Induction of sodium channel Nax (SCN7A) expression in rat

and human hippocampus in temporal lobe epilepsy*yJan A. Gorter, zEmanuele Zurolo, zAnand Iyer, xKees Fluiter, *yErwin A. van Vliet,

{Johannes C. Baayen, and yzEleonora Aronica

*Swammerdam Institute for Life Sciences, Center for Neuroscience, University of Amsterdam, Amsterdam, The Netherlands;

yEpilepsy Institute in The Netherlands Foundation (Stichting Epilepsie Instellingen Nederland, SEIN), Heemstede, The Netherlands;

zDepartment of (Neuro) Pathology, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands;

xDepartment of Neurogenetics, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; and

{Department of Neurosurgery, VU University Medical Center, Amsterdam, The Netherlands

SUMMARY

Purpose: In a recent large-scale gene-expression study in

a rat model of temporal lobe epilepsy (TLE) a persistent

up-regulation in the expression of the SCN7A gene was

revealed. The SCN7A gene encodes an atypical sodium

channel (Nax), which is involved in osmoregulation via a

sensing mechanism for the extracellular sodium concen-

tration. Herein we investigated the expression and cellu-

lar distribution of SCN7A mRNA and protein in normal

and epileptic rat and human hippocampus.

Methods: SCN7A/Nax expression analysis was performed

by polymerase chain reaction (PCR), immunocytochemis-

try, and western blot analysis.

Results: Increased expression of SCN7A/Nax mRNA/pro-

tein was observed during epileptogenesis and in the

chronic epileptic phase in the post–status epilepticus (SE)

model of TLE. The up-regulation was confirmed in human

hippocampal tissue resected from pharmacoresistant

patients with hippocampal sclerosis (HS). In both epilep-

tic rat and human hippocampus, increased Nax expression

was observed in neurons and reactive astrocytes com-

pared to control tissue.

Conclusions: The increased and persistent expression of

SCN7A/Nax in the epileptic rat and human hippocampus

supports the possible involvement of this channel in the

complex reorganization occurring within the hippocam-

pus during the epileptogenic process in TLE. Further stud-

ies are needed for a complete understanding of the

functional role of SCN7A in epilepsy.

KEY WORDS: Rat, Human, Hippocampus, Epilepsy,

Atypical sodium channel, PCR, Immunocytochemistry.

Temporal lobe epilepsy (TLE) is the most common typeof medically intractable epilepsy in adults (Engel, 2001).The pathophysiologic substrate is usually representedby hippocampal sclerosis (HS; Thom, 2004; Wieser, 2004).The clinical history of patients with TLE often includes aninitial injury [i.e., febrile seizures, status epilepticus (SE) ofseveral causes, cerebral trauma] followed by a latent (clini-cally silent) period during which structural and functionalchanges (epileptogenesis) occur in the hippocampus withsubsequent development of chronic spontaneous seizureactivity (Engel et al., 2003).

Large-scale analysis of gene expression studies that havebeen performed in experimental models of TLE indicatechanges in expression of several voltage-gated sodium

channel subunits (for review see Kohling, 2002; Aronica &Gorter, 2007). In the rat post–status epilepticus (SE) model,different voltage-gated sodium channel subunits are down-regulated during epileptogenesis and recover to a largeextent in the chronic phase (Gorter et al., 2006). The excep-tion is the SCN7A sodium channel (also known as SCN6A),which is persistently up-regulated in the latent period aswell as in the chronic phase (Gorter et al., 2006).

The SCN7A gene encodes an atypical sodium channel,named ‘‘Nax,’’ that is considered to be a descendant of thevoltage-gated sodium channel, although it is not regulatedby the membrane’s voltage as in the other channels of thesodium channel family (Goldin et al., 2000; Catterall et al.,2005). The functional properties of the Nax channel are notclearly understood. However, recent experimental data,using Nax knockout mice, indicate that the channel serves asa sodium-level sensor of the body fluid (Hiyama et al.,2002; Watanabe et al., 2003; Shimizu et al., 2007). Thischannel was originally thought to be a glial sodium channel(Na-G) (Gautron et al., 1992, 2001; Black et al., 1994).

Accepted May 28, 2010; Early View publication August 5, 2010.Address correspondence to Dr. E. Aronica, Department of (Neuro)

Pathology, Academic Medical Center, Meibergdreef 9 1105 AZAmsterdam, The Netherlands. E-mail: e.aronica@amc.uva.nl

Wiley Periodicals, Inc.ª 2010 International League Against Epilepsy

Epilepsia, 51(9):1791–1800, 2010doi: 10.1111/j.1528-1167.2010.02678.x

FULL-LENGTH ORIGINAL RESEARCH

1791

However, in situ hybridization studies revealed that SCN7AmRNA is also expressed in neuronal cells in the peripheralnervous system (PNS), as well as in central nervous system(CNS), where it is expressed in restricted neuronal subpopu-lations such as thalamus, hippocampus, cerebellum, andmedian preoptic nucleus (Gautron et al., 1992; Black et al.,1996; Felts et al., 1997; Grob et al., 2004; Fukuoka et al.,2008). The cellular distribution and function of Nax has yetto be studied in human brain.

The aim of the present study was to investigate the cellu-lar distribution and expression of SCN7A/Nax mRNA/pro-tein during epileptogenesis and in the chronic phase ofspontaneous seizures in a rat model of TLE. The expressionand cellular distribution of SCN7A/Nax was also studied inhippocampal specimens from TLE patients with HS in orderto gain further insight into the role of this channel in epilep-tic human brain.

Material and Methods

Experimental animalsAdult male Sprague-Dawley rats (Harlan CPB Labo-

ratories, Zeist, The Netherlands) weighing 300–500 g wereused in this study, which was approved by the UniversityAnimal Welfare committee. The rats were housed individu-ally in a controlled environment (21 € 1�C; humidity 60%;lights on 08:00 a.m. to 8:00 p.m.; food and water availablead libitum).

