S1P induced a functional activation

of PAR-2, (Figure 8C). When HUVECs were exposed to tryp-

sin (Figure 8C, middle panel) or S1P (Figure 8C, left panel) it

is possible to detect the increase in fluorescence due to PAR-2

(green) staining in the cytoplasmic/perinuclear region as well as

in vascular tissues when compared with the vehicle (Figure 8C,

right panel).

DISCUSSION

The role of S1P in the physiology of cardiovascular system

has been widely investigated leading to the demonstration of a

finely tuned integration of S1P sources and receptors to modulate

552 C© The Authors Journal compilation C© 2014 Biochemical Society

S1P/PAR-2 cross-talk and vascular function

Figure 7 Caveolae dysfunction affects S1P–PAR-2 interaction

(A) CAV-1 was immunoprecipitated and immunoblotted with antibody against S1P1. (B) Aortic rings treated with S1P only(left panels) and samples incubated with filipin (middle panels) or ENMD-1068 (right panels) and then exposed to S1Pare shown. S1P-induced cytosolic accumulation of PAR-2 (left panel) was significantly reduced by filipin (middle panel) orENMD-1068 (right panel). Endothelial cells are labelled with an anti-vWF antibody (red). Cell nuclei are labelled with DAPI(blue).

vascular tone [6–8]. PAR-2 involvement in cardiovascular dis-

eases has also been demonstrated [28,30]. Although numerous

previous studies have described a tight link between proteases

and sphingolipids and the modulation of vascular tone by S1P

and PAR-2, the cross-talk between these receptors has not been

as yet investigated.

Administration of S1P or PAR-2AP induces vascular relaxa-

tion that is abrogated following mechanical removal of endothe-

lium. Thus both agonists require an intact endothelium to display

a vascular action, suggesting common endothelium-derived me-

diators. Since it is known that S1P-induced relaxation requires

endothelial-derived NO through the PI3K/Akt/eNOS pathway

[11–13], we investigated the role played by the this pathway.

As expected also in our experimental conditions, S1P induces

a significant phosphorylation of both Akt and eNOS. In per-

fect tune with these data, S1P-induced vasorelaxtion is abrogated

by L-NAME or wortmannin. Conversely, PAR-2 while inducing

a significant phosphorylation of eNOS, does not promote Akt

phosphorylation. Functional data indicate a significant inhibition

of PAR-2AP-induced vasorelaxation by both wortmannin and L-

NAME. Thus S1P and PAR-2 modulate vascular tone activating

signalling pathway that converges on PI3K, but differs in the

downstream signalling. We went on in the present study to evalu-

ate the effect of a pharmacological modulation of both receptors

by using specific and selective receptor antagonists.

Mouse aorta expresses S1P1, S1P2 and S1P3 receptor types but

S1P1 is the most expressed and mediates S1P-induced vascular

relaxation. Either W146, a S1P1 antagonist, or PTX, that spe-

cifically uncouples S1P1 from its Gi-protein, abrogates S1P- in-

duced vasorelaxation. Neither W146 nor PTX affects PAR-2AP

or trypsin-induced vasorelaxation. Conversely, ENMD-1068, the

PAR-2 antagonist, significantly inhibits S1P-induced vasorelaxa-

tion. Indeed, ENMD-1068 significantly impairs S1P-induced vas-

orelaxation. Therefore all together these data demonstrate that (i)

both signals originate from independently engaged receptors, (ii)

S1P activation involves PAR-2, (iii) S1P1 is the main subtype

receptor involved.

To further sustain our hypothesis, we performed additional

experiments by using aortas harvested from either PAR-2tg or

PAR-2 ko mice. The results obtained further confirmed that PAR-

2 is involved in the vascular effect of S1P and that its positive

modulation amplifies S1P effect on vascular tone. Indeed, ves-

sels harvested from PAR-2tg mice and challenged in vitro with

S1P displayed an enhanced response, whereas in vessels harves-

ted from PAR2ko mice the S1P vascular effect was significantly

reduced.

