Molecular Microbiology (1992) 6( 13), 1809-1820

Interaction of the regulatory protein NicR1 with thepromoter region of the pA01-encoded 6-hydroxy-D-nicotine oxidase gene of Arthrobacter oxidans

H. Bernauer, L. Mauch and R. Brandsch*Biomchemisches Institut der Universitat, HermannHerder Strasse 7, D-7800 Freiburg im Breisgau,Germany.

Summary

The D,L-nicotine catabolism of the Gram-positive soilbacterium Arthrobacter oxidans is linked to the pres-ence within the cells of the 160 kb catabolic plasmidpA01. pA01-cured cells tost the cataboiic enzymesand reintroduction of pAOl by electroporation intocured cells reestablished the nic* phenotype. DNAband shift assays with extracts from cured andpAOl^ celts suggested that pAOi encodes the regu-tatory protein NicR1. Footprint analysis revealed thattwo homologous patindromes (1R1 and IR2), presentin the 5'-regulatory region of the 6-HDNO gene, wereprotected from DNase I digestion. Binding of NicR1 tothe patindromes is symmetrical, co-operative, andstronger to tR1 containing the 6-HDNO gene promoterthan to IR2. Site-directed mutagenesis revealed thatsteric constraints and sequence requirements forNicRI-bindlng are located exclusively in the palin-dromic sequences. Deletions and insertions in theinterpalindromic region and in the 6-HDNO promoter-10 sequence had no effect on the binding character-istics of NtcR1 to the 6-HDNO regulatory region. Act-ing as a repressor, NicR1 prevents binding of the E.coli RNA-potymerase to the consensus a^° promoterin vitro. However, the Interaction of NicR1 with the 6-HDNO promoter region in extracts of nicotine-induced cells from various growth stages did notdiffer from that observed with extracts ofnicotine-uninduced cells.

Introduction

The capacity to degrade natural organic compounds iswidespread among soil microorganisms, it is often linkedto the presence of plasmid DNA. usualty over 100 t b insize, within these bacteria. These catabolic plasmids

Received 10 January, 1992; revised and accepted 11 March, 1992. "Forcorrespondence. Tel. (0761) 2033220; Fax (0761) 2033331.

carry a specific set of co-ordinately regulated genesinvolved in the degradation of a particular class of chemi-cal compounds {Lehrbach et ai, 1983; Harayama andDon, 1985; Harayama et ai. 1986; Ghosal etai. 1987;Horn efa/., 1991).

Efforts are being made to characterize the ptasmid-encoded pathways in order to extend their degradativespecifity to man-made xenobiotics resistant to biologicaldegradation (Lehrbach et ai, 1984). A possible way ofachieving this aim is to combine different catabolic path-ways within the same bacterium and select for the aquisi-tlon of enzymes with new or extended substrate speci-ficity (Harayama and Don, 1985). One prerequisite forsuch types of manipulation is the ability to introduce path-ways encoded on native or artificially altered plasmidsinto bacteria with diverse metabolic backgrounds. Elec-troporation has become the method of choice for thetransformation of many Gram-positive bacteria (Haynesand Britz, 1990). The feasibility of transforming plasmidslarger than 100 kb in size, by this method has, however,to our knowledge not been proved for Arthrobacterspecies.

Besides an efficient transformation system, thedirected manipulation of these pathways requires adetailed knowledge of the molecutar mechanisms govern-ing the transcriptional and translationat regulation of theexpression of the component gene clusters. Only thecatabclic plasmids of the Gram-negative bacterium Pseu-domonas putida have been analysed in detail in thisrespect (tnoye ef ai. 1983; Schell. 1986. Ramos eta/.,1990; De Lorenzo etai, 1991). No comparable know-ledge is available for Gram-positive soil bacteria, espe-cially not for the largest group betonging to the genusArthrobaoter. The strictty aerobic bacteria of this genusplay an essential rote in the cycle of energy and matterwithin the ecosystem and several are of industriatinterest.

We are invotved in the molecular characterization of thepathway allowing one of these species. Arthrobacter oxi-dans, to use the tobacco alkaloid nicotine as growth sub-strate (Decker and Bleeg. 1965). It represents a uniquemode! for the investigation of plasmid-encoded catabolicpathways in this group ot bacteria. The first enzyme of thepathway, nicotine dehydrogenase (NDH), is a trimericprotein containing Mo-pterin, FAD, and [Fe-S]-ctusters

1810 H. Bernauer, L. Mauch and R. Brandsch

1 2 3 4 1 2 3

Fig. 1. Curing ol pAOl from A. oxidans me' cells,A. Catabolic ptasmtd pAOl was isolated from A. oxidans cells by usingstandard procstlures (Sambrook eMA, 1989), Lane 1, H/ndlll-digGStGdphage k DNA as molecular weight standard; lar»e 2, EcoRV digest ofpAOl DNA isolated from A. oxidar^s r)ic' cells: lane 3, ttie same isolationprocedure reveals no pAOl DNA in cured A. oxidans nic~ cells; lane 4,EcoFlV digest oi pAOl DNA isolated from A. oxidans nic~ cellstransformed with native pAOl,B. Southern blot of £coRI-H(/idlll cleaved pAOl DNA hybridized to arandom primer ^^P-labelled 6-HDNO gene probe. Shown are pAOlpreparations trom; lane 1, A. oxidans nic' cells; fane 2, A. oxidans niccells; lane 3, -A, oxidans me*cells transformed wilh pAOl.

(Freudenberg etai. 1988). It is followed by two oxidaseswhich degrade 6-hydroxy-L-nicotine and 6-hydroxy-D-nicotine stereospecifically (Decker et al., 1972). 6-hydroxy-L nicotine oxidase (6-HLNO) is a dimer formedfrom two identical monomers, and contains FAD as cofac-tor. 6-hydroxy-D-nicotlne oxidase (6-HDNO) is amonomer with covalently bound FAD (Bruhmuller et ai.1972) and is growth-stage-dependently expressed in thestationary phase (Gloger and Decker, 1969). Besides theinducer (D,L-nicotine). expression of these genes dependson a sufficient supply of the cofactors molybdenum(Freudenberg etai., 1988) and riboflavin (Brandsch andBichler, 1990), One aim of our investigations is to eluci-date the steps in the signal transduction pathway respon-sible for the modulation of the transcriptional apparatusby cofactor supply. As part of this effort we have clonedthe 6-HDNO gene, made a detailed promoter analysis(Mauch et a/.,1990), and showed that the gene isencoded on the 160 kb plasmid pAOl (Brandsch et al.,1986:1987).

Here we show, by electroporation of this catabolic plas-mid into a plasmid-cured A. oxidans nic' strain that pAOldetermines the nic* phenotype. This may indicate thatbesides the 6-HDNO gene other enzymes of the nicotine-catabolizing pathway are encoded on pAOi. We alsodemonstrate that pAOl apparently encodes a regulatoryprotein, NicRI. and characterize its interaction with the 5'-region of the 6-HDNO gene.

Results

Estabiishment of a pA01-cured K oxidans nic~ strain

A. oxidans cells harbouring pA01 are able to use nicotineas growth substrate. In the presence of ammonium saltsthe bacteria use the pyrrolidine ring of nicotine as carbonsource and convert the hydroxylated pyridine ring into adeep blue pigment (Decker and Bleeg, 1965) and finallysecrete this Into the culture medium. The inability ofpAOl -cured A. oxidans cells to grow on minimal mediumwith nicotine, and the lack of pigment formation whengrown on citrate and ammonium salts in the presence ofinducing amounts of nicotine, were the criteria for theselection of plasmid-free cells. The identity of the curedstrain in comparison with the wild type A. oxidans strainwas confirmed by cell wall analysis (kindly performed byProfessor Fiedler. Munich; data not shown).

