lable at ScienceDirect

ARTICLE IN PRESS

European Journal of Soil Biology xxx (2009) 1–8

Contents lists avai

European Journal of Soil Biology

journal homepage: ht tp: / /www.elsevier .com/locate/e jsobi

Original article

Identification of plant genes involved on the initial contact betweenectomycorrhizal symbionts (Castanea sativa – European chestnut and Pisolithustinctorius)

Monica Sebastiana a,*, Andreia Figueiredo a, Bartolomeu Acioli a,1, Lisete Sousa b, Fernando Pessoa a,Aladje Balde a, Maria Salome Pais a

a Plant Molecular Biology & Biotechnology Lab, Centre for Biodiversity, Functional & Integrative Genomics, FCUL, Campo Grande, 1749-016 Lisboa, Portugalb Department of Statistics and Operational Research, CEAUL, FCUL, Campo Grande, 1749-016 Lisboa, Portugal

a r t i c l e i n f o

Article history:Received 18 June 2008Received in revised form22 December 2008Accepted 5 February 2009Available online xxx

Keywords:Castanea sativacDNA microarrayDifferentially expressedEctomycorrhiza (ECM)Pisolithus tinctorius

* Corresponding author. Tel.: þ351 21 7500163; faxE-mail addresses: mgsebastiana@fc.ul.pt, m

(M. Sebastiana).1 Present address: Dep. Micologia, Univ Federal de

Chaves s/n, Cidade Universitaria, 50670-420, Recife, P

1164-5563/$ – see front matter � 2009 Elsevier Massdoi:10.1016/j.ejsobi.2009.02.001

Please cite this article in press as: SebastianaSoil Biol. (2009), doi:10.1016/j.ejsobi.2009.0

a b s t r a c t

In order to contribute to the knowledge on the genes involved in the early steps of ectomycorrhizadevelopment, the transcriptional response of Castanea sativa (European chestnut) during the initialcontact (6 and 12 h) with Pisolithus tinctorius was analysed by microarray. This study revealed thatamong the regulated plant genes, a substantial number of up-regulated transcripts showed homologywith genes encoding for proteins involved in stress and defense responses, (a cystatin, a cystatin-likeprotein, a defensin and a universal stress protein). Early contact with the fungal mycelium also alteredexpression of genes that are putatively involved in cellular processes like signal transduction andcommunication (receptor kinase-related protein), protein fate (papain-like cystein proteinase), and watertransport facilitation (water channel MipK protein). Expression profiling of the early contact betweenC. sativa and P. tinctorius revealed that changes in gene expression occur few hours after contact, longbefore the development of a functional mycorrhiza. The induction of genes involved in stress and defensesuggests that the host plant reacts rapidly to the presence of the mycobiont eliciting a defense pro-gramme similar to that described for pathogenic interactions. Another plant response was the repressionof genes normally implicated in water stress accounting for a water stress relief due to the initial contactwith the ectomycorrhizal fungus.

� 2009 Elsevier Masson SAS. All rights reserved.

1. Introduction

Mycorrhizas are mutually beneficial associations between plantroots and highly specialised root-inhabiting fungi. The functionalbasis of mycorrhizal symbiosis is the exchange of fungus-derivedmineral nutrients with plant-derived carbohydrates. In temperateand boreal forests ectomycorrhizas (ECM) serve as a major organfor nutrient uptake by trees, and it is estimated that up to 95% of theshort roots in these ecosystems form ECM [1]. This symbiosis isessential for the stability of forest ecosystems protecting the rootsystem from pathogen attack and from adverse abiotic soil condi-tions like water stress [1]. The development of an ECM rootcomprises four stages: pre-infection, initiation, differentiation and

: þ351 21 7500172.onicasebastiana@gmail.com

Pernambuco, Av. Prof. NelsonE, Brazil

on SAS. All rights reserved.

et al., Identification of plant g2.001

functioning [2]. In the pre-infection stage both partners exchangesignals in the soil leading to the determination of compatibility forsymbiosis. Once mutually recognized, root and fungal hyphae growtowards each other and establish physical contact (initiation). Next,the fungal hyphae grow and differentiate within the root cortex(differentiation) forming a functional mycorrhiza, a multicellularstructure where nutrient exchange between the symbionts takesplace (functioning).

The development of ECM symbiosis is a highly regulated processinvolving morphological and physiological changes that areaccompanied by alterations on gene expression in both partners[3]. Gene profiling studies led to the identification of hundreds oftranscripts that are preferentially expressed in symbiotic tissuesand that are involved in cellular functions like fungal cell divisionand proliferation, differentiation and signalling, synthesis of cellwall and extracellular matrices, plant defense or stress responsesand primary metabolism (e.g. glycolytic respiration, amino acidbiosynthesis, and the activity of transporters) [4]. These studiesconfirmed that changes in morphology associated with ECM

enes involved on the initial contact between ectomycorrhizal..., Eur. J.

M. Sebastiana et al. / European Journal of Soil Biology xxx (2009) 1–82

ARTICLE IN PRESS

development were accompanied by changes in gene expressionthat commenced at the time of contact between the two partners,long before the formation of a functional mycorrhiza.

The pre-symbiotic phase of ECM development, as been one of theless studied. However, the dynamic events during the early stages ofinteraction are crucial in determining the direction and ultimatesuccess of the formation of a symbiotic association [5]. Mutual signalexchange (via diffusible rhizospheric molecules) between the hostplant and the mycobiont triggers the ECM developmental process[5]. The nature of the signalling molecules and the molecular basis ofsignal perception and transduction are unknown but it is clear thatthe mycobiont alters auxin-regulated developmental pathways,meristematic activity and cell shape through the action of secretedmolecules, such as auxins and hypaphorin [3,5]. The identification ofhost regulated genes involved in auxin metabolism, calcium sig-nalling pathways and transcriptional regulation, supports thishypothesis [6–9]. Most studies analysing transcription in ECMdevelopment have been focused on the colonization events thatcomprise the period that spans from mantle formation (several daysof contact) to fully differentiated mycorrhizas [6–10]. A few studieshave been dedicated to the pre-mycorrhizal phase, and most ofthem analyse gene expression in the fungal partner [11–13].Recently, plant transcriptional changes during the pre-mycorrhizalphase of ECM development have been reported in oak and revealedan increased expression of plant genes related to defense response,signal perception, water regulation and cell rescue functions,whereas genes involved in metabolism were down-regulated [14].However, there is still limited information about the pre-infectionevents when symbiotic partners establish first contact. In thepresent work, we investigated the regulation of plant geneexpression during the first hours of interaction (6 and 12 h) betweenCastanea sativa and Pisolithus tinctorius since alterations in geneexpression at this stage may be related to recognition betweensymbiotic partners and probably influence the outcome of thesymbiosis [3]. C. sativa Mill. (European Chestnut; Sweet Chestnut) isan ecologically and economically important European forestspecies, particularly in the Mediterranean region, where it is culti-vated for fruit and timber production. There are reports showingthat early mycorrhizal inoculation of European Chestnut seedlingsand micropropagated plants improves the general condition ofplants [15,16], and protects plants against ink disease [17], that wasresponsible for major epidemics in Europe and North America.P. tinctorius is a widespread ECM basidiomycete forming ectomy-corrhizas with a variety of hosts [18], including C. sativa [15,16]. Ithas been widely used in forestry inoculation programs, and incommercial mycorrhizal inoculum production. The fact that it canbe easily grown in vitro, and the simplicity of ECM synthesis undercontrolled conditions with a range of host plants, has ensured fulldocumentation of the ontogeny and ultrastructure of P. tinctoriusECM [18]. Developmental and functional aspects of P. tinctoriusECMs are well documented and thus it has been adopted as a modelorganism for investigations of the molecular basis of ECM interac-tions [18]. Symbiotic interactions involving a broad host rangefungus like P. tinctorius are very interesting to a broader audience ofsoil biologist and ecologists, as well as agronomists, since thisfungus can interact with many forest and park trees and canconstitute an important tool in commercial tree production andreforestation approaches.

