1

Investigation of amino-tail translocation by the

conserved YidC, Sec and independent pathways

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy

in the Graduate School of The Ohio State University

By

Sri Karthika Shanmugam

Ohio State University Biochemistry Program

The Ohio State University

2019

Dissertation Committee

Dr. Ross E. Dalbey, Advisor

Dr. James Cowan

Dr. Natividad Ruiz

Dr. Thomas Magliery

2

Copyrighted by

Sri Karthika Shanmugam

2019

ii

Abstract

Chapter 1 of this dissertation reviews existing knowledge of the areas of protein

translocation and membrane insertion. The core machineries involved in membrane protein

biogenesis are remarkably conserved. Proteins that fold within the cell prior to export are

translocated by the Tat system. Canonical substrates of this pathway possess signal

sequences with a twin-arginine motif which interacts with the TatABC membrane

translocon complex to facilitate substrate translocation. The majority of the secreted and

membrane proteins are translocated by the Sec machinery in an unfolded state. It consists

of the SecY, SecE and SecG proteins which form an hour-glass shaped channel with a

lateral gate opening into the membrane. Substrate targeting to the Sec translocon occurs

either post-translationally or co-translationally. Most exported proteins in E. coli are post-

translationally targeted by the SecA/B pathway. The SecB is a molecular chaperone that

delivers a subset of substrate proteins in an unfolded state to SecA. The SecA motor

ATPase powers the movement of substrates through the SecYEG channel. Co-translational

iii

targeting typically involves the association of the translating ribosome with the translocase

directly, or with the translocase after delivery by the signal-recognition particle (SRP) and

its receptor (SR). Certain substrates of the SRP pathway are targeted to another translocon,

YidC. YidC plays a pivotal role in the membrane integration, folding and assembly of a

subset of proteins including energy-transducing and respiratory complexes. It functions

both autonomously and in concert with the SecYEG channel in bacteria. The YidC family

of proteins are widely conserved in all domains of life with new members recently

identified in the eukaryotic ER membrane. Bacterial and organellar members share the

conserved 5 TM core which forms a unique hydrophilic cavity in the inner leaflet of the

bilayer accessible from the cytoplasm and the lipid phase. The work presented here

investigates the pathway-determining factors for amino-terminal translocation in E. coli.

In addition, the conserved function of the YidC family of proteins to insert a single-

spanning protein into the membrane was explored using biophysical methods.

Different attributes of membrane protein substrates have been proposed and characterised

as translocation-pathway determinants. However, several gaps in our understanding of the

mechanism of targeting, insertion and assembly of inner membrane proteins exist.

Specifically, the role played by hydrophilic N-terminal tails in pathway selection is unclear.

In Chapter 2, we have evaluated length and charge density as translocase determinants

using model proteins. Strikingly, the 36 residue N-tail of 2Pf3-Lep translocates

independent of YidC-Sec. This is the longest N-tail region that is translocated by this

pathway. We confirmed this using a newly constructed YidC-Sec double-depletion strain.

Increasing its N-tail length with uncharged spacer peptides led to YidC dependence and

iv

eventually YidC-Sec dependence, hence establishing that length has a linear effect on

translocase dependence. Tails longer than 60 residues were not inserted, however an MBP-

2Pf3-Lep fusion protein could be translocated. This suggests that longer N-tails can be

translocated if it can engage SecA. In addition, we have examined how the positioning of

charges within the translocated N-tail affects the insertion pathway. Additional charges can

be translocated by the Lep TM when the charges are distributed across a longer N-tail. We

tested charge density as a translocase determinant and confirmed that the addition of

positive or negatives charges led to a greater dependence on YidC-Sec when they were

placed close to each other than away. Findings from this work make an important advance

in our existing knowledge about the different insertion mechanisms of membrane proteins

in E. coli.

The YidC family of proteins share structural homology and engage in the process of

membrane protein biogenesis of various cellular and organellar membranes. Chapter 4

explores the functional conservation amongst the eukaryotic YidC homologs by testing the

insertion of the YidC-only model substrate Pf3 coat protein. Fluorescence correlation

spectroscopy technique was utilized to follow the insertion process at the single-molecule

level in vitro. The thylakoid membrane of chloroplasts contains 2 YidC-paralogs: Alb3 and

Alb4. Although both have distinct set of substrates in the chloroplasts, we found that they

can insert Pf3 coat substrate with comparable efficiencies to YidC. This is in agreement

with the fact that these insertases can complement YidC in E. coli. We also tested the

mitochondrial homolog Oxa1 and the newly proposed ER-resident member Get1. Oxa1 is

a bonafide member of the YidC family; both YidC and Oxa1 can complement one another.

v

However, experimental evidence is lacking to confirm the placement of Get1 in the YidC

family. Interestingly, both Oxa1 and Get1 can insert Pf3 coat protein into reconstituted

proteoliposomes. This suggests that Get1 and the other homologs tested are functionally

conserved. This study provides fundamental information about the evolutionarily

conserved role of YidC in membrane protein biogenesis.

vi

Dedication

This document is dedicated to my family.

vii

Acknowledgments

Firstly, I would like to thank my advisor, Dr. Ross E. Dalbey, for his mentorship, support

and encouragement throughout the course of my graduate studies.

Additionally, I am grateful for the valuable advice and feedback that were provided by our

collaborators Dr. Andreas Kuhn and Dr. Gregory Phillips. I would like to thank my

committee members Dr. James Cowan, Dr. Natividad Ruiz and Dr. Thomas Magliery for

their support and guidance.

I would also like to thank former and current lab members Dr. Bala Subramani Hariharan,

Dr. Yuanyuan Chen, Haoze He and Margaret Steward for their advice and friendship. I am

also grateful to the Kuhn lab for their support.

Most importantly, I would like to thank my father Dr. K. R. Shanmugam for his counsel

and encouragement. I am grateful to my sister Sakthi Indra Shanmugam and my

grandmother Rukmani Rangasamy for their constant love and support.

Finally, I would like to thank my friends Sharadhi Sukumaran, Karthic Subramanian,

Anusha Kumar, Suriya Subramanian, Dr. Nidhi Seethapathi and Gowtham Venkatraman

for their kindness and motivation during this journey.

viii

Vita

May 26, 1992 .................................................Born in Erode, India

2013................................................................B. Tech. Industrial Biotechnology,

Anna University, India

2013 - Present ...............................................Graduate Teaching and Research Associate,

Department of Chemistry and Biochemistry,

The Ohio State University

Publications

Chen, Y., Soman, R., Shanmugam, S. K., Kuhn, A., and Dalbey, R.E. (2014) The role of

the strictly conserved positively charges residue differs amongst Gram-positive, Gram-

negative and chloroplast YidC homologs. J. Biol Chem. 289, 35656 - 35667.

Fields of Study

Major Field: Ohio State University Biochemistry Program

ix

Table of Contents

Abstract ............................................................................................................................... ii

Dedication .......................................................................................................................... vi

Acknowledgments............................................................................................................. vii

Vita ................................................................................................................................... viii

Publications ...................................................................................................................... viii

Fields of Study ................................................................................................................. viii

Table of Contents ............................................................................................................... ix

List of Tables ..................................................................................................................... xi

List of Figures ................................................................................................................... xii

Chapter 1 ............................................................................................................................. 1

Introduction ..................................................................................................................... 1

1.1 Overview of bacterial membrane protein translocation ................................... 1

1.2 Tat pathway ...................................................................................................... 4

1.3 Sec pathway ...................................................................................................... 8

1.4 YidC family of proteins .................................................................................. 17

1.5 Figures ............................................................................................................ 25

Chapter 2 ........................................................................................................................... 29

New insights into amino-terminal translocation as revealed by the use of YidC and Sec

depletion strains ............................................................................................................ 29

x

2.1 Introduction .................................................................................................... 29

2.2 Results ............................................................................................................ 32

2.3 Discussion ....................................................................................................... 39

2.4 Materials and methods .................................................................................... 43

2.5 Tables.............................................................................................................. 49

2.6 Figures ............................................................................................................ 50

Chapter 3 ........................................................................................................................... 69

FCS analysis of Pf3 coat insertion by reconstituted YidC homologs ........................... 69

3.1 Introduction .................................................................................................... 69

3.2 Results ............................................................................................................ 73

3.3 Discussion ....................................................................................................... 75

3.4 Materials and methods .................................................................................... 78

3.5 Figures ............................................................................................................ 82

Chapter 4 ........................................................................................................................... 90

Conclusion .................................................................................................................... 90

4.1 Summary of work performed ......................................................................... 90

4.2 Figures ............................................................................................................ 93

References ......................................................................................................................... 95

xi

List of Tables

Table 2.1 - Oligonucleotide primers used in NB167 strain construction. ........................ 49

xii

List of Figures

Figure 1.1 - YidC family of proteins. ............................................................................... 25 Figure 1.2 - Model of YidC-mediated membrane insertion of Pf3 coat protein. .............. 27 Figure 1.3 - Model of YidC-Sec insertion pathway. ......................................................... 28 Figure 2.1 - Construction of model substrates. ................................................................. 50 Figure 2.2 - N-tail length requirement for translocase dependence. ................................. 52

Figure 2.3 - Increasing N-tail length directs YidC-only N-tails to YidC-Sec pathway. ... 54

Figure 2.4 - Translocation of MBP in the N-terminal direction. ...................................... 56

Figure 2.5 - The translocation of MBP-2Pf3-Lep is blocked when Arg residues are added

to its TM and analysis of its SecA-dependence. ............................................................... 58

Figure 2.6 - Testing negative charge distribution on N-terminal tail as a pathway-

determinant. ...................................................................................................................... 60

Figure 2.7 - Testing positive charge distribution on N-terminal tail as pathway-

determinant. ...................................................................................................................... 62 Figure 2.8 - Confirming non-promiscuous insertion of 2Pf3-Lep using YidC-Sec double-

depletion. ........................................................................................................................... 64 Figure 2.9 - Detection of YidC and Sec depletion using western blot. ............................ 66

Figure 2.10 - Amino acid sequence of the model protein constructs................................ 68 Figure 3.1 - Single molecule studies using FCS. .............................................................. 82

Figure 3.2 - Comparison of Pf3 insertion efficiencies by the chloroplast Alb3 and Alb4

paralogs. ............................................................................................................................ 84

Figure 3.3 - Comparison of Pf3 insertion efficiencies by the eukaryotic homologs Oxa1

and Get1. ........................................................................................................................... 86 Figure 3.4 - Representational purification of Alb4. .......................................................... 88

Figure 4.1 - Model for N-tail translocation pathway based on length and charge density.

........................................................................................................................................... 93

1

Chapter 1

Introduction

1.1 Overview of bacterial membrane protein translocation

Biological membranes are protective barriers that separate the cytosol of a cell or enclose

organelles within a cell. The cellular membrane is primarily constituted by phospholipids

arranged as a bilayer and is highly dynamic in nature. It is decorated by an assortment of

integral or peripherally-associated proteins that perform essential functions for the cell like

signal transport, enzymatic activity and cell-cell communication. It is selectively

permeable; however, the membrane is fluidic, allowing the lateral diffusion of its

phospholipid and protein components to perform their different functions. In addition to

the cell membrane, eukaryotes have evolved to contain multiple endomembranes with

unique compositions that border the sub-cellular organelles like mitochondria, lysosome,

2

chloroplast, endoplasmic reticulum, golgi body, peroxisome and nucleus. Some organelles

have multiple surrounding membranes as found in the mitochondria and chloroplasts.

In bacteria, two distinct subgroups exist that differ in their membrane organization and

composition. Gram-positive bacteria contain only the cytoplasmic membrane surrounded

by peptidoglycan cell wall with a narrow periplasmic space in between. A

lipopolysaccharide-rich outer membrane is present in Gram-negative bacteria that is

separated from the cytoplasmic one by a large periplasmic space. Within the periplasmic

space, there is a thin layer of peptidoglycan making up the cell wall. The phospholipid

composition of membranes varies between different species and its environment (1).

Typically, the phospholipids are amphipathic with a hydrophilic head group facing the

aqueous cytosol or periplasm, followed by a tail region made of two fatty acid chains that

form the hydrophobic core of the membrane.

Around 30% of all genes encode membrane proteins and about 20% of the E. coli genome

codes for its cytoplasmic membrane proteins (2). Membrane proteins vary greatly in size,

topology and composition enabling them to perform their different functions either in or at

the membrane. Membrane proteins are responsible for mediating several important

processes like respiration, electron chain transfer, ATP synthesis, cell division, signal

transduction and controlled transport of ions, nutrients and proteins. Not surprisingly, about

60% of all known drug targets are membrane proteins owing to their ease of access and

prominent roles in the cell. Membrane proteins typically possess hydrophobic

transmembrane domains and hydrophilic cytoplasmic and periplasmic domains. In E. coli,

3

the inner membrane proteins have alpha-helical secondary structure domains whereas beta-

barrel proteins reside in the outer membrane.

The hydrophobic nature of the membrane poses a challenge for translocation of the polar

domains of membrane proteins. Proteins need to be shuttled to their destined location by

moving into different organellar or the plasma membrane. In bacteria, proteins synthesized

in the cytosol are required to translocate across one or both membranes in order to reach

its final destination outside the cytosol. The movement of molecules across the membrane

bilayer is regulated by specialized machineries. In particular, the molecular devices that

facilitate the insertion and translocation of proteins across the membrane are conserved in

all domains of life. Remarkably, the proteins are inserted/exported via two different

targeting pathways, co-translational and post-translational. Further upon reaching their

desired location, the substrate proteins are assisted in the folding of the polypeptide chain

to enable it to achieve its final functional form.

Recent advancements in technology has fueled research on membrane protein biogenesis

and the different secretory systems. The fundamental steps involved in the essential

pathway of protein trafficking across the membrane is an active area of study. In this

chapter, we will focus on what is known about the different molecular machineries that

facilitate the membrane translocation of proteins in E. coli so far.

4

1.2 Tat pathway

Many essential exported proteins require the cellular environment for their proper folding

and co-factor association. This includes proteins that require binding to divalent metal ions

or those that are secreted into conditions that are not conducive for folding such as in case

of extremophilic organisms (3, 4). Prominent examples are certain redox proteins involved

in anaerobic respiration, virulence factors and members of the iron and phosphate nutrition

pathway. Cell solves the challenge of translocating bulky globular proteins across the

membrane without disrupting the membrane integrity using the twin-arginine translocation

(Tat) system (5, 6). This pathway has the special ability to transport prefolded proteins

along with their cofactors across the membrane (7). It is broadly conserved across all

domains of life (8, 9).

Substrates of this pathway possess a signal peptide which directs it to the Tat system (10).

The Tat signal peptide has a tripartite structure: a positively charged N-terminus followed

by a moderately hydrophobic segment and a C-terminal region. Signal Peptidase enzyme

(SP1) cleaves off the signal once the substrate is translocated. Sequencing analysis revealed

that the consensus sequence S/T-R-R-X-F-L-K (X is any polar amino acid) is present in

the N-terminal region of the signal sequence of most Tat pathway substrates. The

conserved nature of the double-Arg in the signal led to the term twin-arginine translocation

for this system.

5

In some cases, either one of the Arginine residues could be replaced by a Lysine residue

and still be targeted to the Tat system with varying efficiencies (11-13). However, the other

residues in the consensus sequence are more compliant with substitutions (14). While a

subset of the proteins that contain this twin arginine signal sequence are strictly exported

by the Tat system, there are some that are said to be able to promiscuously translocate by

either the Tat or the Sec translocon, which is the major protein translocase that is discussed

in detail later in this chapter (15). Interestingly, certain proteins that do not have this signal

sequence are exported by Tat as a part of a multimeric complex where at least one protein

has the Tat-specific signal and the other proteins “hitchhike” along with it (16). There are

no known targeting factors to the Tat system, however, the signal sequence has been shown

to bind to Trigger factor (TF), DnaK, SlyD and REMP proteins which may assist in folding

of the substrate before targeting to Tat for translocation (17-19).

Most organisms have a TatA and TatC pair forming the translocase complex. TatC is the

major component of the Tat translocon. The E. coli version has 6 TM segments with a Nin-

Cin orientation (20). X-ray studies revealed that it forms a curved wall structure with a

periplasmic cap that covers the central groove of the concave domain (21). This

periplasmic cap region is formed by the first two periplasmic loops of the protein. TatC is

said to directly engage with the twin-arginine motif of the signal peptide, acting as an initial

substrate docking site (22). It is also shown to interact with other TatC proteins (23).

Suppressor mutation studies revealed that the N-tail and cytoplasmic loop 1 regions are

involved in signal peptide recognition (24). In addition, the C-terminal region is shown to

be critical for protein translocation in B. subtilis (25).

6

The other more abundant member of the complex is TatA, which has an Nout-Cin

conformation with an N-terminal TM segment ending in a hinge region, followed by a

predicted amphipathic helix that lies along the cytoplasmic interface and ending with an

unstructured C-tail (26). In certain Gram-negative and chloroplast systems, an additional

TatA-like protein called TatB is present and essential for translocation (27). Despite the

structural similarity, TatB has distinct functions in the cell, indicating that this could be the

result of an early duplication event (28). Interestingly, TatA from Gram-positive B. subtilis

could functionally replace TatB and TatA of the TatABC complex in E. coli (29). It is also

shown that TatB contacts TatA in its TM region and the substrate signal peptide in the

presence of TatC (30, 31). Thus, it could be serving as an intermediary, handing over the

substrate from TatC to TatA. It is also shown to stabilize the TatBC complex formation

(32).

The mechanism of Tat-mediated translocation is an active field of study. Different models

have been proposed and tested but the process is incompletely understood at the present

time. According to the current model, there are three steps involved: substrate recruitment,

TatA oligomerization and cargo translocation. In the first step, the signal peptide of the

substrate is docked onto the signal peptide recognition site on TatC (30, 33). TatB (TatA-

like protein) interacts with TatC and the substrate to form the TatBC complex (32). A recent

study suggests that TatB proteins form a dome-like structure surrounded by TatC proteins

which form the substrate-binding cavity in the membrane (34). This initiates the formation

of a translocation complex in the next step by recruiting several TatA subunits to the TatBC

complex in a proton-motive-force dependent manner (35, 36). In the second step, TatBC

7

complex binds to TatA proteins making contacts with TatB where the substrate is handed

over for translocation.

For the final step, there are two different models that attempt to explain the translocation

process: the pore model and the membrane-destabilization model. Evidence for the pore

model emerged through a single-particle EM study that showed that TatA proteins can

assemble to form pore-like structures through which the substrates could be translocated

across (26). In keeping with this, TatA oligomers run at different sizes on Native-gels,

suggesting that TatA composition in the complex can be altered to accommodate the folded

cargo of varying diameters (37). It is suggested that the amphipathic helix region of TatA

protein folds or twists inside in such a way to translocate the substrate through the TatA

complex pore (38, 39). However, the presence of an aqueous translocation pore lined by

the amphipathic helix is yet to be confirmed and how this pore prevents the leakage of

cellular contents needs further investigation.

In contrast to the pore model, the membrane destabilization model interprets the EM results

as TatA protein aggregates that form destabilized regions on the membrane that enables

the passage of substrate cargo (40). In addition to this, the TM segment of TatA is not long

enough to span the membrane bilayer (41). The amphipathic helical region is not flexible,

so it was suggested that the movement of the helix into the membrane would be disruptive

(42). Lastly, phage shock protein PspA is linked with the Tat pathway, which suggests that

Tat-mediated translocation might induce stress in the cell (43). PspA is also implicated in

reducing proton leakage in the cell (44) and has been shown to interact with TatA in E. coli

8

(45). This evidence combined with the observation that PspA improves Tat-cargo export

support the membrane destabilization model (46). Nevertheless, a clear picture of what the

transportation device looks like and how the transport occurs needs to be elucidated to fully

understand the system.

1.3 Sec pathway

Majority of the proteins that need to insert or translocate across the membrane in E. coli

utilize the Sec machinery to accomplish this task (47). The core complex is composed of

the heterotrimeric SecYEG proteins which together forms the protein-conducting channel.

Owing to the unique structure of the channel, substrates can be both vertically exported

across the membrane as well as laterally inserted into the membrane (48). Substrates of this

pathway are translocated in an unfolded state either co-translationally or post-

translationally. The Sec machinery is conserved in all domains of life, serving as the major

translocase in the plasma membrane of prokaryotes and in the thylakoid and endoplasmic

reticulum (ER) membranes of eukaryotes (49).

E. coli Sec-dependent substrates typically contain an N-terminal hydrophobic signal

sequence or signal anchor which is utilized for targeting through the interaction of a

number of binding partners. Membrane protein substrates are targeted co-translationally as

ribosome nascent chain complexes (RNCs) where the signal recognition particle (SRP)

binds to the N-terminal signal anchor as it emerges from the ribosome exit tunnel and

9

directs it to its membrane-associated receptor FtsY for translocation (50). In contrast, most

secretory proteins are targeted post-translationally as pre-proteins that are stabilized in the

unfolded state by chaperones like SecB and by engaging with the motor ATPase SecA

protein (51). However, SecA is also involved in the translocation of large periplasmic

domains of membrane proteins (52). These targeting pathways will be discussed in detail

later in this chapter.

The Sec channel is composed of the three integral proteins SecY, SecE and SecG (53). The

first crystal structure of the archaeal SecY complex was solved in a ground-breaking study

published in 2004 (48). It revealed, along with existing experimental data, that the channel

is functional in its monomeric form. SecY protein is the largest, with 10 transmembrane

(TM) segments that forms a pseudo-symmetrical crab-claw like structure where the two

halves (5 TM each) are connected by a hinge formed by the loop between TM 5 & 6. On

the opposite side of the hinge, a lateral gate that can allow membrane proteins to exit into

the lipid bilayer exists (54). The two halves of SecY can further separate to widen the

lateral gateway. SecE consists of 1 to 3 TMs and a horizontal amphipathic helix on the

cytoplasmic membrane surface. It stabilizes SecY by wrapping around the two halves.

