R E S E A R C H A R T I C L E

Intragenomic heterogeneityofthe16S rRNAgene in strainUFO1caused bya100-bp insertion in helix6Allison E. Ray1, Stephanie A. Connon1,2, Peter P. Sheridan1, Jeremy Gilbreath1, Malcolm Shields1,Deborah T. Newby3, Yoshiko Fujita3 & Timothy S. Magnuson1

1Department of Biological Sciences, Idaho State University, Pocatello, ID, USA; 2Jet Propulsion Laboratory, California Institute of Technology,

Pasadena, CA, USA; and 3Idaho National Laboratory, Biological Systems Department, Idaho Falls, ID, USA

Correspondence: Present address: Allison

E. Ray, Biofuels and Renewable Energy

Technology, Idaho National Laboratory, PO

Box 1625, Idaho Falls, ID 83415, USA. Tel.:11

208 526 4554; fax:11 208 526 2639; e-mail:

alikona.ray@gmail.com

Received 31 March 2009; revised 23 February

2010; accepted 7 March 2010.

Final version published online 22 April 2010.

DOI:10.1111/j.1574-6941.2010.00868.x

Editor: Michael Wagner

Keywords

16S rRNA genes; gene inserts; intragenomic

heterogeneity; intervening sequence (IVS);

helix 6.

Abstract

Two different versions of the 16S rRNA gene, one of which contained an unusual100-bp insertion in helix 6, were detected in isolate UFO1 acquired from the OakRidge Integrated Field-Research Challenge (ORIFRC) site in Tennessee. rRNAwasextracted from UFO1 and analyzed by reverse transcriptase-quantitative PCR withinsert- and non-insert-specific primers; only the noninsert 16S rRNA genesequence was detected. Similarly, PCR-based screening of a cDNA library (190clones) constructed from reverse-transcribed rRNA from UFO1 did not detect anyclones containing the 100-bp insert. Examination of cDNAwith primers specific tothe insert-bearing 16S rRNA gene, but downstream of the insert, suggests that theinsert was excised from rRNA. Inspection of other 16S rRNA genes in the GenBankdatabase revealed that a homologous insert sequence, also found in helix 6, hasbeen reported in other environmental clones, including those acquired fromORIFRC enrichments. These findings demonstrate the existence of widely diver-gent copies of the 16S rRNA gene within the same organism, which may confound16S rRNA gene-based methods of estimating microbial diversity in environmentalsamples.

Introduction

Analysis of 16S rRNA gene sequences has become theaccepted standard basis for interpreting evolutionary rela-tionships among bacteria and a foundation of modernmicrobial ecology (Woese & Fox, 1977; Woese, 1987). Inassessments of microbial diversity that are based on retrievalof 16S rRNA genes from the environment, unique 16S rRNAgenes are generally assumed to represent different organisms(Hugenholtz et al., 1998). The determination and compar-ison of 16S rRNA gene sequences is a requirement for theidentification of bacterial isolates and the classification ofprokaryotic species (Stackebrandt et al., 2002). However, anindividual bacterium can have multiple copies of 16S rRNAgenes, which may skew estimates of diversity if the sequencesare divergent. The presence of multiple copies of the 16SrRNA gene and heterogeneity among these genes in a singleorganism has been examined in sequenced microbial gen-omes (Coenye & Vandamme, 2003; Acinas et al., 2004).Significant intragenomic heterogeneity between multiple

copies of 16S rRNA genes has been reported for Thermo-bispora bispora (Wang et al., 1997), Haloarcula marismortui(Mylvaganam & Dennis, 1992; Amann et al., 2000), Desulfo-tomaculum kuznetsovii (Tourova et al., 2001), Anaerosporahongkongensis (Woo et al., 2005), several Aeromonas strains(Morandi et al., 2005), and strains of Desulfitobacterium(Villemur et al., 2007).

It is thought that multiple copies of the rRNA gene arerequired to provide sufficient quantities of rRNA to meet thecellular demand for functional ribosomes (Alberts et al.,2002). In general, it is expected that a positive correlationexists between the growth rate and the number of ribosomaloperons in the genomes of prokaryotic species (Fogel et al.,1999; Klappenbach et al., 2000). However, most Archaeahave only a single ribosomal operon (Acinas et al., 2004),and high growth rates have been observed for some Archaeapossessing a single rRNA operon (Zillig, 1992; Klappenbachet al., 2000). Moreover, while deletion or disruption of oneof several copies of rRNA operons has been shown to have aminimal effect on the growth rate in some bacteria (Condon

FEMS Microbiol Ecol 72 (2010) 343–353 c! 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

MIC

ROBI

OLO

GY

ECO

LOG

Y

et al., 1995; Pisabarro et al., 1998), other research has showna correlation between the number of ribosomal operons andthe rate of adaptation to a change in nutrient source byspecies in a community of soil bacteria (Condon et al., 1995;Klappenbach et al., 2000). The latter suggests that rRNAgene copy number may be a component of ecologicalstrategies for environmental bacterial populations. Whenmultiple copies of 16S rRNA genes are present within asingle genome, the sequences are often identical or verysimilar; this homogeneity of rRNA gene sequences is be-lieved to result from high selection pressure for the con-servation of the important functional role that these genesplay in cellular protein synthesis (Tourova, 2003) and can bebrought about through gene conversion mechanisms (Liao,2000).

Previous work with Escherichia coli suggested that largevariations occurring in one 16S rRNA gene copy can be fixedthrough recombination events with other 16S rRNA genecopies, thereby homogenizing the sequence among all copies(Hashimoto et al., 2003). However, insertion sequences100–200 bp in length have been found in the 50 region ofsome bacterial 16S rRNA genes (Patel et al., 1992; Woo et al.,2005; Villemur et al., 2007). Intervening sequences (IVSs) areintron-like elements that have been found in the rRNA genesof bacteria (Zimmerly, 2005). Previous studies have shownthat IVSs are excised from mature 23S rRNA genes withoutreligation of RNA fragments after excision (Burgin et al.,1990; Pronk & Sanderson, 2001). A 194 bp IVS was detectedin the 16S rRNA gene of the bacterial endosymbiont,Caedibacter caryophila, and the presence of a fragmented16S rRNA gene in C. caryophila was demonstrated (Springeret al., 1993). Another report of IVS in the bacterial endo-symbiont of a protist from an acid mine drainage habitat atIron Mountain, CA, postulated that IVSs may contribute tocommunications required between a host and an endosym-biont (Baker et al., 2003), although the function of IVSs inrRNA genes is unclear (Pronk & Sanderson, 2001).