2. Materials and methods

2.1. Biological material, media and culture conditions

Maintenance of biological material and establishment of plant–fungus contact were performed as described by Baptista et al. [19].

Please cite this article in press as: Sebastiana et al., Identification of plant gSoil Biol. (2009), doi:10.1016/j.ejsobi.2009.02.001

Briefly, C. sativa seeds were germinated using a hydroponic system.P. tinctorius (Pers.) Coker and Couch isolate 289/Marx was main-tained on MMN solid medium [20]. Liquid cultures were obtainedby transferring pieces of mycelium from solid to liquid (250 ml)MMN medium (half concentration of KH2PO4 and (NH4)2HPO4, nomalt extract) in tissue culture flasks. Liquid cultures were main-tained by substituting the medium every month. Interactionbetween C. sativa and P. tinctorius was established in hydroponicsby randomly transferring previously washed mycelium to the flaskscontaining the seedlings (4 months old). Like in the system previ-ously described [19], the roots of the seedlings used in this workbecame totally covered with fungal mycelium. Early contact wasconsidered as defined before by Baptista et al. [19], who observedadhesion of hyphae to the root surface 2 h after plant–funguscontact. The sampling time points for the present work (6 h and12 h) were, thus, defined based on those results. Mock inoculationswere done with sterile water. Inoculated and control roots (wholeroot system) were harvested 6 h and 12 h after contact with fungalmycelium. Mock-inoculated controls were sampled simulta-neously. About 25 inoculated or control roots were collected at eachtime point. The roots were individually snap-frozen in liquidnitrogen and stored at �80 �C. Prior to RNA extraction, roots weregrouped into two (6 h) or three (12 h) pools with an average of 10roots, which constituted biological replicates.

2.2. RNA extraction and cDNA library construction

Total RNA from 6 h and 12 h inoculated and control roots wasisolated using the hot borate method [21]. mRNA was purified usingthe NucleoTrap mRNA purification kit (BD Clontech, PaloAlto, CA,USA). cDNA library was constructed from mRNA using the SMARTcDNA Library Construction Kit (BD Clontech).

2.3. cDNA microarray, labelling and hybridization analysis

Randomly collected library clones were PCR amplified, andinserts longer than 400 bp and amplified as a single band wereselected (2000 cDNAs). Amplified cDNA clones were purified onmultiscreen PCR plates (Milipore, Bedford, MA, USA), transferred to96-well microplates (Corning, NY, USA), resuspended in printingbuffer (50% DMSO, 0.4% SSC) and printed (in duplicate) on poly-L-lysine coated slides using a VersArray ChipWriter Compact System(BioRad, CA, USA). The following genes and known sequences werealso included as internal quality controls: a C. sativa actin gene,lambda DNA, and salmon sperm DNA. DNA was cross-linked to theslides by U.V. irradiation according to protocol from Vodkin labo-ratory (http://soybeangenomics.cropsci.uiuc.edu/). Spot andprinting quality were assessed by staining with GelStar (FMC,Rockland, ME). Microarray hybridization was performed using two(6 h after contact) and three (12 h after contact) biological repli-cates, grown using the same setup and parameters. One hundredmicrograms of total RNA, from inoculated and control roots, wereused to synthesize Cy5- or Cy3-cDNA targets by reverse tran-scription primed with Oligo(dT) primer, according to Nikula et al.[22]. RNA was degraded by incubating at 65 �C for 30 min after theaddition of 10 mg of RNase A. Labelled cDNA probes were combinedand purified with the QIAquick PCR Purification kit (Qiagen).

Blocking of slides, hybridization and post-hybridization washeswere performed according to Nikula et al. [22]. Slides were scannedat a 5 mm resolution using a VersArray ChipReader� (BioRad, USA).Laser power and detector sensitivity were adjusted to obtain anequal distribution of signal intensities for both channels on eachslide. Spot and background intensities were quantified with Ver-sArray Analyser software (BioRad). Data files were imported intoGEPAS (http://gepas.org), and analysed with DNMAD (Diagnosis

enes involved on the initial contact between ectomycorrhizal..., Eur. J.

M. Sebastiana et al. / European Journal of Soil Biology xxx (2009) 1–8 3

ARTICLE IN PRESS

and normalization for microarray data, http://dnmad.bioinfo.cipf.es) for background subtraction, log2 transformation and normali-zation by the print-tip loess method [23]. Normalized data wereimported into PreP (http://gepas.bioinfo.cipf.es/cgi-bin/preprocess)for filtering, merging of replicate spots and imputation of missingvalues. Statistical analysis was performed using the Rank Products(RP) method [24]. Briefly, for each chip genes were sorted(in ascending and descending order) by their normalized log ratiovalues and RP values were calculated. The RPs were compared withthe RPs for 1000 random permutations, with the same number ofreplicates and genes as the real experiment, to correct for themultiple testing problem inherent in microarray experiment. Toassign a significance level to each gene we employed the falsediscovery rate (FDR) [25]. ESTs with a FDR� 0.06 and a fold changeof 2 were considered differentially expressed. This rank-based teststatistic is a non-parametric method shown to generate accurateresults with biological datasets presenting a small number ofreplicates [24]. This method as already been used to analyse tran-scriptional profiling in plants [26–28]. To avoid bias in the micro-array analysis as a consequence of dye related differences inlabelling efficiency, dye labelling for each paired samples (inocu-lated/control) was reversed (reverse dye hybridization). Twoindependent hybridizations (technical replicates) were performedfor each biological replicate, at each time-point. A total of 4 (6 hafter contact), and 6 (12 h after contact) microarray hybridizationswere analysed.

