Microbiology (1 998), 144, 3343-3349 Printed in Great Britain

Heterologous expression of a basic elicitin from Phytophthora cryptogea in Phytophthora infestans increases i ts ability to cause leaf necrosis in tobacco

Franck Panabieres,’ Paul R. J. Birch,’ Shiela E. Unkles,’ Michel Ponchet,’ Isabelle Lacourt,’ Paul Venard,* Harald Keller,’ Valerie Allasia,’ Pierre Ricci’ and James M. Duncan’

Author for correspondence: Paul R. J. Birch. Tel: +44 1382 562731. Fax: +44 1382 562426. e-mail : pbirch@scri.sari.ac.uk

Fungal and Bacterial Plant Pathology Department, Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK

Station de Botanique et de Pathologie Wgetale, INRA, BP 2078, F-06606 Antibes, France

The cry-b sequence, encoding a basic elicitin (cryptogein B) from Phytophthora cryptogea, was co-transformed into Phytophthora infestans. The copy number of the cry& sequence varied in co-transformants. Nevertheless, in all cases the alien elicitin gene was transcribed, translated and the protein secreted in vitro from such transformants. Moreover, the secreted cryptogein B from P. infestans co-transformants increased their ability to cause a hypersensitive- response-like necrosis of tobacco leaves. It was thus concluded that the transfer of a single gene encoding a basic elicitin from one Phyfophthora species to another can dramatically alter the phenotypic interaction of the transformed species with tobacco.

Keywords : co-transformation, elicitin gene, heterologous expression, Phytophthora, tobacco necrosis

INTRODUCTION which are highly virulent to tobacco [P. parasitica Dastur var. nicotianae (Breda de Haan) Tucker], causing

The genus Phytophthora comprises a diverse group of the disease black shank, do not secrete these proteins plant-pathogenic oomycetes, many of which cause (Bonnet et al., 1994). Elicitins are thus believed to act as diseases of economically important crops (Erwin & avirulence factors in tobacco-Phytophthora interactions Ribeiro, 1996). They have been well characterized in (Ricci et al., 1992). However, their potential role in other terms of their morphology, pathology and, more re- plant-Phytophthora interactions, if any, remains un- cently, genomic diversity (Judelson, 1996). Differences clear (Yu, 1995 ; Ricci, 1997). in modes of infection and host range provide interesting models for the study of pathogenicity and host- specificity, ranging from a narrow-host-range and an air-borne, hemi-biotrophic mode of infection exempli- fied by Phytophthora infestans, the cause of late blight in potato, to the wide-host-range, soil-borne and necro- trophic mode of infection of Phytophthora cryptogea. As yet, the molecular basis of such differences is poorly understood ; only the interactions between Phyto- phthora species and tobacco are well characterized (reviewed by Ricci, 1997). Most Phytophthora spp. studied secrete elicitins, small, homologous holoproteins which elicit a hypersensitive response (HR) -like necrosis and systemic acquired resistance (SAR) in tobacco (Ricci et al., 1989). Most isolates of Phytophthora parasitica

A number of elicitins have been purified from culture filtrates of different Phytophthora species and se- quenced. Although highly conserved, they nevertheless may exhibit limited amino acid substitutions, which result in large differences in net charge, and this has been shown to affect the degree to which they induce tobacco leaf necrosis. Hence, two distinct classes of elicitin have been identified and defined as basic, causing strong necrosis, as produced by P. cryptogea (Ricci et al., 1989), or acidic, causing little or no necrosis (Ricci et al., 1993), as produced by P. parasitica (Ricci et al., 1992; Kamoun et al., 1993). Furthermore, 10- to 50-fold higher con- centrations of purified acidic elicitin are required to induce levels of resistance in tobacco similar to those observed with basic elicitins (Bonnet et al., 1996).

.................................................................................................................................................

Abbreviation: UTR, untranslated region.

