Identification of Large Conductance Calcium Activated PotassiumChannel Accessory �4 Subunit in Rat and Mouse BladderSmooth Muscle

Muyan Chen and Georgi V. Petkov*From the Department of Pharmaceutical and Biomedical Sciences, South Carolina College of Pharmacy, University of South Carolina,Columbia, South Carolina

Abbreviations

and Acronyms

BK � large conductance voltageand Ca2� activated K�

BK� � BK channel � subunit

BK�1 � BK channel �1 subunit

BK�2 � BK channel �2 subunit

BK�3 � BK channel �3 subunit

BK�4 � BK channel �4 subunit

PCR � polymerase chain reaction

RT � reverse transcriptase

UBSM � bladder smooth muscle

Submitted for publication October 24, 2008.Study received University of South Carolina

institutional animal care and use committee ap-proval.

Supported by National Institutes of HealthDK-070909 (GVP).

* Correspondence: Department of Pharma-ceutical and Biomedical Sciences, South CarolinaCollege of Pharmacy, University of South Caro-lina, Coker Life Sciences Building, Room 709, 715Sumter St., Columbia, South Carolina 29208 (tele-phone: 803-777-1891; FAX: 803-777-8356; e-mail:petkov@cop.sc.edu).

Purpose: The BK (large conductance voltage and Ca2� activated K�) channel isa key regulator of bladder smooth muscle contractility. To our knowledge inbladder smooth muscle the BK channel pore forming � subunit BK� associates inhomotetramers with 4 regulatory smooth muscle specific �1 subunits. We chal-lenged this concept in identify whether other regulatory BK� subunits exist inmouse and rat bladder smooth muscle.Materials and Methods: We used a novel approach with single cell reversetranscriptase-polymerase chain reaction combined with immunocytochemicalstudies in freshly isolated mouse and rat bladder smooth muscle cells. Westernblot was also performed.Results: Reverse transcriptase-polymerase chain reaction identified the mRNAexpression of various BK channel subunits in freshly isolated bladder smoothmuscle cells. Our data indicate that, in addition to BK� and BK�1, neuronalspecific BK�4 is expressed in mouse and rat bladder smooth muscle cells. BK�4expression was also revealed by Western blot. Immunocytochemistry was furtherapplied to confirm the specific expression of BK�4 protein directly in freshlyisolated mouse and rat bladder smooth muscle cells.Conclusions: To our knowledge we performed the first comprehensive examina-tion of the expression of BK� and BK� subunits in bladder smooth muscle. Weidentified that the bladder smooth muscle BK channel has a distinctive architec-ture involving pore forming BK� and regulatory BK�1/�4. Further studies of thefunctional roles of BK�, BK�1 and BK�4 directly in human bladder smoothmuscle may help the development of alternative therapeutic strategies to controlbladder dysfunction. New drugs targeting specific BK channel subunits in humanbladder smooth muscle may prove useful for overactive bladder.

Key Words: urinary bladder; muscle, smooth; large-conductance calcium-

activated potassium channels; rats; mice

374 www.jurology.com

THE BK channel, also known as themaxiK, KCNMA1, Slo1 or KCa1.1channel, is a member of the Shakerrelated 6 transmembrane domain K�

channel superfamily that is found invarious excitable and nonexcitablecells, including UBSM. In UBSM the

BK channels are key regulators of cell

0022-5347/09/1821-0374/0THE JOURNAL OF UROLOGY®

Copyright © 2009 by AMERICAN UROLOGICAL ASSOCIATION

membrane excitability, action poten-tial formation and contractility, andthey are instrumental in mediating�-adrenergic bladder relaxation.1–6

As key regulators of UBSM mem-brane excitability, BK channels con-trol the opening and closing of L-type

voltage gated Ca2� channels and,

Vol. 182, 374-381, July 2009Printed in U.S.A.

