Identification of tetracycline- and erythromycin-resistant Gram-positive cocci within the fermenting...

ORIGINAL ARTICLE

Identification of tetracycline- and erythromycin-resistantGram-positive cocci within the fermenting microflora of anItalian dairy food productC. Devirgiliis, S. Barile, A. Caravelli, D. Coppola and G. Perozzi

INRAN – National Research Institute on Food & Nutrition, Via Ardeatina, Rome, Italy

Introduction

Selection of antibiotic-resistant (AbR) bacteria in the

intestinal microflora of livestock has occurred over the

past few decades following the use of antimicrobial agents

as growth promoters in animal feed (Teuber 2001;

Wegener 2003). To prevent the environmental spread of

AbR bacteria, this use of antimicrobials was banned in all

EU member states in 2006, but an increasing number of

reports describing recovery of genetically resistant strains

from environmental sources raised great scientific interest

(Wegener 2003), especially in the light of the intrinsic

potential transmission of genetic determinants for anti-

biotic resistance to human pathogens through the food

chain (Mathur and Singh 2005). Commensal bacteria

used as natural fermentation starters in food processing

are not intrinsically pathogenic, although some genera

(mostly enterococci) are capable of acquiring virulence

genes. Enterococcus species represent a substantial propor-

tion of the lactic acid bacteria (LAB) commonly found in

foods, as they are present in raw meat and milk even

when sanitary rules are respected. They can spoil pro-

cessed meats, but they are also important for ripening

and for the development of specific flavours in traditional

cheeses and sausages, especially in those produced in the

mediterranean area. Enterococci are also used as human

probiotics. However, such use remains controversial in

the light of the capability of most Enterococcus species to

Keywords

antibiotic resistance, Enterococcus, food

quality, Lactococcus, Mozzarella di Bufala

Campana, Streptococcus.

Correspondence

Chiara Devirgiliis, INRAN, Via Ardeatina 546,

00178 Rome, Italy. E-mail: [email protected]

2009 ⁄ 1514: received 28 August 2009,

revised 30 November 2009 and accepted

15 December 2009

doi:10.1111/j.1365-2672.2010.04661.x

Abstract

Aims: Microbiological and molecular analysis of antibiotic resistance in Gram-

positive cocci derived from the Italian PDO (Protected Designation of Origin)

dairy food product Mozzarella di Bufala Campana.

Methods and Results: One hundred and seven coccal colonies were assigned

to Enterococcus faecalis, Lactococcus lactis and Streptococcus bovis genera by

ARDRA analysis (amplified ribosomal DNA restriction analysis). Among them,

16 Ent. faecalis, 26 L. lactis and 39 Strep. bovis displayed high minimum inhibi-

tory concentration (MIC) values for tetracycline, while 17 L. lactis showed high

MIC values for both tetracycline and erythromycin. Strain typing and molecu-

lar analysis of the phenotypically resistant isolates demonstrated the presence of

the tet(M) gene in the tetracycline-resistant strains and of tet(S) and erm(B) in

the double-resistant strains. Southern blot analysis revealed plasmid localization

of L. lactis tet(M), as well as of the erm(B) and tet(S) genes. Genetic linkage of

erm(B) and tet(S) was also demonstrated by PCR amplification. Conjugation

experiments demonstrated horizontal transfer to Ent. faecalis strain JH2-2 only

for the plasmid-borne L. lactis tet(M) gene.

Conclusions: We characterized tetracycline-and erythromycin-resistance genes

in coccal species, representing the fermenting microflora of a typical Italian

dairy product.

Significance and Impact of the Study: These results are of particular relevance

from the food safety viewpoint, especially in the light of the potential risk of

horizontal transfer of antibiotic-resistance genes among foodborne commensal

bacteria.

Journal of Applied Microbiology ISSN 1364-5072

ª 2010 INRAN

Journal compilation ª 2010 The Society for Applied Microbiology, Journal of Applied Microbiology 109 (2010) 313–323 313

turn into opportunistic pathogens in immunocompro-

mised individuals, leading to nosocomial infections such

as bacteraemia or endocarditis (Bates 1997; Woodford

1998; Franz et al. 2003). It is therefore of crucial impor-

tance to identify the presence of AbR strains in fermented

foods for human consumption.

Other than enterococci, Gram-positive cocci involved

in manufacturing and preservation of fermented foods

belong to other genera, including Lactococcus and Strepto-

coccus (Liu 2003). Several examples of AbR LAB isolated

from raw meat and from cheese have been recently

reported (reviewed in Mathur and Singh 2005; Ammor

et al. 2007). Genes conferring resistance to tetracycline,

chloramphenicol, erythromycin and vancomycin have

been detected and characterized in Lactococcus lactis

(Perreten et al. 1997) and in enterococci (Giraffa and Sis-

to 1997; Teuber and Perreten 2000; Maietti et al. 2007)

isolated from fermented meat and milk products. Tradi-

tional products typical of mediterranean countries are

particularly rich in live bacteria of environmental origin,

as they do not employ selected industrial starters (Morea

et al. 1998). Such fermented foods can therefore be

considered potential vehicles for the spread of AbR LAB

to consumers through the food chain (Teuber and Perre-

ten 2000).