Cells unable both to grow on nicotine and produce bluepigment also lacked pAOl DNA when compared with A.oxidans nic' wild type cells (Fig. IA), DNA isolated fromthe cured A. oxidans nic~ strain gave no hybridization sig-nal with a 6-HDNO-specific probe on Southern blots (Fig.1B), These results confirm the finding that this gene of thenicotine regulon is located on pAOl (Brandsch ef ai,1986) and demonstrate that there are no chromosomallyencoded homologues of this gene.

Transformation of cured A. oxidans celis withpAOl

To prove that A. oxidans can be transformed with plas-mids of this size, we electroporated A. oxidans nic~ cellswith purified pAOl DNA, The transformation efficiency ofcells harvested in early log-phase at an ODgoo of 0 6 was3 X 10^ transformants per (,ig of pA01 DNA. Selection ofpositive transformants was done on minimal medium withnicotine as sole carbon source. Cells of the nic^ pheno-type transformed with native, isolated pAOl DNAregained the ability to grow on this medium and secretedthe characteristic blue pigment (Eberwein er ai. 1961).This indicates that enzymes of nicotine catabolism areencoded on pAOl, Analysis of plasmid DNA from trans-formants revealed the presence of pAOl, which byrestriction enzyme analysis was indistinguishable frompA01 of wild-type ceils, thus indicating that the transfor-mants contained the entire unaltered pAOl DNA (Fig. 1 A,lane 4). The experiments show that A. oxidans cells canbe transformed by electroporation and that transformationwith plasmid DNA of 160 kb is feasible,

interaction of the DNA -binding protein NicR 1 with the6-HDNO gene regulatory region

Characteristic sequence arrangments within the 6-HDNOgene promoter region (Mauch et al., 1990) are shown in

Nicotine catabolism in Arthrobacter oxidans 1811

24 bpiKpnl

R 1

36 bpPwu II

• 1

PS

•76 Bp- - 50L 5 bp

-242 bo-

B- 150 - 125 - 100

CTGCCGTCCTATTTAAAAAGGT*GTAAAACTGACCTGTACCAG4^CTGTPlCCTGTirqACAGGT*CJiGTCCCTGTTTCTCy

- 3 8

- 5O

R 2

Pvu II

CGATGTGTTCCGGCCTCCCCTAGTCCCGCAAAAATAACCCCCAT rgAgA r 3GAC^ 3C TGTCCATGl TCAATAGGGTGA

• 1

Fig. 2. Representation ot the 6-HDNO gene reguiatory region.A The 242 bp 6-HDNO promoter fragmeni is composed ol an IR2 preceding sequence (PS) and two lnveried repeats (IRI. IR2) separated by aninterpaiindfomic sequence (IS). The restriction sites EcoRI. Sad. KprH, Psti and H/ndlll flanking tiie 6-HDNO promoler Iragment belong to Ihe pUC18-polylinkerof pDH1123A (sea the Experimental procedures). A Pi/yjl-sitein the centre of the IRI sequence and a Haelll restriction site in theinterpalindrofnic sequence are also indicated. T>iese restriction sites allow the generation of DNA fragmenis as indicated: EcoRI-Haslll (A), Haslll-Hirxllll(•). EcoRi-PvuW (•). A o'^-like promoter is marked by a P' and ils direction is shown by an arrowB, The DNA sequence of the 6-HDNO gene regulaiory region IRi and 1R2 exhibit significant homoiogies within and among each other. Sequences whichare homologous among the two inverted repeats are boxed. Other sequence characteristics found in the iR2 preceding sequence (PS) and theinterpalindromic sequence (IS) are polyAT stretches indicated as broken lines and polyGC stretches indicated as lines. A nearly periecl a ' -like promoterconsensus sequence (-35 and -10) Is integrated in IR 1, A consensus o'°-lik8 -35 sequence is found also in IRS.

Fig. 2. It exhibits two inverted repeats, IR1 and 1R2. withextensive homologies to each other (Fig. 2B, arrows), astructural feature common to many bacterial c/s-actingregulatory regions (IHudson and Fried. 1991; Brenowitz1990; Kramer etai, 1987). IRI and IR2 are separated bya 50 bp interpalindromic sequence. An interesting featureof the interpalindromic sequence (IS) and the sequence(PS) in the immediately 5' region preceding 1R2 is thepresence of alternating GC-rich and AT-rich sequenceclusters (Fig. 28, underlined and overlined with a brokenline, respectively). A GC-cluster is located adjacent toIRI. The inverted repeats of this palindrome are homolo-gous over 17 bp. In IRI the right half of the palindrome isinterrupted by a single and a double base pair insertion.Ten out of 12 base pairs of IR1 in the 5' half and 9 out of12 base pairs in the 3' half of the sequence are homolo-gous to IR2 (Fig. 2B. boxed sequences of IRI and IR2).

IR1 represents a nearly perfect o^°-like promoter, how-ever, with one remarkable alteration. The -10 region dif-fers from the consensus sequence TAT AAT by the inser-tion of a C-residue giving rise to the sequence TAT^AAT

(Fig. 2B. -10). In the IR2 sequence a -35 region, but nosimilarity to a known -10 region of a o^-like promotersequence, is found (Harley and Reynolds, 1987).

When a ^P end-labelied DNA fragment carrying the 5'-flanking region of the 6-HDNO gene was incubated withextracts of A. oxidans nic' cells and separated on a native5% polyacrylamide gel the autoradiography of the gelrevealed a shifted DNA band relative to a control sampleof labelled DNA not incubated with cellular protein. Thespecificity of this protein-DNA interaction was tested incompetition experiments (Fig. 3). For this purpose thecloned 6-HDNO promoter fragment (F242) carrying thewild-type (wt) 5*-flanking region of the 6-HDNO gene (Fig.2A) was isolated and labelled with [y-^^Pl-rATP asdescribed in the Experimental procedures. Either differentconcentrations of the same unlabelled fragment or soni-cated salmon-sperm DNA were used to compete with thelabelled DNA fragment for protein binding. The experi-ment showed that the protein binding to F242 interactsspecifically with this DNA and that it has a very low, if any.non-specific affinity for random DNA sequences. The

1812 H. Bernauer. L. Mauch and R. Brandsch

1 2 3 4 5 6 7 8 9 101112

B

Fig. 3. Analysis o( the speciticny o( fNl\cHi mieraction with Ihe 6-HDNOpromoter fragmenl. The 242 bp EcoFil-H/ndill fragmenl carrying IRI andIR2 was ^'^P-labelled and incubated for 15 mm al room temperalure with20 ng of protein of crude extract from A oxidans nic' cells in Ihepresence of various amounts of specific and non-specific competitorDNA. To suppress non-specific binding of crude exlracl prolems lo Ihe 6-HDNO promoter fragment, 2.5 jag ol pdldC was added to each of thebinding reactions a and b indicate a lower and an upper band delectedby the band-shift assay.A. Lane t. ^^P-fabelled 5 HDNO-promoter fragment without crude extractand without specific competitor DNA; lanes 2-12; supplemenled withCfude extract and in addition 225, 112 5, 56.28.1. 14.1. 7-0,3.5. 176.0.88.0.44.0-21 pg \x\ \ unlabelled 6-HDNO promoter (ragment,respeclivelyB. Lane 1, ^P-labelled 6-HDNO-promoter fragment without cnjde extractand withoul non-specitic competitor DNA; lanes 2-12. supplemented withcrude extract and in addition 500. 250. 125.62.5.31 3, 16 6, 7,8, 3.9.2.0.1.0, 0.5 ng ^ r ' . sonicated salmon sperm DNA respectively

ratio between non-specific and specific DNA required totitrate half of the protein out of its binding site is >10^. ThisDNA-binding activity was designated nicotine regulator 1(NicR1).

DNase I protection analysis of NicRI-binding to the6-HDNO promoter region

When band-shift experiments were performed with anammonium sulphate fraction enriched in NicRI protein(see the Experimental procedures) two shifted bandswere observed (see next section. Fig. 5B, lane 1, and Fig.6, lane 1+). This may be taken as an indication that bothpalindromes. IRI and IR2. are sites for protein binding.Alternatively, either IRI or IR2 might be recognized by aprotein dimer and the two shifts represent either themonomeric or the dimeric form.