SecG contains 1 or 2 TM segments and is found at the periphery of the complex. Although

SecG is non-essential, it improves the translocation efficiency (55).

In addition to revealing the architecture of the channel, the structure provided a deeper

understanding of how the channel functions to move proteins inside or across the

membrane without compromising the membrane integrity. It was shown that protein

10

translocation was feasible because it contained an hour-glass shaped channel which is open

to both the cytoplasm and the periplasm. The translocating polypeptides moved through a

tight pore of 3 - 5 A in the center that is surrounded by ring of hydrophobic residues (56).

TM 2a of SecY acts as a plug helix on the periplasmic side that seals the pore when the

channel inactive (48). The plug helix can be in the center of the channel or at the periphery,

suggesting that it moves away during the translocation process to allow the nascent chain

to pass through (57). However, the plug is non-essential for the E. coli SecY channel as the

neighboring loops may take its place (58, 59).

The lateral gate opening was further characterized by later studies that captured the SecY

complex in a “semi-open” state (60, 61). It was shown that TM 7 and TM 2b of SecY move

away from each other upon SecA binding, revealing a gap opening to the membrane

bilayer. In addition to this, the plug helix was shown to be slightly displaced at this stage,

but not completely open as it is during protein translocation. The translocation process is

believed to occur via three steps: i) Activation of the channel by cytoplasmic SecA with a

substrate bound in an unfolded confirmation. ii) Insertion of the substrate into the channel

where the signal sequence interacts at the lateral gate and the C-terminal is translocated

across via the SecY pore. iii) ATP hydrolysis catalyzed by SecA powers the translocation

of the protein into the periplasmic space, while the substrate TM segments exit the channel

via the lateral gate. The observation that a signal sequence added in trans is sufficient for

protein translocation and the identification of protein localization (prl) mutations on the

lateral gate that allows the export of preproteins with defective signals further substantiate

this model (62, 63).

11

The ancillary elements SecDFYajC and YidC are involved in the Sec-mediated membrane

insertion process in E. coli (64). However, in eukaryotes a different set of proteins assist in

the process like the translocating chain-associated membrane protein (TRAM) and the

translocon-associated protein (TRAP) (65). SecD and SecF that function in bacteria and

archaea are integral proteins with 6 TM segments each. SecDF structure revealed a mobile

periplasmic domain and its proton-conducting function (66). It is proposed that the proton

movement through the complex prompts conformational changes in its periplasmic

domain. It is speculated that these changes result in a pulling action on the translocating

substrate from the periplasmic side and prevent its back-sliding. YajC has a single TM with

a cytoplasmic domain and is a shown to form a complex with SecDF, but its function is

unknown. It is proposed that SecDFYajC complex recruits the membrane insertase YidC

to form the Sec holocomplex, which will be discussed in detail in later in this chapter.

SecA-mediated targeting

SecA is a highly dynamic nanomotor that drives the export of majority of the secretory

proteins post-translationally in E. coli in association with the Sec translocon (67). It

catalyzes the protein translocation process via two distinct modes of action: i) As a

targeting factor that guides preproteins synthesized in the cytoplasm to reach their destined

location at the SecYEG channel. ii) Energizes the channel to translocate the substrate

protein using ATP hydrolysis to power the process (68). Perhaps to enable these dual roles,

SecA exists as both membrane-associated as well as cytoplasmically diffusing. In order to

maintain the preprotein substrates in an unfolded state until translocation, SecA is also

12

believed to recruit the preprotein that is bound to chaperone proteins like SecB or TF (69,

70), but the complex network of interactions that facilitate this process is not fully

understood.

The structural organization of SecA has been elucidated using crystallographic and

biochemical techniques (61, 71). The studies revealed that it has a helicase-like DEAD

motor composed of two RecA-like nucleotide binding domains (NBD1 & NBD2) and an

Intramolecular Regulator of ATP hydrolysis 2 (IRA2) domain, which together binds and

hydrolyses ATP to energize SecA function for translocation (72). In addition to the DEAD

motor, it possesses a preprotein binding domain (PBD) (73) and a C-terminal domain

(CTD), which has the motile IRA1 subdomain (also called as the two-helix finger (74))

and a zinc finger region that is known to interact with SecB (75). PBD binds to the signal

peptide of the substrate protein (76), but it may also bind to certain regions of the mature

domain (73, 77). SecA is capable of dimerizing under certain conditions but it is unclear if

it is the native state (78, 79).

The mechanism of SecA mediated targeting has the following proposed steps. First, the

preprotein that is being synthesized in the cytoplasm is recognized by SecA and/or

chaperone proteins. Recognition is facilitated by the interaction of SecA with the substrate

N-terminal signal as well as certain regions of the mature domain. Recent studies suggest

that the ribosome exit tunnel protein L23 binds SecA (80). In addition, cryo-EM studies by

Singh et al proposed another binding site near L22 and L24, which could allow the binding

of two SecA molecules at the same time (81). TF is also proposed to bind L23 protein,

13

however, superimposing the structures showed no steric clash for binding (82). This

suggests that SecA likely scans the emerging polypeptide for a signal sequence with

moderate hydrophobicity and binds to it along with chaperone proteins to carry out post

translational targeting of the substrate to SecYEG (83). In addition, SecA also has the

capacity to bind preproteins that are completely released from the ribosome and located in

the cytoplasm.

Once the SecA binds the preprotein, it undergoes conformational changes including dimer

to monomer conversion to activate the channel (84). The structure of SecYEG complexed

with monomeric SecA (72, 80) revealed a groove at the interface through which the

preprotein can enter the channel. The signal peptide unlocks the channel as observed with

the prl mutations (85) and the translocation process begins. SecA binds and catalyzes

multiple rounds of ATP hydrolysis while simultaneously moving the preprotein through

the SecYEG pore using its “two-helix finger” region. Consistent with this, Rapoport’s

group showed that the model secretory substrate proOmpA contacts both the SecA two-

helix finger and the SecY pore ring (74). SecA could be crosslinked to the pore ring as

well. About 20-30 residues of the substrate protein are translocated through the channel

per ATP hydrolysis cycle (86). PMF is hypothesized to play a role in orienting the signal

sequence at the start of the translocation step. Once the substrate is translocated, the signal

peptide is cleaved off by SP1 enzyme, whose catalytic domain is on the periplasmic side

of the membrane. Finally, the mature protein either folds in the periplasmic (Gram-negative

bacteria) or extracellular space (Gram-positive bacteria) or is inserted into the outer

membrane of Gram-negative bacteria via other specialized machineries.

14

SecB chaperone

Sec-dependent exported proteins synthesized in the cytoplasm need to be maintained in an

unfolded state. Cytosolic chaperone proteins like SecB and TF assist in this process and

also prevent the aggregation and degradation of substrate proteins. TF is ubiquitous in

bacteria, however SecB is prevalent in proteobacteria only (87). But in E. coli a group of

proteins require SecB for proper secretion. This suggests that there must be other proteins

with functional overlap that take up this role in other organisms. General chaperones like

DnaK and DnaJ are proposed to carry out this function in bacteria that lacks SecB (88).

The functional unit of SecB is homo-tetrameric (89). The crystal structure of SecB revealed

a 70 A channel on either side of the tetramer which is proposed to be the preprotein binding

site. These binding sites had deep cleft regions lined with bulky hydrophobic side chains

that could bind to unfolded hydrophobic regions of the substrate protein. In addition, it has

a shallow groove that could potentially bind to β-sheet regions of the polypeptide. The Zn-

binding domain of SecA functions to interact with SecB at its C-terminus electrostatically

(90, 91). It has a higher binding affinity to SecA when it is associated with SecYEG (92).

This later study suggests that SecB binding induces conformational changes in SecA and

leads to the transfer of the substrate protein from SecB to the channel-associated SecA for

translocation. Further, Crane et al showed that SecB has a higher binding affinity to SecA

in its dimeric form than in monomeric form, suggesting that SecB dissociates when SecA

monomerizes during translocation (91).

15

SRP-mediated targeting

Membrane protein targeting is a crucial step in the biogenesis of membrane proteins and

the machineries that regulate this process are universally conserved. The dynamic

interactions between the Signal Recognition Particle (SRP) and its receptor FtsY (also

known as SRP receptor or SR) facilitate the co-translational delivery of substrate

membrane proteins as ribosome-nascent chain (RNC) complexes to their destined location

in the membrane (93). Chloroplast SRP is an exception to this since it operates post-

translationally to deliver substrate proteins to the thylakoidal membrane (94). SRP

typically targets proteins to the Sec translocon for membrane insertion (95), however new

evidences have emerged suggesting that certain substrates are targeted to another

translocon YidC (96).

The composition of SRP varies across different species, having some combination of

proteinaceous and/or RNA domains. Bacterial SRP is the simplest homologue which

remarkably contains one domain each of the protein and RNA component (97). The protein

component is a GTPase containing domain called the Fifty fourth homolog of the

eukaryotic SRP54 (Ffh) (98). It also has a 4.5S RNA component that has been shown to be

essential for SRP stability and its function (97). The SRP receptor is usually membrane-

associated and has a similar GTPase domain as the SRP (99). The bacterial SRP receptor

homologue lacks the TM domain found in the eukaryotic SR. This could explain the

appearance of SR as evenly distributed between the membrane and the cytoplasm in

bacteria, however the role of cytosolic SR is unclear (100). Amazingly, the bacterial SRP

16

and SR can replace their sophisticated mammalian counterparts to mediate successful

targeting of substrate proteins to the ER indicating the evolutionarily conserved function

of this pathway (101).

Bacterial Ffh has two functionally distinct domains: a methionine-rich region called the M

domain and the NG domain that contains the amino-terminal and the GTPase domain (102,

103). Crystallographic evidence showed that the M-domain has a flexible signal peptide

groove that is lined with methionine residues that can interact with various hydrophobic

sidechains (104, 105). The studies also revealed the presence of a flexible fingerloop

structure which may stabilize the substrate signal sequence in the groove, but this remains

to be tested (106). Residues on this fingerloop have been demonstrated to be critical for

GTPase activity and SR binding (107). SR consists of an A domain that is believed to

involve in membrane binding and a GTPase containing NG domain (108, 109). The A

domain of SR can be crosslinked to the SecY cytoplasmic loop regions, which are also said

to contact the ribosome (110, 111).

SRP mediated substrate targeting and delivery consists of the following steps. Recognition

and binding of the N-terminal signal sequence of substrate proteins emerging from the

ribosome exit tunnel by SRP, which initiates conformational changes in SRP and facilitates

binding to SR. Lastly, GTP hydrolysis powered dissociation of SRP and SR and the

successful transfer of RNC complex to the translocon (112). E. coli SRP differentiates

between cytoplasmic and membrane-destined proteins based on the increased

hydrophobicity of the signal sequence, which is typically 20-30 residues long with a

17

tripartite structure described before and may be cleaved off by SP1 on reaching the desired

membrane location (113). Interestingly, SRP can bind to non-translating ribosomes

however the interaction is much more stable in the presence of the signal sequence (114,

115).

Once SRP binds to the ribosome in such a way that the M domain is positioned to receive

the nascent signal peptide emerging from its exit tunnel, a series of conformational changes

are initiated in the G domain and the SRP-RNC complex is directed to the SRP receptor

(116, 117). A “closed” state conformation is achieved where the NG domains of both SRP

and SR are surrounded by GTP molecules (118). The SRP RNA Tetraloop region of the

4.5S RNA has been shown to interact with SR in the presence of RNC initially (119).

However, data presented in (118) showed that the GTPase domains of SRP and SR are

displaced towards the opposite end of the 4.5S RNA which may facilitate the increased

GTPase activity. The RNC complex is transferred to the Sec translocon and the SRP-SR

complex disassembles upon GTP hydrolysis enabling the recycling of components.

However, the mechanistic details of RNC complex hand-over to the different translocons

and how specificity is achieved is not clear.

1.4 YidC family of proteins

Membrane proteins constitute about 30% of the cellular proteome (120) and perform

critical functions like signal transduction, molecular transport and cell adhesion. The

18

molecular machineries that catalyze their targeting, insertion and assembly in the different

cellular and subcellular membranes are remarkably conserved. Sec translocon is

responsible for moving the majority of the proteins across/into the bacterial, archaeal,

thylakoidal and ER membranes in an unfolded state (49). In bacteria, it is proposed to form

a holo-complex composed of the heterotrimeric protein channel SecYEG, and the

accessory elements SecDFYajC, SecA ATPase and YidC (121).

As part of the holo-complex, YidC operates in various capacities ranging from assisting in

the membrane insertion process and the lateral clearance of the substrate TM segments

from the channel to serving as a foldase for Sec-dependent proteins (122). In addition to

this, YidC facilitates the membrane insertion of small membrane protein substrates

independently (123). While larger proteins are typically targeted by the SRP-FtsY

partnership to the Sec holotranslocon, smaller substrates that cannot engage SRP are post-

translationally delivered to YidC (124). However, certain YidC-only substrates like MscL

(96) and the tail-anchored proteins TssL (125), DjlC and Flk (126) employ SRP for

targeting.

YidC/Alb3/Oxa1 family proteins are highly conserved insertases that operate in the

bacterial, thylakoidal and mitochondrial inner membrane respectively (127). Structurally,

they are helical bundles formed by 5 core TM segments (Fig 1.1). YidC is required for the

insertion and assembly of several respiratory and energy-transducing proteins (128) like

the subunits of the F1FOATPase (129), Cytochrome o Oxidase (130) and NADH

dehydrogenase (131). In Gram-negative bacteria, YidC has an additional N-terminal TM

19

segment that acts as a membrane anchor followed by a large beta-sandwich fold within the

first periplasmic domain (132). Although these regions are largely non-essential for

function (133), they have contact sites to SecY (134) and SecDF (135), suggesting a kinetic

role in the protein insertion and substrate folding process. Most Gram-positive bacteria

possess two paralogs: YidC1 and YidC2. While YidC1 is constitutively expressed, YidC2

gene expression is controlled by a MifM sensor protein in B. subtilis (136). Though the

paralogs are functionally exchangeable, YidC1 is specifically required for the sporulation

process (137).

In archaea, DUF106 protein has a three-TM core with a low structural homology to the

bacterial YidC, but its protein insertion function remains to be tested (138). Eukaryotes

contain multiple YidC paralogs and some of them can replace E. coli YidC at least partially,

indicating shared functionality in the cell (139-141). In plants, the paralogs Alb3 and Alb4

exist in the thylakoid membrane of chloroplasts (142, 143). The primary substrates of Alb3

are a subset of the light-harvesting chlorophyll binding protein subunits (144), whereas

Alb4 is involved in the biogenesis of chloroplast F1FOATPase assembly (145). A

prominent feature of Alb3 is the presence of a long cytoplasmic C-terminal domain which

acts as an anchor for SRP43 (146). Both post-translational and co-translational targeting

occurs and Alb3 is known to interact with the chloroplast SecYE translocon like its

bacterial counterparts (147). Oxa1 and Oxa2 paralogs are found in the mitochondrial inner

membrane of eukaryotic cells (148, 149). Sec is absent in this membrane, so Oxa1 is

believed to facilitate the insertion of all mitochondrial DNA encoded membrane proteins

independently (150). Oxa1 has a C-terminal extension which is the ribosome-docking site

20

for translating substrates that are co-translationally inserted (151). Oxa2 performs similar

insertion function for certain respiratory proteins post-translationally (152).

Until recently the presence of YidC homologs in the ER was unknown (153). Anghel et al

(154) employed phylogenic homology studies and identified three Oxa1-like highly

conserved proteins: TMCO1, EMC3 and Get1 which are all involved in the ER membrane

protein translocation process in eukaryotes. The study found that Get1 and EMC3 proteins

were evolutionarily related to the DUF106 group of proteins. Get1 is a part of the tail-

anchored protein insertion complex and substrates of this pathway have a C-terminally

located TM segment that is post-translationally targeted to the ER membrane (155). The

ER Membrane Complex 3 (EMC3) promotes the co-translational membrane insertion of

multi-pass ER proteins with charged TM segments (156, 157). TMCO1 is predicted to

insert newly synthesized ER membrane proteins co-translationally, but it also engages with

the Sec translocon like YidC (154).

YidC-only pathway

YidC’s function was first annotated in 2000 (123); it was shown to be essential in E.coli

and required for the insertion of phage proteins Pf3 coat and M13 Procoat which were

previously thought to insert by an unassisted mechanism. The minimal functional unit is

monomeric (158) even though YidC can dimerize under certain conditions (159). It was

shown using reconstituted proteoliposomes that YidC is sufficient for the membrane

integration of Pf3 (160). In addition to this, YidC is responsible for the membrane insertion

of subunit c of ATP synthase (129), the mechanosensitive channel protein MscL (96) and

21

the C-terminal tail-anchored proteins TssL (161), DjlC and Flk (126). A common feature

of the YidC-only pathway substrates is that they contain short translocated regions

followed by one or two TM segments (162).

Crystal structures of YidC from Gram-positive (163) and Gram-negative bacteria (164)

uncovered important mechanistic details about its function. The conserved 5 TM core of

YidC forms a unique hydrophilic cavity in the inner leaflet facing the cytoplasm but is

closed from the periplasmic side. The groove contains a conserved positive charge which

was shown to be critical for function in gram-positive bacteria but not in the gram-negative

homolog (165). Kumazaki et al showed that MifM substrate could be crosslinked to the

groove (163). Hence it is proposed that the positive charge interacts electrostatically with

the charges on the substrate hydrophilic regions to recruit it into the groove and reduce its

membrane-crossing distance (Fig 1.2). Consistent with this, negative charges on the

substrate N-tail or TM segment have been proposed to act as YidC-only pathway

determinants (166, 167). The proton motive force (PMF) is implied to play a role in

releasing the hydrophilic domain from the groove but it is unclear whether this occurs and,

if so, how it occurs. Further reduction in membrane crossing distance for the substrate was

suggested by MD simulation studies (168) which found thinning of the membrane region

around YidC.

The major substrate contact sites of YidC are the hydrophobic residues found in TM3 and

TM5 that were shown by crosslinking studies to bind the substrate TM segment of Pf3 coat

(169) and MscL (170). This suggests that YidC facilitates substrate insertion through

22

hydrophobic interactions via a greasy-sliding mechanism (Fig 1.2). In line with this, Cryo-

EM studies showed that the TM segment of the FOc substrate is in proximity to the greasy

slide (171). Substrate insertion kinetics was studied in real-time using time resolved single-

molecule FRET analysis (172) which showed that the entire process of substrate contact,

insertion and separation from YidC occurred within 20 ms and Pf3 inserted into

reconstituted YidC proteoliposomes at the rate of 500 molecules per second.

Another feature of YidC is the cytosolic loops C1, C2 and the C-terminal tail region, of

which the latter two constitute the protein docking sites for receiving its translating

substrates. C1 loop forms a helical hairpin that is essential for function (165) and is believed

to be highly dynamic based on their relative positions in the crystal structures. Crosslinking

studies performed by Koch’s group show that the C1 loop interacts with SRP and FtsY,

highlighting its role in recruiting substrates (134). Similarly, Driessen et al found that the

C2 loop and C-terminal region of YidC provide stable docking sites for ribosome nascent

chain complexes (173). These studies define the role played by the different regions of

YidC leading to a better understanding of the mechanism of its insertion function.

YidC-Sec pathway

Substrate specificity studies indicate that YidC has limited potential to function

independently and the translocation of energetically unfavourable regions of substrates

require both YidC and Sec (174). Several essential inner membrane proteins like ATP

synthase subunit a, b (124, 175) and subunit II of Cytochrome b0 oxidase (130, 176), TatC

(177, 178) and anaerobic respiratory protein NuoK (167) are inserted by the combined

23

efforts of YidC and Sec. This phenomenon may also occur in higher eukaryotes in the ER

and thylakoidal membrane where YidC and Sec homologs are known to interact. The

bacterial holo-translocon (HTL), made up of SecYEG, SecDFYajC and YidC, is proposed

to be an efficient insertion machine for the membrane protein substrates of the YidC-Sec

pathway (179).

SecYEG forms a channel through which substrate polar domains are exported across the

membrane whereas the TM segments exit the channel with the help of YidC via a lateral

gate formed by TM 2b and TM7 of SecY (48, 180) (Fig 1.3). Consistent with this, lateral

gate of SecY can be photo-crosslinked to YidC (181). It is predicted that the greasy slide

of YidC might contact the SecY lateral gate and move the substrate TM segment via

hydrophobic interactions from within the channel and into the lipid bilayer. Recent insight

into how this partnership works has revealed that the first TM of E.coli YidC contacts SecY

and SecG (134). It is proposed that this TM may enter the channel and draw the TM

segments out through the lateral gate, but this remains to be tested. The study also reported

C1 loop as a contact site for SecY.

In addition to this, YidC is also known to act as a folding and packaging site for Sec-

dependent proteins (182). Nagamori et al (183) found that LacY protein required YidC to

achieve its functional folded form using monoclonal antibodies recognizing specific

conformational domains. Strikingly, the translocation of the six periplasmic domains of

LacY required only SecYEG while the folding of the protein was dependent on YidC (184).

YidC’s role in folding LacY was further explored by Serduik et al by using single molecule

24

force spectroscopy (185). A mechanical pulling force was applied on a single LacY

molecule to unfold it and extract it from a membrane using the stylus of a cantilever. This

protein was then slowly allowed to refold into another membrane in the presence of YidC.

The study showed that only in the presence of YidC, LacY could fold back to its stable

form in the membrane.