Strain UFO1 (DQ295866, EU215386) is a free-living,fermentative bacterium capable of metal transformationthat was isolated from sediments collected at the USDepartment of Energy’s Oak Ridge Integrated Field-Re-search Challenge (ORIFRC) site in Oak Ridge, TN; it is afirmicute from the Veillonellaceae family in the orderClostridiales (Ray, 2007). During the characterization ofUFO1, sequencing of multiple 16S rRNA gene clonesrevealed the existence of two unique 16S rRNA genes instrain UFO1, but it was unclear whether both sequencescoded for functional rRNA because one of the genesappeared to contain a 100-bp insert that was absent in theother; the sequences are referred to hereafter as ‘insert-bearing’ and ‘noninsert’ genes (Fig. 1). In order to deter-mine whether both of the 16S rRNA gene sequences wereexpressed in the ribosomes of UFO1, rRNA was purified

from ribosomes and reverse transcribed. This cDNA wasthen used as a template to conduct the following analyses:(1) quantitative PCR (qPCR) with primers specific to theinsert and noninsert regions to determine the relativeabundance of the insert and noninsert sequences in thecDNA, (2) cDNA clone library construction from ampliconsgenerated by universal bacterial primers to test for thepresence of insert-bearing and noninsert ribotypes, and (3)PCR with primers specific to the insert-bearing and non-insert sequences, but not located within the insert region, inorder to determine whether the insert region was excisedfrom the gene. Together, the results suggest that both thenoninsert and the insert-bearing ribotypes were expressed,but that the insert was excised from the functional 16S rRNAgene of the insert-bearing ribotype.

Materials and methods

Culture conditions

Strain UFO1 was routinely cultured in an anoxic R2 brothand incubated at 30 1C. R2 broth was prepared from a drymix (BD Diagnostic Systems, Franklin Lakes, NJ) or asfollows (per liter): 0.5 g yeast extract; 0.5 g proteose peptone;0.5 g casamino acids; 0.5 g glucose; 0.5 g soluble starch; 0.3 gsodium pyruvate; 0.3 g K2HPO4; and 0.05 g MgSO4 (Rea-soner & Geldreich, 1985), supplemented with 20mM fuma-rate, and adjusted to pH 7. The prepared broth was boiledand cooled under a headspace of N2 and dispensed intoanaerobic pressure tubes or serum vials with a headspace ofN2, which were then sealed with thick butyl-rubber stoppersand autoclaved.

16S rRNA gene amplification

PCR amplification of the 16S rRNA gene from genomicDNA of strain UFO1 was performed with universal primerset combinations: 8F and 907R and 704F and 1492R, whichare variations of commonly used primers that target bacteria

Fig. 1. 16S rRNA genes in Strain UFO1 used for the design of primer sets

and probes specific to each gene and illustrating the approximate

locations of primer and probe sites on both genes. Shaded region (dark

gray and black) indicate regions of sequence dissimilarity. Ins-F and Ins-R

and F/R indicate the locations of forward and reverse primers for insert

and noninsert sequences. Primer sets were designed using PRIMER3 soft-

ware based on putative 16S rRNA gene sequences. Insert probe is

specific for insert sequence only, while 515–1492 probes will recognize

both insert-bearing and noninsert 16S rRNA genes.

FEMS Microbiol Ecol 72 (2010) 343–353c! 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

344 A.E. Ray et al.

(Lane, 1991). Each 50-mL PCR mixture contained 1U ofDeep VentTM polymerase and 1"ThermoPol reaction buf-fer (New England Biolabs, Ipswich, MA), 250 mM dNTPs,800 nM of each primer, 2mM MgSO4, and 1.5mL of DNAtemplate. The PCR amplification conditions were as follows:an initial 95 1C denaturation for 5min, followed by 30 cyclesof 95 1C denaturation for 1min, 56 1C primer annealing for1min, and 72 1C extension for 2.5min. A final extension wasperformed at 72 1C for 4min. PCR products were purifiedwith spin columns using the Qiagen QIAquicks PCRPurification Kit (Valencia, CA) as per the manufacturer’sinstructions. The 16S rRNA gene products were sequenceddirectly, without preliminary cloning, at the Idaho StateUniversity Molecular Research Core Facility (ISU MRCF)on an ABI 3100 automated capillary sequencer (AppliedBiosystems, Foster City, CA) using primers 8F, 519F, 907R,704F, 1100F, and 1492R (Lane, 1991) in order to ensureoverlap of sequences. In addition, PCR products amplifiedwith 8F and 1492R primers were cloned in order to resolve30 and 50 ends of the 16S rRNA gene, using the TOPOs TAClonings Kit for Sequencing (Invitrogen, Carlsbad, CA).

Ribosome isolation, RNA purification, andreverse transcription

An actively growing (mid-log phase, OD600 nm 0.178),anaerobic culture of strain UFO1 in R2 broth was used forribosome isolation. A cell pellet was obtained via centrifuga-tion at 8000 g for 10min and stored in 2mL of RNAlaters

(Ambion, Austin, TX) at # 20 1C overnight. A portion ofthis pellet was used for ribosome isolation and rRNApreparation as described previously (Pace et al., 1982). TheRNAlater supernatant was discarded, and cells were resus-pended in DEPC-treated 50mM Tris-HCl (pH 7.3)/0.5MNH4Cl/5mM MgCl2 and passed three times through aFrench press at 20 000 psi. The disrupted cell suspensionwas diluted with an equal volume of 50mM Tris-HCl (pH7.3)/0.5M NH4Cl/5mMMgCl2 and clarified at 48 000 g and2 1C. The supernatant was centrifuged at 100 000 g for 3 h at2 1C to obtain a ribosome pellet. The pellet was resuspendedin 400 mL of 10mM Tris-HCl (pH 7.3)/1mM EDTA/0.5%sodium dodecyl sulfate (SDS) on ice. rRNA was purifiedfrom the ribosomes by three phenol extractions and twoethanol precipitations. rRNA preparations were treated withTurboTM DNase (Ambion) according to the manufacturer’sinstructions. rRNA was reverse transcribed to generatecDNA using Transcriptor Reverse Transcriptase (RocheApplied Science, Indianapolis, IN) according to the manu-facturer’s instructions with the 1492R primer.