2.4. Estimation of the proportion of plant and fungal transcripts inthe plant–fungus interaction transcriptome

Although the hybridizations have been performed using equalamounts of labelled cDNA from inoculated and non inoculatedroots, the proportion of plant and fungal cDNA in these twosamples was not the same: samples from inoculated roots (labelledwith Cy5) had a mix of plant and fungal transcripts whereas controlroots (labelled with Cy3) had only plant transcripts. This lead to anunderestimation of Cy5 fluorescence values that needed to becorrected. To equalize the amount of plant mRNA in the twohybridization samples we estimated the proportion of plant tofungal transcripts in cDNA from inoculated roots using reversetranscription real-time PCR, in order to quantify plant and fungalITS (Internal Transcribed Spacer) rRNA. ITS regions are consideredreliable and specific markers for the estimation of the total plant orfungal RNAs in intermingling symbiotic tissues [29].

To isolate the ITS regions, RNA was extracted from C. sativa rootsand P. tinctorius mycelium and cDNA was synthesized by reversetranscription, as described above, using ITS4 [30] to prime thereaction. ITS regions from roots and fungal mycelium were PCRamplified with ITS5/ITS4 primers [30] and cloned into pGEM-T easyvector (Promega). Cloned ITS fragments were sequenced andsequences were compared against the non redundant databases ofthe NCBI, using the internet BLAST server [31].

To quantify the ITS transcripts from each partner and calculatethe proportion of fungal and plant transcripts, total RNA waspurified from 6 h and 12 h inoculated roots and five microgramswere reverse transcribed using primer ITS4. Plant and fungal real-time PCR ITS specific primers are shown in Table 1. RT-PCR andrelative quantification were performed as described above. Twobiological and two technical replicates were used for each time-point.

The proportion of plant to fungal transcripts in the P. tinctorius–C. sativa early interaction transcriptome, calculated by relativequantification of the ITS transcripts, was 4: 1, in the two time points(6 h and 12 h of root-fungal contact) analysed. This proportion wasused to correct microarray signal intensities of the C. sativa

Please cite this article in press as: Sebastiana et al., Identification of plant gSoil Biol. (2009), doi:10.1016/j.ejsobi.2009.02.001

differentially expressed transcripts by multiplying log2 ratio valuesby 1.25.

2.5. Sequencing and sequence analysis

cDNAs differentially expressed were sequenced using the Big-Dye Terminator Cycle sequencing kit (Applied Biosystems, Inc.) andABI Prism 310 genetic analyser (Applied Biosystems, Inc.).Sequences shorter than 100 bases and ambiguous sequences werediscarded. Homology searches in databases were performed at theNCBI, using the blast x and megablast algorithms [31]. Sequenceswith an E-value� 10�5 were considered to identify known genes orhave partial similarity to known genes. ESTs identified as rRNAwere discarded.

2.6. Origin assignment of the differentially expressed genes

Sequence homology, combined with information on the tripletnucleotide frequencies, were used to assign the putative origin(plant or fungal) of the differentially expressed transcriptsaccording to Emmersen et al. [32] using the EST3 server athttp://mips.gsf.de/proj/est3. Training of a classifier for C. sativa andP. tinctorius was performed using 440 unique sequences fromFagaceae plants and 418 sequences from P. tinctorius (mRNA andEST sequence data longer than 50 bp) obtained by clustering ofsequences retrieved from the GenBank (NCBI) with BlastClustprogram. EST sequences have been deposited in the GenBank dbESTat NCBI.

2.7. Quantitative real-time RT-PCR

The transcript expression of two target cDNAs was quantified tovalidate microarray data (gene specific oligonucleotide sequencesare shown in Table 1). An actin transcript from C. sativa (EV253704),non-regulated in the microarray experiment, was used as internalreference for calculating relative transcript abundance.

Total RNA, from 6 h and 12 h inoculated and control roots, wasDNase treated with Turbo DNA-free kit (Ambion Inc.) for genomicDNA removal. Five micrograms of total RNA from each biologicalreplicate were used to synthesize cDNA. QRT-PCR reactions wereperformed with Light Cycler Fast Start ReactionMix MasterPLUSSYBR Green I (Roche, Mannheim, Germany) using a LightCycler�

detection system (Roche, Mannheim, Germany) according tomanufacturer’s instructions. The transcript concentration for eachsample was calculated based on a standard calibration curveobtained from serial dilutions of plasmid DNA containing the insertto be analysed. A negative control reaction without template wasincluded for each primer combination. The specificity of eachprimer set was monitored by melting curve analysis and by thesequencing of the respective amplicons that confirmed the ampli-fication of the expected transcripts. Molecular weight of theamplicons was further estimated by agarose gel electrophoresis.

3. Results

3.1. Microarray analysis

To examine changes in plant gene expression associated withthe pre-symbiotic phase of ECM development, an expressionprofiling using cDNA microarrays was performed. The comparisonbetween arrays in each time point [6 (a) and 12 (b) hours aftercontact] (Fig. 1) shows that there is a good reproducibility betweenbiological and technical replicates. Moreover, Pearson correlationcoefficients (r) for technical (0.83< r< 0.96) and biological(0.75< r< 0.90) replicated microarray pairs support the same

enes involved on the initial contact between ectomycorrhizal..., Eur. J.

Table 1QRT-PCR primers, targets and expected amplicons.

Target sequence (organism) Accession Primer sequence Amplicon (bp)

Receptor-like kinase (C. sativa) ES880903 GGGTGATGTCTCAAAAACAA (F)ATAACCTGCTTAACAAATCC (Rev)

241

Isoflavone redutase (C. sativa) EV253703 ACAAGGTACTCTACATCAGG (F)GGAATTGGGGACTCTTGGAT (Rev)

147

Actin (C. sativa) EV253704 ATGTTGCCCTTGACTATGAG (F)AGATGGCTGGAAGAGGACT (Rev)

105

ITS2 (C. sativa) EU016360 CATCGAGTTTTTGAACGCA (F)AACCACCGATTGTCGTG (Rev)

189

ITS2 (P. tinctorius) AF374709 TCGAAATCTCAAACCAAG (F)GCAAAGTTGGAGAAGCAT (Rev)

203

Fig. 1. Array quality and variation within and between experiments. Box plot graphs ofnormalized log2 ratio values for the 6 h (a) and 12 h (b) plant–fungus contact micro-arrays. Box plots 1, 2 and 3 represent biological replicates (arrays hybridized withfluorescent cDNAs prepared from different RNA extracts from inoculated/controlroots); box plots 1_rev, 2_rev and 3_rev represent the technical replicates of eachbiological replicate, in which Cy5 was used to label control roots and Cy3 was used tolabel inoculated roots (reverse dye).