Electrode implantation and seizure inductionTo record hippocampal electroencephalography (EEG),

a pair of insulated stainless steel electrodes (70 lm wirediameter, tips were 80 lm apart) were implanted into theleft dentate gyrus (DG) under electrophysiologic controlas described previously (Gorter et al., 2001). A pair ofstimulation electrodes was implanted in the angularbundle. Rats underwent tetanic stimulation (50 Hz) of thehippocampus in the form of a succession of trains ofpulses every 13 s. Each train had a duration of 10 s andconsisted of biphasic pulses (pulse duration 0.5 ms, maxi-mal intensity 500 lA). Stimulation was stopped when therats displayed sustained forelimb clonus and salivation forminutes, which usually occurred within 1 h. However,stimulation never lasted longer than 90 min. DifferentialEEG signals were amplified (10x) via a field-effecttransistor (FET) that connected the headset to a differentialamplifier (20x; CyberAmp, Axon Instruments, Burlin-game, CA, U.S.A.), filtered (1–60 Hz), and digitized by acomputer. A seizure detection program (Harmonie, Stel-late Systems, Montreal, Canada) sampled the incomingsignal at a frequency of 200 Hz per channel. EEG record-ings were monitored also visually and screened for seizureactivity. Behavior was observed during electrical stimula-tion and several hours thereafter. Immediately after termi-nation of the stimulation, periodic epileptiform discharges

(PEDs) occurred at a frequency of 1–2 Hz and they wereaccompanied by behavioral and EEG seizures (statusepilepticus). Most rats were monitored continuously fromthe cessation of SE to the time of sacrifice (24 h to1 week). The chronic epileptic group (3–4 months afterSE) was monitored during and shortly after SE and severaldays before sacrifice. In this experiment we used chronicepileptic rats that had frequent daily seizures (range, 5–12). Sham-operated control rats were handled andrecorded identically, but did not receive electrical stimula-tion. The experimental protocols followed the EuropeanCommunities Council directive 86/609/EEC and the DutchExperiments on Animal Act (1997), and were approved bythe Dutch animal welfare committee (DEC).

Rat tissue preparation for RNA isolationRats were decapitated in the acute phase (one day after

SE, n = 4), in the latent period (1 week after SE, n = 5; therats in this group did not exhibit spontaneous seizures), andin the chronic epileptic phase (3–4 months after SE, n = 5).Rats that did not develop SE during stimulation (non-SErats) were included as controls and were sacrificed 3–4 months after stimulation (n = 4). Age-matched controls(4–7 months of age) that were implanted but not stimulatedexcept for field potential recordings, were also included(n = 5). After decapitation, the hippocampus was removedand sliced into smaller parts (200–300 lm) and the CA3region (control, 1 day, 1 week and 3–4 months after SE)and the DG (control, 1 week and 3–4 months after SE) werecut out of the slices under a dissection microscope. Weselected the CA3 region because it is consistently damagedin the post–status epilepticus model, and the same regionhas been used to perform mRNA expression profile at thesame time points (Gorter et al., 2006). All material wasfrozen on dry ice and stored at )80�C until use.

Rat tissue preparation for immunocytochemistryRats were disconnected from the EEG recording setup

and deeply anesthetized with pentobarbital (Nembutal,intraperitoneally, 60 mg/kg). For immunocytochemistry,the animals were perfused through the ascending aorta with300 ml of 0.37% Na2S solution, followed by 300 ml 4%paraformaldehyde in 0.1 M phosphate buffer, pH 7.4. Here-after, the brains were dissected, incubated for 72 h in 0.3 Methylenediamine tetraacetic acid (EDTA), pH 6.7 (Merck,Amsterdam, The Netherlands) and paraffin embedded.Immunocytochemistry was performed on hippocampal sec-tions from each group (control, n = 6; 24 h, n = 4; 1 week,n = 6, 3–4 months, n = 6). Paraffin-embedded tissue wassectioned at 6 lm, mounted on precoated glass slides (StarFrost, Waldemar Knittel GmbH, Brunschweig, Germany),and used for immunocytochemistry. Horizontal sectionswere analyzed at a midlevel of the brain (5,300–6,100 lmbelow cortex surface). Immunostaining was performed ontwo adjacent serial hippocampal sections from each group.

1792

J. A. Gorter et al.

Epilepsia, 51(9):1791–1800, 2010doi: 10.1111/j.1528-1167.2010.02678.x

Two additional serial slices were used for double staining asdescribed below.

Human materialThe human cases included in this study were obtained

from the files of the departments of neuropathology of theAcademic Medical Center (AMC, University of Amster-dam) and the VU University Medical Center (VUMC).Patients underwent resection of the hippocampus for medi-cally intractable TLE. Informed consent was obtained forthe use of brain tissue and for access to medical records forresearch purposes. Two neuropathologists reviewed allcases independently. In six cases a pathologic diagnosis ofHS (without extrahippocampal pathology) was made. TheHS specimens include four cases of classical HS (grade 3,mesial temporal sclerosis, mesial temporal sclerosis (MTS)type 1a) and two cases of severe HS (grade IV; MTS type1b; (Wyler et al., 1992; Blumcke et al., 2007). Five non-HScases (no appreciable neuronal loss and reactive gliosis areobserved in the hippocampus), in which a focal lesion [glio-neuronal tumors (4 gangliogliomas and 1 dysembryoplasticneuropathic tumor) not involving the hippocampus proper]was identified, were also included to provide a comparisongroup to HS cases for immunocytochemistry and in situhybridization (frozen material was not available from thesespecimens).

Control hippocampal tissue was obtained at autopsy fromsix patients without history of seizures or other neurologicdiseases. All autopsies were performed within 12 h afterdeath. Table 1 summarizes the clinical features of TLE andcontrol cases.