Central to the investigations of genes encoding elicitins and other genetic determinants of pathogenicity and

0002-2456 0 1998 SGM 3343

F. P A N A B I E R E S a n d O T H E R S

host specificity is the use of systems of DNA-mediated transformation for the transfer, heterologous expression and subsequent analysis of potentially important genes between representative species of Phytophthora. As yet, transformation has been well characterized only for P. infestans, although at low efficiency (Judelson et al., 1991). Nevertheless, it has been used successfully for antisense inhibition of a transgene (Judelson et al., 1993) and for co-transformation using intermolecular ligation (Judelson, 1993). There has been no report to date of the expression of a foreign Phytophthora gene, complete with flanking transcriptional signals, in P. infestans. The phenotypically characteristic interactions between tobacco and specific elicitins offer a unique opportunity to assay the heterologous expression of genes encoding these proteins following their transfer from one Phyto- phthora species to another, by comparing the level of tobacco leaf necrosis induced by transformants with that of the untransformed fungus. We report the transcription and translation of a gene encoding a basic elicitin, cryptogein, from P. cryptogea in P. infestans, and show that the cryptogein protein is efficiently secreted. Furthermore, we show that whereas the untransformed P. infestans does not elicit visible necrosis on tobacco, necrosis typical of that observed in the case of P. cryptogea is induced by transformants expressing the cryptogein gene.

METHODS

Strains, media and plasmids. The recipient P. infestans strain for transformation was 89-AF1, a potato isolate obtained from D. Shaw (University of Wales, Bangor). P. cryptogea 52 was isolated from Gerbera in France and P. nicotianae 329 was isolated from tobacco in Greece. P. infestans was maintained at 18 "C on Elliot's minimal medium (Elliot et al., 1966), containing 100 pg vancomycin ml-' and 4 pg nystatin ml-'. For transformation, release of zoospores after growth for 1 week on pea agar [per litre : 125 g frozen peas (boiled for 15 min and strained through muslin, pH 6.25) and 15 g agar] at 18 "C was achieved by chilling to 4 "C for 1 h under pre-cooled sterile distilled water. Zoospores were inoculated into 11 Elliott's broth at a density of 5 x lo5 ml-' and incubated at 18 "C for 48 h. Vector pTH210, conferring hygromycin B resistance (Judelson, 1993) was kindly provided by H. Judelson (Uni- versity of California, USA). Plasmid pBG38 (Fig. l a ) contains the cryptogein-encoding sequence cry-6 (Panabieres et al., 1995). DNA and RNA techniques. DNA was extracted from P. infestans using the method of Raeder & Broda (1985). Southern blotting was performed under high-stringency con- ditions, using the method of Sambrook et al. (1989). Plasmid DNA was prepared according to Sambrook et al. (1989). All procedures described below were according to the manu- facturers ' recommendations. RT-PCR amplification products were cloned into the pGEM-T vector (Promega), sequenced using the Amplitaq FS Dye Terminator cycle sequencing kit of Perkin-Elmer and visualized using an automated sequencer (ABI). RNA was extracted from P. infestans using the Qiagen RNeasy minikit. Poly(A)' mRNA was purified using oligo(dT)-coated dynabeads (Dynal) and cDNA synthesized using the Not1 oligo(dT) primer in the Pharmacia First-strand cDNA synthesis kit. DNA was radiolabelled using the Boehringer Random Primed Labelling kit.

9 6 1

3 1 2

1 kb

........................................................................................................... I..... .... ... ..... . ..... . .............

Fig. I . (a) Restriction map of the 3.1 kb Bglll DNA insert in plasmid pBg38. The cryptogein-encoding gene cry-b and the transcriptionally inactive sequence 620 are indicated as filled boxes. The positions of primers used for PCR reactions are indicated by open boxes. Primers 1 and 3 anneal to the sense strand (from left to right) and primer 2 to the anti-sense strand (from right to left). Restriction enzyme sites: 5, Sphl; 6, BdmHI; C, Clal; g, Bglll. (b) Southern hybridization of a region from the 3' UTR of the cry-b gene amplified using primers 1 and 2 (Fig. la) t o genomic DNAs (1Opg of each) from untransformed P. infestans strain 89-AF1 (lane 1) and hygromycin-resistant transformants H1, H2, H6, H7, H8 and H9 (lanes 2-7, respectively) digested with restriction enzyme Sphl. Arrowed i s a hybridizing fragment of approximately 650 bp in lanes 2, 6 and 7.