In order to answer this question a DNase I protectionanalysis was performed to define the binding sites ofNicRi within the 6-HDNO gene regulatory region. By thismethod it should be possible to distinguish clearlywhether the higher molecular-weight band represents anadditional protein-DNA interaction rather than a pro-tein-protein interaction at the same binding site. Increas-ing concentrations of the NicRI-containing ammonium

sulphate fraction in the DNase I protection assay pro-tected IRI as well as IR2 around the symmetry centre ofthe palindromes (Fig. 4. upper and lower bracket, respec-tively). Thus it is reasonable to assume that an additionalproteln-DNA interaction rather than a protein-proteininteraction is responsible for the upper band in the band-shift experiment.

The concentration-dependent protection of the twohomologous palindromes. IRI and IR2, by the ammoniumsulphate fraction 35/53 from DNase I digestion may betaken as an indication that both sequences are recog-nized by one and the same protein. This assumption issupported by the finding that in both palindromes thesame symmetrically positioned base pairs are protectedfrom nuclease digestion (Fig, 4, underlined). IR2 is lessprotected than IRI and thus probably exhibits weakerbinding of NicRI. In agreement with this interpretation isthe observation that in band-shift experiments a doubleshift, as an expression of occupancy at IR1 as well asIR2. occurs only at higher protein concentrations. This isverified in the competition experiment shown in Fig. 3(pane! A, lanes 11 and 12), The second shifted band, indi-cated by arrow b, appears only in samples with the lowestconcentration of unlabelled competitor DNA. This doubleshift tjecomes fully apparent when the ammonium sul-phate fraction 35/53, enriched in NicRI, is employed inthe band shift assays as shown in the experiments dis-cussed below.

Consequences of ONA sequence alterations in the6-HDNO gene regulatory region on NicRI binding

In order to further characterize the binding properties ofNicRI, sequence alterations were introduced into the pro-moter-bearing binding site IRI, and the spacing betweenIRI and IR2 was changed.

The alterations introduced into the 6-HDNO gene regu-latory region are presented In Fig. 6B and the correspond-ing band-shift analyses in Figs 5 and 6. When the 242 bpfragment (Fig. 2A), ^^P-labelled at both ends (Fig, 5A.lane 1) was digested with Haelll. the fragments shown inFig. 2A. (• . • ) and Fig. 5A (lane 2. • . • ) were gener-ated. Tested in the band-shift assay with NicRl. thesmaller fragment carrying IR1 and the 6 HDNO promoterwas shifted (Fig, 5B. lane 2, • ) - The larger fragment har-bouring IR2 gave rise to only a weak band shift (Fig. 5B,lane 2, • ) . The identities of the shifted bands weredemonstrated in band-shift assays with the Haelll-gener-ated fragments (Fig, 5A. lanes 3 and 4) by removing oneof the end-labels with either of the restriction enzymesKpnl or Pst\ respectively (Fig. 2A). The smaller of thefragments was shifted as shown in Fig. 5B (lane 3, • ) .When only the larger of the Haelll fragments waslabelled, this fragment showed the same weak shift as

Nicotine cataboiism in Arthrobacter oxidans 1813

34 5 6 78

IR1

IR2

I -

Fig. 4. DNase t protecllon analysis o! NlcRI -binding to Ihe 6-HDNOpfomoter Iragmenl. ^P-end-label ling of ihe 6-HDNO promotef fragment(EcoRI-HindiII fragment of Fig. 2A) and binding reactions werepetiormed as described m the Experimental procedures The DNase Icleavage pattern of the NicRi protected 6-HDNO promoter tragmenllEcoR\-Pst\ fragmeni ol Fig. 2A) is shown. The protection pattern ot thacorresponding Hin6\\\~Saci fragmeni (Fig. 2A) exhibited proiection in thesame sequence regions (not shown).

A. Lane 1, Maxam-Gilbeit G+A sequencing reaction of the '^P-end-labelled, Psri-cut 6-t^DN0 promoter fragment (£coRl-H/ndlil): !an© 2.DNase i (concentration 16 jag mi ' j cieavage products without protHCtingprotein; lanes 3 to 7. DNase I (32 Mg ml ') reaction products performedwith 5, 20, 35, 50 and 65 ^^Q protein of ammonium suiphate-fraction 35''53(see Ihe Experimental procedures), iane 8, DNase i (4 jig ml"') reactionproducts without protecting protein. The sequence windows whereprotection occurs are indicated by brackets.

B. The sequence ol the 6 HDNO promoter fragmeni with iRI and iR2.Base pairs strongiy protected from DNase I cieavage are indicated bybars, and weaker protections by lines DNA protections are arrangedassymetncally and exclusively ai Ihe same positions m the region of theinverted repeals and no protections can be observed in theinterpalindromic sequence.

B - ISO - 125GACGGCAQGATAAATTTTTCCATCATTTTGACTGGACATGGTCTTGACAAGGACAAGTGTCCATGTCAGGGACAAAGAQ

3-

Pvu II

J,- 7S - 5O

CGATGTGTTCCGGCCTCai CTAGTCCCGCAAAAATAACCCCCATTC

observed before (Fig. 5B. lane 4, A). When the 242 bpfragment, ^^P-labeiled at both sites, was digested withPvull. which cleaves at the symmetry centre of IRI. thefragments shown in Fig. 2A, (•, -) and Fig. 5A (lane 5, • )were generated. Application of these fragments in theband-shift assay with the NicRi-containing ammoniumsulphate fraction 35/53 resulted in the pattern shown inFig. 5B (lane 5. • ) , Only a weak shift, corresponding tobinding at IR2. was apparent.

The results presented in Fig. 5 also indicate that bind-ing of NicRI to IRI and IR2 is co-operative. When theDNA fragment with an intact interpaiindromic bridge car-rying both palindromes {Fig. 5A, lane 1) was incubatedwith the NicRI-containing ammonium sulphate fraction35/53 the band-shift experiment revealed two equallyintense bands (Fig. 5B. lane 1; see also Fig. 6, lane 1, b).This indicates that 50% of the available DNA fragment isoccupied at one site only and 50% at both IRI and IR2sites. Since the band-shift assay revealed only a veryweak binding of the protein to IR2 (Fig. 5B, lanes 2.4 and5), we take the strong upper band in Fig. 5B (lane 1) as anindication of co-operativity in the binding of NicR1 to IRIand IR2. The presence of IRI on the same DNA fragmentwith IR2 increases binding of NlcR1 to iR2. Destruction ofthe interpaiindromic bridge eliminates this effect.

Fig. 5. Co operative binding of NicRI \0 the 6-HDNO promoter fragment.Labeiiing ol the 6-HDNO promoter fragmeni (EcoRI-H/f)dili fragment ofFig. 2AJ was performed as described in the Bxpenmemalprocedures.(A) indicates the EcoRi-Hadll tragmeni, (•) Ihe Hindill-Haellifragment, and (•) the EcoP,\-PvtA\ fragment (see Fig. 2A).A. DNA fragments in the absence of protein (-). Lane 1. EcoRI-HindtIt 6-HDNO promoter fragment: lane 2. fragment cleaved at the Haetli sde(see Fig. 2A), lane 3, fragmeni cleaved with Haelil and Kpnt: lane 4,fragment cleaved with Haelil and Pst\. lane 5, fragment cleaved withfVutI (see Fig. 2A).

B. Band shift assays were performed with 200 pg of 6-HDNO promoterfragment and 30 (ig of NlcRI enriched ammonium sulphate fraction35/53 (>). Lanes 1 to 5 correspond lo a band-shitt assay performed withthe fragments shown in (A).