The accessory elements SecDFYajC is believed to promote YidC’s interaction with the

Sec channel (64). SecDF was shown to contact the periplasmic domain of E. coli YidC

using affinity pull-down experiments (135). This interaction may indicate the shared

functional role of SecDF and periplasmic domain of YidC in the substrate folding process.

The crystal structure of SecDF and electrophysiological experiments revealed a proton-

transport mechanism which could provide the energetic driving force for pulling the

substrate out of the Sec channel during translocation and prevent its back-sliding (66).

Substrates of this pathway are targeted to the holotranslocon by SRP and its membrane-

associated receptor FtsY for co-translational insertion (124).

25

1.5 Figures

Figure 1.1 - YidC family of proteins.

26

Top panel: Structural homology in the YidC/Alb3/Oxa1 family shown by highlighting the

conserved TMs in Green (TM1), Red (TM2), Cyan (TM3), Purple (TM4) and Yellow

(TM5) respectively. YidC structure is adapted from the crystal structure solved in B.

halodurans (PDB: 3WO7); Alb3 and Oxa1 structures are 3D computational models made

using SWISS-MODEL workspace as described in [186]. Bottom panel: Newly identified

members of Oxa1 superfamily highlighting the conserved three TM segments in Green

(TM1), Red (TM2) and Yellow (TM3) respectively. Archaeal DUF106 is adapted from the

crystal structure solved in M. jannaschii (PDB: 5C8J); Yeast Get1, Human TMCO1 and

Human EMC3 structures are evolutionary covariance-based 3D models adapted from [153,

154]. The cytoplasmic regions of these models were modified as described in [153].

27

Figure 1.2 - Model of YidC-mediated membrane insertion of Pf3 coat protein.

This figure is adapted from a review by Kiefer et al [187] (A) Binding of Pf3 coat protein

to YidC. (B) Pf3 TM segment interacts with the cytoplasmic part of the greasy slide and

the N-terminal tail of Pf3 (blue) enters the hydrophilic cavity of YidC possessing the

conserved Arg residue (red). (C) Pf3 coat TM segment inserts across the YidC “greasy

slide” formed by TM3 and TM5 (purple) and release of the N-tail into the periplasmic

space. (D) Release of Pf3 into the bilayer.

28

Figure 1.3 - Model of YidC-Sec insertion pathway.

(A) SRP bound substrate is co-translationally targeted to the Sec holotranslocon

(SecDFYajC not represented) via the membrane-associated SRP-receptor FtsY. (B)

Substrate amino-terminal TM segment inserts at the interface of SecYEG and YidC

and the second TM segment initiates C-terminal translocation. (C)The model

substrate shown here, FOa, is inserted into the bilayer.

29

Chapter 2

New insights into amino-terminal translocation as revealed by the use of

YidC and Sec depletion strains

2.1 Introduction

The bio-machineries responsible for membrane protein biogenesis are universally

conserved. Facilitated insertion and assembly of inner membrane proteins are catalyzed by

two known protein translocases in E. coli, Sec and YidC (186). However, some proteins

like KdpD (187), KscA (188), Pf3-Lep (166) have been proposed to insert by an unassisted

pathway. The question of what features of a membrane protein substrate determines its

translocation-pathway is incompletely answered. In this study, we have addressed

important gaps in this area to improve our understanding of the fundamental mechanism

of membrane protein insertion and assembly. Specifically, we have studied the features of

30

the substrate N-terminal tails that dictate its translocase requirements, which heretofore

have been difficult to address experimentally.

Sec is the membrane integration site for majority of the inner membrane proteins. The

holotranslocon consists of the SecYEG channel, and the accessory elements SecDF, YajC

and YidC (179). Majority of its substrates are targeted to SecYEG as ribosome nascent-

chain complexes (RNCs) by the SRP-FtsY pathway (189) and the substrate hydrophilic

domain is translocated across the membrane in an unfolded state through a pore, while the

TM segment exits the channel through a lateral gate to integrate into the membrane (48).

SecA is an associated ATPase that powers the movement of periplasmic proteins, and large

hydrophilic domains of membrane proteins across the channel (190). YidC is responsible

for the insertion of a smaller subset of proteins like Pf3 coat and M13 procoat (123), subunit

c of FoF1ATPase (129), MscL (96) and SciP (161). In addition, it also assists in the folding,

assembly and membrane partitioning of certain Sec-dependent proteins like MalF (191)

and LacY (183, 184). Recent studies showed that YidC possesses an aqueous cavity in the

inner leaflet that likely can host a substrate N-tail and reduce its membrane crossing

distance (163). YidC and Sec can also work together to insert substrates, presumably at the

YidC TM greasy slide and Sec lateral gate interface via the YidC-Sec pathway (181).

Substrates of this pathway include NuoK (167), subunit a of FOa FOF1ATPase (124, 192)

and CyoA (130, 176).

It is unclear how substrates are destined for translocation by these pathways. Previous

studies suggest that YidC has limited potential to function independently and recruits Sec

for the translocation of more sophisticated proteins in terms of the size, charges and

31

hydrophilicity (166, 174, 193). Typical substrates of the YidC-only pathway have short

translocated N-tails like Pf3 whereas Sec is required for membrane insertion and

translocation of large periplasmic domains of substrate proteins like leader peptidase (194),

-lactamase (195) and alkaline phosphatase (196). Exception to this is ProW, which has

been proposed to insert by a Sec-independent mechanism (197). Cao et al. showed that the

Sec-independent protein Pf3-Lep requires Sec on increasing its N-tail length (198).

However, it is unclear what is the size-limit for N-translocation by YidC-Sec independent,

YidC-only and YidC-Sec pathways. Pathway-selection based on charges have been

controversial and needs further investigation. It has been shown that negative charges on

the N-tail and TM segment can act as YidC determinants and positive charges as Sec

determinants (166, 167). But the unfavorable distribution of positive charges have also

been proposed to act as YidC-determinants (199).

To further our understanding of N-terminal tail translocation, we have examined length

and charge features as pathway determinants by employing single-spanning model

substrates. We have evaluated the critical length required for YidC-only and YidC-Sec

mediated substrate insertion using a new strategy to regulate expression of two essential

genes (yidC and secE) in the same cell. On increasing the N-tail length, we find that

substrates switch from independent to YidC-only to YidC-Sec. Beyond 60-residue N-tail

length, the substrates were not translocated. However, the large periplasmic protein

maltose-binding protein (MBP) could be translocated in the N-terminal direction likely

because it can engage SecA. We also find that longer N-tails could translocate additional

charges, both positive and negative, if they are distributed away from each other. This led

32

to the hypothesis that N-tail charge density plays a role in necessitating translocase

dependency. Our results show that crowding of charges causes a switch in translocation

pathway from YidC-Sec independent to dependent.

2.2 Results

N-tail length requirement for translocase dependence

To study if N-tail length is a determinant for the translocase requirement for insertion, we

used Pf3-Lep, based on the YidC-Sec independent model protein used in (166). Pf3-Lep

has the 18-residue long Pf3 coat N-tail with two negative charges, followed by leader

peptidase positions 4-323. A positive charge added at position 79 renders its TM2 defective

for insertion (198). This prevents the translocation of the C-terminal P2 domain and allows

us to monitor the translocation of the amino-terminus alone. To study the length

requirement, the Pf3 tail segment was first doubled by adding another Pf3 N-tail ahead of

the TM segment to make 2Pf3-Lep (Fig. 2.1A). To further increase the N-tail length,

uncharged spacer residues used in (198) were inserted between residue 36 and 37 of 2Pf3-

Lep (Fig. 2.1B).

The translocase requirements for these substrates were studied using the YidC-depletion

strain JS7131 (123) and the SecE-depletion strain CM124 (200) that has either the yidC or

the secE gene under the araBAD promoter, respectively. SecE depletion has been shown

to affect SecYEG dependent substrates since SecE is required for the stabilization of SecY

(201). The depletion of the respective translocases was confirmed using western blot

analysis (Fig. 2.9A), which showed a steep decline in the translocase levels under

33

conditions where transcription of secE and yidC was blocked. To test YidC-dependence

for membrane insertion, the substrates were expressed in JS7131 and labelled using [35S]

methionine for 1 min under YidC expression (0.2% arabinose) and YidC depletion (0.2%

glucose) growth conditions. N-tail translocation was studied using a protease-accessibility

assay as described in (202). Briefly, spheroplasts were generated using lysozyme to allow

access to the inner membrane and then treated with Proteinase K for 30 min. When the N-

tail of the substrate protein (full length indicated by P in Fig. 2.2) was translocated across

the membrane, the N-tail was digested by the externally added protease (PK) and a smaller

band corresponding to the protease-resistant fragment was observed (indicated by F in Fig

2.2); whereas when the amino-terminal region of the substrate was not translocated, it is

not protease-accessible, so a band whose size corresponds to the full-length protein was

seen. Similarly, to determine Sec dependence of the various constructs, CM124 cells

expressing the model proteins were labelled with [35S] methionine for 1 min under SecE

expression (0.2% arabinose) and SecE depletion conditions (0.2% glucose), and the

protease mapping assay was carried out as described above.

To assess the efficiency of the formation of spheroplasts, degradation of outer membrane

protein A (OmpA) was used as a positive control as it can be digested by Proteinase K from

the periplasmic side of the membrane in properly prepared spheroplasts but cannot be

accessed in intact cells. OmpA controls were performed for all the experiments reported in

this study but are only shown once for representative purposes.

When the substrate N-tail was doubled to 2Pf3-Lep, the 36-residue long N-tail was found

to be translocated efficiently under YidC or Sec depletion conditions and hence it was still

34

YidC-Sec independent (Fig. 2.2A). Upon extending the N-tail with spacer pentapeptides

to 41 (2Pf3+5-Lep) and 46 (2Pf3+10-Lep) residues, we observed a gradual increase in

YidC dependence; but these substrates were still largely Sec-independent (Fig. 2.2B, 2.2C).

Upon further increasing the N-tail length to 51 residues (2Pf3+15-Lep), the efficiency of

insertion was reduced but it continued to be inserted by the YidC-only pathway and did not

require Sec (Fig. 2.2D). At 56 residue N-tail length (2Pf3+20-Lep), the substrate required

both YidC and Sec, albeit the insertion was not efficient (Fig. 2.2E). Further elongation of

the N-tail to 61 residues (2Pf3+25-Lep) prevented its translocation completely (Fig. 2.2F).

The substrate percentage translocated in each condition was measured by quantifying the

bands using ImageJ (see “Materials and Methods”). As a control, we confirmed that OmpA

(indicated by M in Fig. 2.2) was completely digested by the protease indicating good

spheroplast formation (Fig. 2.2G). Additionally, OmpA export required Sec-only, so its

protease-protected precursor form Pro-OmpA (indicated by P in Fig. 2.2) accumulated in

Sec depletion condition but not in YidC.

Sec-dependence on increasing N-tail length of the YidC-only substrate Pf3-23Lep

To test if increasing the N-tail length of a YidC-dependent substrate will cause a pathway-

switch to require Sec, the model substrate Pf3-23Lep was employed. Pf3-23Lep contains

the N-tail and TM segment of Pf3 coat protein fused to the 23rd residue of Lep and is a

well-characterized YidC-only substrate (165). Doubling the N-tail of Pf3-23Lep to 2Pf3-

23Lep (Fig. 2.1B) did not cause a change in its translocation pathway; the substrate

continued to insert by YidC-only mechanism (Fig. 2.3A). However, a gradual Sec

dependence was observed in addition to the YidC dependence, when its N-tail length was

35

increased to 41 (2Pf3+5-23Lep) and 46 (2Pf3+10-Lep) amino acids in length using the

uncharged spacer residues used previously (Fig. 2.3B, 2.3C) (198). Further increases in the

N-tail length to 51 (2Pf3+15-23Lep) and 56 residues (2Pf3+20-23Lep) resulted in a strict

dependence on both YidC and Sec, but the substrate was not translocated efficiently (Fig.

2.3D, 2.3E), as seen in the previous study. The longer N-tail of 61 residues length

(2Pf3+25-23Lep) was not translocated (Fig. 2.3F).

Translocation of the mature domain of MBP in the N-terminal direction

The model substrates tested above, which contained the duplicated Pf3 tails and spacers

peptides, did not insert beyond a size of 60 residues length. This may have to do with the

fact that there is something inherent about these sequences that prevent export, such as the

lack of recognition sites for SecA/B machineries. Therefore, we examined whether a

protein domain that is normally exported, i.e., in the C-terminal direction, could be

exported in the amino-terminal direction. We also wanted to examine whether

translocation of a long protein segment in the amino-terminal would require YidC. To test

this, we fused the secretory protein MBP to the N-terminus of 2Pf3-Lep (MBP-2Pf3-Lep,

Fig. 2.4A) and its translocation was studied as described above. The mature domain

(indicated by M in Fig. 2.4) was translocated efficiently by Sec pathway without its

cleavable signal sequence (Fig. 2.4B). However, YidC was dispensable as the translocated

domain of the substrate was translocated and cleaved by the external protease to produce

the protease-resistant fragment (indicated by F in Fig. 2.4), even when YidC was depleted.

Based on the size of the protease-protected fragment of MBP-2Pf3-Lep, we predict that it

consists of the Lep portion of MBP-2Pf3-Lep, that has 7 Met residues, as compared to the

36

full length MBP-2Pf3-Lep which that has 16 Met residues. The data suggests that the

substrate C-terminal TM behaves as a reverse signal to open the SecYEG channel. We

confirmed this by adding a pair of positive charges in the TM region (MBP-2Pf3-Lep

L41R, L48R) that disabled MBP translocation (Fig. 2.5A). We also analyzed the SecA

requirement for MBP-2Pf3-Lep using a sodium azide study and found that the translocation

was SecA dependent (Fig. 2.5B). Next, we truncated the periplasmic region of this

substrate by deleting all but the first 60 residues of the MBP mature domain (MBP-2Pf3-

Lep ∆61-325, Fig. 2.4A). At this intermediate N-tail length of 96 residues, we observed

that the substrate was inserted partially by Sec and YidC (Fig. 2.4C). PreMBP-2Pf3Lep

that still has the N-terminal signal sequence of MBP attached, was also tested as a positive

control. The precursor protein (indicated by P in Fig. 2.4D) accumulates under Sec

depletion conditions whereas it doesn’t require YidC.

Testing charge density hypothesis

Previously it was shown by Zhu et al. that charges within the N-tail can act as translocase

determinants (166). When a negative or a positive charge was inserted in the Pf3-Lep N-

tail, it caused a switch in translocase requirement from YidC-Sec independent to YidC-

only or YidC-Sec dependent respectively. However, we observed that additional charges

can be translocated when they are distributed across a longer N-tail in the 2Pf3-Lep

construct, which has twice as many charges (Fig. 2.2A). This led us to propose and test the

hypothesis that it is the charge density of the N-tail rather than just the presence of charges

per se that determines its translocation pathway.

37

First, we introduced additional negative charges to the 2Pf3-Lep N-tail (Fig. 2.6A) and

examined its translocase preference. Addition of one negative charge at position 15 on the

first N-tail (2Pf3-Lep V15D), or 15’ that is on the N-tail closer to the TM (2Pf3-Lep

V15’D), did not influence the translocation pathway (Fig. 2.6B, 2.6C); the substrates

continued to insert independent of YidC and Sec. When two negative charges were added

at positions 15 and 15’ (2Pf3-Lep V15D, V15’D), the substrate showed partial dependence

on both YidC and Sec (Fig. 2.6D). To increase the local density of charges in one of the

two N-tails, the two negative charges were either added at positions 12 and 15 in the first

N-tail (2Pf3-Lep L12E, V15D) or at the same positions in the second N-tail (2Pf3-Lep

L12’E, V15’D). The charges introduced in the first N-tail resulted in a greater dependence

on both YidC and Sec (Fig. 2.6E). However, when the charges were positioned closer to

the TM, the N-tail was not efficiently translocated and strictly required YidC and Sec (Fig.

2.6F).

Similarly, to evaluate the effect of adding positive charges, an Arg residue was substituted

in the first and second N-tail of 2Pf3-Lep at the same positions (Fig. 2.7A) as with the

previous study. 2Pf3-Lep V15R was largely independent of YidC and Sec (Fig. 2.7B), but

2Pf3-Lep V15’R that bears the substitution closer to the TM segment was partially

dependent on both YidC and Sec (Fig. 2.7C). On adding two Arg residues at positions 15

and 15’ (2Pf3-Lep V15R, V15’R), the substrate became strictly dependent on YidC and

Sec (Fig. 2.7D). When the two positive charges were placed close to each other in the first

N-tail (2Pf3-Lep L12R, V15R) the substrate was poorly inserted and required both YidC

38

and Sec (Fig. 2.7E). When the charges were substituted in the second N-tail (2Pf3-Lep

L12’R, V15’R), it was not inserted (Fig. 2.7F).

2Pf3-Lep is YidC-Sec independent in double-depletion conditions

In vitro membrane insertion studies have shown that some Sec-dependent substrates

display promiscuity and can be also translocated by the YidC-only pathway (178). This

promiscuity may explain why 2Pf3-Lep can insert under YidC depletion conditions, where

it may go by the Sec pathway, and vice-versa. Therefore, it is critical to evaluate its

insertion under YidC-Sec double depletion conditions to rule out the possibility of a

promiscuous insertion pathway. For this, we utilized CRISPR interference (CRISPRi)

(203) to repress expression of secE in the YidC depletion strain JS7131 and the

translocation of 2Pf3-Lep was assayed using the protease-mapping assay as described

above. The results showed that 2Pf3-Lep was fully inserted when both YidC and Sec were

depleted at the same time (Fig. 2.8A).

To further characterize YidC/SecE depletion strain, we tested the insertion of YidC-Sec

dependent protein subunit a of the FOF1 ATPase with a C-terminal P2 epitope of Lep that

served as a cytoplasmic tag for immunoprecipitation (FOa-P2). The substrate was largely

blocked under YidC or Sec depletion conditions (Fig. 2.8B). However, it remained

uninserted when both YidC and Sec were depleted simultaneously. We also evaluated the

insertion of the YidC-only model protein wild-type Procoat-Lep (PC-Lep) and a YidC-Sec

dependent mutant protein ARGRR-Procoat-Lep (ARGRR-PC-Lep) (174) as controls. The

YidC-only substrate PC-Lep (indicated by P in Fig. 2.8) was converted to the mature coat

protein (indicated by C in Fig. 2.8) by the action of signal peptidase only upon insertion

39

under YidC expression conditions (Fig. 2.8C). In contrast, PC-Lep was largely uninserted

when YidC was depleted and only slightly affected by Sec depletion (Fig. 2.8C). However,

the YidC-Sec substrate ARGRR PC-Lep mutant was largely blocked in any translocase

depletion condition, as expected (Fig. 2.8D). Next, we evaluated the export of the Sec-

only substrate OmpA and found it was affected as seen by ProOmpA accumulation under

Sec- depletion and YidC-Sec depletion conditions (Fig. 2.8E). However, the export was

not completely inhibited, which could be because OmpA has a higher affinity for the Sec

apparatus. To further characterize the double-depletion strain, immunoblotting analysis

was performed (Fig. 2.9B). We observed a dramatic decrease in the translocase levels to

under 5% of the levels measured in their wild type conditions (i.e., over 20 fold decrease),

thus demonstrating the depletion of both YidC and SecE under the conditions tested. We

also verified that 2Pf3-Lep was fully inserted (data not shown) under a more stringent

depletion condition (over 40 fold depletion) of both YidC and SecE. Based on this study,

we favor the idea that 2Pf3-Lep can translocate by a Sec/YidC independent mechanism.

2.3 Discussion

Typically, substrates that are inserted by the YidC-only pathway have short translocated

segments, like Pf3 coat (18 residues), Procoat (20 residues), SciP (11 residues), DjlC (1

residue), Flk (1 residue), FoF1 ATPase subunit c (8 residues), MscL (29 residues), and the

N-region of CyoA (26 residues) (96, 123, 126, 129, 161, 204). Longer translocated regions

typically require the Sec system (195, 196). YidC-Sec independent insertion is rare and

observed in proteins with short translocated regions like KdpD (10 residues), Pf3-Lep (18

40

residues) model protein, and KscA (30 residues) (166, 187, 188). In this study, we report

that a 36-residue tail can be translocated independent of Sec and YidC. This result was

confirmed for the first time using a new strategy to deplete both YidC and SecE in the same

E. coli strain to confirm that the substrate is not promiscuously being inserted by Sec when

we deplete YidC, and vice-versa. Under the YidC/Sec depletion conditions, where the

insertion of 2Pf3-Lep was unaffected, we confirmed that YidC was depleted over 30 fold

and SecY over 20 fold. The combined data suggests the possibility that unassisted

translocation of polar domains across the membrane is feasible in nature and it is

conceivable that the hydrophobicity of the TM segment of the protein fuels this process.

The hydrophobicity of TM1 of 2Pf3-Lep is very high, much higher than the 2Pf3-23Lep

construct that inserts by the YidC-only pathway. However, the presence of residual levels

of translocases under depletion conditions and the involvement of any other unknown

translocation mechanism needs to be considered as well and tested in future studies.

On evaluating size of the translocated region as a pathway-determinant, we found that

increasing the length of the YidC-Sec independent substrate N-tail with uncharged residues

led to YidC dependence and eventually Sec dependence as well. Similarly, increasing the

length of a YidC-dependent substrate N-tail caused a switch in its translocase requirement

to YidC-Sec mode of insertion. This suggests that these substrates insert into the membrane

at the YidC-Sec interface. In both cases, the N-tails were poorly inserted beyond a certain

length and substrate N-tails of about 60-residue length was found to be the upper limit of

translocation capacity for these model proteins. Thus, we observe a correlation between

length of the translocating region and the number of translocating devices employed by the

41

substrate. This agrees with previous studies suggesting a limited role for YidC to function

independently and often require the assistance of Sec for more sophisticated proteins in

terms of the energy barrier of translocation (174).