Frozen tissues (stored at )80�C) from HS and controlhippocampus was used for RNA isolation (n- 6) and forimmunoblot analysis (n = 5).

Tissue was fixed in 10% buffered formalin and embeddedin paraffin. Paraffin-embedded tissue was sectioned at6 lm, mounted on organosilane-coated slides (Star Frost,Waldemar Knittel GmbH, Brunschweig, Germany), andused for in situ hybridization and immunocytochemistry asdescribed below.

RNA isolation and real time quantitative PCRanalysis (qPCR)

For RNA isolation, frozen material was homogenizedin Trizol LS Reagent (Invitrogen, Carlsbad, CA, U.S.A.).After addition of 200 lg glycogen and 200 ll chloroform,the aqueous phase was isolated using Phase Lock tubes(Eppendorf, Hamburg, Germany). The concentration andpurity of RNA were determined spectrophotometrically at260/280 nm using a nanodrop spectrophotometer (OceanOptics, Dunedin, FL, U.S.A.). Five micrograms of totalRNA were reverse-transcribed into cDNA using oligo dTprimers as described previously (Aronica et al., 2004).Specific primers were designed for the genes of interestusing the Universal ProbeLibrary of Roche (https://www.roche-applied-science.com) on the basis of the reportedcDNA sequences. For the rat we used: SCN7A (forward:tctgagagccaatccctgat and reverse: ttgctccgagtctccttgtt); hypo-xanthine guanine phosphoribosyltransferase (HPRT;forward: tcctcctcagaccgctttt; reverse: cctggttcatcatcgctaatc);cyclophilin-A (forward: cccaccgtgttcttcgacat; reverse: aaacagctcgaagcagacgc). For the human material we used: SCN7A(forward: ctttgtggcaacaggacaga; reverse: aataaggcccagccaaaact); hypoxanthine ribosyltransferase (HPRT) (forward:tggcgtcgtcgtgattagtgatg; reverse: tgtaatccagcaggtcagca);TATA-box binding protein (TBP; forward: caggagccaagagtgaagaac; reverse: aggaaataactctggctcataactact). For 1 llsample a LightCycler SYBR green I master mix (Roche,Nutley, NJ, U.S.A.) was made containing a total volume of5 ll: 0.2 ll forward primer; 0.2 ll reverse primer and 2.5 llmaster mix. A total of 6 ll was run in duplicates in a384-well plate in the LightCycler 480 Real-Time PCR Sys-tem (Roche Applied Sciences, Indianapolis, IN, U.S.A.) underthe following conditions: A 5 min denaturing step at 95�Cfollowed by a total of 45 amplification cycles consisting of15 s denaturing at 95�C, 5 s of annealing at 60�C, and 10 sof extension at 72�C. Fluorescent product was measured bya single acquisition mode at 72�C after each cycle. For dis-tinguishing specific from nonspecific products and primerdimers, a melting curve was obtained after amplification byholding the temperature at 65�C for 15 s followed by a grad-ual increase in temperature to 95�C at a rate of 2.5�C s, withthe signal acquisition mode set continuous. Quantificationof data was performed as described previously (Aronicaet al., 2008), using the computer program LinRegPCR inwhich linear regression on the Log (fluorescence) per cyclenumber data is applied to determine the amplificationefficiency per sample (Ramakers et al., 2003). The startingconcentration of each specific product was normalized tothe amount of the reference genes (HPRT and cyclophilin-Afor rat material; HPRT and TBP for human material).

In situ hybridization in human materialIn situ hybridization for human SCN7A was per-

formed using a 5́ fluorescein labeled 19mer antisenseoligonucleotide containing Locked Nucleic Acid and

Table 1. Summary of clinical findings of epilepsy

patients and controls

Total or mean (Range or percentage)

HS (n = 6)

Non-HS

(n = 5)

Control

(n = 6)

Mean age at surgery (years) 31.5 (19–50) 33.4 (21–43) 44.3

(26–55)

Seizure type CPS (100%);

SGS (17%)

CPS (100%);

SGS (20%)

NA

Seizure frequency (CPS/months) 10.6 (3–50) 10.4 (3–30) NA

Duration of epilepsy (years) 11.8 (9–20) 10.6 (9–18) NA

HS, hippocampal sclerosis; CPS, complex partial seizures; SGS, secondarygeneralized seizures; NA: not applicable.

1793

SCN7A Expression in TLE

Epilepsia, 51(9):1791–1800, 2010doi: 10.1111/j.1528-1167.2010.02678.x

2¢OME RNA moieties (FAM – TauTucAccAacTcuCugC,capitals indicate LNA, lower case indicates 2¢OME RNA).The oligonucleotides were synthesized by Ribotask ApS,Odense, Denmark. The hybridizations were done at 59�C on6 lm sections of paraffin embedded materials as describedpreviously (Budde et al., 2008). The hybridization signalwas detected using a rabbit polyclonal anti-fluorescein/Ore-gon green antibody (A21253; Molecular probes; Invitrogen)and a horse radish peroxidase (HRP) labeled goat anti-rabbitpolyclonal antibody (P0448 Dako, Glostrup Denmark) assecondary antibody. Signal was detected with chromogen3-amino-9-ethyl carbazole (AEC, Sigma, St. Louis, MO,U.S.A.).

ImmunohistochemistryGlial fibrillary acidic protein (GFAP; polyclonal rabbit;

1:4,000; DAKO), vimentin (mouse clone V9, 1:1,000;DAKO), neuronal nuclear protein (NeuN; mouse cloneMAB377, IgG1; 1:2,000; Chemicon, Temecula, CA,U.S.A.), and (HLA)-DP, DQ, DR (mouse clone CR3/43;1:400; DAKO) were used in the routine immunocytochemi-cal analysis of TLE human specimens.