qPCR with cDNA template

To determine whether both copies of the 16S rRNA genewere expressed, qPCR was performed with cDNA template

generated from rRNA using primer sets specific to insert(Insert F/Insert R) and noninsert (Noninsert F/Noninsert R)sequences (Table 1). Insert and noninsert primer sets wereused with the FastStart SYBR Green Master kit (RocheApplied Science) for the detection and relative quantificationof these genes in the cDNA generated from the rRNA.Reactions were performed using a Rotor-GeneTM 3000 (Cor-bett Life Science, Sydney, Australia) real-time thermal cyclerand software version 6.0.38. Each 20-mL reaction mixturecontained 10mL of FastStart SYBRGreenMaster mix, 175 nMof each primer, 0.5U uracil N-glycosylase (Roche AppliedScience), 8.05mL H2O, and 1mL of template. The amplifica-tion conditions for qPCR were as follows: 40 1C hold for10min, 95 1C denaturation for 10min, and then 45 cycles of95 1C for 5 s, 56 1C for 15 s, and 72 1C for 10 s. Following 45cycles of amplification, a melting curve was recorded bycooling to 72 1C, holding for 45 s, and then heating at0.2 1C s#1 until 95 1C. Reactions with insert and noninsertprimer sets were performed separately, and dilutions ofgenomic DNA from strain UFO1 were used to generatestandard curves for both primer sets in separate reactions.UFO1 genomic DNAwas used over a concentration range of3.6–3.6" 10#4 ngmL#1 in sequential 10-fold dilutions; reac-tions containing UFO1 genomic DNA and cDNA templatewere performed in triplicate. Genomic DNA from E. coli K12JM109 was used as a negative control. Control reactionscontaining (1) RNA template in the absence of reversetranscriptase and (2) no RNA template were also preparedfor use in the qPCR studies in order to examine the potentialcontribution of contaminating DNA in rRNA preparations orthe potential for rRNA to serve as a template in qPCR.

cDNA clone library construction and screening

PCR was used to generate amplicons from the cDNAtemplate with primers 8F and 1492R, as described

Table 1. Primer sets specific to noninsert, insert, and insert-bearing

sequences

Primer Sequence

Noninsert F 50-TTCAGCAATGGAATCTTAGTGG-3 0

Noninsert R 50-CAACATTCGGTATTAGCACCA-30

Insert F 50-AGCAGTGTAGCAAGCGTCAA-30

Insert R 50-TAGCACCACTTTCGCAGTGT-30

Insert R! (blot) 50-CGCTTTTGTGTTRGCACTTT-30

UFOins278 R 50-GTATGTGAAACAGGCG-30

Potential priming sites specific to the insert and noninsert sequences

were determined using PRIMER 3 (Rozen & Skaletsky, 2000). The CLUSTALW

Multiple Alignment tool in BIOEDIT (version 7.0.5.3; Department of Micro-

biology, North Carolina State University, Raleigh, NC) was used to align

sequences for primer design. Insert F and Insert R!were used to generate

a 72-bp amplicon for the synthesis of a radiolabeled, insert-specific

probe for the Southern blot. UFOins278R was used to target the insert-

bearing sequence beyond the region of the insert.

FEMS Microbiol Ecol 72 (2010) 343–353 c! 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

345Intragenomic heterogeneity in helix 6 of UFO1 16S rRNA gene

previously. The products were cloned using the TOPOs TAClonings Kit for sequencing. Plasmids were purified fromclones using the Montage Plasmid MiniPrep96 Kit (Milli-pore, Billerica, MA).

Purified plasmids from 190 clones were screened for thepresence of the insert by conventional PCR with insert-specific primers, Insert F/Insert R and 8F/1492R, in separatereactions. Reactions were performed in 96-well plates, andeach 30-mL reaction contained 0.75U Taq DNA polymerase,1"ThermoPol reaction buffer (New England Biolabs),200mM dNTPs, 250 nM of each primer, and 0.5 mL ofplasmid DNA. The PCR conditions were as follows: aninitial 95 1C denaturation for 5min, followed by 30 cyclesof 95 1C denaturation for 30 s, 55 1C primer annealing for30 s, and 72 1C extension for 1min (or 1.5min with 8F/1492R), and then a final extension at 72 1C for 7min.

Additionally, cDNA was used as a template for conven-tional PCR in order to evaluate whether the insert wasexcised from rRNA. A primer was designed that was uniqueto the insert-bearing 16S rRNA gene beyond the 100-bpinsert in a region of variability that exists between the insert-bearing (bases 271–289) and the noninsert (bases 171–189)sequences. A reverse primer, UFOins278R (50-GTA TGTGAA ACA GGC G-30), was used in combination with 8F inorder to detect the insert-bearing sequence (regardless ofwhether or not it contained the 100-bp insert) in the cDNAof UFO1. 16S rRNA gene clones derived from genomic DNAof strain UFO1 that contained the insert-bearing and non-insert genes were used as positive and negative controls,respectively. Reactions were performed using JumpStartTM

ReadyMixTM Taq (Sigma, St. Louis, MO) according to themanufacturer’s instructions and amplified for 45 cycles.Electropherograms of the resultant products were deter-mined on the Agilent 2100 Bioanalyzer (Santa Clara, CA).

Predicted 16S rRNA gene secondary structure

16S rRNA gene sequences from strain UFO1 were alignedusing ARB (Strunk et al., 1996). The secondary structure ofrRNA was predicted using RNAfold Web Server (Hofackeret al., 1994; Gruber et al., 2008). The default programsettings for fold algorithms and basic options were usedwith RNA parameters as described previously (Mathewset al., 1999).

Radioactive probe synthesis and Southern blothybridization

Radioactive probes were synthesized using a-32P dCTP (MPBiomedicals, Irvine, CA), the DECAprime IITM RandomDecamer primer extension kit (Ambion), and PCR ampli-cons from strain UFO1 generated using insert and universalprimer sets. A 72-bp probe specific to the insert region wasgenerated using the same forward primer as in qPCR, Insert

F, and a reverse primer, Insert R! (50-CGC TTT TGT GTTRGC ACT TT-30) (Table 1 and Fig. 1). A probe that wasspecific to both genes, but downstream of the insert region,was generated using primers 515F and 1492R.

Restricted genomic DNA was analyzed by Southern blot-ting and hybridization with radiolabeled probes (Ausubelet al., 1992). A minimum of 500 ng of DNA per 25-mLreaction was digested with BamHI, HindIII, PstI, NotI,HaeII, EcoRI, or EarI for 16 h at 37 1C. Double digests werealso performed with the following enzyme combinations:HaeII and HindIII, EcoRI and HindIII, or EarI and HindIIIfor 16 h at 37 1C. Restricted DNA was electrophoresed on agel containing ethidium bromide and imaged with UV light.The gel was treated with 0.25M HCl for 30min, denaturedin 0.5M NaOH/1.5M NaCl for 20min (repeated), neutra-lized for 20min in 1M Tris-HCl (repeated), treated with1.5M sodium chloride at pH 7.4, and rinsed in 2" salinesodium citrate (SSC). The gel was transferred to a Hybond-N nitrocellulose membrane (GE Healthcare-AmershamBiosciences, Piscataway, NJ) by vacuum blotting for90min, rinsed in 2" SSC, and then UV cross-linked at120 000 mJ cm#2 (Fisher BioScience UVXC-1000, Pittsburgh,PA). The membranes were wetted in a 6" SSC solutioncontaining 1% SDS. Prehybridization was performed for aminimum of 12 h in 15–20mL of APH solution (5" SSC,3% SDS, 100mgmL#1 denatured herring sperm DNA) at68 1C. Before hybridization, each probe was denatured at95 1C for 1min, and rapidly cooled on ice. The denaturedprobe was added to each hybridization bottle containing theprehybridized membranes. Hybridization was performed fora minimum of 12 h in 15–20mL of APH solution at 68 1C.Posthybridization washes were performed twice with2" SSC, 2% SDS at room temperature, twice with 2" SSC,2% SDS at 45 1C, and twice with 1" SSC, 1% SDS at 60 1Cfor 15min. Hybridized membranes were exposed using anFX Imaging Screen-K (Bio-Rad Laboratories, Hercules, CA)and visualized using a Bio-Rad FX molecular imager withQUANTITY ONE analysis software (Bio-Rad Laboratories).