DOI:10.1016/j.juro.2009.02.109

IDENTIFICATION OF POTASSIUM CHANNEL SUBUNIT IN BLADDER SMOOTH MUSCLE 375

therefore, the level of Ca2� influx necessary to acti-vate UBSM contraction.

The BK channel pore forming � subunit or BK�associates in homotetramers that can account forthe basic properties of the native channels, such asconductivity and voltage/Ca2� sensitivity. The di-verse kinetic and pharmacological characteristics ofthe BK channel are partially mediated by alterna-tive splicing of the Slo or KCNMA1 gene, whichencodes BK�.7 In 1994 the auxiliary smooth musclespecific �1 subunit BK�1 with modulatory functionwas discovered.8 BK�1, which is particularly en-riched in UBSM, increases channel Ca2� and volt-age sensitivity, slows deactivation kinetics and al-ters the pharmacological properties of the BKchannel.5,7,9,10 In knockout mouse models geneticdeletion of BK� or BK�1 leads to increased UBSMcontractility and bladder overactivity, indicatingthat the BK channels have a fundamental role incontrolling UBSM function.2,5,11

After the initial discovery of BK�1 in smoothmuscle8 increasing evidence has suggested that theheteromultimerization of BK� with the 4 � subunitsBK�1 to BK�4 determines the tissue specific func-tions of the BK channel.5,7,9,12–16 BK�2, which isprominent in endocrine and brain tissue, negativelyshifts channel activation but also results in rapidand complete channel inactivation using a ball andchain mechanism.7,13,14 BK�3, which is abundant inthe human brain and expressed strongly in the ratlung, inactivates BK currents extremely rapidly butincompletely.7,9,12–14 Neuronal specific BK�4 hasthe opposite effects of BK�1, decreasing the appar-ent Ca2� sensitivity of the BK channel.7,9,13,15,17,18

On the other hand, BK�4 was confirmed to be adown-regulator of the BK channel because it moreprofoundly slows the activation and inactivation ki-netics of BK channels compared withBK�1.7,9,13,17,18 Although BK�4 is abundant in thebrain, it is moderately expressed in other tissues,such as the spinal cord, kidney, lung and secretoryglands.9,13,15 Knowledge about the existence ofBK�4 in smooth muscle is sparse. Only 1 group thatused dot and Northern blots have reported low levelsof BK�4 mRNA expression in some smooth muscletissues in which BK�1 is abundant.15

The mentioned studies suggest that more than 1type of BK� subunit exists in a functional channelcomplex resulting in heteromultimeric channelscomposed of BK�/�1 to �4 subunits with intermedi-ate functional properties. We challenged the currentconcept that in UBSM the BK channel consists onlyof 4 pore forming BK� and 4 smooth muscle specificregulatory BK�1.5,8 As a prerequisite to understandthe functional role of potentially novel BK� subunitsin UBSM information on their expression at the

mRNA and protein levels is required. Accordingly

we identified whether, in addition to BK�1, otherregulatory BK� subunits exist in rat and mouseUBSM using molecular and immunological ap-proaches.

MATERIALS AND METHODS

Animal Care, UBSM Tissue and Cell Isolation

ProceduresAdult mice weighing 25 to 35 gm and rats weighing 250 to300 gm of each sex were sacrificed with CO2, followed byexsanguination. This procedure was done in accordancewith the guidelines of the Animal Welfare Act, the Asso-ciation for Assessment and Accreditation of LaboratoryAnimals, and the University of South Carolina institu-tional animal care and use committee (Animal Use Proto-col 1426 for mice and 1482 for rats).