Preparation and transformation of P. infestans protoplasts. Mycelium was collected by filtration through miracloth and protoplasts obtained by digestion with 5 mg novozyme ml-l and 4 mg cellulase ml-' according to Campbell et al. (1989). Transformation of approximately lo7 protoplasts using a total of 30 pg lipofectin-treated vector DNA was performed according to Judelson et al. (1991). Regenerating protoplasts were spread on Elliott's agar containing 1 M mannitol, 50 pg vancomycin ml-', 2 pg nystatin ml-' and 25 pg hygromycin ml-'. PCR conditions. The location of primers used for PCR and RT-PCR of the cry-6 sequence are indicated in Fig. l ( a ) and their sequences are : 1, 5' GTCCACTGATGCTTCTCCGT- AG 3'; 2,5' CACGTGATGCGAAACAATCGG 3'; and 3,5' GTTGCCGCAACACTGTATTGCG 3'. For RT-PCR ampli- fication of the gpd gene of P. infestans, primer 5' AGGTG- ATCCCGAGCCTGAACGG 3' was used. For cDNA syn- thesis and in RT-PCR, an oligo(dT) primer was used, of sequence 5' ATTCGCCGCCGCAGGAT,, 3'. For PCR, 200 ng of genomic DNA was used, and for RT-PCR, SO ng of cDNA was used. In each case, reaction mixtures contained, in

3344

Expression of cryptogein in Phytophthora infestans

addition to template DNA, 2.5 U Tag polymerase (Gibco), 1 x T a q polymerase buffer, 100 pM of each deoxynucleoside triphosphate, 1 mM MgC1, and 100 ng of each primer, made up to a final volume of 100 pl with sterile distilled water. For both PCR and RT-PCR, reaction conditions were: 1 cycle of 94 "C for 1 min, 65 "C for 1 min, 72 "C for 2 min ; followed by 30 cycles of 94 "C for 30 s, 65 "C for 30 s, 72 "C for 1 min; and a final cycle of 72 "C for 10 min.

Protein analysis and plant inoculation. Elicitins were purified and analysed by HPLC according to the procedure of Le Berre et al. (1994). Quantification of purified elicitins was performed after 15 d incubation at 17 "C as described by Le Berre et al. (1994) on the basis of peak areas at 280 nm, using P. cryptogea strain 52 and P . infestans strain 89-AF1 as standards for cryptogein B (CRY B; retention time 7.1 min) and infestin 1 (INF 1; retention time 9 6 min), respectively. For treatment of 8-week-old tobacco plants (wild-type Xanthi nc), inoculations on decapited stems were performed as described by Keller et al. (1996). Symptoms were noted at 1, 3 and 7 d following inoculation.

RESULTS

Co-transformation of P. infestans with a plasmid containing a hygromycin resistance gene and a plasmid containing a basic elicitin gene from P. cryptogea

Recently, elicitin genes from P. cryptogea have been isolated, characterized and found to be clustered (Panabieres et al., 1995). A 3.1 kb BglII DNA fragment was shown to contain two elicitin genes, one of which is transcriptionally inactive (B20) whereas the other, cry-6 (previously X24), encodes the major basic elicitin, cryptogein B (CRY B), produced by this organism. We introduced a plasmid containing this region of DNA (pBg38; Fig. l a ) into P. infestans.

Transformation of P. infestans has previously been achieved with a plasmid vector containing the bacterial HygR gene (pTH210), which conveys resistance to the drug hygromycin B and thus acts as a selectable marker (Judelson, 1993). T o introduce the cry-6 sequence, protoplasts of P. infestans were co-transformed with 15 pg each of both pTH210 and pBg38, digested with restriction enzyme HindIII ; it has been shown previously that plasmids linearized in this way and introduced simultaneously into P. infestans can ligate or recombine in the host cell to form a single DNA molecule carrying both the selectable marker and gene of interest (Judelson, 1993). All transformants were selected initially on medium containing 25 pg hygromycin ml-l (a dose which kills the untransformed fungus). Ten such hygromycin-resistant colonies were selected, two of which proved unstable and reverted to drug sensitivity when further plated on selective medium. An additional two strains lost their resistance to hygromycin after several consecutive inoculations on selective medium, leaving six drug-resistant strains for further investi- gation. Such ' instability ' of P. infestans transformants has been reported previously by Judelson & Whittaker (1995) and attributed to an unknown mechanism of gene silencing.