For the detection of SCN7A (rat and human tissue) thefollowing antibodies (Abs) were used: anti-SCN7A rabbitantibody (1:100; kindly provided by Dr. Berwald-Netter,Biochimie Cellulaire, CNRS FRE 2242, Coll�ge de France)and anti-SCN7A rabbit antibody (1:200; raised against asynthetic peptide derived from the C-terminal domain;Novus biologicals; Littleton, CO, U.S.A.). Sections wereincubated for 1 h at room temperature followed by incuba-tion at 4�C overnight with primary antibodies. Single-labelimmunocytochemistry was performed using 3,3-diam-inobenzidine as chromogen as previously described (Gorteret al., 2002; Aronica et al., 2003). Sections were count-erstained with hematoxylin. Sections incubated without theprimary Ab, with preimmune sera, were essentially blank.

For double-labeling studies, sections were incubated for2 h at RT after incubation with primary antibody, withAlexa Fluor 568 and Alexa Fluor 488 (anti-rabbit IgG oranti-mouse IgG; 1:200; Molecular probes, Eugene, U.S.A.).Sections were mounted with Vectashield (Vector Laborato-ries, Burlingame, CA, U.S.A.) and analyzed by means of alaser scanning confocal microscope (Leica TCS SP2, Wetz-lar, Germany).

Western blot analysisFor immunoblot analysis, freshly frozen histologically

normal autopsy hippocampus (n = 5) and HS (n = 5) sam-ples were homogenized in lysis buffer as previouslydescribed (Aronica et al., 2005). Protein content was deter-mined using the bicinchoninic acid method (Smith et al.,1985). For electrophoresis, equal amounts of proteins(30 lg/lane) were separated by sodium dodecylsulfate-polyacrylamide gel electrophoretic (SDS–PAGE) analysis.Separated proteins were transferred to nitrocellulose paper

for 1 h and 30 min, using a semi-dry electroblotting system(BioRad, Transblot SD, Hercules, CA, U.S.A.). Blots wereincubated overnight in TTBS (20 mM Tris, 150 mM NaCl,0.1% Tween, pH 7.5)/5% non fat dry milk, containing theprimary antibody (1:2,000; Novus biologicals). Afterseveral washes in Tween-Tris Buffered Saline (TTBS), themembranes were incubated in TTBS/5% non fat dry milk/1% bovine serum albumin (BSA), containing the goat anti-rabbit coupled to horse radish peroxidase (1:2500; Dako)for 1 h. After washes in TTBS, immunoreactivity was visu-alized using Lumi–light PLUS western blotting substrate(Roche Diagnostics, Mannheim, Germany) and digitizedusing a Luminescent Image Analyzer (LAS-3000; FujiFilm, Japan). Expression of b-actin (monoclonal mouse;1:50.000; Sigma) was used as reference protein.

Statistical analysisStatistical analyses were performed with SPSS for Win-

dows (SPSS 11.5, SPSS Inc., Chicago, IL, U.S.A.) usingtwo-tailed Student’s t-test and to assess differences betweenmore than two groups, ANOVA and a nonparametric Krus-kal-Wallis test followed by Mann-Whitney U-test. p < 0.05was considered significant.

Results

SCN7A mRNA expression by real time qPCR in ratand human

SCN7A expression was studied using qPCR in both ratand human hippocampal tissue. SCN7A expression in ratCA3 region was significantly increased at 24 h (acutephase), 1 week (latent phase), and 3–4 months (chronicphase) post-SE, compared to both control and non-SE val-ues (Fig. 1A). SCN7A mRNA was also evaluated in the DGat 1 week and 3–4 months post-SE and showed at both timepoints increased level of expression compared to both con-trol and non-SE values (Fig. 1B). Increased SCN7A expres-sion was also observed in human HS specimens comparedto control hippocampus (Fig. 1C). SCN7A expression wasnormalized to that of the reference genes (see material andmethods).

Nax protein expression in rat hippocampusTo determine the temporal-spatial expression and cellular

distribution of Nax, we performed immunocytochemistryin tissue samples of control rats and rats that were sacrificedat different time points after SE (1 day, 1 week, and3–4 months post-SE). Two different anti-SCN7A (Nax)antibodies were used (see material and methods), with simi-lar results (the Novus biologicals antibody is shown inFig. 2). Control hippocampus displayed weak Nax immuno-reactivity (IR) in the different hippocampal subfields(Fig. 2 A–C). Neuronal expression was slightly above back-ground in three of five rats, and no detectable staining wasobserved in resting glial cells. At one day post-SE, Nax

1794

J. A. Gorter et al.

Epilepsia, 51(9):1791–1800, 2010doi: 10.1111/j.1528-1167.2010.02678.x

showed moderate expression in cells with glial appearancein the areas of neuronal damage (CA1, CA3, hilus; notshown). At 1 week post-SE (Fig. 2D–F), up-regulation ofNax IR was detected within the different hippocampalregions in both neuronal and glial cells. Pyramidal neuronsof CA1 and CA3 regions displayed Nax expression. In the

chronic phase (3–4 months post-SE), the hippocampusshowed a pattern similar to that observed at 1 week post-SE, with both neuronal and glial expression, which wasmainly localized in regions of prominent gliosis, such as thehilar region (Fig. 2J–K). Colocalization studies indicatedthat Nax was induced in glial cells and that expression wasconfined to GFAP positive cells (astrocytes; Fig. 2J),whereas no colocalization was observed with markers of mi-croglial cells (not shown).

SCN7A/Nax expression in hippocampal sclerosis

In situ hybridizationThe cellular distribution of SCN7A mRNA in human

hippocampus was investigated using in situ hybridization.Differences in the expression level, as well as in the cell-specific distribution were found in specimens from patientswith HS (Fig. 3). In control hippocampus (autopsy hippo-campal specimens), no detectable SCN7A expression wasobserved in both neuronal and glial cells (Fig. 3A–B).SCN7A expression was also below detection level in non-sclerotic hippocampus (non-HS; surgical hippocampalspecimens; not shown).