In our work, aimed at evaluating the presence of AbR

commensal bacteria along the manufacturing process of

the Italian traditional cheese Mozzarella di Bufala

Campana (MBC), we have established a collection of 555

LAB colonies, comprising both lactobacilli and cocci, iso-

lated from MRS (de Man, Rogosa, Sharp) plates contain-

ing tetracycline, erythromycin or kanamycin (Devirgiliis

et al. 2008). In this study, we analyse the coccal compo-

nent of our LAB collection and we report on its taxo-

nomic identity, genotypic diversity and molecular

identification of the genes responsible for the observed

phenotypic resistance to antibiotics.

Materials and methods

Bacterial strains and growth conditions

Bacterial isolation from dairy samples was previously

described (Devirgiliis et al. 2008). All cultures were

routinely grown in MRS, added or not with the antibiot-

ics under study, at 30�C (L. lactis) or 37�C (Ent. faecalis

and Streptococcus bovis) for 24–48 h, under anaerobic

conditions, and stored at )80�C in 15% (v ⁄ v) glycerol.

Enterococcus faecalis JH2-2 (LMG 19456), resistant to

rifampin and fusidic acid, grown in brain heart broth

(Merck, Darmstadt, Germany) at 37�C, was obtained

from the BCCM ⁄ LMG Bacteria Collection, Belgium

(Belgian Co-ordinated collection of Micro-organisms/

Laboratory of Microbiology, Gent University), and was

used as recipient strain in filter matings. Enterococcus

faecalis RE25 (Teuber et al. 2003), kindly provided by

G. Giraffa, Lodi, Italy, was used as positive control of

conjugal transfer.

DNA extraction and molecular analysis

Genomic DNA was extracted and amplified by PCR as

previously described (Devirgiliis et al. 2009). Plasmid

DNA was isolated with the procedure described by

Anderson and McKay (1983). Primers used are listed in

Table 1. Southern hybridization was performed by stan-

dard protocols, using probes labelled with digoxigenin-

11-dUTP (Roche Diagnostics, Milan, Italy).

Species identification by ARDRA and 16S rDNA gene

sequence analysis

The eubacterial P0–P6 primer pair (Table 1) (Invitrogen

Life Technologies, Milan, Italy) was used to amplify16S

rDNA gene fragments. Taxonomic strain identification

Table 1 Primers and conditions used in PCR amplifications

Primer pair Sequence Target gene

Annealing

T (�C)

Amplicon

size (bp) Reference for primers

P0 GAGAGTTTGATCCTGGCT 16S rDNA 55 1500 Di Cello and Fani (1996)

P6 CTACGGCTACCTTGTTAC

tetM-1 GAACTCGAACAAGAGGAAAGC tet(M) 60 740 Olsvik et al. (1995)

tetM-2 ATGGAAGCCCAGAAAGGAT

tetS7-F (FS) TTTGCCAGATGTTTATCAAG tet(S) 50 980 L. Morelli, personal communication

tetS8-R AGGCTCTCATACTGAATG

ermB1 CATTTAACGACGAAACTGGC erm(B) 55 406 Gevers et al. (2003)

ermB2 (RB) GGAACATCTGTGGTATGGCG

ermC-1 ATCTTTGAAATCGGCTCAGG erm(C) 58 294 Jensen et al. (1998)

ermC-2 CAAACCCGTATTCCACGATT

FB TTACCCGCCATACCACAGATGTTCC erm(B)–tet(S) 64 7000 This study

RS CATTTCCCACAATTACTGTCTCCCATTGTTCTGG

Antibiotic-resistant foodborne cocci C. Devirgiliis et al.

314 Journal compilation ª 2010 The Society for Applied Microbiology, Journal of Applied Microbiology 109 (2010) 313–323

ª 2010 INRAN

was performed by the restriction of amplified fragment

with AvaII enzyme (Promega Italia, Milan, Italy). When

necessary, the DNA sequences of the amplified 16S rDNA

fragments were compared with those reported in the

Basic Blast database (Altschul et al. 1997).

Rep-PCR fingerprinting

Rep-PCR was performed with the (GTG)5 primer, as

described elsewhere (Gevers et al. 2001; Devirgiliis et al.

2009).

Minimum inhibitory concentration (MIC)

The broth microdilution method (Klare et al. 2005) was

used to evaluate MICs for each antibiotic, as previously

described (Devirgiliis et al. 2008).

Filter matings

In vitro conjugation experiments were performed as

described by Devirgiliis et al. (2009). Transconju-

gant colonies were recovered following incubation at

37�C for 24–72 h and characterized by Rep-PCR finger-

printing and PCR-based detection of the transferred

genes. Conjugation frequency is expressed as the ratio

between the number of transconjugants and donor

colonies.

Results

Species identification and strain typing

LAB colonies were isolated from raw milk (M) and nat-

ural whey starter cultures employed for fermentation

during the manufacturing process of the Italian tradi-

tional cheese MBC, as previously described (Devirgiliis

et al. 2008). Among these isolates, we selected 177 cocci

for further characterization at the species level. This was

achieved by restriction digestion of PCR-amplified 16S

rDNA (primers in Table 1) with specific endonucleases.