In RT-PCR experiments the brains, lungs, livers andbladders were removed and placed in ice-cold nominallyCa2�-free solution composed of 80 mM monosodium glu-tamate, 55 mM NaCl, 6 mM KCl, 10 mM glucose, 10 mMHEPES and 2 mM MgCl2 (pH 7.3, adjusted with NaOH).Fresh physiologically active UBSM cells were enzymati-cally isolated as previously described in mice2 and rats.4

Freshly isolated UBSM cells were left to settle at thebottom of a chamber for at least 5 minutes before individ-ual selection based on cell morphology using an Axiovert40CFL microscope (Carl Zeiss®) with Nomarski interfer-ence contrast. In each RT-PCR experiment 200 to 300freshly isolated UBSM cells were collected by suction intoa glass micropipette using an MP-285/ROE micromanip-ulator (Sutter Instruments, San Rafael, California). Col-lected UBSM cells were expelled into a 1.5 ml centrifugetube with RNAlater® and then pelleted at 1,000 � gravityfor 3 minutes. Pellets were prepared for an RT-PCR pro-tocol.

For Western blot rat brain and whole bladder were cutand used for membrane protein extraction. For immuno-cytochemical studies fresh UBSM cells were also isolatedas described and dropped on a glass coverslip to settle for1.5 hours at room temperature before further processing,as described.

RNA Extraction, RT-PCR and SequencingTotal RNA was isolated from brain, lung, liver, UBSMwhole tissue and enzymatically isolated UBSM cells usingan RNeasy™ Mini Kit. Extracted RNA was reverse tran-scribed into cDNA using M-MLV RT (Promega®) and oligodeoxythymidine primers. Specific primers for rat BK�,BK�1, BK�2 and BK�3, and mouse BK�, BK�1, BK�2,BK�3 and BK�4 were designed according to the rat andmouse GenBank® sequence using Primer Premier, ver-sion 5 (Premier Biosoft International, Palo Alto, Califor-nia). Primer for rat BK�4 was designed based on thesequences of multiple species in GenBank and alignedusing Primer Premier, version 5. The table lists all primerpair sequences used in this study. To eliminate the con-tamination of genomic DNA primers were designed acrossexon junctions. cDNA production was PCR amplified us-ing GoTaq® Green Master Mix and specific primers for all

subunits. PCR annealing temperature for each primer

IDENTIFICATION OF POTASSIUM CHANNEL SUBUNIT IN BLADDER SMOOTH MUSCLE376

pair was optimized using a Mastercycler® gradient ther-mocycler. Rat and mouse brain mRNA products served asa positive control for BK�, BK�1, BK�2 and BK�4 toconfirm the effectiveness of primers. Rat lung and mouselivers were chosen as positive controls in RT-PCR experi-ments because they have been reported to abundantlyexpress BK�3.7,12,16 Negative PCR control experimentswere performed in the absence of the RT enzyme to avoidthe contamination of genomic DNA. PCR products werepurified using a GenElute™ PCR Clean-Up Kit and se-quenced directly at our institution to confirm their iden-tity.

Protein Isolation and Western BlotBrain and UBSM tissues were homogenized with stan-dard RIPA buffer containing protease inhibitors (ThermoFisher Scientific, Waltham, Massachusetts). The homoge-nate was vortexed for 60 seconds, sonicated for 5 secondsat low power and incubated on ice for 45 minutes. Themixture was centrifuged at 12,000 � gravity for 30 min-utes at 4C. Supernatant was collected and the pellet wasresuspended in RIPA buffer and centrifuged again. The 2supernatants were mixed and centrifuged at 45,000 �gravity for 30 minutes. Supernatant was collected and theprotein concentration was determined with a BCA proteinassay kit (Thermo Fisher Scientific). Protein was stored at�80C until use for sodium dodecyl sulfate-polyacrylamidegel electrophoresis and Western blot.

