National Institute of Nutrition and Seafood Research, Bergen, Norway

The aim of the present study was to examine whether a

combined plant protein and vegetable oil replacement (P

diet) of fish-based marine feed ingredients (F diet) imposes

oxidative stress on Atlantic salmon after short- and long-

term feeding. Oxidative stress was assessed by measuring a

suit of hepatic biomarkers, including TBARS, enzymatic and

transcriptional levels of a set of antioxidant proteins as well

as antioxidant vitamins. Antioxidants assessed regularly in

the long-term study were influenced by the dietary compo-

sitions, mostly influencing liver astaxanthin and tocopherols.

In the short-term crossover study, fish were sampled initially,

at Day 2 and at Day 17 after transfer to new diet. The results

showed that fish relocated from the F diet to the P diet had

significantly lower transcriptional levels of CuZn SOD (Day

2, P < 0.006) and Mn SOD (Day 17, P < 0.003), in addition

to lower levels of catalase protein (Day 17, P < 0.05) and

total glutathione (Day 17, P < 0.05). At Day 17, both groups

of fish relocated to new diets had significantly increased

transcriptional levels of GSH-Px (F-P: P < 0.05, P-F:

P < 0.007). This study showed that switching from a marine-

based to a plant-based diet affected Atlantic salmon gene

expression and the antioxidative defence in the fish.

KEY WORDSKEY WORDS: antioxidants, Atlantic salmon, oxidative stress,

plant ingredients, sustainable aquafeed, vitamins

Received 21 August 2009, accepted 26 January 2010

Correspondence: P.A. Olsvik, National Institute of Nutrition and Seafood

Research, N-5817 Bergen, Norway. E-mail: pal.olsvik@nifes.no

Salmonids in aquaculture are traditionally fed diets mainly

based on fish oil and fish meal extracted from wild catches.

Overfishing and the decline of wild stocks exploited to pro-

duce fish feed represent both an industrial and an ecological

challenge. This has created an urge to develop more sus-

tainable aquafeeds, with less reliance on wild fish stocks.

Among sustainable alternatives to fish oil and meal are

vegetable oils (VO) and plant proteins (PP). However, VO

and PP contain components that may be physiologically

challenging for salmonids. For example, VOs do not supply

long-chain n-3 fatty acids like eicosapentaenoic acid (20:5n-3;

EPA), docosapentaenoic acid (22:5n-3; DPA) and doc-

osahexaenoic acid (22:6n-3; DHA), but contain high levels of

n-6 fatty acids (18:2n-6) and monoene fatty acids, yielding a

low n-3/n-6 ratio. Likewise, soy, wheat and corn gluten used

as alternatives to fish meal contain high levels of nitrogen and

differ in their contents of indispensable amino acids (IAA�s)

(Torstensen et al. 2008). In addition to possible deficiencies

in essential amino acids and minerals, fish meal may also

contain antinutritional factors (ANFs) and complex carbo-

hydrates (NRC 1993; Francis et al. 2001; Vielma et al. 2003).

Several studies have indicated that replacement of fish oils

(FO) with VO in the diet in fact may enhance growth in

salmonids (Torstensen et al. 2005; Karalazos et al. 2007),

whereas PP-based diets may reduce growth (Espe et al.

2006). In Atlantic salmon (Salmo salar), VOs in the feed alter

the fatty acid composition of the liver cells (Jordal et al.

2007) leading to differences in the hepatic transcription

between dietary groups (Jordal et al. 2005; Panserat et al.

2008). Hence, including alternative dietary ingredients may

have a profound effect on metabolism and growth in fish.

Dietary nutrient and antioxidant composition have the

potential to influence the cellular composition and thus the

transcriptional patterns in an organism. Recently, it has

been shown that almost every level of gene expression is to

some degree regulated by different classes of small and

large non-coding RNAs (Mattick & Makunin 2005). For

example, dietary vitamin E has been shown to affect miRNA

2011 17; e424–e436. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

doi: 10.1111/j.1365-2095.2010.00778.x

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

� 2010 Blackwell Publishing Ltd

Aquaculture Nutrition

concentrations in rat liver (Gaedicke et al. 2008). In addition,

many dietary components such as B vitamins and methyl

donor nutrients are known to modulate DNA methylation,

and imbalances of nutrients in the diet can alter DNA

methylation status via epigenetic mechanisms (Choi et al.