This approach allowed us to identify different species

within the collection, belonging to three genera: Ent.

faecalis, Strep. bovis and L. lactis. Figure 1 shows repre-

sentative ARDRA profiles resulting from digestion of the

amplified 16S rDNA fragments with AvaII, which gave

rise to distinct restriction patterns for each species. As a

control, we used the enzymes Sau3AI, to discriminate

L. lactis from Ent. faecalis and Strep. bovis and AvaI, to

further distinguish Ent. faecalis from Strep. bovis (data

not shown). Using this method, the collection of cocci

was found to contain the following species: 38 Ent.

faecalis (35 of which were isolated on MRS-Ery and 3

on MRS-Kan), 94 L. lactis (40 of which were isolated on

MRS, 21 on MRS-Ery and 33 on MRS-Tet) and 45

Strep. bovis (3 of which were isolated on MRS, 22 on

MRS-Kan and 20 on MRS-Tet). Taken together, these

results show that the majority of coccal colonies were

positively selected by erythromycin (32% of the total)

and tetracycline (30% of the total). Lactococcus lactis was

the most highly represented species (53%), followed by

Strep. bovis (25%) and Ent. faecalis (22%) (Table 2).

Using the rep-PCR technique, we obtained fingerprinting

profiles for all isolates. The dendrograms, constructed

after cluster analysis of the digitized (GTG)5-PCR finger-

prints with the unweighted pair group method with

arithmetic averages, are shown in Fig. 2a–c. The majority

of the observed fingerprinting profiles were unique,

revealing a high degree of biodiversity, which is typical

of traditional products with strong environmental influ-

ence. In particular, the 38 independent isolates of

Ent. faecalis displayed 19 different fingerprinting profiles,

resulting in 50% biodiversity (Fig. 2a and Table 2).

Streptococcus bovis and L. lactis, on the other hand,

M Sb Ef LI M

Figure 1 Species identification. Representative ARDRA profiles of the

three species, obtained by digestion of PCR-amplified 16S rDNA with

AvaII. Sb, Streptococcus bovis; Ef, Enterococcus faecalis; Ll, Lactococ-

cus lactis; M, size markers (Promega), 50-bp step ladder (left) and

1-kb ladder (right).

C. Devirgiliis et al. Antibiotic-resistant foodborne cocci

ª 2010 INRAN


exhibited lower biodiversity (about 30%), with 14 ⁄ 45

and 35 ⁄ 94 rep groups ⁄ total isolates, respectively

(Fig. 2b,c and Table 2).

Phenotypic antibiotic resistance

Each isolate was assayed for MIC for all three antibiot-

ics, irrespective of the selection medium from which

they originated. The resulting MIC values, shown in

Fig. 3 for erythromycin and tetracycline, are plotted as

overall distribution for all coccal isolates, irrespective of

species differences. As shown in the figure, we identified

98 strains (corresponding to 55Æ4% of the total) with

tetracycline MIC values above the breakpoint of 8 mg l)1.

These values, ranging between 16 and >128 mg l)1

(upper limit of test), were distributed in a bell-shaped

curve peaking at 64 mg l)1. The tetracycline MIC values

listed in Fig. 2a–c for each isolate indicate that pheno-

typically resistant strains were present in all three genera.

Among them, the majority (84Æ4%) belonged to

Strep. bovis species, 45Æ7% to L. lactis and 42% to

Ent. faecalis. On the contrary, the majority of erythro-

mycin MIC values were lower than the 4 mg l)1 break-

point, with only 17 isolates, corresponding to 9Æ6% of

the total coccal collection, all displaying the same MIC

value of 128 mg l)1 (Fig. 3b). All 17 erythromycin-resis-

tant isolates belonged to the L. lactis species, as shown

in Fig. 2c. Erythromycin-resistant L. lactis also displayed

64 mg l)1 tetracycline MIC values (framed in Fig. 2c).

Moreover, (GTG)5 fingerprinting analysis showed that

these 17 isolates grouped together, with highly similar

profiles. The erythromycin MIC values of the remaining

isolates of the collection, all below breakpoint, are not

shown in Fig. 2. MIC values for kanamycin are also not

shown, as none of the isolates displayed values above

breakpoint.