1814 H. Bernauer. L Mauch and R. Brandsch

1 2

mini- . f - • - 4 - • - • - • - *

Ftg. 6. In vitro mutagenesis and analysis of the altered 8-HONO promoterfragments in the band-shift assay.A 25 ng ol protein of the NicR l enriched ammonium sulphate fraction35/53 prepared as described in the Experimental procedures wa%incubated for 15 min at room temperature with 200 pg of different ^^P-latjelled 6 HDNO promoter fragments modilied by in vitro mutagenesis.Control lanes with 6 HDNO promoter Iragment wittiout protein traction35/53 are indicated by (-). and lanes in which the 6-HDNO promoterfragment was coincubated with the NicRi -enriched ammonium sulphatefraction 35/53 are irwiicated by (+). Lane 1.6-HDNO promoter Iragment:lane 2, fragment witti the 6-HDNO promoter mutated lo Ihe a""consensus promoter; lane 3. 6-HDNO promoter fragmeni with deletedmarginal IHt sequences leaving a central octamef palindrome; lane 4, 6-HDNO promoter fragment wtth deletion of the cenlral G residue of IRi :lane 5. binding tragment with a 20 bp deletion m the interpalindfomicregion; lane 6. binding fragment with a 5 bp insertion into theinterpalindfomic region; lane 7, binding Iragment with a 5 bp deletion inthe inlerpalindfomic region.B. Schematic representation of the alterations introduced by in vitromulagenesis into the DNA sequence of the 6-HDNO regulatory region.Dotted lines represent sequences identical to the wild type 6 HDNOpromoter fragment sequence (lane 1). Sequence alterations andinsertions are indicated by dots, and deletions by broken lines. The orderot the constructs is identical to that used in (A).

B Pvu II

- 75- IO

1. CAAAGAGCGATGTGTTCCOOCCTCCCCTAGTCCCGCAAAAATAACCCCCATTaAfiATGGACAGCTGTCCATGTAT;

a.

a • ; • • • •

A. •• • * '•••• • • • " • • CCCATTGACATGGACA-CTGTCCATGT ATCAAT

5. CA T C C C C T A G T C C C Q C A A A A A T A A C C "

I I I > (

6. AGCGATGTGTTCCGGCCTTGGATCCCCTAGTCCCGCAAAAATAACC "

7. CAAAGAGCGATGTGTTC TCCCCTAGTCCCGCAAAAATAACC •• *• •'

CCCATTGACATGGACAGCTGTCCATGTAT -AAT•^^, I I I I I

CCCATTGACATGGACAGCTGTGGCCAT ATCAAT

The alterations introduced by site-directed mutagene-sis into the sequence of the promoter-bearing IRI palin-dnatne and into the interpalindromic space and their effecton NicRI binding are presented in Fig. 6A,B. The reduc-tion of IRI to an octamer (Fig. 6B, lane 3} as well as dele-tion of the central G residue (Fig. 68, lane 4) both abolishNIcRi binding to IR1 (Fig. 6, panel A, lanes 3+ and 4+,respectively). The DNA shift seen in ianes 3+ and 4-f is aresult of binding of NicRI to IR2. This was demonstratedby cleaving the ^^P-labelled 242 bp DNA fragment withHaelll in the interpalindromic space and showing, inband-shift assays, that only the IR2-carrying DNA frag-ment was retarded on polyacrylamide gel electrophoresis(PAGE), but not the IRl-carrying fragment (not shown).

Contrary to the profound effect induced by alterationsof either the length or the symmetry of the IRI palindromeon NicRI binding, alterations in the helix turn number ofthe interpalindromic DNA did not result in changes ofNicRI-binding to both of the palindromes. The length ofthe spacing sequence between IRI and IR2 was changed

by either an insertion or a deletion of 5 bp (Fig. 6B, lanes6 and 7. respectively). These alterations correspond to achange by half a helical turn of the helix turn number inthe interpalindromic sequence. As a consequence, inthese DNA mutants, IR2 is positioned on the oppositeface of the DNA helix relative to IRI. In addition, thelength of the 50 bp interpalindromic sequence wasreduced by 20 bp (Fig. 6B, lane 5). The DNA band-shiftpattern obtained with DNA fragments carrying these alter-ations (Fig. 6A, lanes 5, 6. 7) was identical to the controlpattern seen with the unaltered 242 bp DNA fragment(Fig, 6A, lane 1).

The right half of IRI contains the -10 region of the 6-HDNO gene promoter which differs from the consensussequence of promoters recognized by the a™ RNA poly-merase by the insertion of a C-residue into the TATAAT-box (Fig. 6B, lane 1). We asked whether this unusual o™-10 region is involved in the specificity of NicRI-bindingto IR1 by deleting the pertinent C residue (Fig. 6B, lane2). The corresponding DNA band-shift analysis (Fig. 6A,

Nicotine catabolism in Arthrobacter oxidans 1815

Fig. 7. Interaction of the E.co/f o"" HNA polymerase with tfie 6-HDNOpromoter The promoter-binding leactions were performed wilh 3 jig ota'° RNA polymerase from E. coliand 200 pg of labelled 6-HDNOpromoter fragment (EcoRI-WfxIIII) at room temperature for 20 min instandard conditions.A. Lane 1. ^P-labelled 6 HDNO promoter DNA tragment in the absenceof a'° RNA polymerasa: lane 2, interaction of the o™ RNA polymerasewith the 6-HDNO wild type promoter fragmenl; lane 3, binding interactionof E.coiia^° RNA potymerase with the 6 HDNO promoter tragmentmutated to the o"^ consensus sequence.

B; 35 ng of protein of the NicRI enriched ammonium sulphate fraction35/53 alone or mixed with 3 (ig ot purified a '" RNA polymerase wasincubated with 200 pg of labelled 6 HDNO promoier fragment andanalysed in the band-shitt assay. Lane 1, 6-HDNO promoter tragnwnt{a^° consensus) in the absence of DNA-binding protein, lane 2, 6-HDNOpromote! fragmeni (ci'" consensus) bound by NicRI, lane 3, 6 HDNOpromoter fiagment l a ' " consensus) bound by E.coti RNA polymerasa,lane 4. NicRI c(»ncubated witti £co//a'° RNA polymerase in thepresence of 6 HDNO promoter tragment {a'° consensus).

lane 2) showed no modification of the protein binding pat-tem when compared with the pattern obtained with theunaltered DNA fragment.

Competition between E. coli </" RNA polymerase andNicRI for binding to the e-HDNO promoter

The 6-HDNO gene is expressed in the stationary phase ofgrowth (Mauch etai. 1989). One element involved in thegrowth stage-dependent expression of the gene could bethe unusual o^° -10 region of the wild type promoter. Thisdeviant promoter sequence might prevent binding of anA. oxidans RNA polymerase homologous to the E. colia^°RNA polymerase and allow transcription only with anRNA polymerase associated with an alternative activatoror sigma factor as discussed in Bohannan et ai (1991).We were able to show, in an in w/ro transcription-transla-tion system derived from A. oxidans. that mutation of the6-HDNO wild-type -10 region to the 0''° consensussequence increases expression of the gene several-fold{Mauch etai. 1990), demonstrating that A. oxidansceWs

contain a o™-like RNA polymerase. This finding justifiedthe use of the purified a''° RNA polymerase from E. coii inDNA band-shift experiments with the 242 bp DNA frag-ment carrying either the wild-type or the consensus pro-moter sequence. As shown in Fig. 7A (lane 2). the E. coliRNA polymerase binds to the wild-type 6-HDNO genepromoter. However, binding to the consensus -10 pro-moter is approximately eight times stronger, as judged bycomparing the intensity of the shifted bands on theautoradiogram (Fig. 7A, lane 3). Although the interactionof the E. coli a^° RNA polymerase with the promoterexhibiting the consensus -10 promoter is several-foldstronger than with the wild-type 6-HDNO promoter, co-incubation with NicRI at the standard conditions of theband-shift assay prevents binding of the polymerase tothe promoter carrying DNA fragment. On the autoradio-gram a predominant band-shift characteristic of NicRI ispresent (Fig. 7B. lane 4). These experiments are consis-tent with the assumption that the NicRI protein behavesin vitro like a repressor. We cannot exclude the possibilitythat a weak interaction between RNA-polymerase and the-35 region present in IR2 may also take place.