Southern analysis was used to investigate whether the hygromycin-resistant strains had acquired the cry-6 sequence. An alignment of the 3' untranslated regions (UTRs) of c ry6 and infl (Kamoun et al., 1997) revealed regions with few similarities from which primers 1 and 2 were designed (Fig. la). Using these primers, a portion of the 3' UTR of cry-6 was PCR-amplified for use as a specific probe to indicate the presence of this sequence in the DNAs of transformants. Genomic DNA (10 pg) from each of the six hygromycin-resistant transformants and the untransformed fungus was digested with re- striction enzyme SphI and Southern-blotted. As ex- pected, no hybridization of the cry-6-specific probe was observed to DNA from the untransformed fungus, confirming that there is no homology between the region amplified from cry-6 for use as a probe and native infestin-encoding genes (Fig. 1 b). However, hybrid- ization was observed to a single band of expected size (approx. 650 bp) in each of three of the drug-resistant strains (Hl, HS and H9), indicating that these had acquired this region of the alien sequence. Furthermore, the strength of hybridization varied between these three DNA populations, suggesting that the copy numbers of introduced sequences differed. Such variation in copy number of an introduced sequence in P. infestans has been recorded previously (Judelson, 1993) and is nor- mally caused by tandem integrations into the genome. Although no attempt to assess copy number of the introduced DNA was made, it is interesting to note that the strength of hybridization was greater with H8 DNA than with H9 DNA, suggesting a higher copy number in the former. PCR was further used to demonstrate the presence of the entire cry-6 sequence in these strains. Two primers (2 and 3; Fig. l a ) were designed to anneal, respectively, to specific regions of the 5'- and 3' UTRs flanking the normal origin and termination of transcription. PCR was performed on the DNAs of each of the six hygromycin-resistant strains and the untransformed fungus. An amplification product of the expected size (815 bp) was obtained only from DNAs of the three transformants (Hl, H8 and H9) which had previously hybridized to the cry-b-specific probe (results not shown). We hence deduced that the entire cry-6 sequence and flanking regions were present in these strains.

The alien cry-6 sequence is transcribed in P. infestans co- t ra nsf or ma n t s

RT-PCR was used to test whether the cry-6 gene was transcribed in transformants containing this sequence. The six hygromycin-resistant strains and the un- transformed fungus were grown for 15 d in pea broth. RNA was then extracted, mRNA purified using oligo (dT) -coated dynabeads and cDNA synthesized using an oligo(dT) primer. cDNA (50 ng) from each of the strains was used in each RT-PCR. Initially, to test whether, under all conditions, intact mRNA had been extracted and converted to cDNA, RT- PCR was performed using a primer which anneals to the

3345

F. P A N A B I E R E S a n d OTHERS

(b)

cry-b GTGCCGTCCACTGATGCTTCTCCGTAGTAAGTAA~CTCGAGTCCAGCGTGCGT~AATCCTC inf l G T G - - - - - - - - - G - - A C T T G T - C A G C G C G C - T C - A G - C - C G T C

* * * * * * * * * * * * * * * * * * * * ** *** * * * *

cry-b T T A T G A G C A G A C T C C G G C T A T G G C G A - C A A C G A T C G A T T C inf l C-ATTGGCCG-TATCATCT-TGTCTTTCATCGA-CGAT---TCTCCGCG

* * * * * * * * * * * * *** **** ****** * * * * * *

cry-b ATAACTACTCACCCCGTCCGATTGYI'TCGCATCACGTGCGATAAACAAATATGAATGTTG jnfl TCTGTTGCT-ATTAC-TGTAATAGTGTAGCAGC-TGCGGTATA?+AGCTA'FITGAATA?+AA

* * * * * * * * * * * * * * * * * * * * * * * * * *

cry-b T T I U T - C A - ~ CT ( A ) n

inf l ?E?%%%-- (A'n

........................................................................ . ............................................................................ Fig. 2. (a) RT-PCR amplification, using primer 1 (Fig. la) in combination with an oligo(dT) primer, of cDNA prepared from untransformed P. infestans strain 89-AF1 (lane 2) and from hygromycin-resistant strains HI, H2, H6, H7, H8 and H9 (lanes 3-8, respectively). Marker DNA (lane 1) is a 100 bp ladder (Pharmacia). An amplification product obtained from transformants HI, H8 and H9 of 240 bp i s arrowed to the right. (b) Alignment of the 3' UTRs of cDNAs derived from the cry-b gene (GenBank accession number 234459) present in co- transformants and the inf l gene (GenBank accession number U50844) from P. infestans. Identities are indicated by asterisks. Underlined is a common motif close to the site of polyadenylation.