M. Sebastiana et al. / European Journal of Soil Biology xxx (2009) 1–84

ARTICLE IN PRESS

conclusion. The r value for biological replicated arrays was lower,probably as a result of the introduced biological variation.

In the early contact between C. sativa and P. tinctorius, transcriptprofile analysis by cDNA microarray allowed the identification of 11C. sativa transcripts differentially expressed at the initial contact(6 h and 12 h) with the ectomycorrhizal fungus P. tinctorius. These11 transcripts were divided into functional categories according tothe putative function of their homologues in databases (NCBI)(Table 2). Genes involved in stress and defense (cystatin, ES880905;cystatin-like protein, ES880898; defensin, ES880902; non-specificlipid transfer protein, ES880901; universal stress protein,ES880899), signal transduction/communication (receptor proteinkinase-related, ES880903), protein fate (papain-like cysteinproteinase, ES880900), transport facilitation (water channelprotein MipK, ES880908) and genes with unknown function,showed altered expression at 12 h after contact. The transcriptencoding a putative papain-like cystein proteinase was regulated at6 and 12 h after contact with the fungal mycelium.

3.2. Origin assignment of the differentially expressed genes

The microarray was constructed based on a library containingtranscripts from both symbiotic partners, C. sativa and P. tinctorius.A traditional way to classify the origin of genes sampled from a poolof mixed cDNA is through sequence similarity to known genes fromthe two organisms or from other closely related species. However,this approach is prone to error and does not work when theidentified sequence has no close homologues in the sequencedatabases. Using sequence homology combined with tripletnucleotide frequency [32] we were able to predict the origin of thegenes that were differentially expressed in the microarrayexperiments.

Since there was no classifier developed for the C. sativa–P. tinctorius pair we developed our own classifier, based on 440database unique sequences from Fagaceae plants (C. sativa belongsto the family Fagaceae) and 418 unique sequences from P. tinctorius.After input of the sequences at the EST3 server, accuracy of thetraining and test set obtained was 87.7% and 88.5%, respectively,indicating the reproducibility of the output obtained with thedeveloped classifier. The performance of the classifier, tested with88 ESTs from C. sativa and P. tinctorius, already compared tosequences in the GenBank, revealed that 90% of the sequences werecorrectly assigned, which agrees with the accuracy predicted forthe developed classifier. Sequences belonging to the same TC,including ‘‘No Homology TCs’’, were all assigned the same origin bythe classifier, showing its consistency. Incorrectly assignedsequences included sequences coding for highly conserved proteinssuch as ubiquitins or histones, short sequences (less than 150 bp) orpoor quality sequences. Within eukaryotic organisms, it may bemore difficult for the classifier to separate sequences that are highlyconserved such as ubiquitins or histones. The fact that Fagaceae

Please cite this article in press as: Sebastiana et al., Identification of plant gSoil Biol. (2009), doi:10.1016/j.ejsobi.2009.02.001

sequences had to be used to construct the classifier, and that fewC. sativa sequences are available in the public databases, could beresponsible for the decreased classification accuracy of thesesequences. The predicted accuracy also decreases for shortsequences or poor quality sequences. The developed classifierenabled the origin assignment of 35 C. sativa and 53 P. tinctoriuscDNA library clones (including ‘‘no homology’’ sequences) and the

enes involved on the initial contact between ectomycorrhizal..., Eur. J.

Table 2Differential expression of Castanea sativa genes after 6 h and 12 h of contact with Pisolithus tinctorius assessed by microarray analysis.

GenBank ID GenBank homolog descriptiona E-value Fold changeb

6 h 12 h

Stress and defenseES880898 Cystatin-like protein (Arabidopsis thaliana) (AAM64661) [52] 1e�15 3.56ES880905 Cystatin (Castanea sativa) (CAA11899) [38] 9e�29 4.06ES880899 USP-like protein (Astragalus sinicus) (ABB13620) 3e�21 4.19ES880902 Putative gamma-thionine mRNA (Castanea sativa)c (AF417297) [53] 1e�47 6.95ES880901 ns-Lipid transfer protein (Medicago truncatula) (ABE79318) 2e�14 �2.30Signal Transduction/CommunicationES880903 Receptor protein kinase-related (Arabidopsis thaliana) (NP_566697) 8e�34 5.67Protein FateES880900 Putative papain-like cystein proteinase (Gossypium hirsutum) (CAE54306) 4e�54 �3.19 �2.78Transport FacilitationES880908 Water channel protein MipK (Mesembryanthemum crystallinum) (AAD31848) [54] 1e�15 �2.02UnknownES880907 Nucleic acid binding protein (Arabidopsis thaliana) (NP_565781) 4e�35 11.53ES880906 Hyphotetical protein (Vitis vinifera) (CAN69971) 2e�9 4.68ES880904 Unknown (Glycine max) (AAG00940) 6e�30 3.75

a Database match (blast x), corresponding species, accession number and references.b Fold change between inoculated roots and non inoculated roots.c Database match (megablast), corresponding species and accession number.

M. Sebastiana et al. / European Journal of Soil Biology xxx (2009) 1–8 5

ARTICLE IN PRESS

11 C. sativa differentially expressed genes, showing that this newmethodology is very useful to discriminate between plant andfungal sequences in symbiotic interactions.

3.3. Microarray validation by quantitative real-time RT-PCR

To confirm the reliability of microarray expression profileanalysis, QRT-PCR was performed on 2 randomly chosen targetgenes: an isoflavone redutase-like protein and a receptor-likekinase. The isoflavone redutase-like protein transcript was down-regulated in the microarray but was not considered differentiallyexpressed by the Rank Products statistical method. The receptor-like kinase transcript was up-regulated in the microarray and wasconsidered as differentially expressed at 12 h post contact with thefungal mycelium. The data from QRT-PCR confirmed the geneexpression pattern obtained by microarrays for both genes tested(Table 3). However, for the receptor-like kinase protein, the ratiobetween inoculated and control root tissue, obtained by QRT-PCR at6 h (5.50) and at 12 h (68.15) after inoculation was higher thanthose obtained by microarray analysis (1.67 and 4.48 respectively).Nevertheless, the expression levels of the transcripts verified byQRT-PCR were found to be consistent with the microarray data.

4. Discussion

Several papers have reported on molecular changes occurringduring the development of ECM [6–10,14]. However, a very limitednumber of them concern the early molecular events occurringduring the pre-infection stage, before the establishment of symbi-osis, especially in the plant partner [14]. For this reason weconsidered it important to analyse plant–fungus interaction over

Table 3Comparison between fold changes obtained by microarrays and quantitative real-time PCR for genes expressed in Castanea sativa roots inoculated with Pisolithustinctorius mycelium for 6 h (two biological replicates) and 12 h (three biologicalreplicates).