Genetic determinants of antibiotic resistance

Total DNA extracted from the phenotypically resistant

strains was PCR-amplified with primers specific for the

tetracycline and erythromycin-resistance genes most

commonly found in LAB, encoding ribosomal protection

proteins [RPP – tet(M), tet(S)] and methylases [erm(B),

erm(C)] (Table 1). In the majority of tetracycline-resistant

strains, we detected the presence of the tet(M) gene

(Fig. 2 and Table 2). In Ent. faecalis and Strep. bovis, the

presence of tet(M) determined MIC values between 16

and 64 mg l)1 (Fig. 2a,b and Table 2), with the exception

of one isolate of Strep. bovis with an MIC of 8 mg l)1

(equal to breakpoint). All isolates belonging to these two

species were susceptible to erythromycin. In L. lactis, we

detected the tet(M) gene in strains displaying tetracycline

MIC values within the range 64 to >128 mg l)1 (Fig. 2c

and Table 2). However, all isolates, within the 17 L. lactis

group phenotypically resistant to both antibiotics, shared

the same MIC value for tetracycline (64 mg l)1) and

erythromycin (128 mg l)1). These isolates were all shown

to harbour the tet(S) and erm(B) genes, while PCR ampli-

fication of the tet(M) and erm(C) genes was negative. To

investigate a possible association between erm(B) and

tet(S) genes in L. lactis, we used a PCR strategy that could

reveal, if the two genes are linked, also their orientations

relative to each other (Fig. 4a and Table 1). As shown in

Fig. 4b, we obtained the amplification of an intervening

7-kb fragment when using primer pair I (Fig. 4a and

Table 1), indicating that the two genes are indeed linked

and with the same 5¢–3¢ orientation. Previous reports

have indicated that erm genes are frequently linked to van

genes, conferring resistance to vancomycin (Jensen et al.

1998; Manson et al. 2003). However, determination of the

MIC values for vancomycin in these isolates showed that

all erm(B)-positive strains were vancomycin susceptible,

Table 2 Main features of coccal isolates

Species*

Total

rep-groups Source� Isolation medium* AbR*,�

Resistance

gene MIC range (mg l)1)

Enterococcus faecalis (38) 19 M, NWSC MRS-Ery (35) Tet (16) tet(M) 16–64

NWSC MRS-Kan (3)

Lactococcus lactis (94) 35 M, NWSC MRS (40) Tet (7) tet(M) 128

M MRS-Ery (21) Tet, Ery (17) tet(S) erm(B) 64 (tet); 128 (ery)

M, NWSC MRS-Tet (33) Tet (19) tet(M) 64 to >128

Streptococcus bovis (45) 14 M MRS (3) Tet (3) tet(M) 8–32

M, NWSC MRS-Kan (22) Tet (17) tet(M) 16–64

M, NWSC MRS-Tet (20) Tet (19) tet(M) 16–64

MIC, minimum inhibitory concentration.

*The number of isolates is reported in brackets.

�Source: M, raw water buffalo milk; NWSC, natural whey starter cultures.

�AbR, antibiotic-resistant isolates.



ª 2010 INRAN

with MIC values of 2 mg l)1 (data not shown). Table 2

summarizes the main features of the AbR Ent. faecalis,

L. lactis and Strep. bovis isolates. Three representative iso-

lates for each species, with distinct fingerprinting profiles,

were subjected to Southern hybridization with specific

tet(M), tet(S) or erm(B) probes. The tet(S) and erm(B)

genes in L. lactis, as well as the tet(M) genes in L. lactis,

Strep. bovis and Ent. faecalis, were all present in single

copy, as they showed a single positive hybridization band

on filters containing HindIII-digested genomic DNA

(Fig. 5, lanes 1, 3, 5, 7, 8). Furthermore, in the case of

L. lactis tet(S), erm(B) and tet(M), all three resistance

Pearson correlation (Opt: 0·35%) [0·0%–100·0%]GTG5

100

94·5

89·3

84·1

79·2

86·6

97·4

74·8

68·6 83·7

90·2

96·1

95·595

88·7

83·3

62·6

97·9

95·9

94·6

90·1

89·9

94·1

92

88·1

78·6

48·1

25·5

81·5

75·6

66·190·7

85·8 98

94·2

92·1

8983·4

90807060504030

GTG5

ID

1283 M 32 +

+++

+

++

+

+++++

+

++

–

–––––

–

–

–––––

––––

–

–

–

––

321664

222

222222

2

2

22222

2222

2

2

32

32

32323232

3232

64

64

16

16

MMMMMMMMMNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSC

NWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCMMMMM

12851282128112871289129312921296129813511353137013711373107213761380137413751378137713791367

13681369136513661364136313621361135212881291129913001284

Source MIC Tet tet (M)

Figure 2 Strain typing by rep-PCR. Composite figure of (GTG)5-PCR fingerprints of the Enterococcus faecalis (a), Streptococcus bovis (b),

Lactococcus lactis (c) isolates from raw milk or natural whey starter cultures samples. The dendrograms were constructed after cluster analysis of

the digitized (GTG)5-PCR fingerprints with the unweighted pair group method with arithmetic averages. Correlation levels are expressed as per-

centage of the Pearson correlation coefficient. Numerical designations indicate the ID number of each isolate. Minimum inhibitory concentration

values are expressed as mg l)1, and the presence ⁄ absence of the indicated antibiotic-resistant genes were determined by PCR analysis. The vertical

dotted line indicates 90% correlation (minimum level of reproducibility).


ª 2010 INRAN


genes appeared to reside on plasmids, as positive signals

were detected in Southern hybridizations with purified

plasmid DNA preparations (Fig. 5, lanes 2, 4, 6).