ImmunocytochemistryThe expression and cellular distribution of Nax protein

was studied by immunocytochemistry in hippocampal spec-imens of control and TLE patients with HS. Two differentanti-SCN7A (Nax) antibodies were used (see Material andMethods), with similar results (the Novus biologicals anti-body is shown in Fig. 4). In control (autopsy) hippocampusNax displayed weak staining in the different hippocampalsubfields, including pyramidal cells of CA1 and CA3regions, as well as granule cells and hilar neurons of the DG(Fig. 4 A,C,E). No detectable staining was observed in rest-ing glial cells. A similar immunoreactivity pattern wasobserved in non-HS specimens (not shown). Differences inthe expression level of Nax were found in specimens frompatients with HS (Fig 4B,D,F,G). Nax IR was up-regulatedwithin the different hippocampal regions in both neuronaland glial cells. Abundant Nax immunopositive glial cellswith typical astroglial morphology were observed in theareas with prominent gliosis in all the HS specimens exam-ined with prominent perivascular astroglial staining(Fig. 4D,G). Double labeling confirmed Nax expression inGFAP-positive reactive astrocytes (Fig. 4H). No detectableNax IR was observed in cells of the microglial/macrophagelineage. As previously reported in rodent tissue (Watanabeet al., 2006; Fukuoka et al., 2008), Nax IR was detected inhuman control dorsal root ganglia (DRG) and ependymalcell layer (Fig. 4 I–J).

Western blot analysisWestern blot analysis was performed to quantify the total

amount of Nax in total homogenates of HS specimens,

A

B

C

Figure 1.

Quantitative real time PCR of SCN7A expression in rat and

human hippocampus. (A) Expression levels of SCN7A mRNA in

the hippocampal CA3 region of control rats (n = 5), rats at

1 day (n = 4), 1 week (n = 5), and 3–4 months (n = 5) after

SE, and rats that did not develop status epilepticus (SE) during

stimulation (non-SE; n = 4). (B) Expression levels of SCN7A

mRNA in the dentate gyrus (DG) of control rats (n = 5),

1 week (n = 5), and 3–4 months (n = 5) after SE, and rats that

did not develop a SE during stimulation (non-SE; n = 4). (C)

Expression levels of SCN7A in human control hippocampus

(n = 6) and human hippocampal sclerosis specimens (HS;

n = 6). Data represent the SCN7A expression normalized to

the reference genes. The error bars represent standard error

of the mean (SEM) and *represents a p-value < 0.05.

Epilepsia ILAE

1795

SCN7A Expression in TLE

Epilepsia, 51(9):1791–1800, 2010doi: 10.1111/j.1528-1167.2010.02678.x

compared to nonepileptic hippocampal tissue. Westernblot analysis of total homogenates of human controlhippocampus revealed a band at molecular weight ofapproximately 190 kDa (Fig. 4K; expected molecularweight 193 kDa). Subsequent densitometric analysisrevealed an almost twofold increase in Nax expression inHS (OD = 0.65 € 0.07; n = 5) compared to Nax expressionin autopsy control hippocampus (OD = 0.34 € 0.11;n = 5); p < 0.05.

Discussion

In a previous microarray study that was performed inthe electrical post-SE rat model, we observed that theSCN7A gene, encoding an atypical sodium channel (Nax),

was the only sodium channel subunit to be induced duringSE-induced epileptogenesis and to be persistently up-regu-lated during the chronic epileptic phase characterized bydaily spontaneous seizures.

The function of the Nax has been extensively studied inthe circumventricular organs (CVOs), where this channelserves as a sodium-level sensor of the body fluid (Hiyamaet al., 2002; Watanabe et al., 2003; Shimizu et al., 2007).However, SCN7A is widely expressed in several types ofcells, both outside and within the CNS (Gautron et al.,1992; Black et al., 1996; Felts et al., 1997; Grob et al.,2004; Fukuoka et al., 2008). In the CNS the expression ofSCN7A is not confined to specialized glia-like cells butalso in neurons of adult DRG and median preoptic nucleusin rodents. In contrast, in normal adult rodent brain, no

A B C

D E F

G

J K

H I

Figure 2.

Immunostaining of Nax in

hippocampal tissue of control rat

and after induction of status

epilepticus (SE). (A–C) Control

hippocampus showing weak Nax

immunoreactivity (IR) in the

different hippocampal subfields,

including CA3 (B) and CA1

(C) regions. (D–F) hippocampus

1 week post-SE showing increased

neuronal Nax expression within the

different hippocampal subfields,

including CA3 (E) and CA1 (F)

regions. Insert in F shows

expression of Nax (red) in pyramidal

neurons of CA1 region (NeuN

positive, green). (G–I)

hippocampus 3–4 months post-SE

showing increased neuronal Nax

expression within the different

hippocampal subfields, including

CA3 (H), CA1 (I) regions. (J–K)

hilar region at 1 week (J) and 3–

4 months (K) post-SE showing Nax

expression in glial cells (arrows).

Insert a in J: Nax positive glial

processes around a blood vessel.

Insert b in J: high magnification of

positive cells with astroglial

morphology. Insert c in J:

colocalization of GFAP (green) with

Nax (red) in astroglial processes.

Sections are counterstained with

hematoxylin. Scale bar in A: A, D,

G: 250 lm; B, C, H: 140 lm; C, F,

I: 70 lm; J–K: 40 lm;

Epilepsia ILAE

1796

J. A. Gorter et al.

Epilepsia, 51(9):1791–1800, 2010doi: 10.1111/j.1528-1167.2010.02678.x

detectable expression of this sodium channel was observedin neurons within hippocampus, cerebellum and spinal cord(Gautron et al., 1992; Waxman & Black, 1996; Felts et al.,1997; Watanabe et al., 2000). However, during an earlypostnatal period, a transient expression of the SCN7AmRNA was observed in neurons of the hippocampus, cere-bellum, and spinal cord (Felts et al., 1997). The physiologicrole of Nax in brain regions other than CVOs remains uncla-rified. Moreover, very little is currently known about themechanisms controlling the region-specific regulation ofNax expression.