NicRI is encoded by pA01

Many examples show that in bacteria the regulatorygene(s) of a metabolic pathway is (are) closely linked tothe structural genes of the corresponding operon (forexample, De Lorenzo etal., 1991). Since we have shownhere that genes of the nicotine degradative pathway areprobably encoded in A. oxidans on pA01. a linkage ofNicRI with these genes would strongly support a regula-tory role for this protein in nicotine catabolism. To test this

3

<4 shift

Fig. 8. NicRI binding activity in crude extracts of :A ox/dans ceils. Lane 1,^P-labelled 6-HDNO promoter (ragmeni without crude exlract; lane 2.6-HDNO promoter (ragment incubated !or 15 min with 20 ^g ol protein ofcrude extract from A. oxidans nic'; lane 3.6-HDNO promoter fragmentincubated 15 mm with 20 pg protein ol crude extract from A. oxidans nic.

1816 H. Bernauer. i. Mauch and R. Brandsch

1 2 3 4 5 6 7 1 2 3 4 5 6 7

- 1 0 3 0 3 0 10 2 0 3 0 h - 10 3 0 3 0 10 7 0 3 0

N i c - - - - * + +•n i c - - - - - - -

Fig. 9. 6-HDNO promoter binding aclivity wilh A. oxidans crude extractsIrom diHerent growth stages. Binding reactions were perlormGd with 200ng of labelled 6-HDNO promoter fragment in the standard binding bufferplus 10% glycerol. for 30 min on ice in the presence of 30 ng of proteinfrom different A. oxidans crude extracts, A. oxidans nic~ and A. oxidansme' cells were grown in citrate medium in Ihe presence or absence of0,1%D,L-nicotine(Nic). Cells were harvested after 10, 20 and 30 h at 4"Cand crude extracts were prepared as described in the Experimentalprocedures.A. Lane i.6-HDNOpromoterfragment without crude extract, lanes 2-4.band-shift assays with crude extracts from 10, 20 and 30 h-grown A.oxidans nic-t cells, not induced with o.L-nicotine; lanes 5-7, band-shiftassays with crude extracts from 10,20 and 30 h-grown A. oxidans nic-*cells, induced with 0,1% D,L-nicotine,B, Lane 1. 6-HDNO promoter fragment wilhout crude extract, lanes 2-4.band-shift assays with crude extracts from 10, 20 and 30 h-grown A,oxidans nic- cells, without DL-nicotine; lanes 5-7. band-shifl assays withcrude extracts from 10, 20 and 30 h-grown A. oxidans nic- ceils. Inducedwith 0.1% Di-nlcotine,

NicR1 would be inactivated by the inducer. On the otherhand, since expression of the 6-HDNO gene is apparentonly in the stationary phase we speculated that in crudeextracts of pAOl -deficient stationary phase cells it wouldbe possible to identify a chromosomally encoded tran-scription factor which recognizes the 6-HDNO promoterspecifically in the growth phase at which this gene isexpressed.

For these reasons, 6-HDNO promoter DNA band-shiftreactions were performed with crude extracts ot inducedand uninduced cells harvested at 10. 20 and 30 h follow-ing the addition of o,L-nicotine, Unexpectedly, NicRi bind-ing to the 6-HDr>J0 promoter-carrying DNA fragment wasalways observed (Fig, 9A) independently of the inductionstate or the growth phase at which the cells were har-vested. These experiments yielded identical results whenpetiormed under various conditions of KCI and glycerolconcentrations in the DNA band-shift assay. To detectany factor which may be encoded chromosomally butbinds the 6-HDNO promoter region in the absence otNicRI in a growth-stage-dependent manner, the experi-ments presented in Fig. 9B were performed. They utilizedextracts prepared from pAOl-cured A. oxidans cellsgrown 10, 20 and 30 h in the absence (Fig. 9B, lanes 2,3,and 4) and presence (Fig. 9B, lanes 5, 6. and 7) of D.L-nicotine. No band shift was observed under these condi-tions. It should be noted that in the band-shift assay theaddition of 6-hydroxy*D-nicotine and D,L-nicotine up to 10mM had no significant effect on NicRI binding to the 6-HDNO promoter DNA fragment in vitro (data not shown).

assumption, cell extracts obtained from wild-type andcured A. oxidans strains were tested for the presence ofNicRI-binding activity.

The results of this experiment are presented in Fig. 8.Only cell extracts derived from pAOi-bearing cells showthe expected DNA band shift (Fig. 8. lane 2). Cell extractsfrom the pAOl-cured strain lack NicRI activity. ThuspAOi apparently encodes, besides the structural genesof the pathway, a regulatory DNA-binding protein as apresumed component of the transcriptional machinerydirecting the expression of the nicotine degradative genesin A. oxidans.

inducer- and growth-stage-dependent promoter bindingactivity in extracts of pAOl-harbouring andpAOl-curedA. oxidans celis

From in vitro experiments presented above we concludedthat NicRI can behave like a repressor. Thus, weexpected that in cells grown in the presence of D.L-nicotine the 6-HDNO gene promoter-binding activity of

Discussion

The analysis at molecular level of the pAOl-encodedmetabolic pathway responsible for the degradation of thehighly toxic tobacco alkaloid nicotine is representative ofthe large group of Gram-positive soil bacteria belongingto the genus Arthrobacter

An important prerequisite for the investigation of theregulatory mechanism governing the transcriptional andtransiationai regulation of gene expression in theseorganisms is the availability of an efficient transformationsystem. The work presented in this paper demonstratesthat such a method for A. oxidans Is electroporation. Wepresent the first report that large catabolic plasmids. inthis case the 160 kb pA01. can be transformed by thisprocedure.

The availability of a pAOl-cured A. oxidans nic~ straincombined with the possibility of transforming pAOl intothis organism has clearly demonstrated that, besides the6-HDNO gene, enzymes of nicotine catabolism are plas-mid encoded. This conclusion is supported by unpub-lished results (S, Grether-Beck and R. Brandsch, inpreparation) regarding the identification, by hybridization.

Nicotine catabolism in Arthrobacter oxidans 1817

and cloning from pAOl DNA, of the nicotine dehydroge-nase genes and the 6-hydroxy-L-nicotine oxidase gene. Inaddition to structural genes of the nicotine pathway ourresults show that pAOl apparently encodes a reguiatoryprotein, NicRI, involved in the interaction with the pro-moter of the 6-HDNO gene. The 6-HDNO gene appar-ently represents a single transcriptional unit (Mauch etai.1990).

Expression of the nicotine-pathway genes in A. oxidansdepends on the induction by D,L-nicotine and also thepresence of riboflavin, the precursor of the cofactor FADpresent in the encoded enzymes (Hamm and Decker,1978; Brandsch and Bichler, 1990). In our efforts to eluci-date the cofactor-dependent expression of these geneswe set out to identify the transcriptional factors responsi-ble for the mediation of this effect. NicRI is the first identi-fied factor whose interaction with the 6-HDNO gene pro-moter region has been analysed. It is not known whetherNicRi is involved in the regulation of expression of addi-tional genes of the nicotine pathway.

Competition experiments and DNasel protection analy-sis showed that NicRI binding to the 6-HDNO promoterDNA fragment is highly specific. It was observed exclu-sively at the sequence motifs of the inverted repeats andwas stronger to IRI than to IR2. NicRI was bound sym-metrically to both palindromes, which may indicate aninteraction with the 6-HDNO promoter in the form of anoligomeric protein structure. This assumption is sup-ported by the DNasel protection experiment whichshowed protection at both IRI and IR2. The protectedsites are represented by the same base pairs in bothpalindromes, which allows the conclusion that the sameprotein. NicRI, interacts with IRI and IR2.