2009). It has been shown that the cellular oxidant/antioxi-

dant balance is a key factor determining redox-dependent

signal transduction pathways in animals (Rimbach & De

Pascual-Teresa 2005). Antioxidants and nutrients may

interact with cellular receptors and affect key enzymes such

as phosphatases and kinases. Alterations in transcriptional

factors may further lead to changes in mRNA and protein

levels or directly interact with enzymes through protein–

protein binding properties. Transcription factors affected by

oxidative stress are involved in numerous signalling path-

ways, among them pathways related to cell division and

differentiation, immunological responses, cytokine expres-

sion and inflammatory responses, xenobiotic metabolism and

more (Di Giulio & Meyer 2008).

Oxidative stress describes a condition occurring when the

generation of reactive oxygen species (ROS) in a system

exceeds its ability to neutralize and eliminate them. Aerobic

animals generate ROS naturally during normal cellular

metabolism. Mitochondrial respiration is the most important

endogenous source of ROS (Fridovich 2004). In addition to

this endogenous generation of ROS, a long number of

environmental factors and chemical pollutants can generate

ROS and enhance oxidative stress. Elevated intracellular

ROS production may ultimately damage DNA, proteins and

lipids (Halliwell & Gutteridge 1999).

ROS can affect the transcription of many genes, either

acting via various transcription factors or directly as a

result of oxidative damage (Di Giulio & Meyer 2008). ROS-

generating agents are known to induce a battery of genes via

the electrophil response element (EPRE), also called the

antioxidant response element (ARE). Oxidative stress prob-

ably alters the activity of transcription factors by altering the

redox status of the cell. Transcription factors in eukaryotes

reported to be affected by ROS include AP-1, nrf-1, nrf-2,

glucocorticoid receptors, oestrogen receptors, aryl hydro-

carbon receptor and NF-jB (Di Giulio & Meyer 2008).

Alternative feed ingredients potentially altering growth and

intermediary metabolism may therefore be expected to affect

the oxidative homoeostasis in salmonid fish. Dietary imbal-

ances might promote increased ROS generations and thus

increased oxidative stress in fish with altered metabolism.

The aim of this experiment was firstly to examine potential

chronic hepatic oxidative stress in Atlantic salmon adapted

to diets consisting of either marine ingredients or a feed with

combined replacement of fish oil and fish meal with plant

ingredients for 12 months. Secondly, in an integrated short-

term crossover designed experiment, the fish were either fed

their original diets or transferred to the complementary diets

and followed for 17 days to record a potential acute oxida-

tive stress. The transcriptional levels of six genes encoding

proteins known to be affected by oxidative stress in animals,

CuZn superoxide dismutase (SOD), Mn SOD, catalase,

glutathione peroxidase (GSH-Px), glutathione reductase and

heat shock protein 70 (HSP70), were quantified in liver of the

fish at the start of the experiment and at days two and 17

after transfer (crossover) to the new diets. Oxidative stress

and protein markers included glutathione (GSH), thiobar-

bituric-reactive substances (TBARS), total SOD, Mn SOD,

catalase and GSH-Px. As an independent stress marker,

plasma cortisol levels were also assessed. The antioxidant

status of the experimental fish was evaluated, by assessing the

liver status of vitamin C (ascorbic acid), vitamin E (a and c

tocopherol) and astaxanthin (sum astaxanthin, all-trans

astaxanthin, 13-cis astaxanthin). Although a substantial

body of literature exists on the replacement of either fish

meal or fish oil in diets for Atlantic salmon, no studies have

addressed the combined replacement of fish oil and meal and

possible effects on oxidative stress. This paper is part of a

series of publications that address the combined effects of

both fish meal and fish oil replacement in feed for fish, as part

of an IP-EU project AQUAMAX (016249-2; Torstensen

et al. 2008). One aim of the AQUAMAX research pro-

gramme was to develop fish feeds based on sustainable

alternatives to fish meal and fish oil to produce healthy and

minimally contaminated fish being nutritious and acceptable

to consumers (http://www.aquamaxip.eu/).

Same populations of Atlantic salmon were used in the long-

term feeding experiment and an integrated crossover trial.