For Western blot protein was mixed with 5 � Laemmlibuffer (1:4) and denaturized for 5 minutes at 95C. Subse-quently equal amounts of brain and UBSM proteins (ap-proximately 50 �g) were loaded into adjacent lanes, sub-jected to 4% to 20% pre-case sodium dodecyl sulfate-polyacrylamide gel electrophoresis for 2.5 hours at 20 mAand transferred to a polyvinylidene fluoride membrane at40 mA for 2 hours using semidry blot. The membrane wasblocked with 3% bovine serum albumin/TBS-Tween 20buffer for 2 hours at room temperature. The blots wereincubated with affinity purified polyclonal BK�4 antibody(Alomone Labs, Jerusalem, Israel) (1:100) overnight at 4C.The membrane was washed with tris buffered saline-Tween 20, 4 times and incubated with goat anti-rabbit IgGconjugated with horseradish peroxidase (1:2,500) in block-ing buffer for 1 hour at room temperature. Bound antibod-ies were detected by an echochemiluminescence substrate

Table 1. BK channel subunits RT-PCR primers

Subunits Sense

Rat:BK� ATGTCTACAGTGGGTTACGGBK�1 TGACTGTTGCCTCCTGTGBK�2 TTACAGACACGACGAGAAABK�3 CTGGACTTTGCCTTCACCBK�4 GCGTTCTCATTGTGGTCC

Mouse:BK� GCTGTTGATGGGTGTTCGBK�1 CCTGGGAGTGGCAATGGTBK�2 CGGACCTCTTCATCTTACABK�3 CATCCCTGTCCAAATCACGBK�4 ATCGGTTCCCAGCCATTC

kit (Amersham, Piscataway, New Jersey) according to

manufacturer instructions. Staining specificity was veri-fied by pre-incubation of antibodies with a competing pep-tide.

ImmunocytochemistryEnzymatically isolated UBSM cells were fixed with pre-warmed (37C) 4% paraformaldehyde for 10 minutes.UBSM cells were then washed twice in PBS, blocked andpermeabilized for 30 minutes in PBS containing 10% nor-mal donkey serum and 0.1% Triton X-100. UBSM cellswere washed again in PBS and incubated with primaryantibody, that is rabbit polyclonal anti-slo�4 (KCNMB4)BK�4 antibody (Alomone Labs) (1:100) at 37C for 1 hour.Subsequently UBSM cells were washed twice in PBS andlabeled with secondary antibodies, that is Cy3-conjugatedanti-rabbit IgG (1:200) and PBS/3% normal donkey se-rum/0.01% Triton X-100 (Jackson ImmunoResearch, WestGrove, Pennsylvania) for 1 hour in the dark. After labelingUBSM cells were washed with PBS and incubated withphalloidin, which stains F-actin green, for 2 hours in thedark. UBSM cells were then washed twice more with PBS,incubated with 4=,6-diamidino-2-phenylindole, whichstains nuclei in blue, for 15 minutes and washed again,then mounted on slides with Dabco®. Control treatmentsincluded 1) omission of primary antibody to confirm sec-ondary antibody specificity and 2) absorption of primaryantibody by a competing peptide to confirm primary anti-body specificity. Images were acquired at 63� with a CarlZeiss LSM 510 META confocal microscope.

RESULTS

mRNA Detection

To detect BK channel subunit mRNA expressionRT-PCR experiments were performed in mouse andrat UBSM whole tissue, enzymatically isolatedUBSM cells and various other tissues that served aspositive controls, as described. Subunit specificprimers were used to determine the expression ofBK�, BK�1, BK�2, BK�3 and BK�4 (see table andfigs. 1 to 3). BK�, BK�1, BK�2 and BK�4 mRNAexpression was detected in UBSM whole tissue andin brain tissue, which served as a positive control

Antisense Production (bp)

TGGGTGGTAGTTCTTTATGG 504TCCCGAGTGTCTTCTGTG 314CGACACTCACAAGGGACA 449CCTCCCAGCAATGTCAGTA 344TGTGCCTGTTTCTGTTGC 239

CGCAAGCCAAAGTAGAGG 775CCCGAGTGTCTTCCGTGT 239CACTGGGCTTCTTCTGTC 230TCCTGGCAGCTACCCTCA 318CGACTTCTTTGAGGGTTTCC 485

(figs. 1 to 3). As expected, the BK�3 mRNA message

mice.