To test whether any of the identified AbR genes could

be horizontally transferred, we performed conjugal trans-

fer experiments using Ent. faecalis JH2-2 as recipient

ID

1253 M32

32

32

32

323232

32

3232

3232

3232

3232

16

16

16

++++++++++++++

+

+++++++

+++++++++++

+++++

+

–

–

––

–

–

1616

16

16

1616

1616161616

8

2

2

22

2

2

6464

64646464

64

64

MMMMMMMMNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCMMMMMMMMMMMMMMMMMMM

13191317132012801316127612791271135713581398139914001395135413561350134313451347138413921349134213481059106110581064105010511052105310571278131512691273127712591268127012611252


Pearson correlation (Opt: 0·68%) [0·0%–100·0%]GTG5 GTG5

100

70·9

86·4

67·6

79·8 96·7

96·7

97·291·8

97·5

99·496·8

91·1

48·1

7·6

98·998·4

88·698

99.498·697·1

79·995·6

99.4

97·4

78·4

96·2

96·1

92·5

87·3 97·7

96·9

98·296·1

92·6

88·5

79·2 97·6

73·5 97·7

9591·9

90·2

76·3

80604020

Figure 2 (Continued)



ª 2010 INRAN

GTG5 GTG5ID

1303 M >128 +++++++++++++

+++++++

+

––––

––

–––––––––––

–––––––––––––––––––

––

–––––––––––––– +

tet (S) MIC Ery erm (B)

128128128128128128128128128128128128128128128128128

++++++++++++++++

+++++++++++++++++

––––––––––––––––

+++

+

+

>128

>128>128

128

128128128

128128

128

128128128128128128128

>128

64

64

2222

2

22

2

2

222

222222222222222

22

2222222222222

6464646464646464646464646464646464

>128>128

128

64

4

44

444

44

128

2

MMMMMMMMMMMMM

MMMMMMMMMM

M

M

MMMMMMMMMMMMM

M

MM

M

M

MMMMMMMMMMMMMMMMM

NWSCNWSCNWSC

NWSC

NWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSC

NWSCNWSCNWSCNWSC

NWSC

NWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSCNWSC

NWSC

1304130713011302130813091312131313181314131013111290132213311338125412551256125812491305130612471248128613811257138613871389139013911393139413961397124113831385138213881294129712511246996999

1000993995992994

9971004

13231260104810491046132113241325132913351333133413301336132613271328133913401295133710291031103810301039104310261044103610371040104210281034103310321056


20 40 60 80 100

Figure 2 (Continued)


ª 2010 INRAN


strain and three representative isolates for each species as

donors. The results of such filter mating experiments

showed that only plasmid-borne tet(M) from L. lactis was

transferred to Ent. faecalis at relatively high frequency

(2 · 10)5). Molecular typing of two independent trans-

conjugants obtained from such matings was performed by

(GTG)5 fingerprinting, as shown in Fig. 6. Comparison of

the resulting profiles with those of the donor and recipi-

ent strains confirms that horizontal transfer of the tetra-

cycline-resistance determinant present in L. lactis tet(M)

could confer tetracycline resistance to Ent. faecalis.

Discussion

In this study, we report the microbiological characteriza-

tion and the antibiotic resistance of a collection of 177

cocci isolated from the raw ingredients employed in man-

ufacturing of the Italian cheese MBC. Molecular analysis

of phenotypically resistant strains showed that tetracycline

and erythromycin MIC values above breakpoints were

always associated with the presence of genetic determi-

nants of antibiotic resistance. A total of 81 tetracycline-

resistant Ent. faecalis, Strep. bovis and L. lactis harboured

the tet(M) gene, confirming that it is the most common

tetracycline-resistance determinant among LAB (Ammor

et al. 2007). This gene was also reported as the most

frequent in AbR LAB isolated from poultry and swine

meat products (Aquilanti et al. 2007).

Our results show chromosomal localization of tet(M)

in the Ent. faecalis and Strep. bovis tetracycline-resistant

strains, while in the case of L. lactis the gene is likely

carried by a yet unidentified plasmid. The presence of

tet(M) in Ent. faecalis did not appear to be specifically

selected by tetracycline, as tetracycline-resistant isolates

were collected almost exclusively from erythromycin-con-

taining MRS plates. On the other hand, tet(M)-positive

L. lactis and Strep. bovis were positively selected by the

initial plating conditions, as the majority of them were

isolated on MRS-Tet plates. Tetracycline resistance in

Ent. faecalis was described in several reports (Huys et al.

2004; Rizzotti et al. 2005; Wilcks et al. 2005), while only

few studies have been published in L. lactis. Florez et al.

(2008) identified and characterized two tet(M)-positive

L. lactis strains isolated from a raw milk, starter-free

traditional cheese. On the contrary, no data are available

to our knowledge on tetracycline resistance in Strep. bovis.

Up to now, investigations were mainly focused on

pathogenic streptococci, such as Streptococcus pyogenes or

Tetracycline

Erythromycin

*

*2

807060504030

N is

olat

es

2010

0

807060504030N

isol

ates

2010

0

4 8 16 32 64

MIC (mg l–1)

MIC (mg l–1)

0·25 0·5 1 2 4 8 16 128

128 >128

(a)

(b)

Figure 3 Minimum inhibitory concentration (MIC) distribution. Bars

represent the number of isolates displaying the same MIC value,

expressed as mg l)1, for tetracycline (panel a) and erythromycin

(panel b). The data reported in each panel refer to all isolates,

rrespective of the species. Asterisks indicate antibiotic breakpoint con-

centrations added to the isolation medium.