We should point out that this length study here is a reinvestigation of amino-terminal

translocation. Previously, we reported that short tails up to 38 residues are efficiently

translocated in a SecA and SecY-independent manner whereas longer tails are poorly

inserted (198). This agrees with the results reported in this paper. In Cao and Dalbey

(1994), we could obtain translocation of a long N-tail only when we added a leader

sequence to the N-terminus of the protein. However, the N tail translocation of -lactamase

and alkaline phosphatase were reported in later studies to occur even in the absence of an

amino-terminal signal peptide (205, 206). Therefore, we wanted to reinvestigate the

properties of the mature domain that can be translocated in the N-terminal direction.

Specifically, we wanted to look at whether this requires YidC, which was discovered in

2000 (123), and also examine Sec-dependency of insertion using the SecE depletion strain

that was constructed in 1996 (200).

Interestingly here, we found that longer N-tails can be exported by the Sec system if the

substrate has a downstream reverse signal. The mature domain of MBP fused to the N-

terminus of the model substrate 2Pf3-Lep was translocated even when not preceded by its

N-terminal signal sequence. One hypothesis is, Sec A/B engages with the MBP domain

and directs it to the SecYEG channel, which is then opened by the C-terminal TM segment

of the model protein, enabling the translocation of the large periplasmic domain. In keeping

with this, we found that MBP-2Pf3-Lep is SecA dependent (Fig. 2.5B). Previously, the

42

mature alkaline phosphatase has been shown to be exported without an attached signal

peptide if a signal sequence is added in trans (62). Later studies showed that regions of the

translocated segment need also to contain SecA targeting signals that allow this region to

bind to SecA, enabling SecA assisted translocation (77).

In addition to length, we have also tested charge density of the N-tail region as a translocase

determinant. It was previously shown that the addition of charges to N-tail region of the

model substrate Pf3-Lep resulted in a switch in its translocation pathway (166). However,

we observed that doubling this protein’s N-tail length, hence also the number of charged

residues it carries, did not change its translocase requirements. This was surprising and

suggested that additional charges on the N-tail could be translocated without altering the

mechanism if they are distributed across a longer N-tail. This was confirmed by

strategically placing charged residues either close to each other or away and studying the

changes in its translocation pathway. While we found that positive charges had a greater

effect on the translocation mechanism than negative charges, all mutants showed equal

dependence on both YidC and Sec. This is in contrary to the previous study that proposed

negative charges as YidC determinant and positive charges as YidC-Sec determinants

(166). We hypothesize that this can explained as an effect of charge crowding over the

short N-tail of Pf3-Lep substrate that was tested. Although the negatively charged

substrates tested in the previous study are YidC-dependent, our data suggests that

increasing the number of negative charges appear to make it more Sec-dependent as well.

Based on this, we propose that YidC has limited potential to insert charged substrates

independently and requires Sec for more complex substrates.

43

In conclusion, we observed that both N-tail length and charge density can specify the

insertion pathway of substrates. Shorter tails are translocated independently, whereas

longer ones first recruit YidC and beyond a certain threshold, need both YidC and Sec. For

these substrates, we hypothesize that insertion occurs at the YidC-Sec interface, between

the greasy-slide and the lateral gate. Longer periplasmic domains are exported when

followed by a reverse signal by the Sec apparatus. Additionally, crowding of charges in the

translocated region, increases the energy barrier of translocation and thus requires the

assistance of translocases for its membrane clearance.

2.4 Materials and methods

Materials

Isopropyl 1-thio-β-D-galactopyranoside was purchased from Research Products

International Corp. Tran35S-label (mixture of 85% [35S] methionine and 15% [35S]

cysteine at 1000 Ci/mmol concentration) was purchased from PerkinElmer Life Sciences.

Anhydrotetracycline hydrochloride was purchased from ACROS Organics. Lysozyme was

purchased from Sigma, Proteinase K (PK) from Qiagen and PMSF from United States

Biochemical (Affymetrix). Antisera to leader peptidase (anti-Lep) and outer membrane

protein A (anti-OmpA) were from our lab collection. Restriction endonucleases, T4 DNA

ligase, Q5 polymerase, Monarch PCR and DNA Cleanup kits and NEBuilder HiFi DNA

44

Assembly Master Mix were purchased from New England Biolabs. PCR primers were

synthesized by Integrated DNA Technologies (IDT).

Plasmids and Site-directed mutagenesis

To express the 2Pf3-Lep and 2Pf3-23Lep derivatives and mutants in JS7131, CM124 and

YidC-Sec double depletion strain NB167, the genes were cloned into the pLZ1 vector (177)

under the control of T7/lacUV5 promoter. The amino acid sequences of the model proteins

are shown in (Fig 2.10). The techniques described previously (207) were used for DNA

manipulations. Site-directed mutations were made by QuikChange or Fusion PCR method.

N-tail length of the substrates was increased by stepwise insertion of neutral spacer residues

used in (198) (TQVLNAPTSGGQSLNPGTSAQGNLS). DNA sequencing of the entire

gene verified all mutations. The N-terminal addition of MBP and Pre-MBP to 2Pf3Lep was

done by sub-cloning the respective genes amplified from the plasmid pMAL-c2X

(Addgene #75286), a gift from Paul Riggs.

Bacterial Strains

The E.coli YidC depletion strain JS7131 is from our collection (123). The SecE depletion

strain CM124 was obtained from Beth Traxler (200). These strains have either the yidC or

the secE genes expressed under the control of the araBAD promoter while their endogenous

yidC or secE genes are inactivated. The YidC-Sec double depletion strain NB167 is a

derivative of JS7131 with the secE gene repressed using CRISPRi (203) by inducing the

expression of a catalytically defective Cas9 (dCas9). This strain was constructed by

45

synthesizing dCas9 (IDT), originally from Streptococcus pyogenes, with codons optimized

for expression in E. coli. This synthetic construct was introduced into a modified pAH63

vector (208) containing a tetracycline inducible promoter to yield pTR-dCas9. The tetR –

dcas9 region from this plasmid was PCR-amplified using P1 and P2 primers (Supp. Table

S1.) and cloned into the Tn7-based vector pMS26 by USER cloning as described (209),

yielding plasmid pTn7-TR-dCas9. This plasmid was then transformed into JS7131 and

ampicillin resistant transformants were streaked on LB agar at 42C for plasmid curing, as

described (209). Colony PCR (primers P3 and P4) was performed on individual, ampicillin

sensitive colonies to confirm successful chromosomal integration of tetR-dCas9 into

attTn7. To target dCas9 to secE a guide RNA array was constructed by first identifying

three distinct 20-bp pair proto-spacer target sequences adjacent to a NGG PAM site within

the secE promoter region. These 20-bp sequences were each introduced into pgRNA (203)

by inverse PCR. Each individual guide RNA was then assembled as an array into pDLC29,

a low copy ColE1-like plasmid compatible with other vectors used in this study (210)

(primers P11-P16 and P17-P18) using the NEBuilder HiFi DNA Assembly Master Mix.

The resulting plasmid, psgRNA-secE123 was transformed into JS7131 strain harboring

tetR-dCas9 at the attTn7 site to yield NB167.

Growth conditions

The YidC depletion strain JS7131 was cultured at 37 °C for 3.5 h in LB media with 0.2%

arabinose (YidC expression conditions) or 0.2% glucose (YidC depletion conditions). The

SecE depletion strain CM124 was cultured in M9 media with 0.2% arabinose plus 0.4%

46

glucose (SecE expression conditions) or 0.4% glucose (SecE depletion conditions) for 8 h

at 37 °C. YidC-Sec double depletion strain NB167 was cultured at 37 °C for 4 h in LB

media with 0.2% arabinose (YidC-Sec expression conditions) or 0.2% arabinose plus 0.02

μg/ml ATc (SecE depletion conditions) or 0.2% glucose (YidC depletion conditions) or

0.02% glucose plus 0.02 μg/ml ATc (YidC-Sec depletion conditions). For all conditions

tested, the cells were exchanged into fresh M9 media and shaken for 30 min at 37 °C before

inducing the plasmid-encoded substrate protein. SecA dependence was evaluated by

treating the samples with 3 mM sodium azide 5 min prior to induction.

Protease Accessibility Studies

Protein substrates were expressed by induction using 1 mM IPTG (final concentration) for

5 min at 37 °C. Cells were labelled with [35S] methionine for 1 min and converted to

spheroplasts. Briefly, after labelling, the cells were collected by centrifugation and

resuspended in spheroplast buffer (33mM Tris-HCl, pH 8.0, 40% (m/v) sucrose). The

resuspended cells were then treated with 1 mM EDTA (pH 8.0) and 10 μg/ml Lysozyme

on ice for 30 min. To an aliquot of this, Proteinase K (0.75 mg/ml) was added. After 30

min digestion on ice, the reaction was quenched by the addition of 5mM PMSF for 5 min.

Another aliquot was not treated with PK. An equal volume of ice-cold 20% (m/v) TCA

was added to the solution and incubated on ice for 1 h. The total protein was then spun

down at 13000 rpm for 10 min and washed with the sample volume of ice-cold acetone.

The protein pellet was solubilized in Tris-SDS buffer (10mM Tris-HCl, pH 8.0, 2% (m/v)

SDS) overnight at room temperature. The samples were then immunoprecipitated with

47

antiserum to leader peptidase, which precipitates the Lep derivative substrates, or

precipitated with antiserum to OmpA. The samples were analyzed by SDS-PAGE and

phosphorimaging.

Signal Peptidase Processing Assay

Substrates were expressed using 1mM IPTG (final concentration) for 5 minutes at 37°C

and labelled with [35S] methionine for 1 min. The total protein was precipitated on ice for

1 h with an equal volume of ice-cold 20% (m/v) TCA. The samples were spun down at

13000 rpm for 10 min and washed with an equal volume of ice-cold acetone. The pellet

was solubilized in Tris-SDS buffer (10mM Tris-HCl, pH 8.0, 2% (m/v) SDS) overnight at

room temperature. The samples were then immunoprecipitated with antiserum to leader

peptidase, which precipitates the Lep derivative substrates, or precipitated with antiserum

to OmpA. The samples were analyzed by SDS-PAGE and phosphorimaging.

Western blot. E. coli strains JS7131, CM124 and NB167 were grown for various times

(JS7131 and NB167 for 3.5 h, and CM124 for 7 h) in the presence of arabinose or glucose

(with or without ATc for NB167 in each condition) at 37 °C. The cells were then collected

by centrifugation and washed with ice-cold PBS buffer (137 mM NaCl, 2.7 mM KCl, 10

mM Na2HPO4, 2 mM KH2PO4 (pH 7.4)). After normalizing the cells to A600 of 1.2, the

cell samples were pelleted, washed, and dissolved in 40 μl of SDS gel loading buffer, and

5 μl of the protein samples were loaded on a 15% (SecY visualization) and a 10% (YidC

visualization) SDS-polyacrylamide gel. YidC was analyzed by a Western blot using the

total protein. To analyse SecY expression, membrane vesicles were prepared from cells

48

grown in arabinose and glucose conditions, adjusted to A600 of 1.2, respectively and the

proteins resolved on the 15% SDS-polyacrylamide gel. Antisera to YidC and SecY (each

diluted 1:5000) and secondary antibody (goat-to-rabbit IgG horseradish peroxidase,

1:10,000) were used for the Western blot.

Quantification of Membrane Insertion Data

The percent of substrate translocation efficiency was determined by quantifying the

intensities of the protease-protected bands in each condition using ImageJ, a tool developed

by National Institutes of Health as described in (165). The intensities of the cleaved and

cleaved substrate bands were divided by the predicted number of methionine residues they

contain and substituted in the Equation below. For example, 2Pf3-Lep uncleaved substrate

contains 9 methionine residues, where the cleaved product has 7. Hence, the equation to be

used becomes:

% 𝑡𝑟𝑎𝑛𝑠𝑙𝑜𝑐𝑎𝑡𝑖𝑜𝑛 = [9

7𝑐𝑙𝑒𝑎𝑣𝑒𝑑 2𝑃𝑓3𝐿𝑒𝑝

{9

7𝑐𝑙𝑒𝑎𝑣𝑒𝑑 2𝑃𝑓3𝐿𝑒𝑝+𝑢𝑛𝑐𝑙𝑒𝑎𝑣𝑒𝑑 2𝑃𝑓3𝐿𝑒𝑝}

] ∗ 100%

49

2.5 Tables

Oligonucleotide primers used for construction of strain NB167.

Primer and description Sequence (5’ to 3’)

P1 USER ends of dCas9 For. GGGAAAGTUCGCTTTGATACGGAGTAGAG

P2 USER ends of dCas9 Rev. GGAGACATUGTCTCATGAGCGGATACATATT

P3 Tn7-9TR integration For. GATATGCCGGTTATTGTTGTTG

P4 Tn7-9TR integration Rev. AGAGCATCAAGTCGCTAAAG

P5 secE Target-1 For. (5Phos) AACTTCTGACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG

P6 secE Target-1 Rev. TTCTACAAACAGACCGCTAAACTGAAAGTTACTAGTATTATAC

P7 secE Target-2 For. (5Phos) GCGCACTAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG

P8 secE Target-2 Rev. ATTGCGTCAAAGACCGCTAAACTGAAAGTTACTAGTATTATAC

P9 secE Target-3 For. (5Phos) GCTCTGTTGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG

P10 secE Target-3 Rev. CTGTCTCAGCAGACCGCTAAACTGAAAGTTACTAGTATTATAC

P11 secE Target-1 Assembly For. CATTACTCGCATCCATTCTCGCTTTCGCTAAGGATGATTTCTG

P12 secE Target-1 Assembly Rev. TCCGTCTACGAACTCCCAGCAGTCAGTGAGCGAGGAAG

P13 secE Target-2 Assembly For. GCTGGGAGTTCGTAGACGGAGCTTTCGCTAAGGATGATTTCTG

P14 secE Target-2 Assembly Rev. CGATTGAGGACCTTCAGTGCAGTCAGTGAGCGAGGAAG

P15 secE Target-3 Assembly For. GCACTGAAGGTCCTCAATCGGCTTTCGCTAAGGATGATTTCTG

P16 secE Target-3 Assembly Rev. TATTGCTGGCAGGAGGTCAGAGTCAGTGAGCGAGGAAG

P17 DLC29 vector Assembly For. CTGACCTCCTGCCAGCAATATTCCAGTCGGGAAACCT

P18 DLC29 vector Assembly Rev GAGAATGGATGCGAGTAATGCGCTCCTTTCGCTTTCTT

Table 2.1 - Oligonucleotide primers used in NB167 strain construction.

50

2.6 Figures

Figure 2.1 - Construction of model substrates.

A schematic of the fusion proteins with doubled N-tails used in this study, 2Pf3-Lep and

2Pf3-23Lep (A). 2Pf3-Lep has two consecutive 18-residue long Pf3 coat N-tails, followed

by Lep from positions 4-323. 2Pf3-23Lep contains the two consecutive Pf3 N-tails

followed by the TM segment of Pf3 fused to the 23rd residue of Lep. Pf3 portions are

shown in Purple and Lep portions are shown in Green. An arginine is present at position

51

79 of Lep following TM2 in both proteins. The amino acid sequence of the uncharged

pentapeptides (B) added between the N-tail and the TM segments of the model proteins

used to construct the substrates 2Pf3+5-Lep, 2Pf3+10-Lep, 2Pf3+15-Lep, 2Pf3+20-Lep

and 2Pf3+25-Lep with 2Pf3-Lep; 2Pf3+5-23Lep, 2Pf3+10-23Lep, 2Pf3+15-23Lep,

2Pf3+20-23Lep and 2Pf3+25-23Lep with 2Pf3-23Lep.

52

Figure 2.2 - N-tail length requirement for translocase dependence.

E. coli JS7131 cells bearing different plasmids were grown for 3.5 h under YidC expression

(0.2% arabinose) or YidC depletion conditions (0.2% glucose). The substrates 2Pf3-Lep

(A), 2Pf3+5-Lep (B), 2Pf3+10-Lep (C), 2Pf3+15-Lep (D), 2Pf3+20-Lep (E) and 2Pf3+25-

Lep (F) were expressed from pLZ1 plasmid using 1mM IPTG for 5 min and labelled with

[35S] methionine for 1 min. Translocation of the substrate N-tail was analyzed using the

protease-accessibility assay, where the cells were converted into spheroplasts, and a portion

was treated with Proteinase K (PK) (see “Material and Methods”). E. coli CM124 bearing

the same plasmids (A, B, C, D, E, F) were grown for 8 h under SecE expression (0.2%

53

arabinose + 0.2% glucose) or SecE depletion conditions (0.4% glucose) and analyzed using

the protease-accessibility assay. A representational OmpA immunoprecipitation data is

included for both studies (G). The percent translocation of the substrate was quantified as

described in “Methods and Materials”. P denotes the full-length protein, whereas F denotes

the protease-resistant fragment. In panel (G) M denotes the mature OmpA whereas P

denotes the precursor protein.

54

Figure 2.3 - Increasing N-tail length directs YidC-only N-tails to YidC-Sec pathway.

E. coli JS7131 cells bearing different plasmids were grown under YidC expression or

depletion conditions. The substrates 2Pf3-23Lep (A), 2Pf3+5-23Lep (B), 2Pf3+10-23Lep

(C), 2Pf3+15-23Lep (D), 2Pf3+20-23Lep (E) and 2Pf3+25-23Lep (F) were expressed from

pLZ1 plasmid using 1mM IPTG for 5 min and labelled with [35S] methionine for 1 min.

Translocation of the substrate N-tail was analyzed using the protease-accessibility assay,

where the cells were converted into spheroplasts, and a portion was treated with Proteinase

K (PK) (see “Material and Methods”. E. coli CM124 expressing the same substrates (A, B,

C, D, E, F) were grown under SecE expression or depletion conditions and analyzed using

the protease-accessibility assay. Representational OmpA data is included at the bottom for

55

both studies (G). The percent translocation of the substrate was quantified as described in

“Methods and Materials”. P denotes the full-length protein, whereas F denotes the

protease-resistant fragment. In panel (G) M denotes the mature OmpA whereas P denotes

the precursor protein.

56

Figure 2.4 - Translocation of MBP in the N-terminal direction.

A schematic of MBP-2Pf3-Lep, MBP-2Pf3-Lep ∆61-375 and PreMBP-2Pf3-Lep

substrates (A). Maltose-binding protein (shown in Orange) was fused to the N-terminus of

2Pf3-Lep either with its SP (PreMBP-2Pf3-Lep) or without (MBP-2Pf3-Lep). All but the

57

first 60 residues of MBP were deleted to make the truncated MBP-2Pf3-Lep ∆61-375

substrate. E. coli JS7131 cells bearing pLZ1 plasmids expressing MBP-2Pf3-Lep (B),

MBP-2Pf3-Lep ∆61-375 (C) or PreMBP-2Pf3-Lep (D) were grown under YidC expression

or depletion conditions. The substrates were expressed using 1mM IPTG for 5 min and

labelled with [35S] methionine for 1 min. Translocation of the periplasmic domain was

analyzed using the protease-accessibility assay, where the cells were converted into

spheroplasts, and a portion was treated with Proteinase K (PK) (see “Material and

Methods”). E. coli CM124 bearing the same substrate plasmids (B, C, D) were grown under

SecE expression or depletion conditions and analyzed using the protease-accessibility

assay. The percent translocation of the substrate was quantified as described in “Methods

and Materials”. M denotes the mature domain region of MBP fused to 2Pf3-Lep, whereas

F denotes the protease-resistant fragment. P denotes the full-length precursor protein in

panel (D).

58

Figure 2.5 - The translocation of MBP-2Pf3-Lep is blocked when Arg residues are

added to its TM and analysis of its SecA-dependence.

(A) E. coli JS7131 cells expressing MBP-2Pf3-Lep L41R, L48R from pLZ1 plasmid was

tested under YidC expression condition and the N-tail translocation was analyzed using the

protease-accessibility assay. (B) SecA-dependence of MBP-2Pf3 was analyzed by treating

E. coli JS7131 cells expressing MBP-2Pf3-Lep with or without 3mM sodium azide 5 mins

59

prior to substrate induction under YidC expression conditions and the N-tail translocation

was evaluated using the protease-accessibility assay. OmpA export was analyzed under the

same conditions as a control.

60

Figure 2.6 - Testing negative charge distribution on N-terminal tail as a pathway-

determinant.

The positions of the negative charges introduced on the N-tail of 2Pf3-Lep (A). E. coli

JS7131 cells bearing different plasmids were grown under YidC expression or depletion

61

conditions. The substrates were expressed using 1mM IPTG for 5 min and labelled with

[35S] methionine for 1 min. Substrate N-tail translocation was analyzed using the protease-

accessibility assay, where the cells were converted into spheroplasts, and a portion was

treated with Proteinase K (PK) (see “Material and Methods”). The plasmids encoded the

proteins 2Pf3-Lep V15D (B), V15’D (C), V15D/V15’D (D), L12E/V15D (E) and

L12’E/V15’D (F) (mutations positioned in the second Pf3 N-tail ahead of the TM segment

are indicated by (’)). E. coli CM124 expressing the same substrate proteins (B, C, D, E, F)

were grown under SecE expression or depletion conditions and analyzed using the

protease-accessibility assay. Representational OmpA data is included at the bottom for

both studies (G). The percent translocation of the substrate was quantified as described in

“Methods and Materials”. P denotes the full-length protein, whereas F denotes the

protease-resistant fragment. In panel (G) M denotes the mature OmpA whereas P denotes

the precursor protein.