Phylogenetic analysis

Phylogenetic analysis was conducted using both PAUP!

(Swofford, 2002) and ARB software (Strunk et al., 1996).The ARB database contained over 13 500 16S rRNA genesequences, which included all major phylogenetic groups.Sequences were also screened with the GenBank database(http://www.ncbi.nlm.nih.gov) and close matches that werenot already in the ARB database were added. Sequences werealigned using the Fast Aligner in ARB, followed by carefulhand alignment and masked using a slight variation of thestandard Lane mask in ARB that allowed the maximuminclusion of bases; the insert region was masked out.Phylogenetic trees were inferred by neighbor-joining with

FEMS Microbiol Ecol 72 (2010) 343–353c! 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

346 A.E. Ray et al.

the Jukes and Cantor model to estimate evolutionarydistances and resulted in the same tree topography in bothPAUP

! and ARB. Bootstrap values were obtained in PAUP! from

a consensus of 1000 neighbor-joining trees. The final treewas constructed in ARB and short sequences were added tothe tree using the parsimony insertion tool in ARB and areindicated by an asterisk in Fig. 2. The percent similarity ofsequences was determined with the distance matrix tool inARB using an unmasked sequence; gaps and ambiguous baseswere excluded. Both sequences have been submitted to theDDBJ/EMBL/GenBank databases under accession numbersDQ295866 (noninsert) and EU215386 (insert).

Results

Significant heterogeneity was observed in the 50 region ofthe 16S rRNA gene in strain UFO1. When 16S rRNA geneamplicons were cloned and sequenced, two versions of the16S rRNA gene were detected, one of which contained a100-bp insertion. The 100-bp insert occurs at nucleotidepositions 73–172 (Fig. 3), which corresponds to helix 6(positions 73–82/87–97, E. coli nomenclature) (Woese et al.,

1983; Patel et al., 1992). The two genes have a 98.4%sequence similarity, excluding the 100-bp insert region,where most of the gene shows an identical sequencepunctuated by two areas of variability. Twenty variable basepositions that form a stem loop were identified in thenoninsert gene at positions 63–82 located at the site of theinsert, where the insert-bearing sequence shows variabilityfrom bases 63 to 182, with bases 73–172 being the insertregion itself. Variability was also found at bases 272–289(172–189 in the noninsert gene).

In order to determine whether both 16S rRNA genesequences were expressed, reverse transcriptase (RT) qPCRwas used to detect insert and noninsert gene sequences inthe cDNA generated from rRNA of strain UFO1. The RT-qPCR assays using primer sets specific to insert and non-insert regions of the genes suggested that the insert sequencewas not expressed. The insert-specific primer set amplifiedgenomic DNA standards at concentrations from 3.6 to3.6" 10#4 ng mL#1 DNA, yielding (predominant) productswith an average melting temperature (Tm) of 81.5 1C. Insert-specific primer reactions containing 1mL of undilutedcDNA template had Ct values beyond the detection limit,

Fig. 2. Neighbor-joining tree showing the

phylogenetic relationships of the 16S rRNA genes

of the Veillonellaceae family, which includes the

UFO1 clade; the type species for each genus in

the family is included. The insert sequence in the

helix 6 region and all ambiguous bases and gaps

were excluded from the analysis, leaving 1204

characters to infer the tree. Bootstrap values

Z60 are shown at branch points. The tree was

rooted using six members of the Peptococcaceae

family (accession nos CP000141, U76363,

X55797, X99706, Y10164, Y18214), not shown

in the tree. Scale bar indicates 0.1 change per

nucleotide. Short sequences were added to the

tree using the parsimony insertion tool in ARB and

are indicated by an asterisk. UFO1 (insert) and

UFO1 (noninsert) are in bold for clarity, being the

sequences identified and discussed in this study.

FEMS Microbiol Ecol 72 (2010) 343–353 c! 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

347Intragenomic heterogeneity in helix 6 of UFO1 16S rRNA gene

with only one sample indicating a minor product witha Tm of 81.8 1C. Genomic DNA template from E. coliK12 JM109 was used as a negative control and did notproduce a product with Tm comparable to the standards.The no-template and reverse transcriptase-negativecontrol reactions did not amplify with the insert-specificprimers.

Amplicons produced from UFO1 genomic DNA templatewith noninsert specific primers had an average Tm of80.5 1C. Reactions containing 1mL of a 10#2 dilution of cDNAtemplate were predicted to have an average concentrationequivalent to 1.13 ngmL#1 genomic DNA template (or113 ngmL#1 for undiluted cDNA template) with an averageTm of 80.8 1C. No-template and reverse transcriptase-negative controls had a minor product with a Tm at 80.5 1Cand a calculated concentration of 10#5 ng mL#1, whichwas an order of magnitude below the least concentratedgenomic DNA standard (3.6" 10#4 ng mL#1). This smalleffect may be attributable to RNA serving as a template foramplification or to the presence of contaminating DNA inthe RNA preparation, but overall it was insignificant relativeto the response for the noninsert target gene present in thecDNA template. In addition, 30 cycles of conventional PCRwith 8F and 1492R performed on the no-template andreverse transcriptase-negative (RNA template) controlsshowed no products, indicating that the DNA contamina-tion or the contribution of the RNA as a template was likelyvery minimal.

cDNA transcribed from the rRNA of strain UFO1 wasfurther screened for the insert-bearing sequence in a cDNAclone library. The genomic DNA template from strain UFO1yielded a product with the insert-specific primers. Esche-richia coli K12 JM109 genomic DNA template was used as anegative control and did not amplify. Purified plasmid DNAtemplate from cDNA clones did not amplify with the insert-specific primers. In total, 190 clones were screened, none ofwhich amplified with the insert-specific primers. PlasmidDNA from the 190 cDNA clones was also screened withuniversal primers 8F/1492R in order to ensure that eachclone contained a 16S rRNA gene; all did (data not shown).Five clones selected at random were screened with thenoninsert primers and they all contained the 102-bp non-insert target amplicon.