I(a)

(b)

erm(B) tet(S)

RS

RS

FS

FB

erm(B) tet(S)

RB

erm(B)

erm(B)

MKb8-

6-

I II III IV

tet(S)

tet(S)

RB

FSFB

II

III

IV

Figure 4 Association between Lactococcus lactis erm(B) and tet(S)

genes. (a) Graphical representation of the PCR strategy employed to

investigate physical association of the erm(B) and tet(S) genes. Large

arrows represent the two genes in all possible orientations (I–IV), and

primer pairs are indicated by small arrows. F, forward primers; R,

reverse primers. (b) Agarose gel electrophoresis of PCR products

obtained with primer pairs I–IV. M, DNA molecular weight marker.



ª 2010 INRAN

Streptococcus pneumoniae (Widdowson and Klugman

1999; Brenciani et al. 2007), and the presence of the

tet(M) gene was recently reported in group A streptococci

(Ayer et al. 2007). Our results therefore provide impor-

tant insights for better understanding of AbR selection in

this species.

Erythromycin-resistant isolates all belonged to the

L. lactis species and represented a minor percentage of

the total coccal collection (9Æ6%). Moreover, all of them

were derived from the same batch of raw milk from a

single cheese factory, and the analysis of fingerprinting

profiles revealed that they belong to a few, very similar

strain types that represent a distinct branch of the den-

drogram. Molecular analysis of the AbR genes in these

isolates showed that, along with the erythromycin-resis-

tance methylase erm(B), they also harboured the RPP

gene tet(S), conferring resistance to tetracycline up to

64 mg l)1. All of these isolates have been selected by

erythromycin in the isolation medium, and they were

never subjected to selective pressure by tetracycline, sug-

gesting that the two antibiotic-resistance determinants

were somehow associated. PCR amplification with specifi-

cally designed primers confirmed that the erm(B) and

tet(S) genes in such isolates are linked through an inter-

vening 7-kb region and showed that they share the same

transcriptional orientation. Moreover, Southern blot

analysis revealed that the two genes are plasmid borne.

However, neither of the genes could be horizontally trans-

ferred by conjugation to the Ent. faecalis JH2-2 recipient

strain. The only other report that we are aware of,

describing association between these two genes in L. lactis,

was recently published by Walther et al. (2008). They

describe L. lactis isolates from bovine milk harbouring

tet(S), tet(M) or erm(B) genes, one of which contained

both tet(S) and erm(B). Previous reports described other

genetic associations, such as that of tet(S) and mdt(A),

which confers resistance to macrolides and tetracycline, in

L. lactis strain K214 isolated from a raw milk soft cheese

(Perreten et al. 1997, 2001).

Probes:

Probes: 16S 9 10 11 12 13 14 15 16

tet(S)

1 2 3 4 5 6 7 8

erm(B) tet(M)

Figure 5 Genomic localization of resistance genes. Southern blot

analysis of HindIII-digested genomic DNA (lanes 1, 3, 5, 7, 8, 9, 11,

13, 15, 16) and undigested plasmid DNA (lanes 2, 4, 6, 10, 12, 14),

probed with tet(S) (lanes 1, 2), erm(B) (lanes 3, 4), tet(M) (lanes 5–8),

16S rDNA (lanes 9–16). DNA was extracted from: Lactococcus lactis

(lanes1–6 and 9–14); Streptococcus bovis (lanes 7, 15); Enterococcus

faecalis (lanes 8, 16).

1 2 D R – M

tet(M) + + + –

Figure 6 Molecular analysis of transconjugant colonies derived from

Lactococcus lactis (tetM) – Enterococcus faecalis JH2-2 matings.

GTG5-PCR fingerprinting patterns of: (lanes 1–2) two independent

transconjugants; (D) donor L. lactis (tetM); (R) recipient Ent. faecalis

JH2-2. ), negative control; M, DNA molecular weight marker. The

presence or absence of the tet(M) gene is indicated at the bottom.


ª 2010 INRAN


Efficient gene transfer by conjugation is indicative of

the presence of either plasmids or mobile elements such

as transposons (Beaber et al. 2002; Pembroke et al. 2002;

Teuber et al. 2003; Alekshun and Levy 2007). Consis-

tently, we observed high transfer efficiency of plasmid-

borne L. lactis tet(M) to Ent. faecalis. However, our data

on the low efficiency, or lack of transfer of Ent. faecalis

and Strep. bovis tet(M), as well as of the erm(B) and tet(S)

genes of L. lactis, suggest their presence within genetic

contexts lacking mobile elements or in nonconjugative

plasmids. However, in vitro conjugal transfer is not

necessarily indicative of the in vivo situation; therefore,

we cannot directly extrapolate these results to the fre-

quency of horizontal transfer potentially occurring among

species. Moreover, we cannot exclude that species barriers

might have impaired in vitro conjugal transfer in some

cases. We have previously reported the analysis of about

300 Lactobacillus isolates from the Italian dairy product

MBC and from the raw ingredients employed for its man-

ufacturing (Devirgiliis et al. 2008). The results presented

here complete the analysis of the two predominant micro-

bial groups (lactobacilli and cocci) that constitute the fer-

menting microflora in this product and allow comparison

of their features with respect to antibiotic resistance. Con-

sidering the total microbial community, composed of 555

lactobacilli and cocci (Devirgiliis et al. 2008), AbR cocci

represented 17Æ6% of the total bacteria found in MBC

samples (14Æ6% comprising tetracycline-resistant isolates

and 3% comprising erythromycin-resistant isolates). This

value is higher than that observed for AR lactobacilli

(3Æ8% of the total bacteria), all displaying tetracycline

resistance (Devirgiliis et al. 2008). Such resistant species

most likely reflect the persistence of AR bacteria in the

environment and probably relate to the use and misuse of

antibiotics in human therapy and animal farming.