The long-term feeding experiment is described in detail by

Torstensen et al. (2008), as part of the AQUAMAX project.

In brief, the feeding trial was carried out at Matre Aqua-

culture Research Station (Matredal, Norway) during the

period June 22nd 2006–June 15th 2007. The Atlantic salmon

were obtained from Akva Gen A/S (Tingvoll, Norway). In

June 2006, approximately 6000 smolt with a mean weight of

355 ± 92 g (mean ± SE) were distributed equally into

twelve 10 m3 indoor fibreglass tanks containing 7 m3 sea-

water, with a continuous flow-through (� 52 L min)1) of

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e424–e436 � 2010 Blackwell Publishing Ltd

seawater (salinity 34.9 g L)1) from a deepwater inlet

(Matrefjord). Temperature was continuously automatically

recorded and regulated to 8.9 ± 0.1 �C. Oxygen was also

automatically recorded in the outlet water and was never

<80% saturation.

Fish in three randomized tanks were fed on two different

diets, followed in both the long-term study and used in the

crossover experiment: (i) a diet mainly based on fish meal and

fish oil (F diet) and (ii) a diet with an estimated safe maxi-

mum replacement of both fish meal and fish oil with vege-

table meal and vegetable oil (P diet). Antioxidant additives in

the two feeds as well as gross nutrient contents are presented

in Table 1. Detailed information on feed composition is

reported by Torstensen et al. (2008).

An overview of the crossover experiment is given in Fig. 1.

Fish in triplicate tanks per group were either fed their

original diets or transferred to respective complementary

diets in replicate tanks and monitored for about 3 weeks.

Prior to start of the main experiment (June 2006), fish fed the

F diet had been fin marked to make it possible to keep mixed

populations in the tanks. Fish were sampled at Day 0 before

Table 1 Composition of the two diets

(F – fish oil and fish meal–based diet,

P – plant protein and vegetable oil–

based diet) potentially affecting oxi-

dative status of the fish at the start of

the crossover experiment (Day 0)

Feed composition

Feed1

F P

Feed ingredients (g kg)1)

Wheat (Statkorn Norway) 127/157 111/124

Wheat gluten (Cerestar Scandinavia AS, Denmark) 0 150/150

Corn gluten (Cargill, USA) 0 150/150

Soybean meal (Denofa, Norway) 0 130/110

Krill meal (Aker Seafoods Antarctica ASA, Norway) 0 50/50

LT South American (Consortio, Chile) 620/560 120/120

Linseed oil (Elbe Fetthandel GmbH, Germany) 0 30/36

Palm oil (Denofa, Norway) 0 60/61

Rapeseed oil (Emmelev AS, Denmark) 0 110/110

Fish oil Nordic (Nordsildmel, Norway) 250/280 70/86

LL-Lysine (Ajinomoto Europe S.A.S., France) 0 13/0

Histidine-HCl (Kyowa Hakko Kogyo Co. Lid., Japan) 0 1/0

DLDL-methionine (Adisseo, France) 0 1/0

Analysed feed components (g kg)1)

Protein 431/433 442/419

Lipid 286/311 281/320

Ash 108/106 58/56

Dry matter 930/926 930/928

Energy (MJ kg)1) 23.8/24.2 24.8/25.1

TBARS (nmol g)1) 29.4 18.4

Polar lipids (% of lipid) 6.4/3.3 4.0/8.1

Neutral lipids (% of lipid) 93.5/91.9 96.1/96.7

Sum n-6 FA (% of lipid) 2.5/2.3 13.5/13.5

Sum n-3 FA (% of lipid) 25.2/24.7 16.3/20.2

n-3/n-6 ratio (unit) 10.1/10.7 1.2/1.5

Vitamin C (mg kg)1) 54 49

a-tocopherol (mg kg)1) 194 199

c-tocopherol (mg kg)1) 0 44

Astaxanthin (mg kg)1) 59 42

Cantaxanthin (mg kg)1) 0 0

TBARS, thiobarbituric-reactive substances.1 4 mm feed/6 mm feed size or only 6 mm feed size.