gpd gene of P. infestans in combination with the oligo(dT) primer. This gene is believed to be consti- tutively expressed (Moon et al., 1992) and thus cDNA derived from it should be detected in each sample. This proved to be the case and an amplification product of expected size (approx. 540 bp) was obtained from each cDNA sample, whereas no such product was obtained from genomic DNA (result not shown). An oligonucleotide primer was designed to anneal specifically to the 3' UTR of the cry-6 sequence (primer 1; Fig. l a ) , and was used in combination with the oligo(dT) primer. As expected, no amplification product was generated from either the cDNA of the un- transformed fungus, the transformation vector pBg38, or from cDNAs of the hygromycin-resistant strains lacking the cry-6 sequence. However, an amplification product of expected size (240 bp) was obtained from the cDNAs of transformants H1, H8 and H9, all of which contain cry-6 DNA (Fig. 2a).These DNA bands were excised from the gel, cloned and sequenced; the se- quences confirmed them to be derived from transcripts

of the cry-6 gene. Alignment of the amplified region of the cry-6 cDNA sequence with the equivalent region of the native infl cDNA is shown in Fig. 2(b) and reveals a number of motifs common to these terminators, in- cluding the regions (underlined) preceding the sites of polyadenylation.

Transformants containing the cry4 sequence secrete active cryptogein

To assess whether mRNAs encoding cryptogein B (CRY B) were translated and the protein secreted, all six drug- resistant strains (Hl, H2, H6, H7, H8 and H9), the untransformed P. infestans (89-AF1) and, as a control, P. cryptogea isolate 52, were grown in liquid culture and the elicitin content of the extracellular medium was analysed using HPLC as described previously for P. cryptogea (Le Berre et al., 1994). Due to the different growth rates of P. infestans and P. cryptogea, samples were analysed after confluent growth was achieved (15 d for P. infestans isolates and 8 d for P. cryptogea). In the case of the untransformed P. infestans, a single peak of retention time 9.6 min was observed (Fig. 3a) and was identified as infestin by comparison with other acidic elicitins. This peak was also observed in the extracellular media of all six hygromycin-resistant transformants (results for H6, H1, H8 and H 9 shown in Fig. 3(b-e), but was not observed in P. cryptogea medium (Fig. 3f). An additional peak, with a retention time of 7.1 min, corresponding to CRY B (Le Berre et al., 1994), as produced by P. cryptogea isolate 52 (Fig. 3f), was seen only in the culture filtrates of transformants ( H l , H8 and H9) expressing the cry-6 sequence (Fig. 3c-e). This suggests that not only is the protein translated and secreted, but it is also similarly folded (Penot, 1996). From this preliminary analysis, relative amounts of CRY B secreted in relation to dry weight for the three co-transformants were 470 ( H l ) , 620 (H8) and 1050 (H9) pg 8-l. Whereas the values for strains H 1 and H8 were lower than that of P. cryptogea (1000 pg g-'), H9 secreted a similar amount. Nevertheless, the con- centrations of CRY B produced by all three trans- formants are in excess of the threshold required for elicitation of tobacco necrosis typical of this elicitin (Bonnet et al., 1996). To test the consistency of elicitin secretion, four strains were studied in detail; the untransformed strain 89-AF1, a hygromycin-resistant strain lacking cry-6 (H6), a strain expressing the cry-6 sequence (H9) and P. cryptogea isolate 52. Transformant H9 was chosen as it apparently secretes similar levels of CRY B as P. cryptogea. Five replicate cultures of each strain were grown in parallel. Production of elicitin in relation to growth (mycelial dry weight) was again measured 15 d post-inoculation for P. infestans strains and 8 d for P. cryptogea, when similar levels of biomass were achieved for each. Although initially transformants grew more slowly than un- transformed P. infestans, after 15 d similar amounts of mycelium were obtained from each culture. The observed differences in growth rate between trans- formants and the untransformed P. infestans prior to

3346

Expression of cryptogein in Phytophthora infestans

1

4.0

3.0

2.0

1.0

0.0

4.0 7 3.0 1

3.0

4*o r"' 2*ol 1.0 I.

Y

3*0 t

0.4 t 0.2 t- 0.0 (h-<

2 4 6

i

i i 8 10 12

_ _ ~ ~ _ _ ~

c&to& 52 Q. Thevertical line at 7.1 min indicates the CRY B heterologous protein to be clearly distinguished from peaks in (c)-(f). The infestin peak is at 9.6 min (a, b, c, d and e). that of the native infestin.

Retention time (min)

Fig. 3. HPLC traces of elicitin separation for untransformed P. infestans 89-AF1 (a), hygromycin-resistant transformant H6 (b), cryptogein-producinq transformants H1 (c), H8 (d), H9 (e) and P.