Noteworthy, tetracycline- and ⁄ or erythromycin-resistant

species were found exclusively in isolates from the raw

ingredients employed for MBC production, while absent

in the final processed cheese. This result is of particular

relevance from the food safety viewpoint, as it points to a

major role of technological procedures employed in

cheese production in influencing the composition of fer-

menting microflora and, as a consequence, also in affect-

ing the occurrence of AbR species.

Acknowledgements

The Authors thank Kariklia Pascucci for her kind support

in daily lab work. We are grateful to Consorzio MBC

(http://www.mozzarelladop.it) for cooperation in the col-

lection of samples. This work was supported by grant

ARAFOA (DM 662 ⁄ 7303 ⁄ 2003) from the Italian Ministry

of Agriculture, Food & Fisheries (MiPAAF).

References

Alekshun, M.N. and Levy, S.B. (2007) Molecular mechanisms

of antibacterial multidrug resistance. Cell 128, 1037–1050.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang,

Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST

and PSI-BLAST: a new generation of protein database

search programs. Nucleic Acids Res 25, 3389–3402.

Ammor, M.S., Florez, A.B. and Mayo, B. (2007) Antibiotic

resistance in non-enterococcal lactic acid bacteria and bifi-

dobacteria. Food Microbiol 24, 559–570.

Anderson, D.G. and McKay, L.L. (1983) Simple and rapid

method for isolating large plasmid DNA from lactic strep-

tococci. Appl Environ Microbiol 46, 549–552.

Aquilanti, L., Garofalo, C., Osimani, A., Silvestri, G., Vignaroli,

C. and Clementi, F. (2007) Isolation and molecular charac-

terization of antibiotic-resistant lactic acid bacteria from

poultry and swine meat products. J Food Prot 70, 557–565.

Ayer, V., Tewodros, W., Manoharan, A., Skariah, S., Luo, F.

and Bessen, D.E. (2007) Tetracycline resistance in group a

streptococci: emergence on a global scale and influence on

multiple-drug resistance. Antimicrob Agents Chemother 51,

1865–1868.

Bates, J. (1997) Epidemiology of vancomycin-resistant entero-

cocci in the community and the relevance of farm animals

to human infection. J Hosp Infect 37, 89–101.

Beaber, J.W., Burrus, V., Hochhut, B. and Waldor, M.K.

(2002) Comparison of SXT and R391, two conjugative

integrating elements: definition of a genetic backbone for

the mobilization of resistance determinants. Cell Mol Life

Sci 59, 2065–2070.

Brenciani, A., Bacciaglia, A., Vecchi, M., Vitali, L.A., Varaldo,

P.E. and Giovanetti, E. (2007) Genetic elements carrying

erm(B) in Streptococcus pyogenes and association with

tet(M) tetracycline resistance gene. Antimicrob Agents

Chemother 51, 1209–1216.

Devirgiliis, C., Caravelli, A., Coppola, D., Barile, S. and Perozzi,

G. (2008) Antibiotic resistance and microbial composition

along the manufacturing process of Mozzarella di Bufala

Campana. Int J Food Microbiol 128, 378–384.

Devirgiliis, C., Coppola, D., Barile, S., Colonna, B. and Perozzi,

G. (2009) Characterization of the Tn916 conjugative trans-

poson in a food-borne strain of Lactobacillus paracasei.

Appl Environ Microbiol 75, 3866–3871.

Di Cello, F. and Fani, R. (1996) A molecular strategy for the

study of natural bacterial communities by PCR-based tech-

niques. Minerva Biotecnol 8, 126–134.

Florez, A.B., Ammor, M.S. and Mayo, B. (2008) Identification

of tet(M) in two Lactococcus lactis strains isolated from a

Spanish traditional starter-free cheese made of raw milk

and conjugative transfer of tetracycline resistance to lacto-

cocci and enterococci. Int J Food Microbiol 121, 189–194.

Franz, C.M., Stiles, M.E., Schleifer, K.H. and Holzapfel, W.H.

(2003) Enterococci in foods – a conundrum for food

safety. Int J Food Microbiol 88, 105–122.



ª 2010 INRAN

Gevers, D., Huys, G. and Swings, J. (2001) Applicability of

rep-PCR fingerprinting for identification of Lactobacillus

species. FEMS Microbiol Lett 205, 31–36.

Gevers, D., Danielsen, M., Huys, G. and Swings, J. (2003)

Molecular characterization of tet(M) genes in Lactobacillus

isolates from different types of fermented dry sausage. Appl

Environ Microbiol 69, 1270–1275.

Giraffa, G. and Sisto, F. (1997) Susceptibility to vancomycin of

enterococci isolated from dairy products. Lett Appl Micro-

biol 25, 335–338.