Our hypothesis of a functional cross-talk between PAR-2 and

S1P is also sustained by literature data. In fact, it has been shown

that SLIGRL, the same PAR-2 activating peptide we have used

in our experiments (PAR-2AP), prevents the lethal response to

www.clinsci.org 553

F. Roviezzo and others

Figure 8 S1P induces PAR-2 trafficking in HUVECs

(A) S1P1 was immunoprecipitated and immunoblotted with antibody against PAR-2. (B) Four examples of co-expression ofS1P1 (top panels, red) and PAR-2 (middle panels, green) are shown by immunofluorescence in cultured HUVECs. Bottompanels represent the merge of top and middle panels. (C) In the cells exposed to trypsin (middle panel) or S1P (left panel),the enhanced signal of PAR-2 (green) is visible in the cytoplasmic/perinuclear region. Control cells are illustrated on theright panel. Nuclei are stained with DAPI (blue).

a vascular leak-inducing agent in mice. Strikingly, its protective

effect was lost in mutant mice engineered to selectively lack S1P

in plasma. [42]

The mechanism of action of PAR-2 involves cleavage at a

specific site in the N-terminal exodomain that unmasks a new

N-terminus, which interacts intramolecularly with the receptor

exofacial loops promoting the intracellular signalling. We per-

formed additional experiments in order to assess whether an

S1P-mediated effect also triggers this mechanism of autoactiva-

tion. To perform the present study, we used SAM11, an antibody

directed to amino acids 37–50 of the N-terminus where the cleav-

age occurs. SAM11 inhibited trypsin-induced vasorelaxation but

failed to inhibit S1P-induced vasodilatation.

In order to acquire a further insight into the functional

interaction between S1P1 and PAR-2, we performed experi-

ments of immunoprecipitation and immunofluorescence. S1P1

co-precipitates PAR-2, implying that a physical association does

exist. This hypothesis is further supported by the finding that

immunofluorescence studies demonstrate the co-localization of

both receptors in endothelial aortic tissues. Thus S1P1 and PAR-2

can interact locally on the vascular endothelial surface.

Finally, we tested whether S1P can promote PAR-2 traffick-

ing. Normally PAR-2 is mostly detectable at the plasma mem-

brane but upon agonist activation it migrates and it becomes

prominently detected in the cytoplasm and in a perinuclear loc-

ation. This translocation, in our experimental conditions, takes

554 C© The Authors Journal compilation C© 2014 Biochemical Society

S1P/PAR-2 cross-talk and vascular function

place upon challenge of aortic rings with either trypsin or PAR-

2AP. S1P incubation with aortic rings replicates this effect,

demonstrating that S1P triggers PAR-2 translocation. To further

validate this hypothesis, we performed a reversal experiment by

using ENMD-1068, the PAR-2 antagonist. ENMD-1068 abrog-

ates PAR-2 translocation caused by S1P. Therefore S1P causes

activation of PAR-2 by inducing its translocation.

It is known that PAR-2 and S1P1 are widely localized in the

caveolae [39–41]. The compartmentalization of signalling pro-

teins is an important cellular tool to afford efficacy and specificity

of inter-molecular communication processes. This is particularly

the case in endothelial cells signalling machinery, where the dis-

tinct fluid phase of caveolae seems to help draw together proteins

involved in a variety of signalling pathways, therefore facilitat-

ing protein–protein and protein–membrane interactions neces-

sary for signal transduction [43]. In order to further demonstrate

that PAR-2/S1P1 interaction is necessary for signalling to oc-

cur, we treated aortic rings with filipin an agent that depletes

caveolae of cholesterol content, altering their fluidity. Treat-

ment of aortic rings with filipin blunts S1P ability to induce

PAR-2 translocation. Thus S1P1/PAR-2 have physical proximity,

as demonstrated by the immunofluorescence studies and their

endothelial compartmentalization is crucial for their functional

interaction.

In HUVECs, the same phenomenon is clearly visible thereby

indicating that the mechanisms we have defined in mouse aorta

is shared by human endothelial cells.

In conclusion, the findings in the present paper demonstrate

that not only is PAR-2 activated by S1P, but it also works in con-

cert with S1P1 to regulate vascular homoeostasis. Further studies

will be necessary to better clarify the molecular basis of this func-

tional interaction. However, this cross-talk could play a major role

in vascular diseases where both signals have been demonstrated to

play a role such as angiogenesis, restenosis and neointima form-

ation, and atherosclerotic remodelling [7,13,20,29]. The exist-

ence of this cross-talk between S1P1 and PAR-2 further supports

the concept of a tight link between proteases and cardiovascular

function.