Using our assay conditions, IRI is always occupied byNicRI and only approximately 50% of the 242 bp DNAfragment is occupied at both IRI and IR2. Binding ofNicRI to IR2 is stimulated by the interaction of the proteinat IRI and is thus co-operative. This is also indicated bythe fact that binding of NicRI to IR2 is reduced consider-ably when the interpalindromic bridge is destroyed (Hud-son and Fried, 1991). The dissociation rate constant ofNicRI binding was experimentally determined by mea-suring the time required to displace the labelled fragmentunder the standard conditions (described in the Experi-mental procedures) by an excess of unlabelled fragment(data not shown). This parameter is in the range of 2 s,indicating that the binding characteristics of NicRI aredynamic rather than static in nature. This is in contrast tothe binding kinetics of the o'^^-dependent E. coti RNApolymerase which is more static in nature and requires upto 30 min to reach the binding equilibrium (Garner andRevzin, 1990). Upon co-incubation, NicRI is able to pre-vent Escherichia coli RNA polymerase from binding to the6-HDNO promoter mutated to the o™-consensus

promoter sequence. However, whether NicRI is also ableto displace the o''°-dependent RNA polymerase from itsinteraction with the mutant promoter when the poly-merase was first bound to the DNA fragment was nottested. The kinetics and the co-operafivity of binding toIRI and IR2 observed in vitro suggests, however, thatNicRI may also act in vivo as a repressor (Elledge andDavis, 1989).

NicRI binding activity was present in crude extractsirrespective of the growth conditions of the cells. Thus,regulation of 6-HDNO gene expression does not dependon the intraceliular NicRI concentrations. Regulationtherefore, must be accomplished by other means. Thatthe interaction of NicRI with the 6-HDNO regulatoryregion in vivo is subject to competition by a protein of thesame size and similar binding properties as NicRI butwith different activating or repressing functions under var-ious conditions of medium, growth stage, D/L-nicotine orFAD supply is a possibility that cannot be excluded.Homo- or heterodimerization could inhibit or allow differ-ential gene expression of the 6-HDNO gene as has beenshown predominantly in eukaryotic regulatory systems(Jones. 1990) but also in a prokaryotic system (Pedersenetai. 1991). Alternatively, in vivo. NicRI may be subjectto reversible phosphorylation (Bourett et at.. 1991). Thislabile protein modification may be lost during manipula-tion of the cells and preparation of the cell extracts, whichwould explain NicRI binding in cell extracts preparedfrom D,L-^nicotine-induced cells. Experiments are currentlyunder way to distinguish between these possibilities. IfNicRI acted like a repressor, its release from the DNAwould be expected fo allow an alternative sigma factorand/or an activator to recognize the promoter orsequences adjacent to the promoter. Such a factor couldnot be demonstrated in band-shift assays performed withextracts from pAO1-cured and D/L-nicotine-induced A.oxidans nic' cells. Such reguiatory factors, however, maybe at intracellular concentrations too low to be detectedby this assay, the binding to the target sequence may betoo weak, or the protein is also pAOi -encoded and there-fore prevented from binding by NicRI in vitro.

tn vitro mutagenesis of the 6-HDNO gene regulatoryregion revealed that alterations in the interpalindromicsequence were not critical for NicRI binding. An interest-ing sequence feature of this domain is the presence ofGC-rlch clusters interrupted by an AT-rich cluster in the 6-HDNO 5'-sequence. The GC-clusters are locatedupstream of the 5'-region of the o''°-like 6-HDNO pro-moter. This sequence arrangement may reflect the inter-action of an as yet unidentified factor with the interpalin-dromic domain, As with the 'gearbox' promoters(Bohannon et ai, 1991), responsible for growth-stage-dependent expression of many genes mediated by a™RNA polymerase in E. coti this sequence element as well

1818 H. Bernauer. L. Mauch and R. Brandsch

as a modified 6-HDNO promoter -10 sequence may alsobe responsible for the growth-stage-dependent expres-sion of the 6-HDNO gene in Arthrobacter (Aldea et ai.1990). This possibility will be investigated In future experi-ments. Within 800 bp upstream of the two palindromeswe could not identify an open reading frame which wouldterminate at the AT-rich interpalindromic region. An ana-lysis of a short open reading frame divergently orientedand partially overlapping the start of the 6-HDNO genecoding region showed that transcription of this DNA wasnot impaired by the stretch of T residues reminiscent of arho-independent transcription terminator situated 5' to IRIon the lower DNA strand {Fig. 2B) (Mauch etai 1990).

The alterations introduced into the DNA helix turn num-ber between IRI and IR2 did not affect the interaction ofNicRI with these palindromes. It has been demonstratedin many examples of co-operative binding of a regulatoryprotein to two sites on the same DNA that changes in theposition on the DNA helix of the two binding sites relativeto each other has a profound effect on the co-operativebinding of the regulatory protein to these sites {Krametetai. 1987), The absence of such an effect in the interactionof NicRI with IRI and IR2 may be due to the fact that thelength of the interpalindromic DNA still allows sufficientflexibility to permit co-operative binding of NicRI to thepalindromes. We did not test how much of the interpalin-dromic DNA had to be removed before the co-operativityeffect of NicRI-binding to IRI and IR2 would be dimin-ished. The high recognition specificity of the NicRI pro-tein for its target sequence is underlined by the steric andsequence requirements of its interaction with the bindingsite. Deletion of the central G residue, which leaves therest of the palindrome intact, or deletion of marginal IRIsequence residues to leave a perfect central palindromicoctamer, abolished any binding of NicRI to IR1,

Work is in progress to isolate the NicRI gene and toestablish its position relative to the pAOi-encodedcatabolic nicotine genes as well as its possible function inthe expression of the entire pathway. Purification of thenicRi gene product wiil enable analysis of the propertiesof this protem in vitro in greater detail. These aspects willform the subject of future investigations.

Experimental procedures

Reagents

Restriction enzymes, catf-intestinal phosphatase, c!^° RNApolymerase, bovine serum albumin (BSA), salmon-sperm DNAand proteinase K were purchased from Boehringer Mannheim;T4 polynucleotide kinase from New England Biolabs; DNase Ifrom Worthington; D,L-nicotine was obtained as described byHamm and Decker (1978); ly-^^Pj-rATP was from AmershamBuchler, and pdldC was from Pharmacia. Al! other chemicalsused were of the highest purity available.

Bacterial strains, ptasmids and growth conditions

The A. oxidans nic* strain used in this study was isolated byEbenweinand Decker (1961). It harbours the t60kb large plas-mid, pAOl (Brandsch and Decker 1984). A. oxidans nic". apAOl-cured strain was selected as described in the Resultssection. This strain was used as recipient in transformationexperiments.

The A. oxidans strains were grown in minimal medium con-sisting of 50 mM phosphate buffer. pH 7.6. 0.2% (w/v)(NH4)2SO4, 0-05% (w/v) yeast extract and 5% (v/v) mineralsolution according to Eberwein etai (1961). For the analysis olDNA-binding activity in extracts of cells from different growthstages, cells were grown in minimal medium supplementedwith 0.2% (w/v) Na3Citrate, The analysis of NicRi-binding tothe 6-HDNO-promoter fragment was performed with extracts ofcells grown overnight in Luria-Bertani (LB) medium (Sambrooketai., 1989). The LB medium was inoculated 1/100 with a cul-ture grown for >24 h in minimal medium supplemented with0.1%D,L-nicotine.

tsotation ofpAOl DNA

pAOl isolation was performed using standard procedures(Sambrook ef. a/., 1969) and as described betore (Brandschand Decker, 1984).

Curing ofpAOl from A. oxidans nic celts

A. oxidans cells were cured of plasmid pAOl by several pas-sages on rich growth medium. Loss of pAOl was accompaniedby the inability of the cells to grow on 0.1% D.L-nicotine dishes.The pAOl-cured A. oxidans nic~ cells were used in electro-poration experiments with isolated pAOl DNA.