Figure 1 Design of the crossover experiment. Fish were sampled

initially before relocation to new tank, and at Day 2 and Day 17 after

transfer to the new diets.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e424–e436 � 2010 Blackwell Publishing Ltd

transfer, at Day 2 (2 days after transfer to the new diet) and

at Day 17 (17 days after transfer to the new diet). Three fish

were sampled from each tank at each sampling time point in

a nested ANOVAANOVA design (n = 9 in each group), all together

n = 18 at S1, n = 36 at S2 and n = 36 at S3 (N = 90).

Fish were anesthetized with benzocaine (7 g L)1) prior to

tissue sampling and killed by a blow to the head. Blood

samples for plasma cortisol measurements were extracted

from the caudal blood sinus with a heparinized syringe.

Plasma was separated from the blood by centrifugation

(2000 g, 10 min, 4 �C). Tissue samples from liver for RNA

and protein examination were dissected out and immediately

frozen in cryo tubes in liquefied nitrogen, and stored at

)80 �C until further processing. After weight and length

determination, the gender of the individuals was determined

by examination of the gonads.

Plasma cortisol levels were determined using a standardized

radioimmunoassay (RIA) method (125I cortisol kit; Bio-Rad

Laboratories, Richmond, CA, USA).

For the determination of antioxidant enzymes, liver samples

were prepared as described by Lygren et al. (1999). Selenium-

dependent glutathione peroxidase (GSH-Px) activity was

measured according to Bell et al. (1985), following the rate of

NADPH oxidation in the coupled reaction with glutathione

reductase. The assay was modified to a microtiter plate

technique (Lygren et al. 2000). Measurements and calcula-

tions of catalase activity, total superoxide dismutase (SOD)

activity (CuZn SOD + Mn SOD) and concentrations of

glutathione (GSH) and protein in homogenates were per-

formed as described by Lygren et al. (1999). KCN was used

to inactivate CuZn SOD and selectively record Mn SOD

activity. Enzyme activities are given as U mg)1 protein.

Vitamin C (total ascorbic acid) content of the liver (lg g)1)

was analysed by means of a reverse-phase high-performance

liquid chromatography (HPLC) method using electrochemi-

cal detection (Mæland & Waagbø 1998). Liver vitamin E was

measured as a- and c- tocopherol with HPLC and fluori-

metric detection (CEN, Comite Europeen de Normalisation

2000), and given as lg g)1.

Liver astaxanthin was determined by HPLC and reported

as sum astaxanthin, all-trans astaxanthin and 13-cis asta-

xanthin (Ørnsrud et al. 2004).

TBARS analysis was performed on liver samples according

to a colorimetric method based on a malondialdehyde stan-

dard and 2-thiobarbituric acid solution and reported as

nmol g)1 wet tissue (Schmedes & Hølmer 1989; Hamre et al.

2001).

Tissues were thoroughly homogenized before RNA extrac-

tion using zirconium beads (4 mm) in a Retsch MM 310

homogenizer (Retsch GmbH, Haan, Germany). Total RNA

from Atlantic salmon liver was extracted using the BioRobot

EZ1 and RNA Tissue Mini Kit (Qiagen, Hilden, Germany)

and treated with DNase according to the manufacturer�s

instructions and eluted in 50 lL RNase-free MilliQ H2O.

The RNA was then stored at )80�C before further process-

ing. The quality of the RNA was assessed with the Nano-

Drop ND-1000 UV-Vis Spectrophotometer (NanoDrop

Technologies, Wilmington, DE, USA) and the Agilent 2100

Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA).

The RNA 6000 Nano LabChip kit (Agilent Technologies,

Palo Alto, CA, USA) was used to evaluate the RNA integrity

of 12 randomly selected samples. The RNA integrity number

(RIN) was 9.1 or higher for all analysed samples.

A set of genes encoding oxidative stress markers was picked

for screening. Gene names, symbols and their function are

shown in Table 2. PCR primer sequences used for the

quantification of the reference genes encoding b-actin, elon-

gation factor 1 alpha (EF1A), acidic ribosomal protein

(ARP) and the target genes copper–zinc superoxide dismu-

tase (CuZn SOD), manganese superoxide dismutase (Mn

SOD), catalase, glutathione peroxidase (GSH-Px), glutathi-

one reductase and heat shock protein 70 (HSP70) are shown

in Table 2. The primer pairs amplify PCR products between

59–209 basepairs (bp) long. Table 2 also shows the GenBank

accession numbers of the examined genes and PCR efficien-

cies. PCR efficiencies ranged from 1.81–2.05.