CLINICAL PERSPECTIVES

� S1P exerts a diverse set of vascular responses through the

activation of heterotrimeric G-proteins that in turn modulate

the activity of various downstream signalling molecules. PAR-

2 has been shown to be involved in vascular inflammation as

well as in other inflammatory-based diseases.� In the present study, we demonstrate that S1P-mediated vascu-

lar effect involves PAR-2 activation. The hypothesis of the ex-

istence of this transactivation between S1P1 and PAR-2 further

strengthens the concept of a tight link between cardiovascular

function and the inflammatory processes.� We believe that this aspect of the study will be of great interest

since the presence of this cross-talk between S1P and PAR-2

further supports the concept that protease receptors may play

an important role in cardiovascular inflammation.

AUTHOR CONTRIBUTION

Fiorentina Roviezzo and Giuseppe Cirino conceived and designed

the experiments and wrote the paper; Luana De Gruttola, Anto-

nio Bertolino and Nikol Sullo performed the vascular functional

experiments; Antonella De Angelis, Konrad Urbanek and Bruno

D’Agostino performed the immunofluorescence experiments; Raf-

faele De Palma performed the RT–PCR; Mariarosaria and Bucci

Vincenzo Brancaleone performed the cell and molecular experi-

ments; Angela Ianaro and Raffaella Sorrentino analysed data and

contributed to the writing of the paper.

FUNDING

This work was supported by the Ministero della Universita e Ricerca

Scientifica, Italy [grant number PRIN 2009].

REFERENCES

1 Pitson, S. M. (2011) Regulation of sphingosine kinase andsphingolipid signalling. Trend Biochem. Sci. 2, 97–107

2 Hannun, Y. A. and Obeid, L. M. (2008) Principles of bioactivelipid signalling: lessons from sphingolipids. Nat. Rev. Mol. CellBiol. 9, 139–150

3 Maceyka, M., Milstien, S. and Spiegel, S. (2009)Sphingosine-1-phosphate: the Swiss army knife of sphingolipidsignaling. J. Lipid Res. 50, S272–S276

4 Sanchez, T. and Hla, T. (2004) Structural and functionalcharacteristics of S1P receptors. J. Cell Biochem. 92, 913–922

5 Bartke, N. and Hannun, Y. A. (2009) Bioactive sphingolipids:metabolism and function. J. Lipid Res. 50, S91–S96

6 Levkau, B. (2008) Sphingosine-1-phosphate in the regulation ofvascular tone: a finely tuned integration system of S1P sources,receptors, and vascular responsiveness. Circ. Res. 103,231–233

7 Lucke, S. and Levkau, B. (2010) Endothelial functions ofsphingosine-1-phosphate. Cell Physiol. Biochem. 26, 87–96

8 Ozaki, H., Hla, T. and Lee, M. J. (2003) Sphingosine-1-phosphate signaling in endothelial activation. J. Atheroscler.Thromb. 10, 125–131

9 Dantas, A. P., Igarashi, J. and Michel, T. (2003) Sphingosine1-phosphate and control of vascular tone. Am. J. Physiol. HeartCirc. Physiol. 284, H2045–H2052

10 Igarashi, J. and Michel, T. (2008) S1P and eNOS regulation.Biochim. Biophys. Acta 1781, 489–495

11 Igarashi, J. and Michel, T. (2001) Sphingosine 1-phosphate andisoform-specific activation of phosphoinositide 3-kinase β.Evidence for divergence and convergence of receptor-regulatedendothelial nitric-oxide synthase signaling pathways. J. Biol.Chem. 276, 36281–36288

12 Roviezzo, F., Bucci, M., Delisle, C., Brancaleone, V., Di Lorenzo,A., Mayo, I. P., Fiorucci, S., Fontana, A., Gratton, J. P. and Cirino,G. (2006) Essential requirement for Sphingosine kinase activityin eNOS-dependent NO release and vasorelaxation. FASEB J. 20,340–342