The cDNA from strain UFO1 was also examined in orderto evaluate whether the insert was excised from rRNA. Theprimer UFOins278R, unique to the insert-bearing version ofthe 16S rRNA gene, but targeted downstream of the insert,in combination with 8F, would produce a predicted 293-bpproduct according to the insert-bearing 16S rRNA genesequence. 16S rRNA gene clones derived from genomicDNA of strain UFO1 that contained the insert-bearing andnoninsert genes were used as positive and negative controls,respectively. Plasmids that contained the noninsert 16SrRNA gene from UFO1 did not produce an amplicon of theexpected 293 bp size; plasmids containing a copy of theinsert-bearing gene produced an amplicon of the expectedsize. When cDNA was used as a template, an amplicon ofonly$190 bp was produced. The difference in the size of theamplicons produced with the insert-bearing positive con-trols vs. cDNA ($100 bp) suggests that the insert-bearingribotype was expressed, but that the insert may have beenexcised from rRNA post-transcriptionally.

A Southern blot of restricted genomic DNA furtherconfirmed the presence of the insert-bearing sequence inthe genomic DNA of strain UFO1 (Fig. 4). Insert fragmenthybrids were detected in the restriction digests of genomicDNA upon exposure to radiolabeled 72-bp insert-specificprobes. In HindIII and PstI restriction digests, there ap-peared to be at least two copies of the insert sequencepresent in the genomic DNA of strain UFO1. However,similar hybridization patterns were seen when probes wereused that targeted a region downstream of the insert thatwas specific to both genes 515F and 1492R. There were noHindIII or PstI cut sites within either the insert or thenoninsert 16S rRNA gene sequence, and so the copiesappeared to be present on separate fragments of DNAgenerated with both enzymes; however, it may be possiblethat more than one copy was present on the fragmentsgenerated by HindIII or PstI. We were unable to discern theactual number of copies of insert-bearing and noninsert 16SrRNA genes in the UFO1 genome.

Analysis of the predicted secondary structure for the inser-tion in helix 6 of the 16S rRNA gene suggested a functionalrRNA with the formation of an energetically favorable stemloop structure (Fig. 5). The insert sequence formed aloop with a minimum free energy of # 54.4 kcalmol#1,

Insert AGAGTTTGATTCTGGCTCAG GACGAACGCTGGCGGCGTGC CTAACACATGCAAGTCGAAC GGTCTGGTATTCAACACTGA ATTTTTAGCAGTGTAGCAAG 100 Non-ins AGAGTTTGATCCTGGCTCAG GACGAACGCTGGCGGCGTGC CTAACACATGCAAGTCGAAC GGAGATTTCAGC-------- -------------------- 72

Insert CGTCAAGCGCGAAAGAAGTG AGCGCTTCACGCATTTACAA AGTGCTAACACAAAAGCGAA AGATTGAGTGTTGAATATCA GATAGTGGCGAACGGGTGAG 200 Non-ins -------------------- -------------------- -------------------- ------------AATGGAAT CTTAGTGGCGAACGGGTGAG 100

Insert TAACGCGTAGACAACCTACC TTCTAGATGGGGACAACACT GCGAAAGTGGTGCTAATACC GAATGTTGTATGTGAAACGC CTGTTTCACATACTAAAGGT 300 Non-ins TAACGCGTAGACAACCTACC TTCTAGATGGGGACAACACT GCGAAAGTGGTGCTAATACC GAATGTTGTATTTTAGATGC ATATTTAAGATACTAAAGGT 200

Fig. 3. Alignment of partial sequences of the 16S rRNA gene insert-bearing (EU215386) and noninsert (DQ295866) genes for strain UFO1. The insert is

shown in base positions 73–172 of the insert-bearing gene, which corresponds to 20 variable base positions in the noninsert gene at positions 63–82.

Variability was also noted at bases 272–289 in the insert-bearing gene (172–189 in the noninsert gene).

FEMS Microbiol Ecol 72 (2010) 343–353c! 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

348 A.E. Ray et al.

while the noninsert gene was # 10.3 kcalmol#1. The 100-bpinsert sequence did not contain an ORF with a translatablesequence.

UFO1 is included in a clade within the Veillonellaceaefamily, hereafter referred to as the UFO1 clade (Fig 2.), thatincludes Pelosinus fermentans (Shelobolina et al., 2007) andSporotalea propionica (Boga et al., 2007) with a bootstrapcertainty of 100. While the two copies of the UFO1 16SrRNA gene have a 98.4% sequence similarity to each other,excluding the 100-bp insert, they also have a sequencesimilarity comparable to P. fermentans at 98.3% (noninsert)and 97.9% (insert-bearing) and slightly less similarity to S.propionica at 97.9% (noninsert) and 97.0% (insert-bearing).The 100-bp insert from UFO1 was queried separatelyagainst the NCBI database using the BLASTN program(http://blast.ncbi.nlm.nih.gov), and seven environmentalclones of the 16S rRNA gene were discovered that have aninsert in helix 6 with a close sequence similarity to the insertfound in UFO1 and that also branch in the UFO1 cladewhere the insert region has been excluded from the phylo-genetic analysis (Fig 2). The insert-containing environmen-tal clones were found in various soil environments. It isinteresting to note that three of these clones were acquiredfrom Fe(III)-reducing enrichments inoculated from varioussoils: clone KFeR2-10, an enrichment inoculated from thesoils of an acidic mine in Germany (EF544631), (Porschet al., 2009); clone C-u_Lac-1_66, an enrichment inoculatedwith soil collected in the unsaturated zone C horizon of theMelton Branch Watershed, Oak Ridge, TN (EU307103)(Hansel et al., 2008); and clone Gly0305C, from an enrich-

ment inoculated with acidic subsurface sediments contami-nated with uranium(VI) at the ORIFRC site (AY524568)(Petrie et al., 2003). The other four insert-containing 16SrRNA gene clones found in the NCBI database were derivedfrom various soils: clone Hmd12B83 from holocene sedi-ments from the archaeological site of Hemudu in China(EF197052), (Wang et al., 2008); clones TSSUR002_A14 andTSNIR003_K13 from a rice paddy in Japan (AB488128 andAB487414, unpublished data); and clone TCCC 11092 fromsoil (EU567043, unpublished data). Only one other memberof the Veillonellaceae family was found to have an insert inhelix 6. The Thermosinus carboxydivorans genome sequencewas found to contain multiple copies of the 16S rRNA geneincluding one with a large insert in helix 6 (accession no.NZ_AAWL01000016 region 10934–12605) and one withoutthis insert (accession no. NZ_AAWL01000022 region1529–3082); these two sequences branch together in the treewith a bootstrap value of 100 (Fig. 2), but are not includedin the UFO1 clade.

Discussion

The literature indicates that 16S rRNA gene interoperonheterogeneities are typically relatively minor in bacterialspecies, with most 16S rRNA gene copies within a givenbacterium having very similar, if not identical sequences(Coenye & Vandamme, 2003; Tourova, 2003; Acinas et al.,2004). Studies examining 16S rRNA gene sequence homo-geneity within a bacterial species have concluded thatrecombination events are responsible for the conservation

Fig. 4. Southern blots hybridized to

insert- and non-insert-specific probes.