IDENTIFICATION OF POTASSIUM CHANNEL SUBUNIT IN BLADDER SMOOTH MUSCLE 377

was detected in rat lung and mouse liver but not inUBSM whole tissue even when subjected to a secondround of PCR amplification (figs. 1 and 2). Negativecontrol experiments demonstrated absent genomicDNA contamination (figs. 1 to 3). While the expres-sion of mRNA messages in UBSM whole tissue forpore forming BK� and smooth muscle specific BK�1was expected, the detection of BK�2 and BK�4 wassurprising. The presence of other cell types in thedetrusor muscle layer, such as neurons, vascularmyocytes, endothelial cells and fibroblasts, may leadto the detection of subunits expressed in cell typesother than UBSM cells. To address this issue weperformed single cell RT-PCR experiments infreshly isolated UBSM cells from mice and rats. Thesingle cell RT-PCR approach eliminates any contam-ination from other cell types, as described. Freshlyisolated UBSM cells were confirmed to expressmRNA for BK�, BK�1 and BK�4 subunits in ratsand mice (figs. 1 to 3). The BK�2 mRNA messagewas not detected in freshly isolated UBSM cells evenafter the initial RCR products were subjected to asecond round of amplification (figs. 1 and 2). A lackof genomic DNA contamination was also confirmedusing the negative control reactions lacking the RTenzyme. All RT-PCR purified products from intactUBSM tissues and isolated UBSM cells were se-

Figure 1. BK�, BK�1, BK�2 and BK�3 mRNA expression in moshowed 775, 239, 230 and 318 bp mRNA message, respectively.of reaction. Results were verified in total of 6 preparations in 2

quenced to confirm their identity. Results demon-

strated that freshly isolated UBSM cells from ratsand mice expressed BK�, BK�1 and BK�4 mRNA.

Western Blot Detection

While the expression of BK� and BK�1 mRNA mes-sages in freshly isolated mouse and rat UBSM cellswas expected, to our knowledge the detection ofBK�4 was a novel finding. To confirm the presenceof BK�4 protein in mouse and rat UBSM cells weapplied Western blot. The presence of BK�4 proteinin rat and mouse UBSM tissue was confirmed byBK�4 specific antibody (fig. 4). Pre-absorption ofprimary antibody with its antigenic competing pep-tide indicated the specificity of the antibody for itsintended epitope.

Immunocytochemical Detection

Immunocytochemical labeling was further applied toconfirm the specific expression of BK�4 protein di-rectly in freshly isolated mouse and rat UBSM cells.Freshly isolated mouse and rat UBSM cells hadbright, distinct edges when observed with a phasecontrast confocal microscope. BK�4 antibody specifi-cally labeled UBSM cells isolated from mouse and ratbladders (figs. 5 and 6). Results were carefully con-trolled for specificity using omission of the primaryantibody or absorption of the primary antibody by a

ain, liver, UBSM whole tissue and freshly isolated UBSM cellsducts were observed in negative controls (�RT) with RT left out

use brNo pro

competing peptide. BK�4 antibody specificity has also

ns in

IDENTIFICATION OF POTASSIUM CHANNEL SUBUNIT IN BLADDER SMOOTH MUSCLE378

been previously verified.16,19 Immunocytochemical ex-periments confirmed that mouse and rat UBSM cellsexpressed BK�4.