13 d’Emmanuele di Villa Bianca, R., Sorrentino, R., Roviezzo, F.,Imbimbo, C., Palmieri, A., De Dominicis, G., Montorsi, F., Cirino,G. and Mirone, V. (2006) Sphingosine-1-phosphate inducesendothelial NOS activation through phosphorylation in humancorpus cavernosum. J. Pharmacol. Exp. Ther. 316, 703–708

14 Tanimoto, T., Jin, Z. G. and Berk, B. C. (2002) Transactivation ofvascular endothelial growth factor (VEGF) receptor Flk-1/KDR isinvolved in sphingosine 1-phosphate-stimulated phosphorylationof Akt and endothelial nitric-oxide synthase (eNOS). J. Biol.Chem. 277, 42997–43001

www.clinsci.org 555

F. Roviezzo and others

15 Endo, A., Nagashima, K., Kurose, H., Mochizuki, S., Matsuda, M.and Mochizuki, N. (2002) Sphingosine 1-phosphate inducesmembrane ruffling and increases motility of human umbilical veinendothelial cells via vascular endothelial growth factor receptorand CrkII. J. Biol. Chem. 277, 23747–23754

16 Hobson, J. P., Rosenfeldt, H. M., Barak, L. S., Olivera, A.,Poulton, S., Caron, M. G., Milstien, S. and Spiegel, S.(2001) Role of the sphingosine-1-phosphate receptorEDG-1 in PDGF-induced cell motility. Science 291,1800–1803

17 Alderton, F., Rakhit, S., Kong, K. C., Palmer, T., Sambi, B., Pyne,S. and Pyne, N. J. (2001) Tethering of the platelet-derived growthfactor β receptor to G-protein-coupled receptors: a novel platformfor integrative signaling by these receptor classes in mammaliancells. J. Biol. Chem. 276, 28578–28585

18 Tanimoto, T., Lungu, A. O. and Berk, B. C. (2004) Sphingosine1–phosphate transactivates the platelet-derived growth factor β

receptor and epidermal growth factor receptor in vascularsmooth muscle cells. Circ. Res. 94, 1050–1058

19 Benaud, C., Oberst, M., Hobson, J. P., Spiegel, S., Dickson, R. B.and Lin, C. Y. (2002) Sphingosine 1-phosphate, present inserum-derived lipoproteins, activates matriptase. J. Biol. Chem.277, 10539–10546

20 Macfarlane, S. R., Seatter, M. J., Kanke, T., Hunter, G. D. andPlevin, R. (2001) Proteinase-activated receptors. Pharmacol.Rev. 53, 245–282

21 Vu, T. K., Hung, D. T., Wheaton, V. I. and Coughlin, S. R. (1991)Molecular cloning of a functional thrombin receptor reveals anovel proteolytic mechanism of receptor activation. Cell 64,1057–1106

22 Hirano, K. and Kanaide, H. (2003) Role of protease-activatedreceptors in the vascular system. J. Atheroscler. Thromb. 10,211–225

23 Sobey, C. G. and Cocks, T. M. (1998) Activation of proteaseactivated receptor-2 (PAR-2) elicits nitric oxide-dependentdilatation of the basilar artery in vivo. Stroke 29,1439–1444

24 Robin, J., Kharbanda, R., Mclean, P., Campbell, R. and Vallance,P. (2003) Protease-activated receptor 2-mediated vasodilatationin humans in vivo: role of nitric oxide and prostanoids.Circulation 107, 954–959

25 D’Andrea, M. R., Derian, C. K., Leturcq, D., Baker, S. M.,Brunmark, A., Ling, P., Darrow, A. L., Santulli, R. J., Brass, L. F.and Andrade-Gordon, P. (1998) Characterization of proteaseactivated receptor-2 immunoreactivity in normal human tissues.J. Histochem. Cytochem. 46, 157–164

26 Nystedt, S., Ramakrishnan, V. and Sundelin, J. (1996)The proteinase activated receptor 2 is induced byinflammatory mediators in human endothelial cells.Comparison with the thrombin receptor. J. Biol. Chem. 271,14910–14915

27 Cirino, G. and Cicala, C. (2003) Upregulation of proteinase-activated receptors (PARs) and cardiovascular function. DrugDev. Res. 60, 20–23

28 Cocks, T. M. and Moffatt, J. D. (2000) Protease-activatedreceptors: sentries for inflammation? Trends Pharmacol. Sci. 21,103–108