A two-step real-time RT-PCR protocol was developed to

measure the mRNA levels of the six target genes in Atlantic

salmon. The RT reactions were run in triplicate on 96-well

reaction plates with the GeneAmp PCR 9700 machine

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e424–e436 � 2010 Blackwell Publishing Ltd

(Applied Biosystems, Foster City, CA, USA) using TaqMan

Reverse Transcription Reagent containing Multiscribe

Reverse Transcriptase (50 U lL)1) (Applied Biosystems,

Foster City, CA, USA). Twofold serial dilutions of total

RNA (a pool of all samples) were made for efficiency cal-

culations. Six serial dilutions (1000–31 ng) in triplicates were

analysed by qRT-PCR in separate sample wells and the

resulting Cts recorded. Total RNA input was 500 ng in each

reaction for all genes. No template control (ntc) and

RT-control (a duplicate RNA sample analysis where only the

RT enzyme is left out) reactions were run for quality assess-

ment. RT-controls were not performed for every individual

sample, but were run for each assay or gene, with the same

sample as used to make the dilution curves on the 96 well

plates. Reverse transcription was performed at 48 �C for

60 min by using oligo dT primers (2.5 lMM) for all genes in 30 ll

total volume. The final concentration of the other chemicals

in each RT reaction was: MgCl2 (5.5 mMM), dNTP (500 mM

of each), 10· TaqMan RT buffer (1·), RNase inhibitor (0.4

U lL)1) and Multiscribe reverse transcriptase (1.67 U ll)1).

Two microlitre cDNA from each RT reaction for all genes

was transferred to a new 96-well reaction plate and the real-

time PCR run in 20 lL reactions on the LightCycler 480

Real-Time PCR System (Roche Applied Sciences, Basel,

Switzerland). Real-time PCR was performed by using SYBR

Green Master Mix (LightCycler 480 SYBR Green master

mix kit; Roche Applied Sciences, Basel, Switzerland), which

contains FastStart DNA polymerase, and gene-specific

primers (500 nMM). PCR was achieved with initial denatur-

ation and enzyme activation for 5 min at 95 �C, followed by

40 cycles of 10 s denaturation at 95 �C, 20 s annealing at

60 �C and 30 s elongation at 72 �C.

To evaluate the stability of the three selected reference genes,

the geNorm tool was used (Vandesompele et al. 2002). The

Ct values were transformed to quantities using gene-specific

PCR efficiencies, according to the geNorm manual. geNorm

determines the individual stability of a gene within a pool of

genes, given as the M value, and calculates the stability

according to the similarity of their expression profile by pair-

wise comparison, using the geometric mean as a normalizing

factor. The M values for the three examined reference genes

ranked between 0.63–0.65 when all 90 samples were evalu-

ated together. All three reference genes were therefore

included calculating the normalization factor. One-way

ANOVAANOVA with Neuman Keuls post hoc test was used to calculate

differences in transcriptional and protein levels. Spearman

rank correlation was used for non-parametric correlation

analysis between parameters (between plasma cortisol and

gene transcript levels at Day 2 and between plasma cortisol,

TBARS, GSH, protein activities and gene transcript levels at

Day 17). An a level of 0.05 was considered significant. Values

are given as mean ± SE.

The composition of nutrients and antioxidants in the two

experimental feeds is shown in Table 1. For some of the

parameters, data are shown for both the 4 mm feed size used

early in the feeding trial and the 6 mm feed size used later on

and during the crossover experiment. The levels of ash and

TBARS, as well as the n-3/n-6 lipid ratio, were lower in the

plant-based diet (P diet) compared to the marine diet (F diet),

whereas the sum of n-6 fatty acids (FA) and c-tocopherol

levels were higher in the P diet.