DISCUSSION

To our knowledge in the current study we providethe first comprehensive examination of the expres-sion of BK� and BK� subunit mRNA in mouse and

Figure 2. BK�, BK�1, BK�2 and BK�3 mRNA expression in rademonstrated 504, 314, 449 and 344 bp mRNA message, respecleft out of reaction. Results were verified in total of 9 preparatio

Figure 3. BK�4 mRNA expression in mouse and rat brain, and frespectively. No products were observed in negative controls

preparations each in 3 rats and 3 mice.

rat UBSM combined with molecular and immunocy-tochemical studies in freshly isolated UBSM cells.The molecular biological data presented indicatethat, in addition to BK� and BK�1, neuronal specificBK�4 is expressed in rat and mouse UBSM cells. Toour knowledge this finding demonstrates for the firsttime that the UBSM BK channel expresses regula-tory BK�4, which distinguishes the architecture ofthe UBSM BK channel. Our novel findings are con-

n, lung, UBSM whole tissue and freshly isolated UBSM cellsNo products were observed in negative controls (�RT) with RT3 rats.

isolated UBSM cells showed 485 and 239 bp mRNA messages,with RT left out of reaction. Results were verified in total of 9

t braitively.

reshly(�RT)

IDENTIFICATION OF POTASSIUM CHANNEL SUBUNIT IN BLADDER SMOOTH MUSCLE 379

sistent with a previous study in which dot andNorthern blots were used, suggesting the possiblepresence of transcripts encoding BK�4 in somesmooth muscle tissues.15

However, to date conclusions concerning BK�4expression in native UBSM cells have not beendrawn due to the methodological limitations of mo-lecular biological techniques. In our series nativeUBSM BK�4 was identified by applying novel com-plementary techniques to reveal the expression ofmRNA encoding the BK channel subunits and thesubunit proteins themselves. In the current studyRT-PCR was used to identify BK�4 expression infreshly isolated UBSM cells at the mRNA level. Im-munocytochemistry instead of traditional immuno-histochemistry was performed to identify the spe-cific expression of BK�4 protein directly in freshlyisolated UBSM cells from mice and rats. This com-bination of novel approaches minimized the possi-bility of artifactual identification of a subunit be-cause of 1) contaminating mRNA derived from celltypes in the detrusor muscle layer, such as neurons,vascular myocytes, endothelial cells and fibroblastsor 2) nonspecific immunolabeling by BK�4 antibody.Furthermore, the specificity of the BK�4 antibodyhas been previously confirmed by examining it inbrain sections isolated from BK�4�/� knockoutmice.16,19 Those investigators reported that no spe-cific staining was observed in BK�4 deficient ani-mals. The BK�4�/� knockout mouse model used byBrenner et al17 may prove useful to further identifythe functional and regulatory role of BK�4 in mouseUBSM.

Our previous studies in a BK�1 transgenic knock-out mouse model revealed that in UBSM BK�1 isexclusively expressed and functionally associatedwith pore forming BK� to control UBSM function.5

However, to our knowledge the existence of a BK�/�1/�4 heteromultimeric channel complex in mouseand rat UBSM is a novel finding. The current study

Figure 4. Western blot demonstrates BK�4 protein expressioneliminated by competing peptide (�CP). Results were verified irats. KDa, kDa.

provides direct molecular evidence for the presence

of heteromultimeric channels composed of BK�/�1/�4 in native, freshly isolated mouse and ratUBSM cells. The apparent Ca2� affinity of theBK�/�4 channel is decreased dramatically at lowerCa2� concentrations, whereas BK�1 increases Ca2�

affinity without Ca2� concentration dependence.9,10

In addition, BK�/�4 channels cannot be blocked bycharybdotoxin or iberiotoxin at concentrations thattypically block BK�/�1 channels.13,15,20 Interest-ingly our previous studies in a BK�1 knockoutmouse model showed changes in the effects of ibe-riotoxin on UBSM contractility after genetic dele-tion of BK�1.5 Further knowledge about the specificproperties of BK�4 may prove useful to elucidate thecorrelation of BK�/�1 and BK�/�4 complexes inUBSM.