The present study, which reveals that the expression ofSCN7A/Nax is up-regulated in the hippocampus after induc-tion of SE, is the first to focus on SCN7A/Nax expressionand cellular distribution in human hippocampus frompatients with TLE.

In rat hippocampus we detected an up-regulation ofSCN7A during epileptogenesis, and in the chronic epilepticphase in the post-SE model of TLE. Interestingly, in con-trast to other voltage-gated sodium channel subunits,SCN7A was still significantly up-regulated in the chronicphase. Immunocytochemical analysis of Nax in rat hippo-campus post-SE showed expression in both neuronal andglial cells. Our data provide the first evidence that neuronaland astroglial expression of SCN7A can be triggered by epi-leptogenic brain insults in vivo.

The up-regulation of SCN7A/Nax observed in the chronicepileptic phase in the post-SE model of TLE, was confirmedin human HS specimens of patients undergoing surgery forpharmacologically refractory TLE. In situ hybridization andimmunocytochemical analysis of SCN7A/Nax in humancontrol hippocampus demonstrated low or undetectableexpression in neuronal cells and resting astroglia. Similar tothe observation in the post-SE rat hippocampus, increased

SCN7A/Nax neuronal and glial expression was also detectedin the epileptic HS tissue.

Because the expression of SCN7A is developmentallyregulated in the hippocampus (Felts et al., 1997), the induc-tion of SCN7A in adult hippocampus might indicate thatcells regain some of their immature properties after SE. Thishypothesis is consistent with previous observations suggest-ing that molecular mechanisms involved in normal braindevelopment are reactivated during epileptogenesis (Elliottet al., 2003; Elliott & Lowenstein, 2004). Accordingly, wereported previously an up-regulation of neonatal isoformsof voltage-gated sodium channels in hippocampal neuronsin the same experimental model (Aronica et al., 2001). Fur-thermore, a recent study shows that the SCN7A basal pro-moter is enough for expression in neuronal cells, and thatrepression mechanisms that inhibit SCN7A gene expressionare possibly active in certain brain regions under physio-logic conditions (Garc�a-Villegas et al., 2009).

The process of astroglial reactivity has also been shownto be associated with reversion to an immature cell state andexpression of early developmental genes (Ridet et al.,1997). The Nax has been originally suggested to be a glialsodium channel (Gautron et al., 1992); however, (except forthe specialized glia-like cells in the CVOs), the protein isundetectable in resting astroglia and oligodendrocytes innormal brain (Gautron et al., 1992, 2001). In adult rat andhuman hippocampus, the expression in glial cells wasdetected only in epileptic tissue and, as confirmed bydouble-labeling experiments, was confined to reactiveastrocytes. Induction of Nax in reactive glia followingexcitotoxic neuronal injury has been previously suggested(Gautron et al., 2001). Herein we confirm this possibilityshowing that induction in reactive astrocytes can be trig-gered by an epileptogenic brain insult. Moreover, the

A B C D

Figure 3.

SCN7A mRNA expression in human brain tissue. (A–D) In situ hybridization of SCN7A mRNA expression in the CA1 (A, C) and hilar

regions (B, D) of human hippocampus. A–B: in control hippocampus SCN7A expression was below the detection level. C–D:

hippocampal sclerosis (HS) showing SCN7A expression in pyramidal neurons (arrowheads in C) and in cells with glial morphology

(arrows in C and D). Scale bar in A: 40 lm.

Epilepsia ILAE

1797

SCN7A Expression in TLE

Epilepsia, 51(9):1791–1800, 2010doi: 10.1111/j.1528-1167.2010.02678.x

expression of Nax in reactive astrocytes could be interest-ing in view of the suggested role of this channel in theregulation of neuronal activity via Na-dependent productionof lactate (Shimizu et al., 2007). Whether Nax plays a simi-lar role in hippocampus in this pathologic condition needsto be further investigated.

Although a rapid induction of if SCN7A/Nax has beenshown in the post-SE experimental model, seizures alone

cannot account for changes in neuronal and glial proteinexpression in HS, since non-HS tissue was exposed to sei-zures but did not show up-regulation of the protein. There-fore, the lesion per se or the concomitant presence of thelesion and the epileptic activity, are likely to play a role inmodulating the SCN7A/Nax in HS.

In conclusion our observations demonstrate the occur-rence of a neuronal and glial up-regulation of SCN7A/Nax

A B

C

E

G

I J K

H

F

D

Figure 4.

Distribution of SCN7A

immunoreactivity in the

hippocampus of control and TLE

patients with hippocampal sclerosis.

(A, C, E) control hippocampus

showing weak Nax

immunoreactivity (IR) in pyramidal

neurons of CA3 (A) and CA1 (C)

region as well in the dentate gyrus

(DG; E). (B, D, F, G, H)

hippocampal sclerosis (HS) showing

increased neuronal SCN7A IR in

CA3 (arrows in B), CA1 (arrows in

D), and DG (gcl: granule cell layer).

Nax IR was also observed in glial

cells; arrowheads in B indicate

positive glial cells in the CA3 region

and insert in B shows high

magnification of Nax positive glial

cells. Insert in D shows Nax positive

perivascular glial processes.

Increased SCN7A IR was also

detected in the inner molecular

layer (iml) of the DG (F) and in

reactive glial cells within the hilar

region (arrows in G), including

perivascular glia (arrowheads in G).