The levels of a number of antioxidants in liver of the fish were

measured at five time points during the long-term feeding

Table 2 PCR primers, amplicon sizes, accession numbers and PCR efficiencies

Gene Accession no. Forward primer 5¢ – 3¢ Reverse primer 5¢ – 3¢ Amplicon size (bp) PCR efficiency

B-actin BG933897 CCAAAGCCAACAGGGAGAA AGGGACAACACTGCCTGGAT 92 2.04

EF1AB AF321836 TGCCCCTCCAGGATGTCTAC CACGGCCCACAGGTACTG 59 2.05

ARP AY255630 TCATCCAATTGCTGGATGACTATC CTTCCCACGCAAGGACAGA 101 1.81

Cu/Zn SOD BG936553 CCACGTCCATGCCTTTGG TCAGCTGCTGCAGTCACGTT 140 2.04

Mn SOD DY718412 GTTTCTCTCCAGCCTGCTCTAAG CCGCTCTCCTTGTCGAAGC 209 1.89

Catalase BG935638 GGGCAACTGGGACCTTACTG GCATGGCGTCCCTGATAAA 59 2.03

GSH-Px BE518588 GATTCGTTCCAAACTTCCTGCTA GCTCCCAGAACAGCCTGTTG 140 1.96

GR BG934480 CCAGTGATGGCTTTTTTGAACTT CCGGCCCCCACTATGAC 61 2.01

HSP70 BG933934 CCCCTGTCCCTGGGTATTG CACCAGGCTGGTTGTCTGAGT 121 2.05

ARP, acidic ribosomal protein; SOD, superoxide dismutase; GSH, glutathione; GR, glutathione reductase; HSP, heat shock protein.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e424–e436 � 2010 Blackwell Publishing Ltd

trial from which the fish used in the crossover experiment

were taken from, summarized in Table 3. Seven parameters

were quantified in the liver of postsmolt fed the F diet in June

2006 at the start of the experiment. At September 2006,

November 2006, and February 2007 and in June 2007, the

same parameters as well some additional markers were

quantified in salmon fed both diets. Four of the quantified

parameters showed differences between the dietary groups

throughout the year. Liver glutathione (GSH) was moder-

ately higher in the liver of the P compared to F groups, with

significant difference in September. a-tocopherol was 14–

25% higher in P compared to F group during the first period

(P < 0.05 in November), while from February onwards, the

opposite trend (P 20% lower than F) was seen (P < 0.05).

c-tocopherol was only observed in the P group (not present

in the F group). From February, liver astaxanthin levels were

approximately three times higher in the F groups than the P

groups (P < 0.05).

No significant weight differences were observed in sampled

fish between the groups initially and at the Day 2 and Day 17

samplings. The fish were in average weighing 2.15 ± 0.41 kg

(lower and upper 95% Cl of geometric mean: 2.12–2.20 kg)

(mean ± SE; N = 90). Visual inspection of intestinal con-

tent in the sampled fish at Day 2 indicated that few of the fish

transferred to another diet (F-P and P-F) had comparable

feed intakes to fish continuing on the same diets (F-F and

P-P). Plasma cortisol levels, a primary stress response

parameter, were quantified at Day 2 and Day 17 during the

crossover experiment (Fig. 2). No differences were observed

between the four dietary groups (F-F, F-P, P-P, P-F) at Day

2. At Day 17, significant lower cortisol levels were observed

in the P-F group compared to the F-F, F-P and P-P groups

(one-way ANOVAANOVA, Neuman Keuls post hoc test, P < 0.05).

The transcriptional levels of six commonly studied oxida-

tive stress marker genes are presented in Fig. 3. These genes

were CuZn SOD, Mn SOD, catalase, GSH-Px, glutathione

reductase and HSP70. At Day 0, data are presented from fish

fed the two diets (F and P); at Day 2 and Day 17, data are

presented from fish kept at their original diets (F-F or P-P)

and from fish transferred to the complimentary diets (F-P or

P-F). Of the six target genes, only CuZn SOD (Fig. 3a)

showed any significant difference in transcriptional levels in

the liver at the start of the crossover experiment (Day 0),

being lower in fish from the P group than in fish from the

F group (one-way ANOVAANOVA, Neuman Keuls post hoc test,

P < 0.005). At Day 2, two days after transfer to the Table

3Long-term

antioxidativeparametersin

liver

ofthefish

fedthetw

oexperim

entaldiets

FandP

Sam

plin

g(w

eek)