Etectroporation ofpAOl Into A. oxidans nic cells

Transformation of A. oxidans nic" cells with isolated pAOlDNA was performed with a Gene Pulser apparatus (BioRad).Cells to be electroporated were grown in 900 ml of Yt-medium{Sambrook et ai. 1989) to an ODgoo o' 0.6 or 1.0 and har-vested by centrifugation at 12000 x p at O^C. The cell pelletwas washed successively with 10% ice-cold glycerol 1 x 1 /2.1 x1/3, 1x 1/5. 1x 1/30 and 1x 1/90 of the initial culture volume.The final cell pellet was suspended in 10% ice-cold glycerol ata cell density of 3 x 1O'° cells mPV The cells were frozen inliquid nitrogen and kept at -TO^C.

For electroporation, 200 pi oi thawed cells and 0.6 ng ofplasmid DNA in 10 nl of TE (10 mM Tris-HCI, pH 8.0: 1 mMEDTA) were mixed and kept for 10 min on ice. Electroporationwas performed in a 0.2 cm interelectrode-gap cuvette at 2.5 kV(E=12.5 kV cm"', 600I i , 25 \iF). In preliminary experiments itwas found that a decrease in viability of pulsed A. oxidans celtswas obtained only at the highest field strength (12.5 kV cm"^).After 10 min on ice the cells were suspended in 3 ml of dYtmedium (Sambrook et al., 1989) and incubated with agitationat SO^C tor 80 min. The electroporated cells were then platedon selection medium containing nicotine as sole carbonsource. The transformation frequency obtained with cells har-vested at an ODeoo of 0.6 was 3x10^ transformed cells per ngofpAOl DNA.

Nicotine cataboiism in Arthrobacter oxidans 1819

Enrictiment of the binding protein NicR 1 by ammoniumsuiphate fractionation of the crude extract

For the enrichment of NicRI. pAOl harbouring cells of A. oxi-dans grown for >24 h in nicotine medium were inoculated 1:20in 1 litre of LB-medium and incubated at 30°C for 12 h. Cellswere harvested by centrifugation at 12000 x g. and washedand sonicated in 0.1 M phosphate buffer, pH 7 {1:2 w/v) in aBranson sonifier J17V (scale adjustment 1) for 3 min at 0°C.Cell debris was removed by centrifugation at 12 000 xg, ^ h, at4"C- The protein concentration in the supernatant wasadjusted to 2 mg mP' and precipitated with 53% ammoniumsulphate at room temperature. After collecting the precipitateby centrifugation at 3000 x g. the tube was drained and the pel-let dissolved in 35% ammonium sulphate. The protein solutionwas recentrifuged, the pellet discarded, and the resultingsupernatant readjusted to 53% and gently centrifuged. Theresulting supernatant was discarded and the pellet redissolvedand dialysed against 0.1 M phosphate buffer pH 7. The result-ing ammonium sulphate fraction designated 35/53 was subse-quently adjusted lo 10 mg m!^ protein using a centricon 35concentrator (Amicon), and stored In 0.1 M phosphate buffer atpH 7 in 10% glycerol. For DNA-binding experiments performedwith crude cell extract sonication of the cell pellet was per-formed in binding buffer (see below) after its suspension in theratio 1:2 {w/v).

Ctoning, Isolation, and labelling of the binding fragment

The 187 bp protein-binding fragment was isolated by SauUlAdigestion of a 2.8 kb pAOl DNA fragment carrying the 6-HDNOgene and its regulatory region {Mauch etat., 1990). The result-ing fragment was cloned into the BamHI site of pTZ18R givingrise to pDH1123A. The DNA was amplified in E. co//HBIOI.fcoRI-H/nd III digestion of pDHI 123A liberated a 242 bp DNAfragment carrying the regulatory region ot the 6-HDNO gene.This fragment was dephosphoryiated and labelled with [y-^^P]-rATP using T4-polynucleotfde kinase {Sambrook e/a/.,1989).

Alternatively, the Seal-linearized pDHI 123A DNA was usedas a template in the polymerase chain reaction. A 305 bp DNAfragment was amplified with the W3 forward/M13 reverseprimer-pair and labelled as described above.

DNA-protein binding assay

The bindmg reaction was performed in binding buffer {100 mMKCI; 20 mM Tris-HCI, pH 8.0; 100 ytM EDTA, pH 8.0; 100 ^iMdithiothreltol; 100 \ig ml"' bovine serum albumin) at room tem-perature for 20 min. As non-specific binding competitor pdldCwas added to a final concentration of 50-100 ^g ml" ' . Eachbinding reaction was performed with 200 pg of [7^^^P]-rATPlabelled binding fragment.

Native polyacrylamide gel electrophoresis (4.84% acry-lamide, 0.16% bisacrylamide) was carried out in 89 mM Tris,89 mM borate, pH 8.3, 2 mM NajEDTA. {TBE buffer) at roomtemperature. Gels were pre-run at 10 V cm^' for 30 min, Eiec-trophoresis was carried out at 12.5 V cm"' for 1.5 h at roomtemperature. Autoradiographs of the dried gels were obtainedon Fuji RX-100 films at room temperature.

These basic conditions were varied according to the experi-mental needs as detailed In the Resutts section (Fried andCrothers, 1981}.

DNase I protection assay

For the DNase I protection experiments the EcoRI-f//ndlll-cutand 5'-labelled fragments were recut with Pst\ or Sad creatingtwo fragments, one EcoRl-Pst) and the other H/ndlll-Sad,labelled each on one 5'-end only.

DNase I protection assays were performed in binding bufferin the presence of 15% glycerol. PolydldC was adjusted to 50ng ml"' and the binding reaction was for performed 1 h on icewith various amounts of protein from the ammonium sulphatefraction 35/53 which was prepared as described above. TheDNase I cleavage reaction was performed with concentrationsvarying from 1-40 ^g ml"' DNase I for 3 min on ice (Galas andSchmiU, 1978).

Southern biot hybridization, in vitro mutagenesis, DNAsequencing and protein quantifications

Southern blots and hybridization reactions were performed asdescribed in Sambrook et ai (1989). The in vitro mulagenesiswas performed according to Kunkel {1985). The G+A DNA-sequenclng reaction was performed according to Maxam andGilbert (1980). Protein concentrations were determinedaccording to Peterson (1983).

Acknowledgements

We wish to thank Dr C. Bonifer (University of Freiburg, BiologieIII) for her helpful advice and for reading the manuscript, Dr U.GObe! {University of Freiburg, Abteilung Mikrobiologie undHygiene) for permission to use the electroporation device, andProfessor Fiedler for the cell wall analysis of the wild-type andcured A. oxidans strain. This work was supported by the DFGthrough SFB 206 and by the Fonds der Chemischen Industrie.

References

Aldea, M., Garrido, T., Pla, J.. and Vicente, M. (1990) Divisiongenes in Escherischia coti are expressed coordinately to cellseptum requirements by gearbox promoters. EMBO J 9:3787-3794.

Bohannan, D.E., Connell. N., Keener, J., Tormo, A., Espinosa-Urgel, M., Zambrano. and MM,. Kolter, R. (1991) Sta-tionary-phase-inducible 'Gearbox'-Promoters: differentialeffects of tfatF mutations and role of a '° . J Bacteriot 173:4482^*492.

Bourret, R.B., Borkovich. K.A.. and Simon, M.I. {1991) Signaltransduction pathways involving protein phosphorylation inProkaryotes, Annu Rev Biochem 40: 401 -441,

Brandsch, R., and Bichler V. {1990} Riboflavin-dependentexpression of flavoenzymes of the nicotine regulon ofArthrobacter oxidans. Biochem J 270:673-678.

Brandsch, R.. and Decker, K. {1984) Isolation and partial char-acterisation of plasmid DNA from Arthrobacter oxidans. Arch

:15-17.

1820 H. Bernauer. L. Mauch and R. Brandsch

Brandsch. R., Faller, W,, and Schneider, K. (1986) PlasmidpAOl of Arthrobacter oxidans encodes 6-hydroxy-O-nico-tine oxidase: cloning and expression of the gene inEscherichia coii. Mol Gen Genet 202: 96-101.