The gel shows the restriction digests of

genomic DNA, the first blot illustrates the

insert fragment hybrids detected, and

the second blot shows the noninsert

hybrids in restricted genomic DNA. Two

copies of the insert sequence are

apparent in genomic DNA digests with

HindIII and PstI.

Fig. 5. Comparative predictions of helix

6 secondary structure and minimum free energy

for insert and noninsert sequences from strain

UFO1. Sequences were analyzed using RNAfold

Web Server (Gruber et al., 2008).

FEMS Microbiol Ecol 72 (2010) 343–353 c! 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

349Intragenomic heterogeneity in helix 6 of UFO1 16S rRNA gene

seen within rRNA genes (Liao, 2000; Hashimoto et al.,2003). The homogenization of 16S rRNA genes is usuallyexplained as the result of gene conversion: a form ofrecombination between different ‘versions’ of the same genethat results in the nonreciprocal transfer of genetic informa-tion and maintains the same sequence in all copies of thegene (Liao, 2000; Hashimoto et al., 2003). However, theresults of this study demonstrate the presence of distinctlydifferent copies of the 16S rRNA gene within a singlebacterial strain, with the presence of a 100-bp insertion inone of two known copies of the 16S rRNA gene punctuatedby regions of sequence divergence among the two copies.

The insert sequence was not detected in RT-qPCR experi-ments or during screening of an rRNA-derived clone library,when primers targeting the insert sequence were used.Further examination of the cDNA from strain UFO1 usinga reverse primer specific to the insert-bearing sequence, butdownstream of the region of the insert, suggested theexpression of the insert-bearing ribotype with insert exci-sion and religation of the 16S rRNA gene, as was reportedpreviously for strains of Desulfitobacterium (Villemur et al.,2007).

An alternative to insert excision as an explanation for thedetection of the 190-bp product from cDNA and primers 8Fand UFOins278R could be that the insert-bearing sequenceis actually not expressed, and an alternate, otherwise un-detected copy of a 16S rRNA gene from strain UFO1 thatdoes not contain the insert, but has sequence homology withthe rest of the insert-bearing sequence, is expressed. Genomesequencing of strain UFO1 would be necessary in order todetermine the true 16S rRNA gene copy number andsequence divergence among multiple copies. The insert-bearing sequence may represent a 16S rRNA pseudogene.Pseudogenes are nonfunctional DNA sequences (genes) thathave been disabled as a result of mutations, insertions,deletions, and/or frameshifts that can accumulate in bacter-ial genomes over long periods of time (Mira & Pushker,2005). Given the important functional role of the 16S rRNAgene in the ribosome, it makes sense that preventing theexpression of degenerate rRNA pseudogenes is critical toprotein synthesis and cell survival.

Another possible explanation for the absence of the insertin the rRNA of strain UFO1 could be due to the differentialexpression of distinct 16S rRNA genes under various envir-onmental conditions, although the occurrence of this phe-nomenon in bacterial rRNA operons is unknown (Caseet al., 2007). Differential expression of divergent rRNAoperons was demonstrated in the halophilic archaeon,H. marismortui, under different temperature conditions,suggesting that the presence of divergent copies of rRNAgenes indicates adaptations that may improve fitness at highor low temperatures (Lopez-Lopez et al., 2007). However,the divergence seen among 16S rRNA gene copies of

H. marismortui was a consequence of nucleotide sequencedivergence (Dennis et al., 1998) rather than the presence ofinsertions or IVSs. The differential expression of two diver-gent 18S rRNA genes was observed at various stages of thelife cycle in the eukaryotic parasite Plasmodium berghei(Gunderson et al., 1987). It may be possible that thedifferential expression of distinct 16S rRNA genes in strainUFO1 also occurs, but was not detected under the condi-tions studied here. This hypothesis could be exploredfurther by examination of rRNA expression under variousenvironmental conditions, for example, nutrient limitation,high and low temperatures, presence or absence of metalcontaminants, etc.

Strain UFO1 was isolated from pristine sediments fromthe background area of the ORIFRC site at Oak RidgeNational Laboratory. Clones with high 16S rRNA genesequence similarity to strain UFO1 have also been detectedin Fe(III)-reducing enrichments initiated with contami-nated ORIFRC sediments (Petrie et al., 2003), which maysuggest a prevalence of this organism in subsurface environ-ments at this site. The most closely related, described speciesto strain UFO1 is P. fermentans strain R7T, a fermentativebacterium that was similarly isolated from an Fe(III)-reducing enrichment established with subsurface sedimentsoriginating from Plast, Russia (Shelobolina et al., 2007).Another close relative of strain UFO1 is S. propionica (Bogaet al., 2007), a strictly anaerobic bacterium isolated from theintestinal tract of the soil-feeding termite, Thoracotermesmacrothorax. Sporotalea propionica ferments various sub-strates to propionate. Although these organisms share a highlevel of 16S rRNA gene sequence similarity to strain UFO1,there are no reports of insertions in the 16S rRNA genes ofeither P. fermentans strain R7Tor S. propionica.

A recent study with Desulfitobacterium strains has alsoreported an intragenomic heterogeneity caused by the pre-sence of 100–200-bp inserts among copies of the 16S rRNAgene (Villemur et al., 2007). All eight of the strains examinedhad at least one copy of the 16S rRNA gene with a largeinsert in the 50 region beginning at nucleotide 68 (E. colinumbering) in a region that encompasses helix 6 of therRNA molecule and is known to be highly variable amongbacterial species. Examination of total RNA extracts withRT-PCR revealed that the insertions were absent in therRNA transcripts of all, except for one of the eight Desulfi-tobacterium strains. Interestingly, the 100-bp insert found inone copy of the 16S rRNA gene in strain UFO1 also starts atnucleotide 68 (E. coli numbering; position 62 in UFO1accession no. EU215386). When a BLAST search was per-formed with the 100-bp insert sequence from strain UFO1,three of the seven clones found had significant sequencehomology in the insert region: clone KFeR2-10 (EF544631)from a study of iron-reducing organisms in an acid-minedrainage-impacted lake undergoing remediation (Porsch

FEMS Microbiol Ecol 72 (2010) 343–353c! 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