Fold change Isoflavone-redutase Receptor-like kinase

6 h 12 h 6 h 12 h

Microarray �1.83 �1.85 1.67 5.50QRT-PCR �0.82 �0.70 4.68 68.15

Please cite this article in press as: Sebastiana et al., Identification of plant gSoil Biol. (2009), doi:10.1016/j.ejsobi.2009.02.001

a 12 h time course since alterations in gene expression at this stagemay be related to recognition between symbiotic partners andprobably influence the outcome of the symbiosis.

Using a microarray approach, 11 C. sativa transcripts were foundto be differentially expressed in inoculated roots when comparedwith non inoculated control roots. Compared to other data on globalgene expression profile in symbiotic interactions [6–8] the numberof genes differentially expressed in the system C. sativa–P. tinctoriusis low. Most studies analysing transcription in ECM developmenthave been focused on the colonization events that comprise theperiod that spans from mantle formation (several days of contact)to fully differentiated mycorrhizas [6–10], and so they do notanalyse ECM development earlier than 2 days after initial contact.Nevertheless, in 2 day old ECM between Betula pendula and Paxillusinvolutus a number of differentially expressed transcripts similar tothe one presented in the present work was reported [10]. The lownumber of regulated transcripts found in C. sativa may be related tothe very early stage of plant–fungus contact (6 h and 12 h). Prob-ably, at this early stage of ECM development, the plant has onlystarted to respond to the presence of the fungus.

QRT-PCR analysis for microarray validation showed higher foldchanges for one of the transcripts tested. The dynamic range ofmicroarrays tends to be lower than of QRT-PCR [33] and severalauthors have reported higher fold changes with QRT-PCR whencompared to microarrays [34,31]. This difference on the dynamicrange of these two techniques is generally attributed to microarrayprobe saturation or to cross-hybridization with members of thesame gene family having a different expression pattern [33,34].Other authors ascribed these discrepancies to the normalization orbackground subtraction methods used in microarray analysis [36].Since this experiment was performed using cDNA microarrays,which are less specific than oligo arrays, and using an organismwith an ‘‘unknown’’ genome like chestnut, cross-hybridization withtranscripts from the same gene family could have happened,reducing the range of fold change values on arrays.

4.1. Genes involved in plant defense and stress response

A considerable amount of the regulated C. sativa genes displayedsequence similarities with genes known to be involved in plantdefense and stress responses From the identified C. sativa tran-scripts two showed sequence similarity with protease inhibitors,

enes involved on the initial contact between ectomycorrhizal..., Eur. J.

M. Sebastiana et al. / European Journal of Soil Biology xxx (2009) 1–86

ARTICLE IN PRESS

such as a cystatin and a cystatin-like protein. One of the identifiedtranscripts is homolog to the CsC gene from C. sativa that is tran-scriptionally activated after infection with pathogenic fungi,wounding and abiotic stress [37]. This cystatin shows a strongantifungal activity on several pathogenic fungi, which is probablyrelated to its inhibitory activity against fungal proteases [38,39]. Acysteine proteinase inhibitor gene has been reported to be inducedin Eucalyptus globulus during the early ECM development [8].During the development of other root symbioses, like arbuscularmycorrhizas (AM) and root nodules, up-regulation of transcriptscoding for proteinase inhibitors also occurs [40,41].

A C. sativa putative gamma-thionin homolog was significantlyup-regulated in inoculated roots when compared to the non inoc-ulated ones. Plant gamma-thionins, or defensins, are ubiquitous inplants and inhibit the growth of various plant pathogens by bindingto specific fungal membrane targets, causing severe membranedamage [42]. The induction of plant defensins (syn. Kunitz-typeprotesase inhibitors) has been reported to occur in AM [41]. InECMs from B. pendula and P. involutus a gene coding for a defensinprotein was down-regulated at 25 days old ECM root tips [7], aninverse pattern of regulation compared to the C. sativa identified inthis work. This difference may be due to the late stage of ECMdevelopment studied by those authors.

A gene with sequence similarity to a plant lipid transfer/seedstorage/trypsin-alpha amylase inhibitor, which belongs to the non-specific lipid transfer protein (nsLTPs)–like subfamily, appearsdown-regulated in C. sativa roots in contact with P. tinctoriusmycelium. Plant nsLTPs are small, soluble proteins that facilitate thetransfer of fatty acids, phospholipids, glycolipids, and steroidsbetween membranes. LTPs have been correlated with resistance tobiotic and abiotic stress, some of them having antibiotic activityagainst fungi and bacteria [43,44]. Other authors suggest that LTPscan have a role in signalling and recognition between plants andfungi [45]. The down regulation of a transcript coding for a nsLTPsat 12 h of contact between P. tinctorius and C. sativa is consistentwith the regulation pattern described for the homolog PVR3-likeprotein identified in the pre-mycorrhizal stage during the forma-tion of Quercus robur ECMs with Piloderma croceum [46]. The exactfunction of the nsLTPs is still, not clear.

The Universal Stress Protein (USP) is a small cytoplasmicbacterial protein overexpressed when the cell is exposed to stressagents. USP enhances the cell survival rate during prolongedexposure to such conditions and may provide a general ‘‘stressendurance’’ activity. The up regulation of this gene in C. sativa rootsmay account for its role in increasing the capability of the plantroots to cope with the stress imposed by the invading mycobiont.

According to several authors, mycorrhizal fungi induce in thehost plants, the transcription of stress responsive genes similar tothose induced by pathogenic fungi [6–9]. In ECMs this induction isapparently transient, occurring only in the early stages of symbi-osis, probably to control fungal ingress, and being repressed as theinteraction proceeds [8,9]. Our results confirm earlier reports onthe activation of the plant defense system during the initial stagesof ECM development. At initial contact, P. tinctorius induces inC. sativa roots, the production of reactive oxygen species like theoxidative burst occurring in early plant–pathogen interactions [19].It is tempting to speculate that this oxidative burst could modulatethe expression of genes involved in the plant defense system,switched-on in early steps of C. sativa–P. tinctorius ECM formation.