CONCLUSIONS

To our knowledge we provide the first evidence forthe expression of BK�4 mRNA and protein infreshly isolated mouse and rat UBSM cells. It isreasonable to speculate that BK�4 is a regulatorycomponent of the UBSM BK channel. However, fu-ture studies are required to determine the func-tional roles of this auxiliary BK�4 in UBSM andelucidate the pharmacological properties of theUBSM BK channel in BK�4�/� knockout mice.17

Confirming the unique architecture of the UBSMBK channel involving pore forming BK� and regu-latory BK�1/�4 would provide innovative insightinto the function of the BK channel in UBSM cells.Further knowledge about the functional and regula-tory roles of UBSM BK�, BK�1 and BK�4 may behelpful for developing alternative therapeutic strat-egies to control overactive bladder. For example,drugs targeting specific UBSM BK channel subunitsmay prove useful for some forms of bladder dysfunc-tion.1 However, we must first obtain information

se and rat brain and UBSM tissue. Immunoreactive band wasstern blot reactions using proteins isolated from 3 mice and 4

in moun 3 We

about BK channel structure and function directly in

IDENTIFICATION OF POTASSIUM CHANNEL SUBUNIT IN BLADDER SMOOTH MUSCLE380

Figure 5. Wide field confocal microscopy reveals immunocyto-chemical detection of BK�4 in freshly isolated mouse UBSMcells. Results were verified in total of 9 cells freshly isolated from3 mice. Note results using BK�4 specific antibody (A). In controlexperiments primary antibody was omitted and cells were in-cubated with secondary antibody only (2° Control) (B). Noteresults after absorption of primary antibody with competingpeptide (�CP Control) (C). Red areas indicate BK�4 detection(A). Blue areas indicate cell nuclei. Green areas indicate F-actin.

Merged images show nucleus, actin and �4 subunit overlap.

Figure 6. Wide field confocal microscopy shows immunocyto-chemical detection of BK�4 in freshly isolated rat UBSM cells.Results were verified in total of 12 cells freshly isolated from 4rats. Note results using BK�4 specific antibody (A). In controlexperiments primary antibody was omitted and cells were in-cubated with secondary antibody only (2° Control) (B). Noteresults after absorption of primary antibody with competingpeptide (�CP Control) (C). Red areas indicate BK�4 detection.Blue areas indicate cell nuclei. Green areas indicate F-actin.

Merged images indicate nucleus, actin and �4 subunit overlap.

IDENTIFICATION OF POTASSIUM CHANNEL SUBUNIT IN BLADDER SMOOTH MUSCLE 381

human UBSM, as knowledge about this fundamen-tal channel is limited.3

ACKNOWLEDGMENTS

Dr. Kiril Hristov, University of South Carolina

assisted with cell isolation and collection. Dr.

REFERENCES

beta-subunits. News Physiol Sci 2002; 17: 156. 2000; 474: 99.

Jennifer G. Schnellmann, Medical University ofSouth Carolina assisted with the article. PCRproducts were sequenced at the EnvironmentalGenomics Core Facility, University of South Caro-lina. The BK�4�/� knockout mouse model wascreated at University of Texas Health Science

Center, San Antonio, Texas.17

1. Andersson KE and Arner A: Urinary bladder con-traction and relaxation: physiology and patho-physiology. Physiol Rev 2004; 84: 935.

2. Brown SM, Bentcheva-Petkova LM, Liu L, HristovKL, Chen M, Kellett WF et al: �-Adrenergic re-laxation of mouse urinary bladder smooth musclein the absence of large-conductance Ca2�-acti-vated K� channel. Am J Physiol Renal Physiol2008; 295: F1149.

3. Hristov K, Cui X, Kellett WF, Rovner ES andPetkov GV: Evidence for the presence of largeconductance Ca2�-activated K� channels in na-tive human urinary bladder smooth muscle. J Urol2008; 179.

4. Hristov KL, Cui X, Brown SM, Liu L, Kellett WFand Petkov GV: Stimulation of �3-adrenoceptorsrelaxes rat urinary bladder smooth muscle viaactivation of the large conductance Ca2�-acti-vated K� (BK) channels. Am J Physiol CellPhysiol 2008; 295: C1344.