350 A.E. Ray et al.

et al., 2009) was 95% similar; clone Hmd12B83 (EF197052)from a study of bacterial diversity along a geochemicalgradient in Holocene sediment in China (Wang et al.,2008) was 93% similar; and clone Gly030-5C (AY524568)from an iron-reducing enrichment with U(VI)-contami-nated sediments from the ORIFRC site (Petrie et al., 2003)was also 93% similar. Examination of the partial 16S rRNAgene sequence from these clones reveals that the insert alsooccurs in helix 6. In the study by Villemur et al. (2007), asearch of gene databases for sequences similar to the eighttypes of insertions seen in Desulfitobacterium strains foundthat 29 other insertion sequences, 57–217 nucleotides long,located at position 68, and all except for one of the 29sequences were associated with Veillonellaceae, Clostridi-aceae, Peptococcaceae, Peptostreptococcaceae, or Syntropho-monadaceae families within the order Clostridiales. Most ofthe sequences containing insertions were in clones derivedfrom environmental samples, and in several instances, thesampled environments were contaminated with halogenatedcompounds or U(VI). The results presented here are con-sistent with the findings of Villemur et al. (2007), suggestingthat among members of Clostridiales, such as strain UFO1,insertions in helix 6 of the 50 region of the 16S rRNA geneare not unusual. Villemur and colleagues suggest that thisregion could potentially be the site of a homing sequence forinsertions, and helix 6 in the 16S rRNA gene has also beenidentified as a ‘heterogeneity hot spot’ in multiple species(Case et al., 2007). The detection of the same insert sequencein a clone derived from contaminated ORIFRC sediments,along with the location of the insert in a variable region ofthe 16S rRNA gene, may further suggest that the insert inUFO1 was acquired from an environmental pool as a resultof horizontal gene transfer between organisms that occupy asimilar niche. Previous studies of IVSs have inferred mobi-lity, although the mechanism of mobility is unknown(Zimmerly, 2005).

Acknowledgements

We would like to thank Hope Lee, Aren Eddingsaas, JamesHenriksen, Amber Miller, Joni Barnes, Lynn Wendt, andCindy Breckenridge for helpful advice and technical assis-tance. We thank Erin O’Leary-Jepson and Michelle Andrewsof the Idaho State University Molecular Research CoreFacility for 16S rRNA gene sequencing. We also extend ourthanks to David Reed and Frank Roberto, of the INL forreviewing this manuscript and providing helpful comments.This work was supported by the Idaho National Laboratory,the Inland Northwest Research Alliance (Grant NumberISU-004 to T.S.M., and Graduate Fellowship to A.E.R.),and the US Department of Energy (Grant NumberDE-FG02-04ER63626 to T.S.M.).

ReferencesAcinas SG, Marcelino LA, Klepac-Ceraj V & Polz MF (2004)

Divergence and redundancy of 16S rRNA sequences ingenomes with multiple rrn operons. J Bacteriol 186:2629–2635.

Alberts B, Johnson A, Lewis J, Raff M, Roberts K & Walter P(2002)Molecular Biology of the Cell. Garland Science, NewYork, NY.

Amann G, Stetter KO, Llobet-Brossa E, Amann R & Anton J(2000) Direct proof for the presence and expression of two 5%different 16S rRNA genes in individual cells of Haloarculamarismortui. Extremophiles 4: 373–376.

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG,Smith JA & Struhl K (1992) Short Protocols in MolecularBiology. Greene Publishing Associates and John Wiley & Sons,New York.

Baker BJ, Hugenholtz P, Dawson SC & Banfield JF (2003)Extremely acidophilic protists from acid mine drainage hostRickettsiales-lineage endosymbionts that have interveningsequences in their 16S rRNA genes. Appl Environ Microb 69:5512–5518.

Boga H, Ji R, Ludwig W & Brune A (2007) Sporotalea propionicagen. nov. sp. nov., a hydrogen-oxidizing, oxygen-reducing,propionigenic firmicute from the intestinal tract of a soil-feeding termite. Arch Microbiol 187: 15–27.

Burgin AB, Parodos K, Lane DJ & Pace NR (1990) The excision ofintervening sequences from Salmonella 23S ribosomal RNA.Cell 60: 405–414.

Case RJ, Boucher Y, Dahllof I, Holmstrom C, Doolittle WF &Kjelleberg S (2007) Use of 16S rRNA and rpoB genes asmolecular markers for microbial ecology studies. Appl EnvironMicrob 73: 278–288.

Coenye T & Vandamme P (2003) Intragenomic heterogeneitybetween multiple 16S ribosomal RNA operons in sequencedbacterial genomes. FEMS Microbiol Lett 228: 45–49.

Condon C, Liveris D, Squires C, Schwartz I & Squires CL (1995)rRNA operon multiplicity in Escherichia coli and thephysiological implications of rrn inactivation. J Bacteriol 177:4152–4156.

Dennis PP, Ziesche S & Mylvaganam S (1998) Transcriptionanalysis of two disparate rRNA operons in the halophilicarchaeon Haloarcula marismortui. J Bacteriol 180: 4804–4813.

Fogel GB, Collins CR, Li J & Brunk CF (1999) Prokaryoticgenome size and SSU rDNA copy number: estimation ofmicrobial relative abundance from amixed population.MicrobEcol 38: 93–113.

Gruber AR, Lorenz R, Bernhart SH, Neubock R & Hofacker IL(2008) The Vienna RNAwebsuite. Nucleic Acids Res 36:W70–W74.

Gunderson JH, Sogin ML, Wollett G, Hollingdale M, DelacruzVF, Waters AP & Mccutchan TF (1987) Structurally distinct,stage specific ribosomes occur in Plasmodium. Science 238:933–937.

Hansel CM, Fendorf S, Jardine PM & Francis CA (2008) Changesin bacterial and archaeal community structure and functional

FEMS Microbiol Ecol 72 (2010) 343–353 c! 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

351Intragenomic heterogeneity in helix 6 of UFO1 16S rRNA gene

diversity along a geochemically variable soil profile. Appl

Environ Microb 74: 1620–1633.Hashimoto JG, Stevenson BS & Schmidt TM (2003) Rates and

consequences of recombination between rRNA operons.

J Bacteriol 185: 966–972.Hofacker IL, Fontana W, Stadler PF, Bonhoeffer LS, Tacker M &

Schuster P (1994) Fast folding and comparison of RNA

secondary structures.Monatsh Chem 125: 167–188.Hugenholtz P, Goebel BM & Pace NR (1998) Impact of culture-

independent studies on the emerging phylogenetic view of

bacterial diversity. J Bacteriol 180: 4765–4774.Klappenbach JA, Dunbar JM & Schmidt TM (2000) rRNA

operon copy number reflects ecological strategies of bacteria.