15 d may have been due to the effects of hygromycin on transformant metabolism. Overall elicitin production in relation to dry weight, although similar for both transformants, was significantly higher than that of the untransformed P. infestans (Table 1). Any relationship between overall elicitin production and growth rates remains to be assessed. CRY B production by trans- formant H9 was 7.8 % of overall elicitin secretion by this isolate and was again similar to CRY B production (in relation to dry weight) by P. cryptogea (Table 1).

To test whether the heterologously expressed cryptogein retains its biological activity on tobacco, mycelial plugs of strains H1, H6, H8, H9, 89-AF1 and, as additional controls, P. cryptogea strain 52 and P. nicotianae strain 329 (non-elicitin producer), were each inoculated onto five decapitated 6-week-old tobacco plants (Xanthi nc) and incubated at 24 "C. This test is the standard assay used to distinguish between acidic and basic elicitins produced in uitro (Yu, 1997). After 3 d, no necrosis was observed in the cases of transformant H6, un- transformed P. infestans and P. nicotianae. However, as expected (e.g. Ricci, 1997), symptoms appeared after 1 d, and comparable levels of necrosis were clearly visible after 3 d, on leaves inoculated with P. cryptogea and transformants H1, H8 and H9 (results not shown). After 9 d, symptoms had still not appeared on leaves inoculated with untransformed P. infestans or trans- formant H6, whereas leaves inoculated with trans- formants H1, H8 and H9 and P. cryptogea were equally highly necrotized (results not shown).

Additional inoculations of strains 89-AF1, H6 and H9 were performed and plants incubated at 18 "C, a temperature more suitable for P. infestans growth. The pattern and extent of necrosis was similar to that observed at 24 "C (result not shown). In an attempt to test for the development of the fungus in tobacco, after 9 d stem slices from plants inoculated with strains 89- AF1, H6 and H9 were removed at a distance of 0 5 5 and 10 cm from the inoculation site. These were then inoculated onto agar plates and incubated for 20 d at 18 "C. As expected, no mycelial growth from stems inoculated with P. infestans strains was observed during this time, confirming that it does not invade tobacco and that the transformation event had not altered this. In contrast, viable P. infestans is easily recovered from potato leaf material 9 d after inoculation (results not shown).

DISCUSSION

In this paper we report the introduction of a gene encoding a basic elicitin from P. cryptogea into P. infestans and demonstrate its transcription, and trans- lation and secretion of the elicitin into the extracellular medium. In addition, the well-characterized interactions between elicitins and tobacco allowed the activity of the

3347

F. P A N A B I E R E S a n d OTHERS

Table 1. Elicitin production in untransformed P. infestans (isolate 89-AFI), P. infestans transformants H6 and H9, and P. cryptogea isolate 52

Values are means f SD of five replicate cultures.

Isolate Dry weight Infestin production Cryptogein production Total elicitin production (mg)

(pg ml-') [pg (g dry wt)-'] (pg m1-l) [pg (g dry wt)-'I (clg m1-l) [pg (g dry wt)-'l

89-AF1 49.6 f 2.1 19.8 4.5 7 983 f 1560 0 0 19.8 f 4.5 7983 f 1560 H6 44.5 & 1.5 28.15 f 1.9 12 650 f 590 0 0 28.1 f 1.9 12650 & 590 H9 48-2 f 0.7 246 f 1.4 10209 f 480 2.1 & 0.1 871 f 50 26.7 f 1.5 11080&530 52 63-6 f 9.3 0 0 3.15 f 0.5 990 f 20 3.15 f 0-5 990 & 20

RT-PCR revealed that the cry-6 sequence was tran- scribed in all co-transformants. PCR amplification of DNA with primers which anneal to the 5' and 3' flanking regions of the gene, together with hybridization of the cry-6-specific probe to only a single band in SphI- digested transformant DNA, suggest that, in all cases, the introduced sequence had remained intact. Therefore, we propose that such transcription is driven by the cry- 6 promoter region. In addition, sequencing of the RT- PCR products (Fig. 2b) demonstrated unequivocally that the cry-6 terminator works efficiently in P. infestans. Earlier reports of transformation described heterologous expression of chimaeric transgenes in P. infestans, using various oomycete promoters and terminators with bacterial reporter genes. This is the first demonstration of expression of an entire Phytopthora gene, complete with 5' and 3' flanking regions, in another Phytophthora species.