29 Roviezzo, F., Bucci, M., Brancaleone, V., Di Lorenzo, A., Geppetti,P., Farneti, S., Parente, L., Lungarella, G., Fiorucci, S. and Cirino,G. (2005) Proteinase-activated receptor-2 mediates arterialvasodilation in diabetes. Arterioscler. Thromb. Vasc. Biol. 25,2349–2354

30 Cicala, C., Pinto, A., Bucci, M., Sorrentino, R., Walker, B., Harriot,P., Cruchley, A., Kapas, S., Howells, G. L. and Cirino, G. (1999)Protease-activated receptor-2 involvement in hypotension innormal and endotoxemic rats in vivo. Circulation 99, 2590–2597

31 Kang, H., Kwak, H. I., Kaunas, R. and Bayless, K. J. (2011) Fluidshear stress and sphingosine1-phosphate activate calpain topromote membrane type 1 matrix metalloproteinase (MT1-MMP)

membrane translocation and endothelial invasion intothree-dimensional collagen matrices. J. Biol. Chem. 286,42017–42026

32 Zebrakovska, I., Masa, M., Srp, J., Horn, M., Vavrova, K. andMares, M. (2011) Complex modulation of peptidolytic activity ofcathepsin D by sphingolipids. Biochim. Biophys. Acta 1811,1097–1104

33 Kim, E. S., Kim, J. S., Kim, S. G., Hwang, S., Lee, C. H. andMoon, A. (2011) Sphingosine 1-phosphate regulates matrixmetalloproteinase-9 expression and breast cell invasion throughS1P3–Gαq coupling. J. Cell Sci. 124, 2220–2230

34 Kojima, K. and Inouye, K. (2011) Activation of matriptasezymogen. J. Biochem. 150, 123–125

35 Niessen, F., Schaffner, F., Furlan-Freguia, C., Pawlinski, R.,Bhattacharjee, G., Chun, J., Derian, C. K., Andrade-Gordon, P.,Rosen, H. and Ruf, W. (2008) Dendritic cell PAR1–S1P3

signalling couples coagulation and inflammation. Nature 452,654–658

36 Kelso, E. B., Lockhart, J. C., Hembrough, T., Dunning, L., Plevin,R., Hollenberg, M. D., Sommerhoff, C. P., McLean, J. S. andFerrell, W. R. (2006) Therapeutic promise of proteinase-activatedreceptor-2 antagonism in joint inflammation. J. Pharmacol. Exp.Ther. 316, 1017–1024

37 Kaiser, R. A., Oxhorn, B. C., Andrews, G. and Buxton, I. L. (2002)Functional compartmentation of endothelial P2Y receptorsignaling. Circ. Res. 91, 292–299

38 Dery, O., Thoma, M. S., Wong, H., Grady, E. F. and Bunnett, N. W.(1999) Trafficking of proteinase-activated receptor-2 andβ -arrestin-1 tagged with green fluorescent protein.β -Arrestin-dependent endocytosis of a proteinase receptor.J. Biol. Chem. 274, 18524–18535

39 Awasthi, V., Mandal, S. K., Papanna, V., Rao, L. V. and Pendurthi,U. R. (2007) Modulation of tissue factor-factor VIIa signaling bylipid rafts and caveolae. Arterioscler. Thromb. Vasc. Biol. 27,1447–1455

40 Hachem, J. P., Houben, E., Crumrine, D., Man, M. Q., Schurer, N.,Roelandt, T., Choi, E. H., Uchida, Y., Brown, B. E., Feingold, K. R.and Elias, P. M. (2006) Serine protease signaling of epidermalpermeability barrier homeostasis. J. Invest. Dermatol. 126,2074–2086

41 Igarashi, J. and Michel, T. (2000) Agonist-modulated targeting ofthe EDG-1 receptor to plasmalemmal caveolae. eNOS activationby sphingosine 1-phosphate and the role of caveolin-1 insphingolipid signal transduction. J. Biol. Chem. 275,32363–32370