Huys, G., D’Haene, K., Collard, J.M. and Swings, J. (2004)

Prevalence and molecular characterization of tetracycline

resistance in Enterococcus isolates from food. Appl Environ

Microbiol 70, 1555–1562.

Jensen, L.B., Ahrens, P., Dons, L., Jones, R.N., Hammerum,

A.M. and Aarestrup, F.M. (1998) Molecular analysis of

Tn1546 in Enterococcus faecium isolated from animals and

humans. J Clin Microbiol 36, 437–442.

Klare, I., Konstabel, C., Muller-Bertling, S., Reissbrodt, R.,

Huys, G., Vancanneyt, M., Swings, J., Goossens, H. et al.

(2005) Evaluation of new broth media for microdilution

antibiotic susceptibility testing of Lactobacilli, Pediococci,

Lactococci, and Bifidobacteria. Appl Environ Microbiol 71,

8982–8986.

Liu, S.Q. (2003) Practical implications of lactate and pyruvate

metabolism by lactic acid bacteria in food and beverage

fermentations. Int J Food Microbiol 83, 115–131.

Maietti, L., Bonvini, B., Huys, G. and Giraffa, G. (2007) Inci-

dence of antibiotic resistance and virulence determinants

among Enterococcus italicus isolates from dairy products.

Syst Appl Microbiol 30, 509–517.

Manson, J.M., Keis, S., Smith, J.M. and Cook, G.M. (2003) A

clonal lineage of VanA-type Enterococcus faecalis predomi-

nates in vancomycin-resistant Enterococci isolated in New

Zealand. Antimicrob Agents Chemother 47, 204–210.

Mathur, S. and Singh, R. (2005) Antibiotic resistance in food

lactic acid bacteria – a review. Int J Food Microbiol 105,

281–295.

Morea, M., Baruzzi, F., Cappa, F. and Cocconcelli, P.S. (1998)

Molecular characterization of the Lactobacillus community

in traditional processing of Mozzarella cheese. Int J Food

Microbiol 43, 53–60.

Olsvik, B., Olsen, I. and Tenover, F.C. (1995) Detection of

tet(M) and tet(O) using the polymerase chain reaction in

bacteria isolated from patients with periodontal disease.

Oral Microbiol Immunol 10, 87–92.

Pembroke, J.T., MacMahon, C. and McGrath, B. (2002) The

role of conjugative transposons in the Enterobacteriaceae.

Cell Mol Life Sci 59, 2055–2064.

Perreten, V., Schwarz, F., Cresta, L., Boeglin, M., Dasen, G.

and Teuber, M. (1997) Antibiotic resistance spread in

food. Nature 389, 801–802.

Perreten, V., Schwarz, F.V., Teuber, M. and Levy, S.B. (2001)

Mdt(A), a new efflux protein conferring multiple antibiotic

resistance in Lactococcus lactis and Escherichia coli. Antimic-

rob Agents Chemother 45, 1109–1114.

Rizzotti, L., Simeoni, D., Cocconcelli, P., Gazzola, S.,

Dellaglio, F. and Torriani, S. (2005) Contribution of

enterococci to the spread of antibiotic resistance in the

production chain of swine meat commodities. J Food

Prot 68, 955–965.

Teuber, M. (2001) Veterinary use and antibiotic resistance.

Curr Opin Microbiol 4, 493–499.

Teuber, M. and Perreten, V. (2000) Role of milk and meat

products as vehicles for antibiotic-resistant bacteria. Acta

Vet Scand Suppl 93, 75–87; discussion 111–117.

Teuber, M., Schwarz, F. and Perreten, V. (2003) Molecular

structure and evolution of the conjugative multiresistance

plasmid pRE25 of Enterococcus faecalis isolated from a

raw-fermented sausage. Int J Food Microbiol 88, 325–329.

Walther, C., Rossano, A., Thomann, A. and Perreten, V.

(2008) Antibiotic resistance in Lactococcus species from

bovine milk: presence of a mutated multidrug transporter

mdt(A) gene in susceptible Lactococcus garviae strains. Vet

Microbiol 131, 348–357.

Wegener, H.C. (2003) Antibiotics in animal feed and their role

in resistance development. Curr Opin Microbiol 6, 439–

445.

Widdowson, C.A. and Klugman, K.P. (1999) Molecular mech-

anisms of resistance to commonly used non-betalactam

drugs in Streptococcus pneumoniae. Semin Respir Infect 14,

255–268.

Wilcks, A., Andersen, S.R. and Licht, T.R. (2005) Characteriza-

tion of transferable tetracycline resistance genes in Entero-

coccus faecalis isolated from raw food. FEMS Microbiol Lett

243, 15–19.

Woodford, N. (1998) Glycopeptide-resistant enterococci: a

decade of experience. J Med Microbiol 47, 849–862.


ª 2010 INRAN


Copyright of Journal of Applied Microbiology is the property of Wiley-Blackwell and its content may not be

copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written

permission. However, users may print, download, or email articles for individual use.

Identification of tetracycline- and erythromycin-resistant Gram-positive cocci within the fermenting...

Documents

Transcript of Identification of tetracycline- and erythromycin-resistant Gram-positive cocci within the fermenting...