62

Figure 2.7 - Testing positive charge distribution on N-terminal tail as pathway-

determinant.

The positions of the positive charges introduced on the N-tail of 2Pf3-Lep (A). E. coli

JS7131 cells bearing different plasmids were grown under YidC expression or depletion

63

conditions. The plasmids encoded the proteins 2Pf3-Lep V15R (B), V15’R (C),

V15R/V15’R (D), L12’R/V15’R (E) and L12R/V15R (F). The substrates were expressed

using 1mM IPTG for 5 min and labelled with [35S] methionine for 1 min. Translocation of

the substrate N-tail was analyzed using the protease-accessibility assay, where the cells

were converted into spheroplasts, and a portion was treated with Proteinase K (PK) (see

“Material and Methods”). E. coli CM124 expressing the same substrate proteins (B, C, D,

E, F) were grown under SecE expression or depletion conditions and analyzed using the

protease-accessibility assay. Representational OmpA data is included at the bottom for

both studies (G). The percent translocation of the substrate was quantified as described in

“Methods and Materials”. P denotes the full-length protein, whereas F denotes the

protease-resistant fragment. In panel (G) M denotes the mature OmpA whereas P denotes

the precursor protein.

64

Figure 2.8 - Confirming non-promiscuous insertion of 2Pf3-Lep using YidC-Sec

double-depletion.

E. coli NB167 cells expressing 2Pf3-Lep (A) from pLZ1 plasmid and FOa-P2 (B) from

pMS119 plasmid were grown under YidC-Sec expression or YidC/Sec/YidC-Sec depletion

conditions. The substrate was expressed using 1mM IPTG for 5 min and labelled with [35S]

methionine for 1 min. Translocation of the substrate regions was analyzed using the

protease-accessibility assay, where the cells were converted into spheroplasts, and a portion

65

was treated with Proteinase K (PK) (see “Material and Methods”). NB167 cells bearing the

pLZ1 plasmid expressing either the YidC-only substrate PC-Lep (C) or the YidC-Sec

substrate ARGRR PC-Lep mutant (D) were grown under YidC-Sec expression or

YidC/Sec/YidC-Sec depletion conditions and the substrate membrane insertion was

analyzed using the signal peptidase processing assay, where the substrate labelled with

[35S] methionine for 1 min and precipitated with TCA were analyzed for signal peptidase

processing (see “Material and methods”). OmpA signal processing assay data for the same

conditions are also included (E). P denotes the full-length protein, whereas F denotes the

protease-resistant fragment. C denotes the signal peptide processed mature coat protein in

panel (C, D). In panel (E), M denotes the mature OmpA whereas P denotes the precursor

protein.

66

Figure 2.9 - Detection of YidC and Sec depletion using western blot.

(A) Western blot analysis of YidC and SecY protein expression under YidC/Sec expression

and depletion conditions respectively, in strains JS7131 and CM124. (B) The YidC and

67

SecY levels were evaluated in the double-depletion strain NB164 using western blot. The

percent YidC/Sec remaining under depletion conditions were quantified for each case and

reported as fold decrease relative to the corresponding wild-type levels. For details, see

“Material and Methods” section.

68

Figure 2.10 - Amino acid sequence of the model protein constructs.

(A) The 2Pf3-Lep model protein contains two consecutive Pf3 N-tails followed by the

LepTM segment. (B) In 2Pf3-23Lep model protein the Lep TM segment is replaced by a

Pf3 TM segment instead. Pf3 portions are shown in Purple whereas Lep portions are shown

in Green. The TM segment of each construct is followed by residues 23–323 of Lep, where

an arginine is present at position 79 of Lep following TM2.

69

Chapter 3

FCS analysis of Pf3 coat insertion by reconstituted YidC homologs

3.0 Contributions

The work reported in this chapter was carried out by Maximilian Haase and Sri Karthika

Shanmugam in the laboratory of Dr. Andreas Kuhn in University of Hohenheim, Germany.

Both authors contributed equally to the data collection and interpretation process. The

proteins used in the study were purified by Gisela Nagler, Renate Hess, Eleni Silioni,

Maximilian Haase and Sri Karthika Shanmugam.

3.1 Introduction

Membrane proteins have vital functions for the cell and are attractive drug targets.

Therefore, it is critical to understand how proteins are inserted and assembled into the

membrane. The fundamental process of membrane protein biogenesis is a well-

70

orchestrated interplay between several key bio-machineries that are highly conserved in

nature. These molecular devices ensure that substrates reach their destined location and

achieve their folded functional form with proper orientation in the membrane. The YidC

family of proteins represent a novel class of insertases that operate in the bacterial cell

membrane and eukaryotic organellar membranes of chloroplasts and mitochondria (127).

Additional members have been proposed to reside in the ER membrane (154). Although

these proteins display structural conservation, less is known about the functional overlap

between them. Of these, the best understood is the bacterial homolog YidC that is

responsible for the membrane insertion of a number of essential proteins including those

involved in respiration and energy-transduction (128).

The YidC paralogs Alb3 and Alb4 are found to be present in the chloroplast thylakoid

membranes of higher plants and algae (142, 143). They play essential roles in the

biogenesis of chloroplast enzyme complex. Alb3 (Albino3) was first identified to be

essential for thylakoid biogenesis in a pigmentless-mutant A. thaliana (142). Specifically,

Alb3 is required for membrane assembly of post-translationally imported light-harvesting

chlorophyll-binding proteins (211, 212). Interestingly, Alb3 has been shown to interact

with the chloroplast SecY (cpSecY) protein (147). However, it is currently unknown if they

constitute a holotranslocon comprised of SecYE and Alb3 for membrane protein substrate

integration and stabilization similar to its bacterial counterparts. Another common feature

between YidC and Alb3 is their chaperone activity; Alb3 has been suggested to assist in

the folding of D1 protein, a component of the chloroplast photosystem II complex (213).

71

Alb4 protein was more recently discovered to be localized in the thylakoid membrane

(143). Though Alb4 depletion had a minor effect on growth, it was required for the efficient

assembly of chloroplast ATP synthase complex (CF1FO-ATPase) (145). Further, the

subunits CF1β and CFOII were shown to interact with Alb4 but not Alb3 or cpSecY. This

suggests that though both Alb3 and Alb4 are involved in thylakoid membrane biogenesis,

it is likely that they have evolved to promote the membrane assembly and insertion of

distinctive substrate groups. Interestingly, the conserved regions of both Alb3 and Alb4

can functionally replace the bacterial YidC in E. coli (139, 145).

In contrast to the thylakoid membrane of chloroplasts, the mitochondrial inner membrane

does not contain a SecY-like protein translocon. Instead, Oxa1 (oxidase assembly protein

1) insertase facilitates the membrane assembly of mitochondrion-encoded subunits of the

respiratory complexes like cytochrome c oxidase (Cox 1 and 2) and NADH reductase

(214). Certain nuclear-encoded proteins that are imported from the cytoplasm by other

transport machineries, also utilize Oxa1 to insert into the mitochondrial membrane (215).

It is closely related to YidC; it can complement E. coli YidC and shares the conserved 5

TM core region (216). Additionally, it possesses a C-terminal helical domain that can bind

to the translating ribosomes and recruit it for co-translational insertion (151, 217, 218).

Controversially, Oxa1 has been shown to form a dynamic pore in the membrane bilayer

that responds to the membrane potential and substrate signals (219).

Get1 (guided-entry tail-anchored protein 1) is a newly identified member of the YidC

superfamily (220). Until recently, the ER resident YidC homologs were unknown. A

systematic homology study by the Keenan group (154) revealed that the Get1 along with

72

two others proteins EMC3 and TMCO1 share structural homology with the mitochondrial

homolog Oxa1 protein. Like the other members of this family, Get1 also plays a role in the

ER membrane biogenesis. It assists in the membrane insertion of tail-anchored (TA)

proteins by recognizing the substrate C-terminal TM anchor. However, it remains to be

seen if these ER homologs can functionally substitute for the bacterial YidC.

To demonstrate a conserved role for YidC in the substrate membrane insertion process, we

have taken advantage of the highly sensitive biophysical technique, fluorescence

correlation spectroscopy (FCS) (221). This method can be used to trace individual

fluorescently-labelled proteins within small confocal volumes in millisecond time-scales.

A strong excitation light is employed to excite the sample placed as a droplet on a coverslip

of an inverted confocal microscope with a water-immersive objective (Fig 3.1A). The

labelled molecules diffuse through the detection volume and variations in the fluorescence

intensities are measured as single photons to determine the diffusion time of the molecule.

It is critical to sufficiently dilute the number of particles in the sample in order to detect

single events and separate it from the background signals.

In this study, we have evaluated the insertion efficiency of the model protein Pf3 coat by

the eukaryotic YidC homologs Alb3, Alb4, Oxa1 and Get1 in vitro. The different homologs

were purified and reconstituted into proteoliposomes in sub-nanomolar concentrations. We

uncoupled the substrate translation step from membrane insertion by adding purified and

fluorescently labelled Pf3 coat protein to the proteoliposomes and the insertion event was

followed using FCS (Fig. 3.1A). Upon excitation of the sample, the quencher-resistant

fluorescent signals were counted using an avalanche photo diode (APD) after filtering out

73

the excitation photons using a beam splitter. The process was followed for 10 minutes and

the software “Burst Analyzer 2.0” by Becker and Hickl was used to identify inserted Pf3

molecules within the proteoliposomes using their diffusion properties determine in the

work by Ernst et al (222). Potassium iodide (KI) was used to quench the fluorescence of

uninserted Pf3 molecules (Fig. 3.1B). For each homolog tested, so far 30 bursts were

analyzed and normalized to determine the rate of insertion. Our preliminary results suggest

that all the tested homologs could successfully facilitate the insertion of Pf3 with

comparable efficiencies. This study sheds light on the conserved nature of YidC function

across these homologs.

3.2 Results

Insertion of Pf3 coat protein by the chloroplast YidC homologs Alb3 and Alb4

To study the insertion of the YidC substrate Pf3 using FCS, a mutant version (Pf3 16C)

was expressed and purified as described in (172). The substrate was kept in a partially

unfolded state using an organic solvent. Pf3 N-tail was labelled using the fluorescent dye

Atto520 and the free dye was separated from the labelled protein using gel-filtration

chromatography. The mature region of Alb3 was expressed and purified using affinity

chromatography with Nickel-resin, followed by a gel-filtration step. YidC translocase

encompassing a C-terminal 10 His-tag was also purified using affinity chromatography to

compare the substrate insertion efficiencies in amongst the homologs. Alb3 and YidC were

reconstituted into DOPC liposomes at the final concentration of 0.4 nM.

74

The substrate protein was diluted and added to the proteoliposomes along with the

fluorescence quencher KI. If the substrate N-tail was translocated within 10 mins into the

lumen of the liposome by the action of the insertase, then the molecule will continue to

fluoresce as KI is membrane impermeable (Fig. 3.1B). This mixture was analyzed for the

diffusion of fluorescent molecules using the FCS setup (Fig 3.1A). The excited signals

from the sample were scanned for “burst” events which correspond to the diffusion time

previously calculated for fluorescent proteins within a liposome (Fig. 3.1C). We observed

that Pf3 coat was inserted into both YidC and Alb3 proteoliposomes. The number burst

events in each condition was normalized and plotted along with its standard deviations (Fig

3.2A). The insertion efficiency into Alb3 proteoliposomes was about 75% in comparison

to the YidC proteoliposomes. As a negative control, we also monitored Pf3 insertion using

DOPC liposomes under the same conditions. The substrate was confirmed to be largely

uninserted in the absence of the insertase, since it had none, or significantly lesser number

of bursts recorded during each trial.

Alb4 protein was also tested for its ability to insert the YidC substrate Pf3 protein. The

mature region of Alb4 preceded by the first TM segment of YidC was expressed and

purified similar to Alb3. The pure protein was reconstituted into DOPC liposomes with a

final concentration of 0.4 nM. The substrate was diluted to follow the individual molecules

within the focal volume and mixed with the proteoliposomes and the quencher KI. Pf3

insertion into DOPC liposomes and YidC proteoliposomes was also followed as controls.

Our results show that Alb4 can also insert Pf3 and the efficiency was either comparable or

slightly more than that of YidC (110%) (Fig 3.2B). In the insertase-free DOPC conditions,

75

some burst-like events were observed (8%), which could be due to fluorescent noises in

the background.

Functional conservation in Oxa1 and Get1 eukaryotic homologs

The mature domains of both Oxa1 and Get1 proteins were expressed with an N-terminal

TM1 of YidC. Oxa1 and Get1 proteins were purified using affinity chromatography

(Nickel resin), followed by size exclusion chromatography. The proteins were

reconstituted into DOPC liposomes and assayed as described before to monitor Pf3 coat

insertion. YidC proteoliposomes and DOPC liposomes were used as controls. The

experiments were performed in similar conditions and the number of bursts recorded in

each condition was normalized and plotted with standard deviations (Fig 3.3A & 3.3B).

The insertion was efficient in both Oxa1 and Get1 reconstituted liposomes. They displayed

comparable efficiencies to that of YidC proteoliposomes. However, in the conditions we

tested, Get1 displayed better insertion rate (115%) compared to YidC. The insertion

efficiency by Oxa1 was about 93% compared to that of YidC. We confirmed that there

were only a small number of burst-like events in DOPC liposomes conditions in all the

trials.

3.3 Discussion

YidC is a unique insertase that assists in the membrane insertion and folding of substrate

proteins both autonomously and in association with the Sec machinery by forming the holo-

translocase complex (162). It is remarkably conserved in all domains of life. Previously, it

76

was thought to exist in endosymbiotic organellar membranes of chloroplasts and

mitochondria only. But recent evidences indicate that there are homologs present in the ER

membrane as well (154). However, it is currently unknown if these new members can

functionally complement YidC. Pf3, the 44-residue long bacteriophage coat protein is a

well-studied model substrate of the E. coli YidC insertase. Here, we utilized FCS analysis

to monitor Pf3 insertion efficiencies by the different YidC homologs, Alb3, Alb4, Oxa1

and Get1.

Alb3 and Alb4 in the thylakoid membranes of chloroplasts are proposed to be involved in

the membrane biogenesis pathway, like YidC. Previously it has been shown that both Alb3

and Alb4 can functionally replace E. coli YidC. However, Alb3 is responsible for the

membrane insertion of light-harvesting chloroplast-binding substrate proteins, whereas

Alb4 is responsible for non-chlorophyll binding photosynthetic proteins (145, 154, 172).

Structural predictions show that Alb3 has a unique C-terminal extension that Alb4 lacks.

This region has been proposed to be involved in the recruitment of SRP for the co-

translational insertion of its substrate proteins (223). But Alb3 can facilitate post-

translational insertion as well. In this study, we followed the insertion efficiency of Pf3

substrate by Alb3 and Alb4. Functional conservation in terms of substrate insertion has not

been visualized for these homologs before. Using FCS, we monitored Pf3 insertion into

reconstituted proteoliposomes by the action of Alb3 and Alb4 and compared its efficiency

to that of YidC at similar concentrations. Our results show that both homologs can

effectively insert Pf3 with slightly different efficiencies when compared to YidC-mediated

insertion rate.

77

Next, we demonstrated that the other eukaryotic homologs Oxa1 and Get1 can also assist

in the translocation of the Pf3 N-tail. The mitochondrial Oxa1 and E. coli YidC can

functionally complement each other (216). Since SecY channel is absent in the

mitochondria, it is suggested that Oxa1 can only carry out the independent insertion

function of YidC. In line with this, it was shown that Oxa1 can insert the YidC-only

substrates M13 Procoat and FOc in E. coli, but it could not be crosslinked to the Sec-

dependent substrate FtsQ like YidC can. We have confirmed that Oxa1 can insert in vitro

a YidC-only substrate Pf3, showing indeed it has a similar insertion function. The ER

resident Get1 was recently proposed to share structural homology with the YidC family of

proteins (154). Tail-anchored protein are more common in eukaryotes than bacteria.

However, the tail-anchored TssL protein is a substrate of the E. coli YidC (161). In this

work, we have demonstrated for the first time that Get1 can efficiently insert the YidC

pathway substrate Pf3 coat, which has the opposite topology of its normal substrates which

are C-tail anchored. Since the SecY channel is present in the ER membrane, it would be

interesting to explore in future if Get1 also cooperates with Sec for Sec-dependent

substrates.

Substrate translocation is commonly assessed in vivo using protease-accessibility assays.

However, these involve the construction of depletion strains and it cannot be used to

visualize insertion in real-time. In vitro methods serve as useful tools to monitor protein

translocation in the absence of other components that may influence the process. YidC has

been shown to be the minimal translocase unit, making it an ideal system for biophysical

studies. In this study, we have established the experimental setup to study the various YidC

78

homologs in purified reconstituted systems. Fluorescence based assays offer the advantage

to follow the insertion in real-time with single-molecule resolution. We have used DOPC

lipids for our reconstitution assays, however, the lipid composition of the different

membranes varies greatly in size and charge status and could have an effect on the insertion

efficiencies. In (188), the authors showed that the lipid composition could affect the rate of

insertion as it could play a role in the recruitment of substrate proteins. It could be

hypothesized that the slight differences we observed in the insertion rates could be due to

the change in the lipid composition between the native membranes of these homologs.

Taken together, this work provides biophysical evidence for the functionally conserved

nature of YidC across its different homologs.

3.4 Materials and methods

Materials

Ni2+-NTA beads were obtained from Qiagen. DOPC lipids and extruder were purchased

from Avanti Polar Lipids Inc. Activated charcoal was from Merck. The fluorescence label

Atto520 maleimide was purchased from Atto-tec. All other chemicals were supplied from

Sigma.

Expression and purification of the YidC homologs

The mature region of Alb3 was expressed with a C-terminal 6 His-tag from a pET29b

vector (224). The mature regions of the other YidC homologs, Alb4, Oxa1 and Get1 were

expressed with an upstream E. coli YidC TM segment 1 (1-45 residues) and a C-terminal

10 His-tag from a pET22b vector. The plasmids were transformed into E. coli LEMO

79

(DE3) cells and induced with 0.5mM IPTG at mid-log phase. The cells were harvested 1-

hour post-induction and resuspended in 20 mM Tris-HCl buffer (pH was maintained at 7.5

for YidC and Alb4, whereas Get1, Alb3 and Oxa1 purifications were carried out at pH 8)

with 300 mM NaCl and lysed using Oneshot. The membranes were isolated and separated

overnight using a sucrose gradient. The inner membrane fraction obtained from the

gradient was diluted 5 times in 20 mM Tris-HCl buffer with 300 mM NaCl at appropriate

pH values and solubilized with 1% DDM in the presence of 0.5 mM PMSF for 2 h. The

proteins were purified using a Ni2+ affinity column and eluted in 20 mM Tris-HCl buffer

containing 300 mM Imidazole, 300 mM NaCl and 0.01% DDM. The samples were

analyzed using SDS-PAGE and the eluates containing the protein was further purified by

gel filtration chromatography using a Superdex 200 column with 20 mM Tris-HCl buffer

(pH 7.5 or 8 respectively) with 300 mM NaCl and 0.01% DDM. The fractions containing

the protein was run on SDS-PAGE to confirm its purity and the concentration of the

proteins were estimated using Nanodrop2000. A representational purification of Alb4

protein is shown in (Fig. 3.4A & 3.4B).

Pf3 coat mutant purification and labelling

Pf3 16C mutant protein was purified as described in (222). Briefly, E. coli BL21 (DE3)

cells bearing pMS119-Pf3 16C gene was grown in LB media at 37°C until 0.6 OD was

reached, and then protein expression was induced using 1mM IPTG for 3 h. The cells were

harvested and resuspended in 20 mM Tris-HCl buffer (pH 8) containing 10% sucrose per

gram of cell pellet before flash freezing in liquid N2 and storing at -20°C. The cells were

disrupted using Oneshot and the membranes were isolated and homogenized in 100 mM

80

Tris-HCl buffer (pH 8) containing 8 M Urea. For the purification of Pf3 coat mutant, the

extract was first diluted with an equal volume of 100 mM Tris-HCl buffer (pH 8) with 10%

isopropanol. Next, it was fractionated using reversed phase chromatography that was run

with a buffer gradient of 5% to 80% isopropanol in 100 mM Trsi-HCl (pH 8) with 0.1%

trifluoroethanol. The substrate was further purified by two steps of gel filtration using a

Superdex 200 and a Superdex 75 column run with 100 mM Tris-HCl (pH 7.5) containing

10% isopropanol. The purified protein was mixed with Atto520 maleimide dye in dimethyl

sulfoxide solution in a ratio of 1:1.3 protein to dye concentration, in a dark room for 1 h.

Finally, the free dye was removed by gel filtration using a Superdex 200 column with 100

mM Tris-HCl (pH 7.5) with 10% isopropanol.

Liposome preparation and reconstitution of the YidC homologs

The liposomes and proteoliposomes used in this study were prepared using 1,2-Dioleoyl-

sn-glycero-3-phosphocholine (DOPC) lipids as described in (222). Briefly, the lipids were

dissolved in dichloromethane and dried by rotation under vacuum for 8 h to get a thin lipid

film. This was dissolved in 100 μl water and diluted with an equal volume of 20 mM Tris-

HCl buffer containing 300 mM NaCl (pH 7.5). To form the unilamellar liposomes, the

lipids solution was extruded 31 times through a nitrocellulose membrane of 0.4 μm pore

size. Reconstituted proteoliposomes were prepared by adding purified YidC homologs to

the lipid solution in the ratio of 1:25,000 with a final protein concentration of 0.4 nM and

extruded as described above. The mean particle diameter of the liposomes and the

proteoliposomes were evaluated to be 250 nm using dynamic light scattering technique

(DLS).