42 Camerer, E., Regard, J. B., Cornelissen, I., Srinivasan, Y.,Duong, D. N., Palmer, D, Pham, T. H., Wong, J. S., Pappu,R. and Coughlin, S. R. (2009) Sphingosine-1-phosphatein the plasma compartment regulates basal andinflammation-induced vascular leak in mice. J. Clin. Invest. 119,1871–1879

43 Gonzalez, E., Kou, R., Lin, A. J., Golan, D. E. and Michel, T.(2002) Subcellular targeting and agonist-induced site-specificphosphorylation of endothelial nitric-oxide synthase. J. Biol.Chem. 277, 39554–39560

Received 19 June 2013/7 October 2013; accepted 17 October 2013

Published as Immediate Publication 17 October 2013, doi: 10.1042/CS20130272

556 C© The Authors Journal compilation C© 2014 Biochemical Society

Clinical Science (2014) 126, 545–556 (Printed in Great Britain) doi: 10.1042/CS20130272

SUPPLEMENTARY ONLINE DATA

Involvement of proteinase activated receptor-2in the vascular response to sphingosine1-phosphateFiorentina ROVIEZZO∗, Antonella DE ANGELIS†, Luana DE GRUTTOLA∗, Antonio BERTOLINO∗, Nikol SULLO†,

Vincenzo BRANCALEONE‡, Mariarosaria BUCCI∗, Raffaele DE PALMA§, Konrad URBANEK†,

Bruno D’AGOSTINO†, Angela IANARO∗, Raffaella SORRENTINO∗ and Giuseppe CIRINO∗

∗Dipartimento di Farmacia, Universita di Napoli Federico II, Napoli, Italy

†Dipartimento di Medicina Sperimentale, Sezione di Farmacologia L. Donatelli, Seconda Universita degli Studi di Napoli, Napoli, Italy

‡Dipartimento di Chimica, Universita degli Studi della Basilicata, Pontenza, Italy

§Dipartimento di Internistica Clinica e Sperimentale, Seconda Universita degli Studi di Napoli, Napoli, Italy

MATERIALS AND METHODS

Generation of PAR2tg mice

A 140-kb human BAC clone (identification no. 23C20) con-

taining the entire genomic sequence of human PAR-2 was ob-

tained from the Lawrence Berkley National Laboratory Hu-

man Genome Center (University of California, Berkeley, CA,

U.S.A.). The PAR2 gene is under the control of the endo-

genous human promoter and flanked by a minimum of 30 kb

of genomic sequence. This BAC DNA was microinjected

into the pronuclei of FVB/N eggs. F0 pups were screened

for incorporation of the transgene using the human-specific

PAR-2 primer set 5′-GTAAGCTTGATGGCACTACCC and 3′-

TCTGATCATCAGCACATAGGC and was confirmed by South-

ern blotting. Copy number of the transgene was estimated at

5–10 copies/diploid cell based on the intensity of the band in a

Southern blot compared with a single copy gene. Charles River

Breeding Laboratories were used for controls.

Generation of PAR2ko mice

Four mouse genomic clones were isolated using mouse PAR2

primers. The short arm of the vector (Xba–Kpn fragment) was

cloned into the ppNTT neo vector. A hygromycin selectable

marker and a lox P sequence from the vector pBS-PGKhyg/loxP

modified with Sse8783 linkers were incorporated. Finally, the

long arm of the vector (Xho–Sse) was ligated in to produce the

final 16-kb targeting vector. RW4 embryonic stem cells were

electroporated with the vector and screened for homologous re-

combination using standard selection conditions of 10–12 days

of G418 treatment. Surviving clones were screened by South-

ern blot analysis and positive clones were injected into C57

blastocysts. Chimaeric males were back-crossed to C57 females

to test for germline transmission and to 129SvJ females to cre-

ate an inbred strain of homozygous KO mice. Animals were

genotyped using primers specific for the mouse PAR2 gene (5′-

GCATTGAACATCACCACCTG, 3′-GGATAGCCCTCTGCCT-

Correspondence: Professor Giuseppe Cirino (email cirino@unina.it).

Table S1 Primers used in qRT-PCR

FW, forward; RV, reverse.