Appl Environ Microb 66: 1328–1333.Lane DJ (1991) 16S/23S rRNA sequencing. Nucleic Acid

Techniques in Bacterial Systematics (Stackebrandt E &

Goodfellow M, eds), pp. 115–175. John Wiley & Sons, New

York, NY.Liao D (2000) Gene conversion drives within genic sequences:

concerted evolution of ribosomal RNA genes in bacteria and

archaea. J Mol Evol 51: 305–317.Lopez-Lopez A, Benlloch S, Bonfa M, Rodriguez-Valera F & Mira

A (2007) Intragenomic 16S rDNA divergence in Haloarcula

marismortui is an adaptation to different temperatures. J Mol

Evol 65: 687–696.Mathews DH, Sabina J, Zucker M & Turner H (1999) Expanded

sequence dependence of thermodynamic parameters provides

robust prediction of RNA secondary structure. J Mol Biol 288:

911–940.Mira A & Pushker R (2005) The silencing of pseudogenes. Mol

Biol Evol 22: 2135–2138.Morandi A, Zhaxybayeva O, Gogarten JP & Graf J (2005)

Evolutionary and diagnostic implications of intragenomic

heterogeneity in the 16S rRNA gene in Aeromonas strains.

J Bacteriol 187: 6561–6564.Mylvaganam S & Dennis PP (1992) Sequence heterogeneity

between the two genes encoding 16S rRNA from the halophilic

archaebacterium Haloarcula marismortui. Genetics 130:

399–410.Pace B, Matthews EA, Johnson KD, Cantor CR & Pace NR (1982)

Conserved 5S rRNA complement to tRNA is not required for

protein synthesis. P Natl Acad Sci USA 79: 36–40.Patel BKC, Love CA & Stackebrandt E (1992) Helix 6 of the

16S rRNA of the bacterium Desulfotomaculum australicum

exhibits an unusual structural idiosyncrasy. Nucleic Acids Res

20: 5483.Petrie L, North NN, Dollhopf SL, Balkwill DL & Kostka JE (2003)

Enumeration and characterization of iron(III)-reducing

microbial communities from acidic subsurface sediments

contaminated with uranium(VI). Appl Environ Microb 69:

7467–7479.Pisabarro A, Correia A & Martin JF (1998) Characterization of

the rrnB operon of the plant pathogen Rhodococcus fascians

and targeted integrations of exogenous genes at rrn loci. Appl

Environ Microb 64: 1276–1282.

Porsch K, Meier J, Kleinsteuber S & Wendt-Potthoff K (2009)

Importance of different physiological groups of iron reducing

microorganisms in an acidic mining lake remediation

experiment. Microb Ecol 57: 701–717.Pronk LM & Sanderson KE (2001) Intervening sequences in rrl

genes and fragmentation of 23S rRNA in genera of the family

Enterobacteriaceae. J Bacteriol 183: 5782–5787.Ray AE (2007) Discovery and characterization of a novel

anaerobe with a potential role in bioremediation of metal-

contaminated subsurface environments. PhD Thesis, Idaho

State University, Pocatello, ID.Reasoner DJ & Geldreich EE (1985) A new medium for the

enumeration and subculture of bacteria from potable water.

Appl Environ Microb 49: 1–7.Rozen S & Skaletsky HJ (2000) Primer3 on the WWW for general

users and for biologist programmers. Bioinformatics Methods

and Protocols: Methods in Molecular Biology (Krawetz S &

Misener S, eds), pp. 365–386. Humana Press, Totowa, NJ.Shelobolina ES, Nevin KP, Blakeney-Hayward JD et al. (2007)

Geobacter pickeringii sp. nov., Geobacter argillaceus sp. nov.

and Pelosinus fermentans gen. nov., sp. nov., isolated

from subsurface kaolin lenses. Int J Syst Evol Micr 57:

126–135.Springer N, Ludwig W, Amann R, Schmidt HJ, Gortz HD &

Schleifer KH (1993) Occurrence of fragmented 16S rRNA in

an obligate bacterial endosymbiont of Paramecium caudatum.

P Natl Acad Sci USA 90: 9892–9895.Stackebrandt E, Frederiksen W, Garrity GM et al. (2002) Report

of the ad hoc committee for the re-evaluation of the species

definition in bacteriology. Int J Syst Evol Micr 52: 1043–1047.Strunk O, Ludwig W, Gross O et al. (1996) ARB – A Software

Environment for Sequence Data, 2.5b. Technical University of

Munich, Munich, Germany.Swofford DL (2002) PAUP (Phylogenetic Analysis Using

Parsimony), Version 4.0b10. Sinauer Associates, Sunderland,

MA.Tourova TP (2003) Copy number of ribosomal operons in

prokaryotes and its effect on phylogenetic analyses.

Microbiology 72: 437–452.Tourova TP, Kuznetzov BB, Novikova EV, Poltaraus AB & Nazina

TN (2001) Heterogeneity of the nucleotide sequences of the

16S rRNA genes of the type strain of Desulfotomaculum

kuznetsovii.Microbiology 70: 678–684.Villemur R, Constant P, Gauthier A, Shareck M & Beaudet R

(2007) Heterogeneity between 16S ribosomal RNA gene copies

borne by one Desulfitobacterium strain is caused by different

100–200 bp insertions in the 50 region. Can J Microbiol 53:

116–128.Wang J, Wu Y, Jiang H et al. (2008) High beta diversity of bacteria

in the shallow terrestrial subsurface. Environ Microbiol 10:

2537–2549.Wang Y, Zhang Z & Ramanan N (1997) The actinomycete

Thermobispora bispora contains two distinct types of

transcriptionally active 16S rRNA genes. J Bacteriol 179:

3270–3276.

FEMS Microbiol Ecol 72 (2010) 343–353c! 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

352 A.E. Ray et al.

Woese CR (1987) Bacterial evolution.Microbiol Mol Biol R 51:221–271.

Woese CR & Fox GE (1977) Phylogenetic structure of theprokaryotic domain: the primary kingdoms. P Natl Acad SciUSA 74: 5088–5090.

Woese CR, Gutell R, Gupta R & Noller HF (1983) Detailedanalysis of the higher order structure of 16S-like ribosomalribonucleic acids. Microbiol Rev 47: 621–669.

Woo PCY, Teng JLL, Leung K-W et al. (2005) Anaerosporahongkongensis gen. nov. sp. nov., a novel genus and species

with ribosomal DNA operon heterogeneity isolated from anintravenous drug abuser with pseudobacteremia.MicrobiolImmunol 49: 31–39.

Zillig W (1992) The order Thermococcales. The Prokaryotes(Balows A, Truper HG, DworkinM, Harder W & Schleifer KH,eds), pp. 702–706. Springer-Verlag, New York, NY.

Zimmerly S (2005) Mobile introns and retroelements in bacteria.Advances in Molecular and Cellular Microbiology: The DynamicBacterial Genome, Vol. 8 (Mullany P, ed), pp. 121–147.Cambridge University Press, New York.

FEMS Microbiol Ecol 72 (2010) 343–353 c! 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

353Intragenomic heterogeneity in helix 6 of UFO1 16S rRNA gene

Copyright of FEMS Microbiology Ecology is the property of Wiley-Blackwell and its content may not becopied or emailed to multiple sites or posted to a listserv without the copyright holder's express writtenpermission. However, users may print, download, or email articles for individual use.