5. Petkov GV, Bonev AD, Heppner TJ, Brenner R,Aldrich RW and Nelson MT: Beta1-subunit of theCa2�-activated K� channel regulates contrac-tile activity of mouse urinary bladder smoothmuscle. J Physiol 2001; 537: 443.

6. Petkov GV and Nelson MT: Differential regulationof Ca2�-activated K� channels by beta-adreno-ceptors in guinea pig urinary bladder smoothmuscle. Am J Physiol Cell Physiol 2005; 288:C1255.

7. Orio P, Rojas P, Ferreira G and Latorre R: Newdisguises for an old channel: MaxiK channel

8. Knaus HG, Garcia-Calvo M, Kaczorowski GJ andGarcia ML: Subunit composition of the high con-ductance calcium-activated potassium channelfrom smooth muscle, a representative of themSlo and slowpoke family of potassium chan-nels. J Biol Chem 1994; 269: 3921.

9. Brenner R, Jegla TJ, Wickenden A, Liu Y andAldrich RW: Cloning and functional characteriza-tion of novel large conductance calcium-activatedpotassium channel beta subunits, hKCNMB3 andhKCNMB4. J Biol Chem 2000; 275: 6453.

10. Cox DH and Aldrich RW: Role of the beta1 sub-unit in large-conductance Ca(2�)-activated K(�)channel gating energetics. Mechanisms of en-hanced Ca(2�) sensitivity. J Gen Physiol 2000;116: 411.

11. Meredith AL, Thorneloe KS, Werner ME, NelsonMT and Aldrich RW: Overactive bladder and in-continence in the absence of the BK large con-ductance Ca2�-activated K� channel. J BiolChem 2004; 279: 36746.

12. Xia XM, Ding JP and Lingle CJ: Molecular basisfor the inactivation of Ca2�- and voltage-depen-dent BK channels in adrenal chromaffin cells andrat insulinoma tumor cells. J Neurosci 1999; 19:5255.

13. Behrens R, Nolting A, Reimann F, Schwarz M,Waldschütz R and Pongs O: hKCNMB3 and hKC-NMB4, cloning and characterization of two mem-bers of the large-conductance calcium-activatedpotassium channel beta subunit family. FEBS Lett

14. Uebele VN, Lagrutta A, Wade T, Figueroa DJ, LiuY, McKenna E et al: Cloning and functional ex-pression of two families of beta-subunits of thelarge conductance calcium-activated K� chan-nel. J Biol Chem 2000; 275: 23211.

15. Meera P, Wallner M and Toro L: A neuronal betasubunit (KCNMB4) makes the large conductance,voltage- and Ca2�-activated K� channel resis-tant to charybdotoxin and iberiotoxin. Proc NatlAcad Sci U S A 2000; 97: 5562.

16. Grimm PR, Foutz RM, Brenner R and Sansom SC:Identification and localization of BK-beta subunitsin the distal nephron of the mouse kidney. Am JPhysiol Renal Physiol 2007; 293: F350.

17. Brenner R, Chen QH, Vilaythong A, Toney GM,Noebels JL and Aldrich RW: BK channel beta4subunit reduces dentate gyrus excitability andprotects against temporal lobe seizures. Nat Neu-rosci 2005; 8: 1752.

18. Wang B, Rothberg BS and Brenner R: Mechanismof beta4 subunit modulation of BK channels.J Gen Physiol 2006; 127: 449.

19. Piwonska M, Wilczek E, Szewczyk A and Wilc-zynski GM: Differential distribution of Ca(2�)-activated potassium channel beta4 subunit in ratbrain: immunolocalization in neuronal mitochon-dria. Neuroscience 2008; 153: 446.

20. Gan G, Yi H, Chen M, Sun L, Li W and Wu Y:Structural basis for toxin resistance of beta4-associated calcium-activated potassium (BK)

channels. J Biol Chem 2008; 283: 24177.