4.2. Signal perception related genes

A transcript encoding a putative signal perception/transductioncomponent was up-regulated in C. sativa roots, 12 h after contactwith P. tinctorius mycelium. The deduced peptide sequence shares

Please cite this article in press as: Sebastiana et al., Identification of plant gSoil Biol. (2009), doi:10.1016/j.ejsobi.2009.02.001

similarity with a receptor kinase-related protein from Arabidopsisthaliana. This transcript presents the DUF26 domain (pfam 01657,4e-12), which is found in serine/threonine kinases and hasunknown function. In Arabidopsis and rice, members of thissubfamily are rapidly induced upon pathogen infection [47,48] andcan trigger the hypersensitive response against pathogens bycausing increased accumulation of salicylic acid [48]. Several geneswith a putative function in signal transduction are up-regulated insymbiotic tissues, including AM [40,41], root nodules [34] and ECM[6,14]. The induction of this receptor kinase-related protein inC. sativa roots 12 h after contact with P. tinctorius myceliumsuggests that a signalling process similar to that operating duringpathogenic interactions may take place during the first hours ofcontact between C. sativa roots and P. tinctorius hyphae. Theproliferation of root tissue and fungal hyphae forming the symbi-otic organ and the need of both to adapt to rapid changes of theenvironment (changes in pH, enhanced fluxes of nutrients, pres-ence of ROS) probably involve the activation of signalling networks[4]. Very little is known about transduction pathways in mycor-rhizas. However, several clues came from studies using arbuscularmycorrhizas (AM), the other major group of mychorrizas in which,contrary to ECM, the fungal partner penetrates inside the root cells,and the root nodule symbiosis with rhizobia (both endosymbioses).These studies, using legume (Lotus japonicus, Medicago sativa andMedicago truncatula) mutants impaired in early symbiosis devel-opment, revealed that AM and root nodule symbiosis sharea common set of genes (referred to as the SYM genes) [49]. Some ofthe common SYM genes encode typical signal transductioncomponents, like a receptor-like kinase (M. truncatula DMI2,doesn’t make infection), or a calcium-calmodulin-dependentprotein kinase (M. truncatula, DMI3). These proteins are involved ina signal transduction network that is required for the developmentof intracellular accommodation structures for symbiotic fungi andbacteria by the host cell, during the early steps of symbiosis [49].Although evidence of the recruitment of SYM genes in ECM earlysignalling hasn’t been, to our knowledge, reported yet, DMI genesare found in the genome of Populus trichocarpa [50], a host of bothECM and AM symbiosis. Interestingly, in P. trichocarpus a quantita-tive trait locus (QTL) linked to the ECM infection rate is localized toa linkage group already characterized as involved in the interactionbetween poplar leaves and pathogenic fungi [51]. These evidencesprovide a genetic indication that the ECM trait could be associatedwith plant loci and genes that might be common to interaction withsymbiotic and pathogenic fungi [4]. In rice (an AM host) studiesrevealed a conservation of the plant transcriptional response tosymbionts and pathogens, including genes involved in signaltransduction, leading to the suggestion that plants might use thesame genetic program for responding to these different fungi [35].

4.3. Transport facilitation

A plant gene down-regulated in 12 h inoculated C. sativa roots,displays sequence similarity with a water channel MipK proteinfrom Mesembryanthemum crystallinum [54]. Major intrinsicproteins (MIPs) (syn aquaporins) are thought to play a role inpassive water flux across biomembranes [54]. During early ECMdevelopment between Birch (B. pendula) roots and P. involutus, MIPproteins were down-regulated together with dehydrins, which areproteins reported as having a function in protection against waterstress [7,9]. According to Le Quere et al. [9], at a later stage ofinfection, when fungal mantle and Hartig net are established, theexpression levels of water channel Mip genes decreases in referenceroot tissue to levels below the expression on the mycorrhizal roots,suggesting a plant water stress relief due to the formation of thefungal mantle, which accounts for the role of water channel MipK

enes involved on the initial contact between ectomycorrhizal..., Eur. J.

M. Sebastiana et al. / European Journal of Soil Biology xxx (2009) 1–8 7

ARTICLE IN PRESS

in protecting the roots from the water stress that constitutesa major problem for the non mycorrhizal roots of young plantseedlings [9]. In Eucalyptus ECMs, a water stress-inducible proteingene, repressed during the initial symbiosis development (until day7), is up-regulated and increases its expression as symbiosisproceeds (from day 12 to day 21) [8]. Since the transcriptionalresponse of C. sativa was analysed at 6 and 12 h of contact withP. tinctorius it cannot be ruled out the hypothesis that the identifiedaquaporin may be up-regulated in latter stages of the symbioticinteraction, being the 12 h, probably the turning point.

Elucidation of the nature of genes differentially expressedduring the development of ECMs can help in understanding themolecular basis of the early events in plant–ectomycorrhizal fungusinteraction [5]. To our knowledge, this is the first transcriptomestudy concerning the first hours of contact between plant andfungus in an ECM symbiosis.

Expression profiling of the early contact between C. sativa andP. tinctorius shows that changes in gene expression occur few hoursafter contact, long before the development of a functional mycor-rhiza. A clear and evident plant response concerns the induction ofgenes involved in stress and defense response indicating that thehost plant reacts rapidly to the presence of the mycobiont elicitinga defense programme similar to that found in pathogenic interac-tions. Another plant response was the repression of genes normallyimplicated in water stress suggesting a water stress relief due to theinitial contact with the ectomycorrhizal fungus.

Acknowledgments

We thank Dr. Silvia Ferreira for the critical reading of themanuscript. The authors are grateful to the anonymous reviewerfor the constructive suggestions. Financial support for this workwas obtained from Fundaçao para a Ciencia e Tecnologia throughfellowship (SFRH/BD/825/2000) and the projects FCT/POCI 2010and PTDC/MAT/64353/2006.

References

[1] S. Smith, D. Read, Mycorrhizal Symbiosis, Academic Press, London, 1997.[2] F. Martin, F. Lapeyrie, D. Tagu, Altered gene expression during ectomycorrhiza

development, in: P. Lemke, G. Caroll (Eds.), The Mycota, Springer, Berlin, 1997,pp. 223–242.

[3] D. Tagu, F. Lapeyrie, F. Martin, The ectomycorrhizal symbiosis: genetics anddevelopment, Plant and Soil 244 (2002) 97–105.

[4] F. Martin, A. Kohler, S. Duplessis, Living in harmony in the wood underground:ectomycorrhizal genomics, Curr. Opin. Plant Biol. 10 (2007) 204–210.

[5] F. Martin, S. Duplessis, F. Ditengou, H. Lagrange, C. Voiblet, F. Lapeyrie,Developmental cross talking in the ectomycorrhizal symbiosis: signals andcommunication genes, New Phytol. 1511 (2001) 145–154.

[6] C. Voiblet, S. Duplessis, N. Encelot, F. Martin, Identification of symbiosis-regulated genes in Eucalyptus globulus–Pisolithus tinctorius ectomycorrhiza bydifferential hybridization of arrayed cDNAs, Plant J. 25 (2001) 181–191.

[7] T. Johansson, A. Le Quere, D. Ahren, B. Soderstrom, R. Erlandsson, J. Lundeberg,M. Uhlen, A. Tunlid, Transcriptional responses of Paxillus involutus and Betulapendula during formation of ectomycorrhizal root tissue, Mol. Plant Microbe.Interact. 17 (2004) 202–215.

[8] S. Duplessis, P. Courty, D. Tagu, F. Martin, Transcript patterns associated withectomycorrhiza development in Eucalyptus globulus and Pisolithus micro-carpus, New Phytol. 165 (2005) 599–611.