(H) colocalization (yellow) of GFAP

(green) with Nax (red) in reactive

astrocytes (arrows; insert: high

magnification). (I, J) Nax

immunoreactivity in human dorsal

root ganglia (I) and in human

ependymal cell layer (J). (K)

Representative immunoblot of total

homogenates from control autopsy

hippocampus and hippocampal

sclerosis (HS) specimens. Scale bar

in A–D: 120 lm; E, F, H: 80 lm; G:

40 lm; G, F: 40 lm; G: 25 lm.

Epilepsia ILAE

1798

J. A. Gorter et al.

Epilepsia, 51(9):1791–1800, 2010doi: 10.1111/j.1528-1167.2010.02678.x

during epileptogenesis, as well as in the chronic phase ofspontaneous seizures. Therefore, understanding the role ofthis channel in epilepsy-associated pathologies may haveimportance in view of the development of new therapeuticstrategies. Overexpression and loss of function studies inanimal models are needed, to further explore the functionalrole of Nax in epileptogenesis and epilepsy.

Acknowledgments

We are grateful to J.T. van Heteren for her technical help. This work hasbeen supported by National Epilepsy Fund, NEF 09-05 (EA), and EU FP7project NeuroGlia, Grant Agreement No. 202167.

Disclosure

We confirm that we have read the Journal’s position on issues involvedin ethical publication and affirm that this report is consistent with thoseguidelines. None of the authors has any conflict of interest to disclose.

References

Aronica E, Yankaya B, Troost D, van Vliet EA, Lopes da Silva FH, GorterJA. (2001) Induction of neonatal sodium channel II and III alpha-isoform mRNAs in neurons and microglia after status epilepticus in therat hippocampus. Eur J Neurosci 13:1261–1266.

Aronica E, Troost D, Yankaya B, Jansen GH, Isom L, Gorter JA. (2003)Expression and regulation of voltage gated sodium channel (NaCh) ß1subunit protein in human glioses-associated pathologies. Acta Neuropa-thol 105:515–523.

Aronica E, Gorter JA, Ramkema M, Redeker S, Ozbas-Gerceker F, vanVliet EA, Scheffer GL, Scheper RJ, van der Valk P, Baayen JC, TroostD. (2004) Expression and cellular distribution of multidrug resistance-related proteins in the hippocampus of patients with mesial temporallobe epilepsy. Epilepsia 45:441–451.

Aronica E, Gorter JA, Redeker S, van Vliet EA, Ramkema M, Scheffer GL,Scheper RJ, van der Valk P, Leenstra S, Baayen JC, Spliet WG, TroostD. (2005) Localization of breast cancer resistance protein (BCRP)in microvessel endothelium of human control and epileptic brain.Epilepsia 46:849–857.

Aronica E, Gorter J. (2007) Gene Expression Profile in Temporal LobeEpilepsy. Neuroscientist 13:1–9.

Aronica E, Boer K, Becker A, Redeker S, Spliet WG, van Rijen PC, WittinkF, Breit T, Wadman WJ, Lopes da Silva FH, Troost D, Gorter JA.(2008) Gene expression profile analysis of epilepsy-associated ganglio-gliomas. Neuroscience 151:272–292.

Black JA, Yokoyama S, Waxman SG, Oh Y, Zur KB, Sontheimer H,Higashida H, Ransom BR. (1994) Sodium channel mRNAs in culturedspinal cord astrocytes: in situ hybridization in identified cell types.Brain Res Mol Brain Res 23:235–245.

Black JA, Dib-Hajj S, McNabola K, Jeste S, Rizzo MA, Kocsis JD, Wax-man SG. (1996) Spinal sensory neurons express multiple sodium chan-nel alpha-subunit mRNAs. B Brain Res Mol Brain Res 43:117–131.

Blumcke I, Pauli E, Clusmann H, Schramm J, Becker A, Elger C, Mers-chhemke M, Meencke HJ, Lehmann T, von Deimling A, Scheiwe C,Zentner J, Volk B, Romstock J, Stefan H, Hildebrandt M. (2007) A newclinico-pathological classification system for mesial temporal sclerosis.Acta Neuropathol 113:235–244.

Budde BS, Namavar Y, Barth PG, Poll-The BT, Nurnberg G, Becker C, vanRuissen F, Weterman MA, Fluiter K, te Beek ET, Aronica E, van derKnaap MS, Hohne W, Toliat MR, Crow YJ, Steinling M, Voit T, Roe-lenso F, Brussel W, Brockmann K, Kyllerman M, Boltshauser E, Ham-mersen G, Willemsen M, Basel-Vanagaite L, Krageloh-Mann I, deVries LS, Sztriha L, Muntoni F, Ferrie CD, Battini R, Hennekam RC,Grillo E, Beemer FA, Stoets LM, Wollnik B, Nurnberg P, Baas F.(2008) tRNA splicing endonuclease mutations cause pontocerebellarhypoplasia. Nat Genet 40:1113–1118.

Catterall WA, Goldin AL, Waxman SG. (2005) International Union ofPharmacology XLVII. Nomenclature and structure-functionrelationships of voltage-gated sodium channels. Pharmacol Rev57:397–409.

Elliott RC, Miles MF, Lowenstein DH. (2003) Overlapping microarray pro-files of dentate gyrus gene expression during development- and epi-lepsy-associated neurogenesis and axon outgrowth. J Neurosci23:2218–2227.

Elliott RC, Lowenstein DH. (2004) Gene expression profiling of seizuredisorders. Neurochem Res 29:1083–1092.

Engel J Jr. (2001) Mesial temporal lobe epilepsy: what have we learned?Neuroscientist 7:340–352.

Engel J Jr, Wilson C, Bragin A. (2003) Advances in understanding the pro-cess of epileptogenesis based on patient material: what can the patienttell us? Epilepsia 44(Suppl 12):60–71.

Felts PA, Yokoyama S, Dib-Hajj S, Black JA, Waxman SG. (1997) Sodiumchannel alpha-subunit mRNAs I, II, III, NaG, Na6 and hNE (PN1): dif-ferent expression patterns in developing rat nervous system. Brain ResMol Brain Res 45:71–82.