81

Confocal fluorescence correlation spectroscopy (FCS) measurement of Pf3 insertion

To evaluate the insertion efficiency of Pf3 substrate protein into the reconstituted

proteoliposomes, FCS measurements were performed as described in (188). At room

temperature, the liposomes or the reconstituted proteoliposomes with the different YidC

homologs were diluted in 20 mM Tris-HCl buffer (pH 7.5) to ensure that the protein

concentrations were as similar as possible in all measurements. 0.1 ng of labelled Pf3

protein was mixed into it along with 200 mM potassium iodide (fluorescence quencher)

and placed as a droplet (45 μl) on the coverslip of the lab-built confocal microscope,

Olympus IX71 (Fig. 3.1A). It has a water immersion objective (UPlanSApo 60X, N.A.1.2;

Olympus) which was used to focus a 105 μW attenuated laser beam to excite the

fluorophore on Pf3 protein in the droplet. A dichroic beam splitter separated the excited

signal from the source signal. An avalanche photodiode detected the single photons from

the excited signal that passed through an interference filter and the photons were counted

using a TCSPC card. In each trial, the fluorescent signals were recorded for 600 s. Photon

bursts with a minimum threshold of 35 counts per millisecond that last for at least 40 ms

were separated from background signals and analyzed using an automated algorithm called

“Burst Analyzer 2” by Becker and Hickl. A sample burst is shown in (Fig. 3.1B).

82

3.5 Figures

Figure 3.1 - Single molecule studies using FCS.

(A) A schematic of the FCS setup. A sample containing the N-terminally labelled (Atto520

dye) Pf3 protein and the DOPC liposomes/YidC homolog reconstituted liposomes was

placed on the coverslip of an inverted confocal microscope with a water immersion

objective. An attenuated laser beam of 514 nm wavelength and 105 μW strength was used

to excite the fluorophore on Pf3. The fluorescent signal is filtered from the excitation light

and split by a dichroic mirror which separates wavelengths below 630 nm and the signal is

83

further passed through another filter of 560 nm and detected by the APD (avalanche

photodiode). The wavelengths higher than 630 nm are filtered and detected by another

APD. The signals from the APDs are counted as single photons by synchronized TCSPC

(time-correlated single photon counting) cards. (B) A schematic representation of the freely

diffusing molecule within the excitation focal volume. The Atto520 dye on uninserted Pf3

is quenched by KI, but N-tails that are translocated are fluorescent. The fluorescent signals

from the diffusing liposome is recorded as single photons and analyzed. (C) A

representative burst that is recorded by the Becker & Hickl “Burst Analyzer 2” program.

The single photons detected by the APDS were recorded. The excited signals specific to

the Pf3 Atto520 dye was only observed in the APD which received the signals from the

560 nm filter (blue) and not in the other one (green). The burst events with a minimum

threshold of 35 counts/ms with a diffusion time of at least 40 ms which corresponds to the

fluorescent liposomes were estimated in each trial.

84

Figure 3.2 - Comparison of Pf3 insertion efficiencies by the chloroplast Alb3 and

Alb4 paralogs.

(A) FCS burst measurements of Pf3-16C mutant proteins labelled with Atto520 dye in the

presence of DOPC liposomes, reconstituted DOPC YidC and Alb3 proteoliposomes. The

Pf3 N-tails that translocated to the lumenal side of the liposomes were protected from the

fluorescence quencher KI and recorded as individual burst events based on their slower

diffusion time within the confocal volume. The average normalized burst recorded in each

condition is determined. The insertion efficiency by Alb3 was about 75% compared to that

85

of YidC. In the negative control, marginal to no insertion was observed in the absence of

the insertase. (B) Insertion efficiency of labelled Pf3 proteins examined in the presence of

DOPC liposomes, reconstituted DOPC YidC and Alb4 proteoliposomes. The burst events

corresponding to translocated Pf3-N tails within the liposomes were averaged for each

condition and plotted in comparison with DOPC YidC condition. Alb4 showed a slightly

higher efficiency rate (110%) for Pf3 coat insertion. In comparison, only a small number

of burst-like events were observed in DOPC liposomes conditions.

86

Figure 3.3 - Comparison of Pf3 insertion efficiencies by the eukaryotic homologs Oxa1

and Get1.

(A) FCS burst measurements of Pf3-16C mutant proteins labelled with Atto520 dye in the

presence of DOPC liposomes, reconstituted DOPC YidC and Oxa1 proteoliposomes. The

Pf3 N-tails that translocated to the lumen side of the liposomes were protected from the

fluorescence quencher KI and recorded as individual burst events based on their slower

diffusion time within the confocal volume. The average normalized burst recorded in each

condition is represent above and compared to the insertion rate into DOPC YidC

87

liposomes. The insertion efficiency by Oxa1 was about 93% compared to that of YidC. In

the negative control with DOPC liposomes, a small number of burst-like events were

observed. (B) Insertion efficiency of labelled Pf3 proteins examined in the presence of

DOPC liposomes, reconstituted DOPC YidC and Get1 proteoliposomes. The burst events

corresponding to translocated Pf3-N tails within the liposomes were averaged for each

condition and plotted. Get1 showed 115% Pf3 insertion efficiency rate compared to that of

YidC. In comparison, only a small number of burst-like events were observed in DOPC

liposomes conditions.

88

Figure 3.4 - Representational purification of Alb4.

(A) Affinity chromatography. mAlb4 protein expressed with a C-terminal His-tag was

purified using a Nickel-resin column after cell disruption, membrane isolation and

solubilization steps (See Materials and Methods). The flow-through was collected and

loaded in lane 2. Lanes 3 & 4 are the two wash fractions collected. The protein was eluted

in the presence of 300 mM Imidazole and samples collected from the fractions were run

on lanes 5 - 12. (B) Gel-filtration purification. Elution fractions from the affinity

chromatography step that contained the protein were pooled and further purified using gel-

89

filtration chromatography. The samples taken from fractions 1 - 10 were analyzed on SDS-

PAGE for purity.

90

Chapter 4

Conclusion

4.1 Summary of work performed

The primary findings of the work are described below:

(i) The length of the translocated N-terminal tails of membrane protein substrates

acts as a translocase-determinant. YidC and Sec independent translocation of a

short amino-terminal tail was confirmed in vivo using a novel double depletion

strain. Upon increasing its length, the substrate required the YidC translocase.

Further increase led to YidC-Sec dependence and eventually could not be

inserted.

91

(ii) The large mature region of Maltose-binding protein (MBP) was translocated by

the Sec system when it was N-terminally fused to a YidC-Sec independent

model membrane protein. In the absence of its signal sequence, we hypothesize

that MBP translocation was feasible since the C-terminal TM segment of the

protein could open the channel. In line with this, we confirmed that

destabilizing the TM segment with positive charges blocks its translocation.

(iii) The location of charges within the N-tail has an effect on the translocation

mechanism. When the charged residues, positive or negative, were positioned

in proximity to each other, the need for translocase involvement increased.

YidC-Sec independent substrates switched to the dependent pathway when

additional charges were introduced close to each other. Positively charged

residues had a greater effect than negatively charged residues, which could be

explained a greater need for a translocase to move the positively charged

regions to the positive side of the membrane due to the membrane electrical

potential.

(iv) The conserved function of YidC homologs in membrane protein insertion was

investigated using single-molecule methods. The eukaryotic YidC homologs

Oxa1, Get1 and the chloroplast paralogs Alb3 and Alb4 were reconstituted into

proteoliposomes and their ability to insert the fluorescently-labelled YidC-

substrate Pf3 was analyzed using fluorescence correlation spectroscopy. Our

92

results show that all the tested YidC homologs can insert the substrate with near

similar efficiencies as the E. coli YidC protein.

The findings from this work provide a framework to understand the mechanistic

features of the substrate amino-tail that determine its insertion pathway. An increase in

length or charge density necessitates translocase assistance. YidC has limited potential

to act independently and serves as a secondary site for insertion of proteins with shorter

translocated regions while Sec tackles the more energy-intensive substrates (Fig. 4.1A).

Our study suggests that YidC insertase is functionally conserved in all walks of life.

This dissertation builds upon existing knowledge on how protein translocation occurs

in E. coli and in similar pathways in higher organisms.

93

4.2 Figures

Figure 4.1 - Model for N-tail translocation pathway based on length and charge

density.

94

The wild-type model substrate inserts independent of YidC and Sec. An increase in the

length and/or charge density of the translocating amino-terminal switches its translocation

pathway from independent to YidC-only, to YidC-Sec dependent.

95

References 1. Sohlenkamp C, Geiger O. Bacterial membrane lipids: diversity in structures and

pathways. FEMS microbiology reviews. 2016;40(1):133-59. Epub 2015/04/12.

2. Krogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane

protein topology with a hidden Markov model: application to complete genomes. Journal

of molecular biology. 2001;305(3):567-80. Epub 2001/01/12.

3. Tottey S, Waldron KJ, Firbank SJ, Reale B, Bessant C, Sato K, et al. Protein-

folding location can regulate manganese-binding versus copper- or zinc-binding. Nature.

2008;455(7216):1138-42. Epub 2008/10/25.

4. Bolhuis A. Protein transport in the halophilic archaeon Halobacterium sp. NRC-1:

a major role for the twin-arginine translocation pathway? Microbiology. 2002;148(Pt

11):3335-46. Epub 2002/11/13.

5. Sargent F, Bogsch EG, Stanley NR, Wexler M, Robinson C, Berks BC, et al.

Overlapping functions of components of a bacterial Sec-independent protein export

pathway. The EMBO journal. 1998;17(13):3640-50. Epub 1998/07/03.

6. Berks BC, Palmer T, Sargent F. Protein targeting by the bacterial twin-arginine

translocation (Tat) pathway. Current opinion in microbiology. 2005;8(2):174-81. Epub

2005/04/02.

7. Wickner W, Schekman R. Protein translocation across biological membranes.

Science. 2005;310(5753):1452-6. Epub 2005/12/03.

8. Yen MR, Tseng YH, Nguyen EH, Wu LF, Saier MH, Jr. Sequence and

phylogenetic analyses of the twin-arginine targeting (Tat) protein export system.

Archives of microbiology. 2002;177(6):441-50. Epub 2002/05/25.

9. Bogsch EG, Sargent F, Stanley NR, Berks BC, Robinson C, Palmer T. An

essential component of a novel bacterial protein export system with homologues in

plastids and mitochondria. The Journal of biological chemistry. 1998;273(29):18003-6.

Epub 1998/07/11.

10. Sambasivarao D, Turner RJ, Simala-Grant JL, Shaw G, Hu J, Weiner JH.

Multiple roles for the twin arginine leader sequence of dimethyl sulfoxide reductase of

Escherichia coli. The Journal of biological chemistry. 2000;275(29):22526-31. Epub

2000/05/10.

11. Ize B, Gerard F, Zhang M, Chanal A, Voulhoux R, Palmer T, et al. In vivo

dissection of the Tat translocation pathway in Escherichia coli. Journal of molecular

biology. 2002;317(3):327-35. Epub 2002/04/02.

12. Buchanan G, Sargent F, Berks BC, Palmer T. A genetic screen for suppressors of

Escherichia coli Tat signal peptide mutations establishes a critical role for the second

arginine within the twin-arginine motif. Archives of microbiology. 2001;177(1):107-12.

Epub 2002/01/18.

13. DeLisa MP, Samuelson P, Palmer T, Georgiou G. Genetic analysis of the twin

arginine translocator secretion pathway in bacteria. The Journal of biological chemistry.

2002;277(33):29825-31. Epub 2002/05/22.

96

14. Stanley NR, Palmer T, Berks BC. The twin arginine consensus motif of Tat signal

peptides is involved in Sec-independent protein targeting in Escherichia coli. The Journal

of biological chemistry. 2000;275(16):11591-6. Epub 2000/04/15.

15. Cristobal S, de Gier JW, Nielsen H, von Heijne G. Competition between Sec- and

TAT-dependent protein translocation in Escherichia coli. The EMBO journal.

1999;18(11):2982-90. Epub 1999/06/05.

16. Rodrigue A, Chanal A, Beck K, Muller M, Wu LF. Co-translocation of a

periplasmic enzyme complex by a hitchhiker mechanism through the bacterial tat

pathway. The Journal of biological chemistry. 1999;274(19):13223-8. Epub 1999/05/01.

17. Jong WS, ten Hagen-Jongman CM, Genevaux P, Brunner J, Oudega B, Luirink J.

Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play

a critical role in Tat-mediated export. European journal of biochemistry / FEBS.

2004;271(23-24):4779-87. Epub 2004/12/21.

18. Graubner W, Schierhorn A, Bruser T. DnaK plays a pivotal role in Tat targeting

of CueO and functions beside SlyD as a general Tat signal binding chaperone. The

Journal of biological chemistry. 2007;282(10):7116-24. Epub 2007/01/12.

19. Jack RL, Buchanan G, Dubini A, Hatzixanthis K, Palmer T, Sargent F.

Coordinating assembly and export of complex bacterial proteins. The EMBO journal.

2004;23(20):3962-72. Epub 2004/09/24.

20. Behrendt J, Standar K, Lindenstrauss U, Bruser T. Topological studies on the

twin-arginine translocase component TatC. FEMS microbiology letters.

2004;234(2):303-8. Epub 2004/05/12.

21. Rollauer SE, Tarry MJ, Graham JE, Jaaskelainen M, Jager F, Johnson S, et al.

Structure of the TatC core of the twin-arginine protein transport system. Nature.

2012;492(7428):210-4. Epub 2012/12/04.

22. de Leeuw E, Granjon T, Porcelli I, Alami M, Carr SB, Muller M, et al.

Oligomeric properties and signal peptide binding by Escherichia coli Tat protein

transport complexes. Journal of molecular biology. 2002;322(5):1135-46. Epub

2002/10/09.

23. Punginelli C, Maldonado B, Grahl S, Jack R, Alami M, Schroder J, et al. Cysteine

scanning mutagenesis and topological mapping of the Escherichia coli twin-arginine

translocase TatC Component. Journal of bacteriology. 2007;189(15):5482-94. Epub

2007/06/05.

24. Holzapfel E, Eisner G, Alami M, Barrett CM, Buchanan G, Luke I, et al. The

entire N-terminal half of TatC is involved in twin-arginine precursor binding.

Biochemistry. 2007;46(10):2892-8. Epub 2007/02/16.

25. Eijlander RT, Kolbusz MA, Berendsen EM, Kuipers OP. Effects of altered TatC

proteins on protein secretion efficiency via the twin-arginine translocation pathway of

Bacillus subtilis. Microbiology. 2009;155(Pt 6):1776-85. Epub 2009/04/23.

26. Gohlke U, Pullan L, McDevitt CA, Porcelli I, de Leeuw E, Palmer T, et al. The

TatA component of the twin-arginine protein transport system forms channel complexes

of variable diameter. Proceedings of the National Academy of Sciences of the United

States of America. 2005;102(30):10482-6. Epub 2005/07/20.

97

27. Sargent F, Stanley NR, Berks BC, Palmer T. Sec-independent protein

translocation in Escherichia coli. A distinct and pivotal role for the TatB protein. The

Journal of biological chemistry. 1999;274(51):36073-82. Epub 1999/12/14.

28. Goosens VJ, van Dijl JM. Twin-Arginine Protein Translocation. Current topics in

microbiology and immunology. 2017;404:69-94. Epub 2016/04/29.

29. Barrett CM, Freudl R, Robinson C. Twin arginine translocation (Tat)-dependent

export in the apparent absence of TatABC or TatA complexes using modified Escherichia

coli TatA subunits that substitute for TatB. The Journal of biological chemistry.

2007;282(50):36206-13. Epub 2007/09/21.

30. Alami M, Luke I, Deitermann S, Eisner G, Koch HG, Brunner J, et al. Differential

interactions between a twin-arginine signal peptide and its translocase in Escherichia coli.

Molecular cell. 2003;12(4):937-46. Epub 2003/10/29.

31. Barrett CM, Mangels D, Robinson C. Mutations in subunits of the Escherichia

coli twin-arginine translocase block function via differing effects on translocation activity

or tat complex structure. Journal of molecular biology. 2005;347(2):453-63. Epub

2005/03/03.

32. Lausberg F, Fleckenstein S, Kreutzenbeck P, Frobel J, Rose P, Muller M, et al.

Genetic evidence for a tight cooperation of TatB and TatC during productive recognition

of twin-arginine (Tat) signal peptides in Escherichia coli. PloS one. 2012;7(6):e39867.

Epub 2012/07/05.

33. Robinson C, Matos CF, Beck D, Ren C, Lawrence J, Vasisht N, et al. Transport

and proofreading of proteins by the twin-arginine translocation (Tat) system in bacteria.

Biochimica et biophysica acta. 2011;1808(3):876-84. Epub 2010/12/04.

34. Blummel AS, Haag LA, Eimer E, Muller M, Frobel J. Initial assembly steps of a

translocase for folded proteins. Nature communications. 2015;6:7234. Epub 2015/06/13.

35. Mori H, Cline K. A twin arginine signal peptide and the pH gradient trigger

reversible assembly of the thylakoid [Delta]pH/Tat translocase. The Journal of cell

biology. 2002;157(2):205-10. Epub 2002/04/17.

36. Dabney-Smith C, Mori H, Cline K. Oligomers of Tha4 organize at the thylakoid

Tat translocase during protein transport. The Journal of biological chemistry.

2006;281(9):5476-83. Epub 2006/01/13.

37. Beck D, Vasisht N, Baglieri J, Monteferrante CG, van Dijl JM, Robinson C, et al.

Ultrastructural characterisation of Bacillus subtilis TatA complexes suggests they are too

small to form homooligomeric translocation pores. Biochimica et biophysica acta.

2013;1833(8):1811-9. Epub 2013/04/10.

38. Walther TH, Gottselig C, Grage SL, Wolf M, Vargiu AV, Klein MJ, et al. Folding

and self-assembly of the TatA translocation pore based on a charge zipper mechanism.

Cell. 2013;152(1-2):316-26. Epub 2013/01/22.

39. Gouffi K, Gerard F, Santini CL, Wu LF. Dual topology of the Escherichia coli

TatA protein. The Journal of biological chemistry. 2004;279(12):11608-15. Epub

2004/01/01.

40. Bruser T, Sanders C. An alternative model of the twin arginine translocation

system. Microbiological research. 2003;158(1):7-17. Epub 2003/03/01.

98

41. Rodriguez F, Rouse SL, Tait CE, Harmer J, De Riso A, Timmel CR, et al.

Structural model for the protein-translocating element of the twin-arginine transport

system. Proceedings of the National Academy of Sciences of the United States of

America. 2013;110(12):E1092-101. Epub 2013/03/09.

42. Walther TH, Grage SL, Roth N, Ulrich AS. Membrane alignment of the pore-

forming component TatA(d) of the twin-arginine translocase from Bacillus subtilis

resolved by solid-state NMR spectroscopy. Journal of the American Chemical Society.

2010;132(45):15945-56. Epub 2010/10/28.

43. Vrancken K, Van Mellaert L, Anne J. Characterization of the Streptomyces

lividans PspA response. Journal of bacteriology. 2008;190(10):3475-81. Epub

2008/03/11.

44. Kobayashi R, Suzuki T, Yoshida M. Escherichia coli phage-shock protein A

(PspA) binds to membrane phospholipids and repairs proton leakage of the damaged

membranes. Molecular microbiology. 2007;66(1):100-9. Epub 2007/08/30.

45. Mehner D, Osadnik H, Lunsdorf H, Bruser T. The Tat system for membrane

translocation of folded proteins recruits the membrane-stabilizing Psp machinery in

Escherichia coli. The Journal of biological chemistry. 2012;287(33):27834-42. Epub

2012/06/13.

46. DeLisa MP, Lee P, Palmer T, Georgiou G. Phage shock protein PspA of

Escherichia coli relieves saturation of protein export via the Tat pathway. Journal of

bacteriology. 2004;186(2):366-73. Epub 2004/01/02.

47. Driessen AJ, Nouwen N. Protein translocation across the bacterial cytoplasmic

membrane. Annual review of biochemistry. 2008;77:643-67. Epub 2007/12/15.

48. Van den Berg B, Clemons WM, Jr., Collinson I, Modis Y, Hartmann E, Harrison

SC, et al. X-ray structure of a protein-conducting channel. Nature. 2004;427(6969):36-

44. Epub 2003/12/09.

49. Pohlschroder M, Prinz WA, Hartmann E, Beckwith J. Protein translocation in the

three domains of life: variations on a theme. Cell. 1997;91(5):563-6. Epub 1997/12/11.

50. Steinberg R, Knupffer L, Origi A, Asti R, Koch HG. Co-translational protein

targeting in bacteria. FEMS microbiology letters. 2018;365(11). Epub 2018/05/24.

51. Chatzi KE, Sardis MF, Economou A, Karamanou S. SecA-mediated targeting and

translocation of secretory proteins. Biochimica et biophysica acta. 2014;1843(8):1466-74.

Epub 2014/03/04.

52. Facey SJ, Kuhn A. Membrane integration of E. coli model membrane proteins.

Biochimica et biophysica acta. 2004;1694(1-3):55-66. Epub 2004/11/18.

53. du Plessis DJ, Nouwen N, Driessen AJ. The Sec translocase. Biochimica et

biophysica acta. 2011;1808(3):851-65. Epub 2010/08/31.

54. du Plessis DJ, Berrelkamp G, Nouwen N, Driessen AJ. The lateral gate of

SecYEG opens during protein translocation. The Journal of biological chemistry.

2009;284(23):15805-14. Epub 2009/04/16.