[9] A. Le Quere, D.P. Wright, B. Soderstrom, A. Tunlid, T. Johansson, Global patternsof gene regulation associated with the development of ectomycorrhizabetween Birch (Betula pendula Roth.) and Paxillus involutus (Batsch) Fr. Mol.Plant Microbe. Interact. 18 (2005) 659–673.

[10] D.P. Wright, T. Johansson, A. Le Quere, B. Soderstrom, A. Tunlid, Spatialpatterns of gene expression in the extramatrical mycelium and mycorrhizalroot tips formed by the ectomycorrhizal fungus Paxillus involutus in associa-tion with birch (Betula pendula) seedlings in soil microcosms, New Phytol. 167(2005) 579–596.

[11] G.K. Podila, J. Zheng, S. Balasubramanian, S. Sundaram, S. Hiremath, J.H. Brand,M.J. Hymes, Fungal gene expression in early symbiotic interactions betweenLaccaria bicolor and red pine, Plant and Soil 244 (2002) 117–128.

Please cite this article in press as: Sebastiana et al., Identification of plant gSoil Biol. (2009), doi:10.1016/j.ejsobi.2009.02.001

[12] M. Mennota, A. Amicucci, D. Sisti, A.M. gioacchini, V. Stocchi, Differential geneexpression during pre-symbiotic interaction between Tuber borchii Vittad. andTilia americana L, Curr. Genet. 46 (2004) 158–165.

[13] M. Zarestsky, Y. Sitrit, D. Mills, N. Roth-Bejerano, V. Kgan-Zur, Differentialexpression of fungal genes at preinfection and mycorrhiza establishmentbetween Terfezia boudieri isolates and Cistus incanus hairy root clones, NewPhytol. 171 (2006) 837–846.

[14] P. Frettinger, J. Derory, S. Herrmann, C. Plomion, F. Lapeyrie, R. Oelmuller,F. Martin, F. Buscot, Transcriptional changes in two types of pre-mycorrhizalroots in ectomycorrhizas of oak microcuttings inoculated with Pilodermacroceum, Planta 225 (2007) 331–340.

[15] A. Martins, J. Barroso, M.S. Pais, Effect of ectomycorrhizal fungi on survival andgrowth of micropropagated plants and seedlings of Castanea sativa Mill,Mycorrhiza 6 (1996) 265–270.

[16] A. Martins, A. Casimiro, M.S. Pais, Influence of mycorrhization on physiologicalparameters of micropropagated Castanea sativa Mill, Plants. Mycorrhiza 7(1997) 161–165.

[17] M.B. Branzanti, E. Rocca, A. Pisi, Effect of ectomycorrhizal fungi on chestnut inkdisease, Mycorrhiza 9 (1999) 103–109.

[18] J.W.G. Carney, S.M. Chambers, Interactions between Pisolithus tinctorius and itshosts: a review of current knowledge, Mycorrhiza 7 (1997) 117–131.

[19] P. Baptista, A. Martins, M.S. Pais, R.M. Tavares, T. Lino-Neto, Involvement ofreactive oxygen species during early stages of ectomycorrhiza establishmentbetween Castanea sativa and Pisolithus tinctorius, Mycorrhiza 17 (2007) 185–193.

[20] D.H. Marx, The influence of ectotrophic mycorrhizal fungi on the resistance ofpine roots to pathogenic infections I. Antagonism of mycorrhizal fungi to rootpathogenic fungi and soil bacteria, Phytopathology 59 (1969) 153–163.

[21] C.Y. Wan, T.A. Wilkins, A modified hot borate method significantly enhancesthe yield of high-quality RNA from cotton (Gossypium hirsutum L.), Anal.Biochem. 223 (1994) 7–12.

[22] T. Nikula, A. West, M. Katajamaa, T. Lonnberg, R. Sara, T. Aittokallio,O.S. Nevalainen, R.A. Lahesmaa, Human Immuno Chip cDNA microarrayprovides a comprehensive tool to study immune responses, J. Immunol. Meth.303 (2005) 122–134.

[23] Y.H. Yang, S. Dudoit, P. Luu, D.M. Lin, V. Peng, J. Ngai, T.P. Speed, Normalizationfor cDNA microarray data: a robust composite method addressing single andmultiple slide systemic variation, Nucleic Acids Res. 30 (2002) e15.

[24] R. Breitling, P. Armengaud, A. Amtmann, P. Herzyk, Rank products: a simple,yet powerful, new method to detect differentially regulated genes in repli-cated microarray experiments, FEBS Lett. 573 (2004) 83–92.

[25] J.D. Storey, The positive false discovery rate: a Bayesian interpretation and theq-value, Ann. Statist. 31 (2003) 2013–2035.

[26] P. Armengaud, R. Breitling, A. Amtmann, The potassium-dependent tran-scriptome of Arabidopsis reveals a prominent role of jasmonic acid in nutrientsignalling, Plant Physiol. 136 (2004) 2556–2576.

[27] A. Figueiredo, A.M. Fortes, S. Ferreira, M. Sebastiana, Y.H. Choi, L. Sousa,B. Acioli-Santos, F. Pessoa, R. Verpoorte, M.S. Pais, Transcriptional and meta-bolic profiling of grape (Vitis vinifera L.) leaves unravel possible innate resis-tance against pathogenic fungi, J. Exp. Bot. 59 (2008) 3371–3381.

[28] A.M. Fortes, F. Santos, Y.H. Choi, M.S. Silva, A. Figueiredo, L. Sousa, F. Pessoa,B.A. Santos, M. Sebastiana, K. Palme, R. Malho, R. Verpoorte, M.S. Pais, Orga-nogenic nodule development in hop (Humulus lupulus L.): transcript andmetabolic responses, BMC Genomics 9 (2008) 445.

[29] E.C. Diaz, D. Tagu, F. Martin, Ribosomal DNA internal transcribed spacers toestimate the proportion of Pisolithus tinctorius and Eucalyptus RNAs in ecto-mycorrhiza, Appl. Environ. Microbiol. 63 (1997) 840–843.

[30] T.J. White, T. Bruns, S. Lee, J.W. Taylor, Amplification and direct sequencing offungal ribosomal RNA genes for phylogenetics, in: M.A. Innis, D.H. Gelfand,J.J. Sninsky, T.J. White (Eds.), PCR Protocols: A Guide to Methods and Appli-cations, Academic Press, New York, 1990, pp. 315–322.

[31] S.F. Altschul, T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller,D.J. Lipman, Gapped blast and PSI-BLAST: a new generation of protein data-base search programs, Nucleic Acids Res. 25 (1997) 3389–3402.

[32] J. Emmersen, S. Rudd, H.W. Mewes, I.V. Tetko, Separation of sequences fromhost–pathogen interface using triplet nucleotide frequencies, Fungal Genet.Biol. 44 (2007) 231–241.