Fukuoka T, Kobayashi K, Yamanaka H, Obata K, Dai Y, Noguchi K.(2008) Comparative study of the distribution of the alpha-subunits ofvoltage-gated sodium channels in normal and axotomized rat dorsalroot ganglion neurons. J Comp Neurol 510:188–206.

Garc�a-Villegas R, L�pez-Alvarez LE, Arni S, Rosenbaum T, Morales MA.(2009) Identification and functional characterization of the promoter ofthe mouse sodium-activated sodium channel Na(x) gene (Scn7a).J Neurosci Res 87:2509–2519.

Gautron S, Dos Santos G, Pinto-Henrique D, Koulakoff A, Gros F,Berwald-Netter Y. (1992) The glial voltage-gated sodium channel:cell- and tissue-specific mRNA expression. Proc Natl Acad Sci USA89:7272–7276.

Gautron S, Gruszczynski C, Koulakoff A, Poiraud E, Lopez S, Cambi-er H, Dos Santos G, Berwald-Netter Y. (2001) Genetic and epige-netic control of the Na-G ion channel expression in glia. GLIA 33:230–240.

Goldin AL, Barchi RL, Caldwell JH, Hofmann F, Howe JR, Hunter JC, Kal-len RG, Mandel G, Meisler MH, Netter YB, Noda M, Tamkun MM,Waxman SG, Wood JN, Catterall WA. (2000) Nomenclature of volt-age-gated sodium channels. Neuron 28:365–368.

Gorter JA, Vliet van EA, Aronica E, Lopes da Silva FH. (2001) Progressionof spontaneous seizures after status epilepticus is related with extensivebilateral loss of hilar parvalbumin and somatostatin immunoreactiveneurons. Eur J Neurosci 13:1–14.

Gorter JA, Vliet van EA, Lopes da Silva FH, Isom L, Aronica E. (2002)Sodium Channel ß1-Subunit Expression is increased in reactive astro-cytes in a Rat Model for Mesial Temporal Lobe Epilepsy. Eur J Neuro-sci 16:360–364.

Gorter JA, Van Vliet E, Aronica E, Rauwerda H, Breit T, Lopes da SilvaFH, Wadman WJ. (2006) Potential New Antiepileptogenic TargetsIndicated by Microarray Analysis in a Rat Model for Temporal LobeEpilepsy. J Neurosci 26:11083–11110.

Grob M, Drolet G, Mouginot D. (2004) Specific Na+ sensors are function-ally expressed in a neuronal population of the median preoptic nucleusof the rat. J Neurosci 24:3974–3984.

Hiyama TY, Watanabe E, Ono K, Inenaga K, Tamkun MM, Yoshida S,Noda M. (2002) Na(x) channel involved in CNS sodium-level sensing.Nat Neurosci 5:511–512.

Kohling R. (2002) Voltage-gated sodium channels in epilepsy. Epilepsia43:1278–1295.

Ramakers C, Ruijter JM, Deprez RH, Moorman AF. (2003) Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR)data. Neurosci Lett 339:62–66.

Ridet JL, Malhotra SK, Privat A, Gage FH. (1997) Reactive astrocytes:cellular and molecular cues to biological function. Trends Neurosci20:570–577.

Shimizu H, Watanabe E, Hiyama TY, Nagakura A, Fujikawa A, OkadoH, Yanagawa Y, Obata K, Noda M. (2007) Glial Nax channelscontrol lactate signaling to neurons for brain [Na+] sensing. Neuron 54:59–72.

Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, ProvenzanoMD, Fujimoto EK, Goeke NM, Olson BJ, Klenk DC. (1985) Measure-ment of protein using bicinchoninic acid. Anal Biochem 150:76–85.

1799

SCN7A Expression in TLE

Epilepsia, 51(9):1791–1800, 2010doi: 10.1111/j.1528-1167.2010.02678.x

Thom M. (2004) Recent advances in the neuropathology of focal lesions inepilepsy. Exp Rev Neurotherap 4:973–984.

Watanabe E, Fujikawa A, Matsunaga H, Yasoshima Y, Sako N, YamamotoT, Saegusa C, Noda M. (2000) Nav2/NaG channel is involved in controlof salt-intake behavior in the CNS. J Neurosci 20:7743–7751.

Watanabe U, Shimura T, Sako N, Kitagawa J, Shingai T, Watanabe E, NodaM, Yamamoto T. (2003) A comparison of voluntary salt-intake behav-ior in Nax-gene deficient and wild-type mice with reference to periph-eral taste inputs. Brain Res 967:247–256.

Watanabe E, Hiyama TY, Shimizu H, Kodama R, Hayashi N, Miyata S, Ya-nagawa Y, Obata K, Noda M. (2006) Sodium-level-sensitive sodium

channel Na(x) is expressed in glial laminate processes in the sensorycircumventricular organs. Am J Physiol Regul Integr Comp Physiol290:R568–R576.

Waxman SG, Black JA. (1996) Expression of mRNA for a sodiumchannel in subfamily 2 in spinal sensory neurons. Neurochem Res21:395–401.

Wieser HG. (2004) ILAE Commission Report. Mesial temporal lobe epi-lepsy with hippocampal sclerosis. Epilepsia 45:695–714.

Wyler AR, Dohan C, Schweitzer JB, Berry AD III. (1992) A grading systemfor mesial temporal pathology (hippocampal sclerosis) from anteriortemporal lobectomy. J Epilepsy 5:220–225.

1800

J. A. Gorter et al.

Epilepsia, 51(9):1791–1800, 2010doi: 10.1111/j.1528-1167.2010.02678.x

This document is a scanned copy of a printed document. No warranty is given about the accuracy of the copy.

Users should refer to the original published version of the material.