55. Hanada M, Nishiyama KI, Mizushima S, Tokuda H. Reconstitution of an efficient

protein translocation machinery comprising SecA and the three membrane proteins,

SecY, SecE, and SecG (p12). The Journal of biological chemistry. 1994;269(38):23625-

31. Epub 1994/09/23.

99

56. Park E, Rapoport TA. Preserving the membrane barrier for small molecules

during bacterial protein translocation. Nature. 2011;473(7346):239-42. Epub 2011/05/13.

57. Harris CR, Silhavy TJ. Mapping an interface of SecY (PrlA) and SecE (PrlG) by

using synthetic phenotypes and in vivo cross-linking. Journal of bacteriology.

1999;181(11):3438-44. Epub 1999/05/29.

58. Maillard AP, Lalani S, Silva F, Belin D, Duong F. Deregulation of the SecYEG

translocation channel upon removal of the plug domain. The Journal of biological

chemistry. 2007;282(2):1281-7. Epub 2006/11/10.

59. Li W, Schulman S, Boyd D, Erlandson K, Beckwith J, Rapoport TA. The plug

domain of the SecY protein stabilizes the closed state of the translocation channel and

maintains a membrane seal. Molecular cell. 2007;26(4):511-21. Epub 2007/05/29.

60. Tsukazaki T, Mori H, Fukai S, Ishitani R, Mori T, Dohmae N, et al.

Conformational transition of Sec machinery inferred from bacterial SecYE structures.

Nature. 2008;455(7215):988-91. Epub 2008/10/17.

61. Zimmer J, Nam Y, Rapoport TA. Structure of a complex of the ATPase SecA and

the protein-translocation channel. Nature. 2008;455(7215):936-43. Epub 2008/10/17.

62. Gouridis G, Karamanou S, Gelis I, Kalodimos CG, Economou A. Signal peptides

are allosteric activators of the protein translocase. Nature. 2009;462(7271):363-7. Epub

2009/11/20.

63. Emr SD, Hanley-Way S, Silhavy TJ. Suppressor mutations that restore export of a

protein with a defective signal sequence. Cell. 1981;23(1):79-88. Epub 1981/01/01.

64. Nouwen N, Driessen AJ. SecDFyajC forms a heterotetrameric complex with

YidC. Molecular microbiology. 2002;44(5):1397-405. Epub 2002/06/19.

65. Hegde RS, Kang SW. The concept of translocational regulation. The Journal of

cell biology. 2008;182(2):225-32. Epub 2008/07/23.

66. Tsukazaki T, Mori H, Echizen Y, Ishitani R, Fukai S, Tanaka T, et al. Structure

and function of a membrane component SecDF that enhances protein export. Nature.

2011;474(7350):235-8. Epub 2011/05/13.

67. Lee C, Beckwith J. Cotranslational and posttranslational protein translocation in

prokaryotic systems. Annual review of cell biology. 1986;2:315-36. Epub 1986/01/01.

68. Chatzi KE, Sardis MF, Karamanou S, Economou A. Breaking on through to the

other side: protein export through the bacterial Sec system. The Biochemical journal.

2013;449(1):25-37. Epub 2012/12/12.

69. Oh E, Becker AH, Sandikci A, Huber D, Chaba R, Gloge F, et al. Selective

ribosome profiling reveals the cotranslational chaperone action of trigger factor in vivo.

Cell. 2011;147(6):1295-308. Epub 2011/12/14.

70. Weiss JB, Ray PH, Bassford PJ, Jr. Purified secB protein of Escherichia coli

retards folding and promotes membrane translocation of the maltose-binding protein in

vitro. Proceedings of the National Academy of Sciences of the United States of America.

1988;85(23):8978-82. Epub 1988/12/01.

71. Sharma V, Arockiasamy A, Ronning DR, Savva CG, Holzenburg A, Braunstein

M, et al. Crystal structure of Mycobacterium tuberculosis SecA, a preprotein

translocating ATPase. Proceedings of the National Academy of Sciences of the United

States of America. 2003;100(5):2243-8. Epub 2003/02/28.

100

72. Yang Q, Jankowsky E. ATP- and ADP-dependent modulation of RNA unwinding

and strand annealing activities by the DEAD-box protein DED1. Biochemistry.

2005;44(41):13591-601. Epub 2005/10/12.

73. Papanikou E, Karamanou S, Baud C, Frank M, Sianidis G, Keramisanou D, et al.

Identification of the preprotein binding domain of SecA. The Journal of biological

chemistry. 2005;280(52):43209-17. Epub 2005/10/26.

74. Erlandson KJ, Miller SB, Nam Y, Osborne AR, Zimmer J, Rapoport TA. A role

for the two-helix finger of the SecA ATPase in protein translocation. Nature.

2008;455(7215):984-7. Epub 2008/10/17.

75. Breukink E, Nouwen N, van Raalte A, Mizushima S, Tommassen J, de Kruijff B.

The C terminus of SecA is involved in both lipid binding and SecB binding. The Journal

of biological chemistry. 1995;270(14):7902-7. Epub 1995/04/07.

76. Gelis I, Bonvin AM, Keramisanou D, Koukaki M, Gouridis G, Karamanou S, et

al. Structural basis for signal-sequence recognition by the translocase motor SecA as

determined by NMR. Cell. 2007;131(4):756-69. Epub 2007/11/21.

77. Chatzi KE, Sardis MF, Tsirigotaki A, Koukaki M, Sostaric N, Konijnenberg A, et

al. Preprotein mature domains contain translocase targeting signals that are essential for

secretion. The Journal of cell biology. 2017;216(5):1357-69. Epub 2017/04/14.

78. Driessen AJ. SecA, the peripheral subunit of the Escherichia coli precursor

protein translocase, is functional as a dimer. Biochemistry. 1993;32(48):13190-7. Epub

1993/12/07.

79. Jilaveanu LB, Zito CR, Oliver D. Dimeric SecA is essential for protein

translocation. Proceedings of the National Academy of Sciences of the United States of

America. 2005;102(21):7511-6. Epub 2005/05/18.

80. Huber D, Rajagopalan N, Preissler S, Rocco MA, Merz F, Kramer G, et al. SecA

interacts with ribosomes in order to facilitate posttranslational translocation in bacteria.

Molecular cell. 2011;41(3):343-53. Epub 2011/02/05.

81. Singh R, Kraft C, Jaiswal R, Sejwal K, Kasaragod VB, Kuper J, et al. Cryo-

electron microscopic structure of SecA protein bound to the 70S ribosome. The Journal

of biological chemistry. 2014;289(10):7190-9. Epub 2014/01/21.

82. Merz F, Boehringer D, Schaffitzel C, Preissler S, Hoffmann A, Maier T, et al.

Molecular mechanism and structure of Trigger Factor bound to the translating ribosome.

The EMBO journal. 2008;27(11):1622-32. Epub 2008/05/24.

83. Wu ZC, de Keyzer J, Kedrov A, Driessen AJ. Competitive binding of the SecA

ATPase and ribosomes to the SecYEG translocon. The Journal of biological chemistry.

2012;287(11):7885-95. Epub 2012/01/24.

84. Or E, Boyd D, Gon S, Beckwith J, Rapoport T. The bacterial ATPase SecA

functions as a monomer in protein translocation. The Journal of biological chemistry.

2005;280(10):9097-105. Epub 2004/12/25.

85. Gouridis G, Karamanou S, Sardis MF, Scharer MA, Capitani G, Economou A.

Quaternary dynamics of the SecA motor drive translocase catalysis. Molecular cell.

2013;52(5):655-66. Epub 2013/12/18.

86. Vassylyev DG, Mori H, Vassylyeva MN, Tsukazaki T, Kimura Y, Tahirov TH, et

al. Crystal structure of the translocation ATPase SecA from Thermus thermophilus

101

reveals a parallel, head-to-head dimer. Journal of molecular biology. 2006;364(3):248-58.

Epub 2006/10/25.

87. van der Sluis EO, Driessen AJ. Stepwise evolution of the Sec machinery in

Proteobacteria. Trends in microbiology. 2006;14(3):105-8. Epub 2006/02/24.

88. Wild J, Altman E, Yura T, Gross CA. DnaK and DnaJ heat shock proteins

participate in protein export in Escherichia coli. Genes & development. 1992;6(7):1165-

72. Epub 1992/07/01.

89. Xu Z, Knafels JD, Yoshino K. Crystal structure of the bacterial protein export

chaperone secB. Nature structural biology. 2000;7(12):1172-7. Epub 2000/12/02.

90. Fekkes P, de Wit JG, Boorsma A, Friesen RH, Driessen AJ. Zinc stabilizes the

SecB binding site of SecA. Biochemistry. 1999;38(16):5111-6. Epub 1999/04/23.

91. Crane JM, Mao C, Lilly AA, Smith VF, Suo Y, Hubbell WL, et al. Mapping of

the docking of SecA onto the chaperone SecB by site-directed spin labeling: insight into

the mechanism of ligand transfer during protein export. Journal of molecular biology.

2005;353(2):295-307. Epub 2005/09/20.

92. Crane JM, Suo Y, Lilly AA, Mao C, Hubbell WL, Randall LL. Sites of interaction

of a precursor polypeptide on the export chaperone SecB mapped by site-directed spin

labeling. Journal of molecular biology. 2006;363(1):63-74. Epub 2006/09/12.

93. Akopian D, Shen K, Zhang X, Shan SO. Signal recognition particle: an essential

protein-targeting machine. Annual review of biochemistry. 2013;82:693-721. Epub

2013/02/19.

94. Li X, Henry R, Yuan J, Cline K, Hoffman NE. A chloroplast homologue of the

signal recognition particle subunit SRP54 is involved in the posttranslational integration

of a protein into thylakoid membranes. Proceedings of the National Academy of Sciences

of the United States of America. 1995;92(9):3789-93. Epub 1995/04/25.

95. Ulbrandt ND, Newitt JA, Bernstein HD. The E. coli signal recognition particle is

required for the insertion of a subset of inner membrane proteins. Cell. 1997;88(2):187-

96. Epub 1997/01/24.

96. Facey SJ, Neugebauer SA, Krauss S, Kuhn A. The mechanosensitive channel

protein MscL is targeted by the SRP to the novel YidC membrane insertion pathway of

Escherichia coli. Journal of molecular biology. 2007;365(4):995-1004. Epub 2006/11/23.

97. Bernstein HD, Poritz MA, Strub K, Hoben PJ, Brenner S, Walter P. Model for

signal sequence recognition from amino-acid sequence of 54K subunit of signal

recognition particle. Nature. 1989;340(6233):482-6. Epub 1989/08/10.

98. Romisch K, Webb J, Herz J, Prehn S, Frank R, Vingron M, et al. Homology of

54K protein of signal-recognition particle, docking protein and two E. coli proteins with

putative GTP-binding domains. Nature. 1989;340(6233):478-82. Epub 1989/08/10.

99. Voigts-Hoffmann F, Schmitz N, Shen K, Shan SO, Ataide SF, Ban N. The

structural basis of FtsY recruitment and GTPase activation by SRP RNA. Molecular cell.

2013;52(5):643-54. Epub 2013/11/12.

100. Luirink J, ten Hagen-Jongman CM, van der Weijden CC, Oudega B, High S,

Dobberstein B, et al. An alternative protein targeting pathway in Escherichia coli: studies

on the role of FtsY. The EMBO journal. 1994;13(10):2289-96. Epub 1994/05/15.

102

101. Bernstein HD, Zopf D, Freymann DM, Walter P. Functional substitution of the

signal recognition particle 54-kDa subunit by its Escherichia coli homolog. Proceedings

of the National Academy of Sciences of the United States of America. 1993;90(11):5229-

33. Epub 1993/06/01.

102. Keenan RJ, Freymann DM, Walter P, Stroud RM. Crystal structure of the signal

sequence binding subunit of the signal recognition particle. Cell. 1998;94(2):181-91.

Epub 1998/08/08.

103. Focia PJ, Shepotinovskaya IV, Seidler JA, Freymann DM. Heterodimeric GTPase

core of the SRP targeting complex. Science. 2004;303(5656):373-7. Epub 2004/01/17.

104. Janda CY, Li J, Oubridge C, Hernandez H, Robinson CV, Nagai K. Recognition

of a signal peptide by the signal recognition particle. Nature. 2010;465(7297):507-10.

Epub 2010/04/07.

105. Hainzl T, Huang S, Merilainen G, Brannstrom K, Sauer-Eriksson AE. Structural

basis of signal-sequence recognition by the signal recognition particle. Nature structural

& molecular biology. 2011;18(3):389-91. Epub 2011/02/22.

106. Hainzl T, Huang S, Sauer-Eriksson AE. Interaction of signal-recognition particle

54 GTPase domain and signal-recognition particle RNA in the free signal-recognition

particle. Proceedings of the National Academy of Sciences of the United States of

America. 2007;104(38):14911-6. Epub 2007/09/12.

107. Bradshaw N, Walter P. The signal recognition particle (SRP) RNA links

conformational changes in the SRP to protein targeting. Molecular biology of the cell.

2007;18(7):2728-34. Epub 2007/05/18.

108. Parlitz R, Eitan A, Stjepanovic G, Bahari L, Bange G, Bibi E, et al. Escherichia

coli signal recognition particle receptor FtsY contains an essential and autonomous

membrane-binding amphipathic helix. The Journal of biological chemistry.

2007;282(44):32176-84. Epub 2007/08/30.

109. Weiche B, Burk J, Angelini S, Schiltz E, Thumfart JO, Koch HG. A cleavable N-

terminal membrane anchor is involved in membrane binding of the Escherichia coli SRP

receptor. Journal of molecular biology. 2008;377(3):761-73. Epub 2008/02/19.

110. Angelini S, Boy D, Schiltz E, Koch HG. Membrane binding of the bacterial signal

recognition particle receptor involves two distinct binding sites. The Journal of cell

biology. 2006;174(5):715-24. Epub 2006/08/23.

111. Kuhn P, Weiche B, Sturm L, Sommer E, Drepper F, Warscheid B, et al. The

bacterial SRP receptor, SecA and the ribosome use overlapping binding sites on the SecY

translocon. Traffic. 2011;12(5):563-78. Epub 2011/01/25.

112. von Loeffelholz O, Knoops K, Ariosa A, Zhang X, Karuppasamy M, Huard K, et

al. Structural basis of signal sequence surveillance and selection by the SRP-FtsY

complex. Nature structural & molecular biology. 2013;20(5):604-10. Epub 2013/04/09.

113. Peterson JH, Woolhead CA, Bernstein HD. Basic amino acids in a distinct subset

of signal peptides promote interaction with the signal recognition particle. The Journal of

biological chemistry. 2003;278(46):46155-62. Epub 2003/09/02.

114. Bornemann T, Jockel J, Rodnina MV, Wintermeyer W. Signal sequence-

independent membrane targeting of ribosomes containing short nascent peptides within

103

the exit tunnel. Nature structural & molecular biology. 2008;15(5):494-9. Epub

2008/04/09.

115. Zhang X, Rashid R, Wang K, Shan SO. Sequential checkpoints govern substrate

selection during cotranslational protein targeting. Science. 2010;328(5979):757-60. Epub

2010/05/08.

116. Halic M, Blau M, Becker T, Mielke T, Pool MR, Wild K, et al. Following the

signal sequence from ribosomal tunnel exit to signal recognition particle. Nature.

2006;444(7118):507-11. Epub 2006/11/07.

117. Buskiewicz IA, Jockel J, Rodnina MV, Wintermeyer W. Conformation of the

signal recognition particle in ribosomal targeting complexes. RNA. 2009;15(1):44-54.

Epub 2008/11/26.

118. Ataide SF, Schmitz N, Shen K, Ke A, Shan SO, Doudna JA, et al. The crystal

structure of the signal recognition particle in complex with its receptor. Science.

2011;331(6019):881-6. Epub 2011/02/19.

119. Estrozi LF, Boehringer D, Shan SO, Ban N, Schaffitzel C. Cryo-EM structure of

the E. coli translating ribosome in complex with SRP and its receptor. Nature structural &

molecular biology. 2011;18(1):88-90. Epub 2010/12/15.

120. Krogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane

protein topology with a hidden Markov model: application to complete genomes. Journal

of molecular biology. 2001/01/12 ed2001. p. 567-80.

121. Duong F, Wickner W. Distinct catalytic roles of the SecYE, SecG and SecDFyajC

subunits of preprotein translocase holoenzyme. The EMBO journal. 1997;16(10):2756-

68. Epub 1997/05/15.

122. Dalbey RE, Kuhn A. YidC family members are involved in the membrane

insertion, lateral integration, folding, and assembly of membrane proteins. The Journal of

cell biology. 2004;166(6):769-74. Epub 2004/09/15.

123. Samuelson JC, Chen M, Jiang F, Moller I, Wiedmann M, Kuhn A, et al. YidC

mediates membrane protein insertion in bacteria. Nature. 2000;406(6796):637-41. Epub

2000/08/19.

124. Yi L, Celebi N, Chen M, Dalbey RE. Sec/SRP requirements and energetics of

membrane insertion of subunits a, b, and c of the Escherichia coli F1F0 ATP synthase.

The Journal of biological chemistry. 2004;279(38):39260-7. Epub 2004/07/21.

125. Pross E, Soussoula L, Seitl I, Lupo D, Kuhn A. Membrane Targeting and

Insertion of the C-Tail Protein SciP. Journal of molecular biology. 2016;428(20):4218-

27. Epub 2016/09/08.

126. Peschke M, Le Goff M, Koningstein GM, Karyolaimos A, de Gier JW, van Ulsen

P, et al. SRP, FtsY, DnaK and YidC Are Required for the Biogenesis of the E. coli Tail-

Anchored Membrane Proteins DjlC and Flk. Journal of molecular biology.

2018;430(3):389-403. Epub 2017/12/17.

127. Hennon SW, Soman R, Zhu L, Dalbey RE. YidC/Alb3/Oxa1 Family of Insertases.

The Journal of biological chemistry. 2015;290(24):14866-74. Epub 2015/05/08.

128. van der Laan M, Urbanus ML, Ten Hagen-Jongman CM, Nouwen N, Oudega B,

Harms N, et al. A conserved function of YidC in the biogenesis of respiratory chain

104

complexes. Proceedings of the National Academy of Sciences of the United States of

America. 2003;100(10):5801-6. Epub 2003/05/02.

129. van der Laan M, Bechtluft P, Kol S, Nouwen N, Driessen AJ. F1F0 ATP synthase

subunit c is a substrate of the novel YidC pathway for membrane protein biogenesis. The

Journal of cell biology. 2004;165(2):213-22. Epub 2004/04/21.

130. du Plessis DJ, Nouwen N, Driessen AJ. Subunit a of cytochrome o oxidase

requires both YidC and SecYEG for membrane insertion. The Journal of biological

chemistry. 2006;281(18):12248-52. Epub 2006/03/04.

131. Price CE, Driessen AJ. YidC is involved in the biogenesis of anaerobic

respiratory complexes in the inner membrane of Escherichia coli. The Journal of

biological chemistry. 2008;283(40):26921-7. Epub 2008/07/19.

132. Ravaud S, Stjepanovic G, Wild K, Sinning I. The crystal structure of the

periplasmic domain of the Escherichia coli membrane protein insertase YidC contains a

substrate binding cleft. The Journal of biological chemistry. 2008;283(14):9350-8. Epub

2008/02/01.

133. Jiang F, Chen M, Yi L, de Gier JW, Kuhn A, Dalbey RE. Defining the regions of

Escherichia coli YidC that contribute to activity. The Journal of biological chemistry.

2003;278(49):48965-72. Epub 2003/09/25.

134. Petriman NA, Jauss B, Hufnagel A, Franz L, Sachelaru I, Drepper F, et al. The

interaction network of the YidC insertase with the SecYEG translocon, SRP and the SRP

receptor FtsY. Scientific reports. 2018;8(1):578. Epub 2018/01/14.

135. Xie K, Kiefer D, Nagler G, Dalbey RE, Kuhn A. Different regions of the

nonconserved large periplasmic domain of Escherichia coli YidC are involved in the

SecF interaction and membrane insertase activity. Biochemistry. 2006;45(44):13401-8.

Epub 2006/11/01.

136. Chiba S, Ito K. MifM monitors total YidC activities of Bacillus subtilis, including

that of YidC2, the target of regulation. Journal of bacteriology. 2015;197(1):99-107.

Epub 2014/10/15.

137. Errington J, Appleby L, Daniel RA, Goodfellow H, Partridge SR, Yudkin MD.

Structure and function of the spoIIIJ gene of Bacillus subtilis: a vegetatively expressed

gene that is essential for sigma G activity at an intermediate stage of sporulation. Journal

of general microbiology. 1992;138(12):2609-18. Epub 1992/12/01.

138. Borowska MT, Dominik PK, Anghel SA, Kossiakoff AA, Keenan RJ. A YidC-

like Protein in the Archaeal Plasma Membrane. Structure. 2015;23(9):1715-24. Epub

2015/08/11.

139. Jiang F, Yi L, Moore M, Chen M, Rohl T, Van Wijk KJ, et al. Chloroplast YidC

homolog Albino3 can functionally complement the bacterial YidC depletion strain and

promote membrane insertion of both bacterial and chloroplast thylakoid proteins. The

Journal of biological chemistry. 2002;277(22):19281-8. Epub 2002/03/14.

140. Preuss M, Ott M, Funes S, Luirink J, Herrmann JM. Evolution of mitochondrial

oxa proteins from bacterial YidC. Inherited and acquired functions of a conserved protein

insertion machinery. The Journal of biological chemistry. 2005;280(13):13004-11. Epub

2005/01/18.

105

141. van Bloois E, Koningstein G, Bauerschmitt H, Herrmann JM, Luirink J.