Primer Sequence

Mouse S1P1 FW 5′ -TTCCACCGGCCCATGTACTA-3′

Mouse S1P1 RV 5′ -CAAACATACTCCCTTCCCGC-3′

Mouse S1P2 FW 5′ -AACTCCCGTGCAGTGGTTTG-3′

Mouse S1P2 RV 5′ -CATCAGCATTCGGCAGCTTT-3′

Mouse S1P3 FW 5′ -GCGACACCTGACCATGATCA-3′

Mouse S1P3 RV 5′ -GCAGTCGGGAAAGTTCTCCAG-3′

Mouse GAPDH FW 5′ -TGCACCACCAACTGCTTAGC-3′

Mouse GAPDH RV 5′ -TGATGGCATGGACTGTGGTC-3′

TTTC) as well as for the selection marker (5′-GCAGCCA-

ATATGGGATCG, 3′-ATCAGAGCAGCCGATTGTCT).

Cell culture

HUVECs were purchased from Promocell. All experiments were

performed on low-passage cell cultures. Cells were grown in

endothelial growth medium-2 (EBM-2, 2 % FBS, VEGF, R3-

IGF-1, hEGF, hFGF, hydrocortisone, ascorbic acid, heparin and

GA-1000) (Clonetics) at 37 ◦C and in a 5 % (v/v) CO2 atmosphere.

To examine trafficking cells were maintained at 37 ◦C in DMEM

containing 0.1 % BSA. Cells were observed after addition of

trypsin (10 nM) or S1P (1 μM). Cells were washed and fixed

with 4 % (v/v) paraformaldehyde in 100 mM PBS, pH7.4.

Western blot analysis

Thoracic aorta was dissected and cleaned from fat and connect-

ive tissue. Rings, of the same size as described before, were

homogenized in RIPA buffer (50 mM Tris/HCl, pH 7.4, 1% Tri-

ton X-100, 0.25 %, sodium deoxycolate, 150 mM NaCl, 1 mmol/l

EDTA, 1 mmol/l PMSF, 10 μg/ml aprotinin, 20 μmol/l leupeptin

and 50 mmol/l sodium fluoride) using a Polytron homogenizer

www.clinsci.org

F. Roviezzo and others

Figure S1 Effect of W146 and ENMD-1068 on eNOS or Akt

phosphorylation

(A) Representative Western blot of eNOS or Akt phosphorylation in aor-tic rings incubated with both S1P (10− 6 mol/l) and PAR-2AP (10− 6

mol/l) without or with W146 or ENMD-1068. Histograms indicate therelative densitometry compared with total eNOS protein. Data are ex-pressed as means +

− S.E.M., n = 6/group. ∗P < 0.05 and ∗∗

P < 0.01compared with vehicle.

(two cycles of 10 s at maximum speed). Lysates were centrifuged

14 000 g in a pre-cooled centrifuge for 15 min. Lysates were

spearated by SDS/PAGE (10 % gels) and proteins were trans-

ferred on to a PVDF membrane. Membranes were blocked by in-

cubation in PBS containing 0.1 % Tween 20 and 5 % (w/v) non-fat

dried skimmed milk for 2 h, followed by overnight incubation at

4 ◦C with anti-eNOS (1:1000 dilution) and anti-(phospho-eNOS)

(1:1000 dilution) antibodies. The filters were washed extensively

in PBS containing 0.1 % Tween 20, before incubation for 2 h

with HRP (horseradish peroxidase)-conjugate secondary anti-

bodies. Membranes were then washed and developed using ECL

(enhanced chemiluminescence substrate).

Immunoprecipitation

The cell lysate was pre-cleared by adding 100 μl of either Protein

A or G–agarose/sepharose bead slurry (50 %) for 1 ml of cell lys-

ate. The Protein A or G beads were removed by centrifugation.