Brandsch, R., Hinkkanen, A,E., Mauch, L,, Nagursky, H,, andDecker, K, (t987) 6-hydroxy-D-nicotine oxidase ofArthrobacter oxidans. Gene structure of the flavoenzymeand its relationship to 6-hydroxy-L-nicotine. Eur J Biochem167:315-320,

Brenowllz, M,, Jamison, E., Majumdar, A,, and Adhya, S,(1990) Interaction of the Escherichia co/f gai repressor pro-tein with its DNA operators in vitrc. Biochemistry 29:3374-3383,

Bruhmuller. M., Mbhier, H.. and Decker, K. (1972) Covalentlybound flavin in D-6-hydroxynicotme oxidase from Arthrobac-ter oxidans. Eur J Biochem 29:143-151,

Decker, K,. and Bleeg, H, (1965) Induction and purification ofstereospecific nicotine oxidizing enzymes from Arthrobacteroxidans. Biochim Biophys Acta 105: 313-324,

Decker, K,. Dai. V,D,. M6hler. H.. and BriJhmutler, M, (1972) D-and L-6'hydroxynicotine oxidase. enantiozymes ofArthrobacter oxidans. Z Naturforsch 27b: 1072-1073.

De Lorenzo, V,, Herrero, M,. Metzke. M,. and Timmis. K.N.(1991) An upstream XylR- and IHF-induced nucleoproteincomplex regulates the tr^^-dependent Pu promotor of TOLplasmid. EMBO J10: 1159-1167.

Eberwein, ,H , Gries, F.A,, and Decker, K. (1961) 1. Uber denAbbau des Nicotins durch Bakterienenzyme, II, Isolierungund Charakterisierung eines nicotinabbauenden Bodenbak-teriums. Hoppe Seylers Z Physiot Chem 323:236-248.

Elledge, S,J,, and Davis. R,W, (1989) Position and densityeffects on repression by stationary mobile DNA-binding pro-teins. Genes DevetZ: 185-197,

Freudenberg, W,, Kcinig, K,. and Andreesen, J.R. (1988) Nico-tine dehydrogenase from Arthrobacter oxidans: a molybde-num containing hydrogenase, FEMS Microbioi Letts 52:13-18.

Fried, M.G,, and Crothers. D,M. (1981) Equilibria and kineticsof tac repressor operator interactions by polyacrylamid elec-trophoresis, Nud Acids Res9: 6505-6525,

Galas. D,J.. and Schmit2, A, (1978) DNase footprinting: a sim-ple method tor the detection of protein-DNA binding speci-ficity, Nud Acids ResS: 3157-3170.

Garner, M,M., and Revzin, A. (1990) Gel retardation analysis ofnucleic acid-protein interactions. In Get Etectrophoresis ofNucleic Acids. A Practical Approach. Richwood. D,, andHames, B.D. (eds). Oxford: Oxford University Press.pp.199-247,

Ghosal. D., You, 1,-S., and Gunsalus, I.C. (1987) Nucleotidesequence and expression of gene nahH of plasmid NAH7and homology with gene xylE of TOL pWWO. Gene 55:19-28.

Gloger, M,, and Decker, K, (1969) Zum Mechanismus derInduktion Nicotin abbauender Enzyme in Arthrcbacter oxi-dans. ZNaturtorsch 24b: 1016-1025.

Hamm, H,-H., and Decker. K, (1978) Regulation ot flavoproteinsynthesis studied in vivo in a riboflavin-requiring mutant ofArthrobacter oxidans. Arch Microbioi 119: 65-70.

Harayama. S.. and Don, RH . (1985) Genetic Engineering:Principles and Methods. Vol, 7, Setlow, J.K.. and Hollaen-der. A, (eds). New York: Plenum Press, pp, 283-307.

Harayama. S,. Leppik, R.A,, Rekik. M., Mermod, N,, Lehrbach.P.R., Reinecke, W, and Timmis, K,N. (1986) Gene order of

the TOL catabolic upper pathway operon and oxidation ofboth toluene and benzyl alcohol by the XylA product, J. Bac-terio/167:455^61.

Harley, C.B., and Reynolds. R,P. (1987) Analysis of E co//pro-moter sequences, Nud Acids Res 15: 2343-2361.

Haynes, J,L.. and Britz, M,L, (1990) The effect ol growth condi-tions of Corynebacterium glutamicum on the transformationfrequency obtained by eiectroporation, J Gen Microbiot 136:255-263.

Horn, J,M., Harayama. S.. and Timmis, K.N. (1991) DNAsequence determination of the TOL plasmid (pWWO) xylGFJgenes of Pseudomonas putida: implications for the evolutionof aromatic cataboiism. Mol Microbioi 5: 2459-2474,

Hudson, J,M., and Fried, M.G. (1991) The binding of cyclicAMP receptor protein to two lactose promoter sites is notcooperative in vitro. J Bacterioi 173: 59-66.

Inouye, S,. Nakazawa, A,, and Nakazawa, T. (1983) Molecularcloning of regulatory gene XylR and operator-promotorregions of the xylABC and xylDEGF operons of the TOLplasmid, J Bacterioi 155:1192-1199,

Jones. N. (1990) Transcriptional regulation by dimerisation:two sides to an incestuous relationship, Ce//61: 9-11.

KrSmer, H,. Niemoller, M.. Amouyal, M,, Revet, B,, vonWilcken-Bergmann. B,, and Muller-Hill, B, (1987) /ac repres-sor forms loops with linear DNA carrying two suitable spaced/acoperators. EMBOJ6: 1481-1491,

Kunkel, T.A. (1985) Rapid and efficient site-specific mutagene-sis without phenotypic selection. Proc Nati Acad Sci USA82:488-492.

Lehrbach, P.R., McGregor, I,, Ward, J.M.. and Broda, P, (1983)Molecular relationships between Pseudomonas INC P-9degradative plasmids TOL, NAH and SAL, Ptasmid 10:164^176.

Lehrbach, P.R., Zeyer, J.. Reineke, W.. Knackmuss. H,-J,. andTimmis, K,N, (1984) Enzyme recruitment in vitro: use ofcloned genes to extend the range of haloaromaticsdegraded by Pseudomonas sp, strain B13, J Bacterioi A5&:1025-1032.

Mauch L,. Kraus B., and Brandsch, R. (1989) Growth-stagedependent expression of 6-hydroxy-D-nicotine oxidase ofthe nicotine regulon of Arthrobacter oxidans. Arch Microbioi152:95-99

Mauch L,, Bichler V,. and Brandsch R, (1990) Funktional analy-sis of the 5' regulatory region and the UUG translation initia-tion codon of the Arthrobacter oxidans 6-hydroxy-nicotineoxidase gene Moi Gen Genet 221:427-434,

Maxam, A., and Gilbert, W, (1980) Sequencing end-labeledDNA with base specific chemical cleavages. Meth Enzymoi65: 499-560,

Pedersen, H,. Sogaard-Anderson. L.. Hoist. B., and Valentin-Hansen, P. (1991) Heterologous cooperativity in Escherichiacoli. J Bacterioi 266: 17804-17808,

Peterson, G.L. (1983) Meth Enzymol 9 1 : 95-119,Ramos, J.L., Rojo. F. Zhou, L. and Timmis, K,N, (1990) A fam-

ily of positive regulators related to the Pseudomonas putidaTOL plasmid XylS and Escherichia coli AraC activators, NucIAcids Res 18: 2149-2152.

Sambrook, J,, Fritsch, EF, and Maniatis, T, (1989) MolecularCloning, A Laboratory Manual. Cold Spring Harbor, NewYork: Cold Spring Harbor Laboratory Press 1:1,25-1.28.

Schell. M.A. (1986) Homology between nucleotide sequencesof promoter regions of nah and sal operons of NAH 7 ofPseudomonas putida. Proc Nati Acad Sci USA 83:369-373.