Saccharomyces cerevisiae Cox18 complements the essential Sec-independent function of

Escherichia coli YidC. The FEBS journal. 2007;274(21):5704-13. Epub 2007/10/10.

142. Sundberg E, Slagter JG, Fridborg I, Cleary SP, Robinson C, Coupland G.

ALBINO3, an Arabidopsis nuclear gene essential for chloroplast differentiation, encodes

a chloroplast protein that shows homology to proteins present in bacterial membranes and

yeast mitochondria. The Plant cell. 1997;9(5):717-30. Epub 1997/05/01.

143. Gerdes L, Bals T, Klostermann E, Karl M, Philippar K, Hunken M, et al. A

second thylakoid membrane-localized Alb3/OxaI/YidC homologue is involved in proper

chloroplast biogenesis in Arabidopsis thaliana. The Journal of biological chemistry.

2006;281(24):16632-42. Epub 2006/04/06.

144. Woolhead CA, Thompson SJ, Moore M, Tissier C, Mant A, Rodger A, et al.

Distinct Albino3-dependent and -independent pathways for thylakoid membrane protein

insertion. The Journal of biological chemistry. 2001;276(44):40841-6. Epub 2001/08/29.

145. Benz M, Bals T, Gugel IL, Piotrowski M, Kuhn A, Schunemann D, et al. Alb4 of

Arabidopsis promotes assembly and stabilization of a non chlorophyll-binding

photosynthetic complex, the CF1CF0-ATP synthase. Molecular plant. 2009;2(6):1410-

24. Epub 2009/12/10.

146. Falk S, Ravaud S, Koch J, Sinning I. The C terminus of the Alb3 membrane

insertase recruits cpSRP43 to the thylakoid membrane. The Journal of biological

chemistry. 2010;285(8):5954-62. Epub 2009/12/19.

147. Klostermann E, Droste Gen Helling I, Carde JP, Schunemann D. The thylakoid

membrane protein ALB3 associates with the cpSecY-translocase in Arabidopsis thaliana.

The Biochemical journal. 2002;368(Pt 3):777-81. Epub 2002/09/10.

148. Bonnefoy N, Chalvet F, Hamel P, Slonimski PP, Dujardin G. OXA1, a

Saccharomyces cerevisiae nuclear gene whose sequence is conserved from prokaryotes to

eukaryotes controls cytochrome oxidase biogenesis. Journal of molecular biology.

1994;239(2):201-12. Epub 1994/06/03.

149. Funes S, Nargang FE, Neupert W, Herrmann JM. The Oxa2 protein of

Neurospora crassa plays a critical role in the biogenesis of cytochrome oxidase and

defines a ubiquitous subbranch of the Oxa1/YidC/Alb3 protein family. Molecular biology

of the cell. 2004;15(4):1853-61. Epub 2004/02/10.

150. Ott M, Herrmann JM. Co-translational membrane insertion of mitochondrially

encoded proteins. Biochimica et biophysica acta. 2010;1803(6):767-75. Epub

2009/12/08.

151. Jia L, Dienhart M, Schramp M, McCauley M, Hell K, Stuart RA. Yeast Oxa1

interacts with mitochondrial ribosomes: the importance of the C-terminal region of Oxa1.

The EMBO journal. 2003;22(24):6438-47. Epub 2003/12/06.

152. Fiumera HL, Broadley SA, Fox TD. Translocation of mitochondrially synthesized

Cox2 domains from the matrix to the intermembrane space. Molecular and cellular

biology. 2007;27(13):4664-73. Epub 2007/04/25.

153. Chen Y, Dalbey RE. Oxa1 Superfamily: New Members Found in the ER. Trends

in biochemical sciences. 2018;43(3):151-3. Epub 2018/01/10.

106

154. Anghel SA, McGilvray PT, Hegde RS, Keenan RJ. Identification of Oxa1

Homologs Operating in the Eukaryotic Endoplasmic Reticulum. Cell reports.

2017;21(13):3708-16. Epub 2017/12/28.

155. Srivastava R, Zalisko BE, Keenan RJ, Howell SH. The GET System Inserts the

Tail-Anchored Protein, SYP72, into Endoplasmic Reticulum Membranes. Plant

physiology. 2017;173(2):1137-45. Epub 2016/12/08.

156. Guna A, Volkmar N, Christianson JC, Hegde RS. The ER membrane protein

complex is a transmembrane domain insertase. Science. 2018;359(6374):470-3. Epub

2017/12/16.

157. Shurtleff MJ, Itzhak DN, Hussmann JA, Schirle Oakdale NT, Costa EA, Jonikas

M, et al. The ER membrane protein complex interacts cotranslationally to enable

biogenesis of multipass membrane proteins. eLife. 2018;7. Epub 2018/05/29.

158. Spann D, Pross E, Chen Y, Dalbey RE, Kuhn A. Each protomer of a dimeric

YidC functions as a single membrane insertase. Scientific reports. 2018;8(1):589. Epub

2018/01/14.

159. Boy D, Koch HG. Visualization of distinct entities of the SecYEG translocon

during translocation and integration of bacterial proteins. Molecular biology of the cell.

2009;20(6):1804-15. Epub 2009/01/23.

160. Serek J, Bauer-Manz G, Struhalla G, van den Berg L, Kiefer D, Dalbey R, et al.

Escherichia coli YidC is a membrane insertase for Sec-independent proteins. The EMBO

journal. 2004;23(2):294-301. Epub 2004/01/24.

161. Aschtgen MS, Zoued A, Lloubes R, Journet L, Cascales E. The C-tail anchored

TssL subunit, an essential protein of the enteroaggregative Escherichia coli Sci-1 Type

VI secretion system, is inserted by YidC. MicrobiologyOpen. 2012;1(1):71-82. Epub

2012/09/06.

162. Dalbey RE, Kuhn A, Zhu L, Kiefer D. The membrane insertase YidC. Biochimica

et biophysica acta. 2014;1843(8):1489-96. Epub 2014/01/15.

163. Kumazaki K, Chiba S, Takemoto M, Furukawa A, Nishiyama K, Sugano Y, et al.

Structural basis of Sec-independent membrane protein insertion by YidC. Nature.

2014;509(7501):516-20. Epub 2014/04/18.

164. Kumazaki K, Kishimoto T, Furukawa A, Mori H, Tanaka Y, Dohmae N, et al.

Crystal structure of Escherichia coli YidC, a membrane protein chaperone and insertase.

Scientific reports. 2014;4:7299. Epub 2014/12/04.

165. Chen Y, Soman R, Shanmugam SK, Kuhn A, Dalbey RE. The role of the strictly

conserved positively charged residue differs among the Gram-positive, Gram-negative,

and chloroplast YidC homologs. The Journal of biological chemistry.

2014;289(51):35656-67. Epub 2014/11/02.

166. Zhu L, Wasey A, White SH, Dalbey RE. Charge composition features of model

single-span membrane proteins that determine selection of YidC and SecYEG translocase

pathways in Escherichia coli. The Journal of biological chemistry. 2013;288(11):7704-

16. Epub 2013/01/29.

167. Price CE, Driessen AJ. Conserved negative charges in the transmembrane

segments of subunit K of the NADH:ubiquinone oxidoreductase determine its

107

dependence on YidC for membrane insertion. The Journal of biological chemistry.

2010;285(6):3575-81. Epub 2009/12/05.

168. Chen Y, Capponi S, Zhu L, Gellenbeck P, Freites JA, White SH, et al. YidC

Insertase of Escherichia coli: Water Accessibility and Membrane Shaping. Structure.

2017;25(9):1403-14 e3. Epub 2017/08/29.

169. Klenner C, Yuan J, Dalbey RE, Kuhn A. The Pf3 coat protein contacts TM1 and

TM3 of YidC during membrane biogenesis. FEBS letters. 2008;582(29):3967-72. Epub

2008/11/11.

170. Neugebauer SA, Baulig A, Kuhn A, Facey SJ. Membrane protein insertion of

variant MscL proteins occurs at YidC and SecYEG of Escherichia coli. Journal of

molecular biology. 2012;417(4):375-86. Epub 2012/02/09.

171. Kedrov A, Wickles S, Crevenna AH, van der Sluis EO, Buschauer R,

Berninghausen O, et al. Structural Dynamics of the YidC:Ribosome Complex during

Membrane Protein Biogenesis. Cell reports. 2016;17(11):2943-54. Epub 2016/12/16.

172. Winterfeld S, Ernst S, Borsch M, Gerken U, Kuhn A. Real time observation of

single membrane protein insertion events by the Escherichia coli insertase YidC. PloS

one. 2013;8(3):e59023. Epub 2013/03/26.

173. Geng Y, Kedrov A, Caumanns JJ, Crevenna AH, Lamb DC, Beckmann R, et al.

Role of the Cytosolic Loop C2 and the C Terminus of YidC in Ribosome Binding and

Insertion Activity. The Journal of biological chemistry. 2015;290(28):17250-61. Epub

2015/05/30.

174. Soman R, Yuan J, Kuhn A, Dalbey RE. Polarity and charge of the periplasmic

loop determine the YidC and sec translocase requirement for the M13 procoat lep protein.

The Journal of biological chemistry. 2014;289(2):1023-32. Epub 2013/11/28.

175. Kol S, Majczak W, Heerlien R, van der Berg JP, Nouwen N, Driessen AJ. Subunit

a of the F(1)F(0) ATP synthase requires YidC and SecYEG for membrane insertion.

Journal of molecular biology. 2009;390(5):893-901. Epub 2009/06/06.

176. Celebi N, Yi L, Facey SJ, Kuhn A, Dalbey RE. Membrane biogenesis of subunit

II of cytochrome bo oxidase: contrasting requirements for insertion of N-terminal and C-

terminal domains. Journal of molecular biology. 2006;357(5):1428-36. Epub 2006/02/21.

177. Zhu L, Klenner C, Kuhn A, Dalbey RE. Both YidC and SecYEG are required for

translocation of the periplasmic loops 1 and 2 of the multispanning membrane protein

TatC. Journal of molecular biology. 2012;424(5):354-67. Epub 2012/10/13.

178. Welte T, Kudva R, Kuhn P, Sturm L, Braig D, Muller M, et al. Promiscuous

targeting of polytopic membrane proteins to SecYEG or YidC by the Escherichia coli

signal recognition particle. Molecular biology of the cell. 2012;23(3):464-79. Epub

2011/12/14.

179. Schulze RJ, Komar J, Botte M, Allen WJ, Whitehouse S, Gold VA, et al.

Membrane protein insertion and proton-motive-force-dependent secretion through the

bacterial holo-translocon SecYEG-SecDF-YajC-YidC. Proceedings of the National

Academy of Sciences of the United States of America. 2014;111(13):4844-9. Epub

2014/02/20.

180. Egea PF, Stroud RM. Lateral opening of a translocon upon entry of protein

suggests the mechanism of insertion into membranes. Proceedings of the National

108

Academy of Sciences of the United States of America. 2010;107(40):17182-7. Epub

2010/09/22.

181. Sachelaru I, Petriman NA, Kudva R, Kuhn P, Welte T, Knapp B, et al. YidC

occupies the lateral gate of the SecYEG translocon and is sequentially displaced by a

nascent membrane protein. The Journal of biological chemistry. 2013;288(23):16295-

307. Epub 2013/04/24.

182. Beck K, Eisner G, Trescher D, Dalbey RE, Brunner J, Muller M. YidC, an

assembly site for polytopic Escherichia coli membrane proteins located in immediate

proximity to the SecYE translocon and lipids. EMBO reports. 2001;2(8):709-14. Epub

2001/07/21.

183. Nagamori S, Smirnova IN, Kaback HR. Role of YidC in folding of polytopic

membrane proteins. The Journal of cell biology. 2004;165(1):53-62. Epub 2004/04/07.

184. Zhu L, Kaback HR, Dalbey RE. YidC protein, a molecular chaperone for LacY

protein folding via the SecYEG protein machinery. The Journal of biological chemistry.

2013;288(39):28180-94. Epub 2013/08/10.

185. Serdiuk T, Mari SA, Muller DJ. Pull-and-Paste of Single Transmembrane

Proteins. Nano letters. 2017;17(7):4478-88. Epub 2017/06/20.

186. Xie K, Dalbey RE. Inserting proteins into the bacterial cytoplasmic membrane

using the Sec and YidC translocases. Nature reviews Microbiology. 2008;6(3):234-44.

Epub 2008/02/05.

187. Facey SJ, Kuhn A. The sensor protein KdpD inserts into the Escherichia coli

membrane independent of the Sec translocase and YidC. European journal of

biochemistry / FEBS. 2003;270(8):1724-34. Epub 2003/04/16.

188. Altrichter S, Haase M, Loh B, Kuhn A, Leptihn S. Mechanism of the Spontaneous

and Directional Membrane Insertion of a 2-Transmembrane Ion Channel. ACS chemical

biology. 2017;12(2):380-8. Epub 2016/12/15.

189. Jomaa A, Boehringer D, Leibundgut M, Ban N. Structures of the E. coli

translating ribosome with SRP and its receptor and with the translocon. Nature

communications. 2016;7:10471. Epub 2016/01/26.

190. Economou A, Wickner W. SecA promotes preprotein translocation by undergoing

ATP-driven cycles of membrane insertion and deinsertion. Cell. 1994;78(5):835-43.

Epub 1994/09/09.

191. Wagner S, Pop OI, Haan GJ, Baars L, Koningstein G, Klepsch MM, et al.

Biogenesis of MalF and the MalFGK(2) maltose transport complex in Escherichia coli

requires YidC. The Journal of biological chemistry. 2008;283(26):17881-90. Epub

2008/05/06.

192. Yi L, Jiang F, Chen M, Cain B, Bolhuis A, Dalbey RE. YidC is strictly required

for membrane insertion of subunits a and c of the F(1)F(0)ATP synthase and SecE of the

SecYEG translocase. Biochemistry. 2003;42(35):10537-44. Epub 2003/09/03.

193. Kuhn A. Alterations in the extracellular domain of M13 procoat protein make its

membrane insertion dependent on secA and secY. European journal of biochemistry /

FEBS. 1988;177(2):267-71. Epub 1988/11/01.

109

194. Lee JI, Kuhn A, Dalbey RE. Distinct domains of an oligotopic membrane protein

are Sec-dependent and Sec-independent for membrane insertion. The Journal of

biological chemistry. 1992;267(2):938-43. Epub 1992/01/15.

195. Pradel N, Delmas J, Wu LF, Santini CL, Bonnet R. Sec- and Tat-dependent

translocation of beta-lactamases across the Escherichia coli inner membrane.

Antimicrobial agents and chemotherapy. 2009;53(1):242-8. Epub 2008/11/05.

196. Yang YB, Lian J, Tai PC. Differential translocation of protein precursors across

SecY-deficient membranes of Escherichia coli: SecY is not obligatorily required for

translocation of certain secretory proteins in vitro. Journal of bacteriology.

1997;179(23):7386-93. Epub 1997/12/11.

197. Whitley P, Zander T, Ehrmann M, Haardt M, Bremer E, von Heijne G. Sec-

independent translocation of a 100-residue periplasmic N-terminal tail in the E. coli inner

membrane protein proW. The EMBO journal. 1994;13(19):4653-61. Epub 1994/10/03.

198. Cao G, Dalbey RE. Translocation of N-terminal tails across the plasma

membrane. The EMBO journal. 1994;13(19):4662-9. Epub 1994/10/03.

199. Gray AN, Henderson-Frost JM, Boyd D, Sharafi S, Niki H, Goldberg MB.

Unbalanced charge distribution as a determinant for dependence of a subset of

Escherichia coli membrane proteins on the membrane insertase YidC. mBio. 2011;2(6).

Epub 2011/11/24.

200. Traxler B, Murphy C. Insertion of the polytopic membrane protein MalF is

dependent on the bacterial secretion machinery. The Journal of biological chemistry.

1996;271(21):12394-400. Epub 1996/05/24.

201. Matsuyama S, Akimaru J, Mizushima S. SecE-dependent overproduction of SecY

in Escherichia coli. Evidence for interaction between two components of the secretory

machinery. FEBS letters. 1990;269(1):96-100. Epub 1990/08/20.

202. Dalbey RE, Wickner W. The role of the polar, carboxyl-terminal domain of

Escherichia coli leader peptidase in its translocation across the plasma membrane. The

Journal of biological chemistry. 1986;261(29):13844-9. Epub 1986/10/15.

203. Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, et al.

Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene

expression. Cell. 2013;152(5):1173-83. Epub 2013/03/05.

204. van Bloois E, Haan GJ, de Gier JW, Oudega B, Luirink J. Distinct requirements

for translocation of the N-tail and C-tail of the Escherichia coli inner membrane protein

CyoA. The Journal of biological chemistry. 2006;281(15):10002-9. Epub 2006/02/17.

205. Mitsopoulos C, Hashemzadeh-Bonehi L, Broome-Smith JK. N-tail translocation

of mature beta-lactamase across the Escherichia coli cytoplasmic membrane. FEBS

letters. 1997;419(1):18-22. Epub 1998/01/13.

206. McMurry JL, Kendall DA. An artificial transmembrane segment directs SecA,

SecB, and electrochemical potential-dependent translocation of a long amino-terminal

tail. The Journal of biological chemistry. 1999;274(10):6776-82. Epub 1999/02/26.

207. Maniatis T, Fritsch EF, Sambrook J. Molecular cloning: a laboratory manual:

Cold spring harbor laboratory Cold Spring Harbor, NY; 1982.

110

208. Haldimann A, Wanner BL. Conditional-replication, integration, excision, and

retrieval plasmid-host systems for gene structure-function studies of bacteria. Journal of

bacteriology. 2001;183(21):6384-93. Epub 2001/10/10.

209. Sibley MH, Raleigh EA. A versatile element for gene addition in bacterial

chromosomes. Nucleic acids research. 2012;40(3):e19. Epub 2011/11/30.

210. Phillips GJ, Park SK, Huber D. High copy number plasmids compatible with

commonly used cloning vectors. BioTechniques. 2000;28(3):400-2, 4, 6 passim. Epub

2000/03/21.

211. Bellafiore S, Ferris P, Naver H, Gohre V, Rochaix JD. Loss of Albino3 leads to

the specific depletion of the light-harvesting system. The Plant cell. 2002;14(9):2303-14.

Epub 2002/09/07.

212. Moore M, Harrison MS, Peterson EC, Henry R. Chloroplast Oxa1p homolog

albino3 is required for post-translational integration of the light harvesting chlorophyll-

binding protein into thylakoid membranes. The Journal of biological chemistry.

2000;275(3):1529-32. Epub 2000/01/15.

213. Ossenbuhl F, Gohre V, Meurer J, Krieger-Liszkay A, Rochaix JD, Eichacker LA.

Efficient assembly of photosystem II in Chlamydomonas reinhardtii requires Alb3.1p, a

homolog of Arabidopsis ALBINO3. The Plant cell. 2004;16(7):1790-800. Epub

2004/06/23.

214. Bonnefoy N, Fiumera HL, Dujardin G, Fox TD. Roles of Oxa1-related inner-

membrane translocases in assembly of respiratory chain complexes. Biochimica et

biophysica acta. 2009;1793(1):60-70. Epub 2008/06/05.

215. Hell K, Herrmann JM, Pratje E, Neupert W, Stuart RA. Oxa1p, an essential

component of the N-tail protein export machinery in mitochondria. Proceedings of the

National Academy of Sciences of the United States of America. 1998;95(5):2250-5. Epub

1998/04/16.

216. van Bloois E, Nagamori S, Koningstein G, Ullers RS, Preuss M, Oudega B, et al.

The Sec-independent function of Escherichia coli YidC is evolutionary-conserved and

essential. The Journal of biological chemistry. 2005;280(13):12996-3003. Epub

2005/01/27.

217. Szyrach G, Ott M, Bonnefoy N, Neupert W, Herrmann JM. Ribosome binding to

the Oxa1 complex facilitates co-translational protein insertion in mitochondria. The

EMBO journal. 2003;22(24):6448-57. Epub 2003/12/06.

218. Keil M, Bareth B, Woellhaf MW, Peleh V, Prestele M, Rehling P, et al. Oxa1-

ribosome complexes coordinate the assembly of cytochrome C oxidase in mitochondria.

The Journal of biological chemistry. 2012;287(41):34484-93. Epub 2012/08/21.

219. Kruger V, Deckers M, Hildenbeutel M, van der Laan M, Hellmers M, Dreker C,

et al. The mitochondrial oxidase assembly protein1 (Oxa1) insertase forms a membrane

pore in lipid bilayers. The Journal of biological chemistry. 2012;287(40):33314-26. Epub

2012/07/26.

220. Wang F, Chan C, Weir NR, Denic V. The Get1/2 transmembrane complex is an

endoplasmic-reticulum membrane protein insertase. Nature. 2014;512(7515):441-4. Epub

2014/07/22.

111

221. Elson EL. Fluorescence correlation spectroscopy: past, present, future.

Biophysical journal. 2011;101(12):2855-70. Epub 2012/01/03.

222. Ernst S, Schonbauer AK, Bar G, Borsch M, Kuhn A. YidC-driven membrane

insertion of single fluorescent Pf3 coat proteins. Journal of molecular biology.

2011;412(2):165-75. Epub 2011/07/30.

223. Moore M, Goforth RL, Mori H, Henry R. Functional interaction of chloroplast

SRP/FtsY with the ALB3 translocase in thylakoids: substrate not required. The Journal of

cell biology. 2003;162(7):1245-54. Epub 2003/10/01.

224. Dunschede B, Bals T, Funke S, Schunemann D. Interaction studies between the

chloroplast signal recognition particle subunit cpSRP43 and the full-length translocase

Alb3 reveal a membrane-embedded binding region in Alb3 protein. The Journal of

biological chemistry. 2011;286(40):35187-95. Epub 2011/08/13.