Transcription from the cry-6 promoter region in P. infestans may be unsurprising; sequences in the en- vironment of the transcription initiation site of this gene are conserved with those of other genes isolated from various Phytophthora species (Panabieres et al., 1995). Although as yet uncharacterized, such sequence simi- larities suggest a common gene architecture within the genus. Furthermore, a number of sequence similarities are observed between the terminator regions of cry-6 and the recently reported infl gene (Fig. 2b). In addition, HPLC analysis identified a protein of a size expected of the cry-6 gene product (Le Berre et al., 1994) only in culture filtrates from transformants expressing this sequence. From this we deduce that, for translation, accurate cleavage and secretion to occur, the ribosome- binding site and export signal, respectively, are both recognized. This may be due to conservation between the signal-peptide-encoding sequences of all elicitin genes, especially at the cleavage point (Panabieres et al., 1997). Nevertheless, the structure and regulation of oomycete promoters remain poorly characterized and thus the accurate expression and processing of the alien cry-6 gene was not an obvious outcome.

Southern analysis suggested that the copy number of the introduced sequences differed between transformants. This has been reported previously and attributed to

tandem integrations (Judelson, 1993). Such variation in copy number has been shown to have little effect on the expression of DNA introduced into P. infestans (Judelson et al., 1993). However, small differences were seen in the amounts of CRY B produced by H1, H8 and H9. Such transgenic expression was only a small proportion of the overall elicitin secreted from such transformants, but was nevertheless similar to amounts of CRY B secreted from P. cryptogea grown under similar conditions. Given that there are no more than two genes encoding INF 1 (Kamoun et al., 1997), it would thus appear that the introduced cry-6 sequence was either expressed to a lower level or processed less efficiently than endogenous genes. The most likely explanation for this is that either the in f i promoter contains elements allowing higher levels of transcription than the cry6 promoter, or that regulatory elements required for expression of these genes, or stability and secretion of their products, are divergent. Nevertheless, sufficient CRY B was secreted to cause necrotic symptoms typical of this basic elicitin. In conclusion, demonstration of co-transformation was effectively tested by a biological assay. This was possible for two reasons. Firstly, the expression of CRY B by P. infestans does not appear to be toxic to this organism. Secondly, infestins alone do not induce visible necrosis when P. infestans is inoculated onto decapitated tobacco stems. The high level of necrosis induced by trans- formant H9 was therefore due to the secretion of the transgene alone, albeit at only a fraction of the overall elicitin secreted. Due to the high level of biological activity of its product, which can be assayed by a number of different methods (Bonnet et al., 1996; Yu, 1997), the cry-6 coding region could thus be used as a reporter for analysis of regulated promoter functions in P. infestans, and may in the future be adapted for promoter-trapping experiments, given an increase in transformation frequency.

ACKNOWLEDGEMENTS

The authors would like to thank Dr H. Judelson for gifting plasmid pTH210. This work was supported by the Scottish Office Agriculture, Environment and Fisheries Department and by an Alliance grant from the British Council.

3348

Expression of cryptogein in Phytophthora infestans

REFERENCES

Bonnet, P., Lacourt, I., Venard, P. & Ricci, P. (1994). Diversity in pathogenicity and in elicitin production among isolates of Phytophthora parasitica. ] Phytopathol 141, 25-37. Bonnet, P., Bourdon, E., Ponchet, M., Blein, I.-P. & Ricci, P. (1996). Acquired resistance triggered by elicitins in tobacco and other plants. Eur ] Plant Pathol 102, 181-192. Campbell, A. M., Moon, R. P., Duncan, 1. M., Gurr, S.-1. & Kinghorn, 1. R. (1989). Protoplast formation and regeneration from sporangia and encysted zoospores of Phytophthora infestans. Physiol Mol Plant Pathol 34, 299-307. Elliott, C. G., Hendrie, M. R. & Knights, B. A. (1966). The sterol requirement of Phytophthora cactorum. ] Gen Microbiol 42, 425-435. Erwin, D. C. & Ribeiro, 0. K. (1996). Phytophthora Diseases Worldwide. St Paul, M N : American Phytopathological Society. Judelson, H. S. (1 993). Efficient co-transformation mediated by intermolecular ligation occurring in vivo in the oomycete Phytophthora infestans. Mol Gen Genet 239, 241-250. Judelson, H. 5. (1996). Recent advances in the genetics of oomycete plant pathogens. Mol Plant-Microbe lnteract 7,