[33] J.C. Rockett, J.M. Hellmann, Confirming microarray data – is it really neces-sary? Genomics 83 (2004) 541–549.

[34] F. Yahyaoui, H. Kuster, B. Ben Amor, N. Hohnjec, A. Puhler, A. Becker, J. Gouzy,T. Vernie, C. Gough, A. Niebel, L. Godiard, P. Gamas, Expression profiling inMedicago truncatula identifies more than 750 genes differentially expressedduring nodulation, including many potential regulators of the symbioticprogram, Plant Physiol. 136 (2004) 3159–3176.

[35] S. Guimil, H.S. Chang, T. Zhu, A. Sesma, A. Osbourn, C. Roux, V. Ioannidis,E.J. Oakeley, M. Docquier, P. Descombes, S.P. Briggs, U. Paszkowski, Compara-tive transcriptomics of rice reveals an ancient pattern of response to microbialcolonization, PNAS 102 (2005) 8066–8070.

[36] C. Gachon, A. Mingam, B. Charrier, Real-time PCR: what relevance to plantstudies? J. Exp. Bot. 55 (2004) 1445–1454.

[37] M. Pernas, R. Sanchez-Monge, G. Salcedo, Biotic and abiotic stress can inducecystatin expression in chestnut, FEBS Lett. 467 (2000) 206–210.

[38] M. Pernas, R. Sanchez-Monge, L. Gomez, G. Salcedo, A chestnut seed cystatindifferentially effective against cysteine proteinases from closely related pests,Plant Mol. Biol. 38 (1998) 1235–1242.

enes involved on the initial contact between ectomycorrhizal..., Eur. J.

M. Sebastiana et al. / European Journal of Soil Biology xxx (2009) 1–88

ARTICLE IN PRESS

[39] M. Pernas, E. Lopez-Solanilla, R. Sanchez-Monge, G. Salcedo, P. Rodrıguez-Palenzuela, Antifungal activity of a plant cystatin, Mol. Plant Microbe. Interact.12 (1999) 624–627.

[40] H. Kuster, N. Hohnjec, F. Krajinski, F. El Yahyaoui, K. Manthey, J. Gouzy,M. Dondrup, F. Meyer, J. Kalinowski, L. Brechenmacher, D. van Tuinen,V. Gianinazzi-Pearson, A. Puhler, P. Gamas, A. Becker, Construction and vali-dation of cDNA-based Mt6k-RIT macro- and microarrays to explore rootendosymbioses in the model legume Medicago truncatula, J. Biotechnol. 108(2004) 95–113.

[41] N. Hohnjec, M.E. Vieweg, A. Puhler, A. Becker, H. Kuster, Overlaps in thetranscriptional profiles of Medicago truncatula roots inoculated with twodifferent Glomus fungi provide insights into the genetic program activatedduring arbuscular mycorrhiza, Plant Physiol. 137 (2005) 1283–1301.

[42] P.B. Pelegrini, O.L. Franco, Plant-thionins: novel insights on the mechanism ofaction of a multi-functional class of defense proteins, Int. J. Biochem. Cell Biol.37 (2005) 2239–2253.

[43] F. Garcıa-Olmedo, A. Molina, A. Segura, M. Moreno, The defensive role ofnonspecific lipid-transfer proteins in plants, Trends Microbiol. 3 (1995) 72–74.

[44] A. Molina, F. Garcıa-Olmedo, Enhanced tolerance to bacterial pathogenscaused by the transgenic expression of barley lipid transfer protein LTP2, PlantJ. 12 (1997) 669–675.

[45] J.P. Blein, P. Coutos-Thevenot, D. Marion, M. Ponchet, From elicitins to lipid-transfer proteins: a new insight in cell signalling involved in plant defencemechanisms, Trends Plant Sci. 7 (2002) 293–296.

[46] S. Herrmann, F. Buscot, Cross talks at the morphogenetic, physiological andgene regulation levels between the mycobiont Piloderma croceum and oakmicrocuttings (Quercus robur) during formation of ectomycorrhizas, Phyto-chemistry 68 (2007) 52–67.

Please cite this article in press as: Sebastiana et al., Identification of plant gSoil Biol. (2009), doi:10.1016/j.ejsobi.2009.02.001

[47] S.T. Kim, S.G. Kim, D.H. Hwang, S.Y. Kang, H.J. Kim, B.H. Lee, J.J. Lee,K.Y. Kang, Proteomic analysis of pathogen-responsive proteins from riceleaves induced by rice blast fungus, Magnaporthe grisea, Proteomics 4(2004) 3569–3578.

[48] B.R. Acharya, S. Raina, S.B. Maqbool, G. Jagadeeswaran, S.L. Mosher, J. Appel,H.M.C. Schultz, D.F. Klessig, R. Raina, Overexpression of CRK13, an Arabidopsiscysteine-rich receptor-like kinase, results in enhanced resistance to Pseudo-monas syringae, Plant J. 50 (2007) 488–499.

[49] M. Parniske, Arbuscular mycorrhiza: the mother of plant root endosymbioses,Nat. Rev. Microbiol. 6 (2008) 763–775.

[50] G. Tuskan, S. DiFazio, S. Jansson, Bohlmann, I. Grogoriev, U. Hellsten,N. Putnam, S. Ralph, S. Rombauts, A. Salamov, et al., The genome of blackcottonwood, Populus trichocarpa, Science 313 (2006) 1596–1604.

[51] D. Tagu, C. Bastien, P. Faivre-Rampant, J. Garbaye, P. Vion, M. Villar, F. Martin,Genetic analysis of phenotypic variation for ectomycorrhiza formation in aninterspecific F1 poplar full-sib family, Mycorrhiza 15 (2005) 87–91.

[52] B.J. Haas, N. Volfovsky, C.D. Town, M. Troukhan, N. Alexandrov, K.A. Feldmann,R.B. Flavell, O. White, S.L. Salzberg, Full length messenger RNA sequencesgreatly improve genome annotation, Genome Biol. 3 (6) (2002)research0029.1–0029.12.

[53] R. Schafleitner, E. Wilhelm, Isolation of wound-responsive genes fromchestnut (Castanea sativa) microstems by mRNA display and their differ-ential expression upon wounding and infection with the chestnut blightfungus (Chryphonectria parasitica), Physiol. Mol. Plant Pathol. 61 (2002)339–348.

[54] H. Kirch, R. Vera-Estrella, D. Golldack, F. Quigley, C.B. Michalowski, B.J. Barkla,H.J. Bohnert, Expression of water channel proteins in Mesembryanthemumcrystallinum, Plant Physiol. 123 (2000) 111–124.

enes involved on the initial contact between ectomycorrhizal..., Eur. J.