The supernatant was transferred to a fresh centrifuge tube. The

immunoprecipitating antibody (20 μg of anti-S1P1) was added

to 500 μl of cell lysate. The cell lysate/antibody mixture was

gently rocked overnight at 4 ◦C on an orbital shaker. The im-

munocomplex was captured by adding 100 μl of Protein A or

G–agarose/sepharose bead slurry and gently rocking on either

a orbital shaker for 1 h at 4 ◦C. The agarose/sepharose beads

were collected by pulse centrifugation. The supernatant was dis-

carded and the beads washed three times with 800 μl of ice-cold

modified RIPA buffer. The agarose/sepharose beads were sus-

pended in 60 μl of 2× sample buffer and mixed gently. The

agarose/sepharose beads were boiled for 5 min to dissociate the

immunocomplexes from the beads. The denatured proteins were

separated by SDS/PAGE (10 % gel) and transferred on to a PVDF

membrane. The total lysate was used as positive control and the

isotype control antibody as negative control. Membrane were

blocked by incubation in PBS containing 0.1 % Tween 20 and

5 % non-fat dried skimmed milk for 2 h, followed by a overnight

incubation at 4 ◦C with anti-PAR-2. The filters were washed ex-

tensively in PBS containing 0.1 % Tween 20, before incubation

for 2 h with an HRP-conjugated secondary antibody. Membranes

were then washed and developed using ECL.

mRNA quantification by qPCR

Briefly, total RNA from homogenized aorta tissue was extracted

by using TRIzol® reagent (Invitrogen), subsequently, to eliminate

genomic DNA contamination, 1 μg of the RNA was treated

with RQ1 RNase-free DNase I (Promega Corporation) and

reverse transcription was performed using M-MLV Reverse

Transcriptase (Invitrogen) according to the manufacturer’s

recommendations. qPCR was carried out with cDNAs by

using Sybr Green PCR Master Mix (Applied Biosystems) and

7500 real-time PCR System (Applied Biosystems). All cDNA

samples were run in triplicate in 25-μl reactions. Primers used

were specifically designed using Primer Express Software

2.0 (Applied Biosystems) and validated for their specificity

(Table S1). Samples were incubated at 50 ◦C for 2 min and at

95 ◦C for 10 min followed by 40 cycles at 95 ◦C for 15 s and

60 ◦C for 1 min. Differences in cDNA input were corrected by

normalizing signals obtained with primers specific for GADPH

(glyceraldehyde-3-phosphate dehydrogenase). To exclude non-

specific amplification and/or the formation of primer dimers,

control reactions were performed in the absence of target cDNA.

Gene expression levels were calculated using the 2− �CT method

and are presented as the ratio between mean+−S.E.M.-fold

change of the target gene and GAPDH.

Immunofluorescence

The sections were used for immunolabelling and analysed

by fluorescence microscopy. PAR-2 was detected by indirect

immunofluorescence using a mouse monoclonal anti-PAR-2

antibody. The expression of S1P1 receptor was determined by

indirect immunofluorescence with a rabbit polyclonal anti-S1P1

C© The Authors Journal compilation C© 2014 Biochemical Society

S1P/PAR-2 cross-talk and vascular function

Figure S2 S1P-induced vasorelaxation does not involve PAR-1 activation

(A) PAR-1 antagonist (RWJ 56110) does not modify S1P-induced vasorelaxation. (B) PAR-1AP-mediated vasorelaxation isnot affected by both ENMD 1068 and W146.

antibody. Endothelial cells were identified by labelling with

fluorescein-conjugated Griffonia simplicifolia Lectin I or a rabbit

polyclonal anti-vWF antibody. Nuclei were stained with DAPI.

Briefly, after rehydration, the tissue sections were treated with

10 % normal donkey serum for 20 min at room temperature and

then incubated with the anti-PAR-2 and/or anti-S1P1 primary an-

tibodies diluted 1:200 in PBS. After being washed several times

with PBS, the sections were incubated with the FITC-conjugated

or TRITC-conjugated affinity-pure donkey anti-(mouse IgG) and

anti-(rabbit IgG) secondary antibodies, diluted 1:200, for 60 min

in the dark. Following washing with PBS, the sections were in-

cubated with Lectin I diluted 1:200 for 2 h at room temperature.

Incubation with anti-vWF antibody diluted 1:100 was performed

for 1 h following by TRITC-conjugated anti-rabbit secondary

antibody staining. Nuclear counterstaining with DAPI was per-

formed for 15 min at room temperature. Sections were analysed

with a Leica DM5000B fluorescence microscope.Figure S3 Pre-treatment with filipin (1 mg/l) for 30 min inhibits

S1P-induced vasorelaxation

Received 19 June 2013/7 October 2013; accepted 17 October 2013

Published as Immediate Publication 17 October 2013, doi: 10.1042/CS20130272

www.clinsci.org