Judelson, H. 5. & Whittaker, S. L. (1995). Inactivation of trans- genes in Phytophthora infestans is not associated with their deletion, methylation, or mutation. Curr Genet 28, 571-579. Judelson, H. S., Tyler, B. M. & Michelmore, R. W. (1991). Stable transformation of the oomycete pathogen Phytophthora infestans. Mol Plant-Microbe Interact 4, 602-607. Judelson, H. S., Dudler, R., Pieterse, C. M. J. & Unkles, 5. E. (1993). Expression and antisense inhibition of transgenes in Phyto- phthora infestans is modulated by choice of promoter and position effects. Gene 133, 63-69. Kamoun, S., Young, M., Glascock, C. B. & Tyler, B. M. (1993). Extracellular protein elicitors from Phytohpthora : host-specificity and induction of resistance to bacterial and fungal phyto- pathogens. Mol Plant-Microbe Interact 6, 15-22. Kamoun, S., van West, P., de long, A. J., de Groot, K. E., Vieeshouwers, V. G. A. A. & Covers, F. (1997). A gene encoding a protein elicitor of Phytophthora infestans is down-regulated during infection of potato. Mol Plant-Microbe Interact 10,13-20. Keller, H., Bonnet, P., Galiana, E., Pruvot, L., Friedrich, L., Ryals, J. & Ricci, P. (1 996). Salicylic acid mediates elicitin-induced sytemic acquired resistance, but not necrosis in tobacco. Mol Plant- Microbe Interact 9, 696-703. Le Berre, J.-Y., Panabibres, F., Ponchet, M., Deneroy, L., Bonnet, P., Marais, A. & Ricci, P. (1994). Occurrence of multiple forms of

302-304.

elicitins in Phytophthora cryptogea. Plant Physiol Biochem 32,

Moon, R. P., Unkles, 5. E., Duncan, 1. M., Hawkins, A. R. & Kinghorn, 1. R. (1992). Sequence of the Phytophthora infestans glyceraldehyde-3-phosphate dehydrogenase-encoding genes (gpdA). Plant Mol Biol 18, 1209-1211. Panabibres, F., Marais, A., Le Berre, J.-Y., Penot, I., Fournier, D. & Ricci, P. (1995). Characterisation of a gene cluster of Phytophthora cryptogea which codes for elicitins, proteins inducing a hyper- sensitive-like response in tobacco. Mol Plant-Microbe Interact 8,

Panabibres, F., Ponchet, M., Allasia, V., Cardin, L. & Ricci, P. (1997). Characterisation of border species among Pythiaceae : several Pythiums produce elicitins, typical proteins from Phytophthora spp. Mycol Res 101, 1459-1468. Penot, 1. (1996). Induction de necrose et de resistance chez le tabac par une famille de proteines fongiques; les elicitines. These de doctorat, Universitk Claude Bernard. Raeder, U. & Broda, P. (1985). Rapid preparation of DNA from filamentous fungi. Lett Appl Microbiol 1 , 17-20. Ricci, P. (1997). Induction of the hypersensitive response and systemic acquired resistance by fungal proteins : the case of elicitins. In Plant-Microbe Interactions, vol. 3, pp. 53-75. Edited by G. Stacey & N. T. Keen. New York: Chapman & Hall. Ricci, P., Bonnet, P., Huet, 1. C., Sallantin, M., Beauvais-Cante, F., Bruneteau, M., Billard, V., Michel, G. & Pernollet, 1. C. (1989). Structure and activity of proteins from pathogenic fungi Phytophthora eliciting necrosis and acquired resistance in tobacco. Eur J Biochem 183, 555-563. Ricci, P., Trentin, F., Bonnet, P., Venard, P., Mouton-Perronnet, F. & Bruneteau, M. (1 992). Differential production of parasiticein, an elicitor of necrosis and resistance in tobacco, by isolates of Phytophthora parasitica. Plant Pathol41, 298-307. Ricci, P., Panabibres, F., Bonnet, P. & 7 other authors (1993). Proteinaceous elicitors of plant defense responses. In Mechanisms of Plant Defense Responses, pp. 121-135. Edited by M. Legrand & B. Fritig. Dordrecht: Kluwer. Sambrook, 1.. Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Yu, L. M. (1995). Elicitins from Phytophthora and basic resistance in tobacco. Proc Natl Acad Sci USA 92,4088-4094. Yu, L. M. (1997). The isolation and assay of elicitins. In Methods in Plant Biochemistry and Molecular Biology, pp. 265-279. Edited by W. V. Dashek. New York: CRC Press.

251-258.

996-1003.

Received 2 February 1998; revised 3 August 1998; accepted 7 August 1998.

3349