N

Jun

e2006

Sep

tem

ber

2006

No

vem

ber

2006

Feb

ruary

2007

Jun

e2007

An

aly

sis

(un

it)

FF

PF

PF

PF

P

Mean

SEM

ean

SEM

ean

SEM

ean

SEM

ean

SEM

ean

SEM

ean

SEM

ean

SEM

ean

SE

To

tal

GSH

-Px

(Ug

)1)

3420

424

21

668

412

474

33

218

393

675

22

971

448

614

13

462

399

227

17

891

565

095

51

954

449

959

7107

521

663

14

637

544

133

16

899

SeG

SH-P

x(U

g)

1)

3312

397

14

511

326

432

17

751

279

163

13

437

403

774

20

204

298

136

36

713

GSH

(lm

ol

g)

1)

31.7

0.1

2.8

0.1

**

3.3

0.0

3.0

0.1

3.3

0.1

3.2

0.1

43.3

0.1

12.6

0.3

3.0

0.1

TB

AR

S(n

mo

lg

)1)

35.6

0.2

6.6

0.6

5.7

0.5

6.4

0.2

6.4

0.7

5.8

0.1

5.7

0.4

5.3

0.1

5.3

0.4

Asc

orb

icaci

d(l

gg

)1)

369

1139

10

157

9160

7147

7101

1110

389

5108

9

a-To

cop

hero

l(l

gg

)1)

3462

24

293

16

335

23

259

10*

324

14

669

33*

531

11

778

20*

623

47

c-To

cop

hero

l(l

gg

)1)

30

00

0***

19

20

0***

23

20

0***

21

30

0***

40

5

To

tal

SOD

(Um

g)

1p

rote

in)

327.9

1.4

25.9

2.1

27.0

0.6

*23.6

0.8

Mn

SOD

(Um

g)

1p

rote

in)

310.3

2.2

7.7

2.3

7.1

1.0

5.9

2.2

Cata

lase

(Um

g)

1p

rote

in)

3438

7447

13

469

11

446

15

Sum

ast

axa

nth

in

(lg

g)

1)

30.8

0.3

0.6

0.2

6.1

0.7

*2.3

1.1

4.8

1.0

*1.8

0.2

TB

AR

S,th

iob

arb

itu

ric-

react

ive

sub

stan

ces;

GSH

,g

luta

thio

ne;

GSH

-Px,

glu

tath

ion

ep

ero

xid

ase

.

Mean

±SE

*=

P<

0.0

5.

**

=P<

0.0

1,

***

=P<

0.0

01

sho

win

gst

ati

stic

all

yd

iffe

ren

ces

betw

een

die

tary

treatm

en

tsw

ith

ineach

tim

ep

oin

t.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e424–e436 � 2010 Blackwell Publishing Ltd

complimentary diets, a significant down-regulation in CuZn

SOD was observed in fish transferred from the marine diet to

the vegetable-based diet (F-P group, P = 0.047). The same

pattern was observed at Day 17, with a significant down-

regulation of CuZn SOD in the F-P group (P = 0.046).

Compared to the initial transcription levels at Day 0, there

was a significant drop in CuZn SOD expression for all four

groups both at Day 2 and at Day 17 (P < 0.011). For Mn

SOD (Fig. 3b), no significant difference was observed

between fish from the four groups at Day 2. At Day 17, there

was a significant lower expression of Mn SOD in fish from

the F-P group compared to the F-F group (P = 0.002), the

same pattern as observed for CuZn SOD. The F-F group at

Day 17 also showed a higher transcript level than in the Day

0 P group (P = 0.029), whereas the Day 17 F-P transcript

level was significantly lower than the Day 2 F-F and P-F

levels (P < 0.05). Catalase showed no significant differences

between fish from the four groups either at Day 2 or at Day

17 (Fig. 3c). The P-F group at Day 2, however, showed

significantly higher expression of catalase than the initial

levels at Day 0 (both for the F and P groups, P < 0.03) and

also compared to the F-P group at Day 17 (P = 0.047).

No significant differences were observed between any of

fish groups for GSH-Px at Day 2 (Fig. 3d); however, at Day

17, both groups transferred to new diets showed increased

transcript levels compared to the groups fed their original

diets (F-P, P = 0.044; P-F, P = 0.006). The transcriptional

levels in these groups were also significantly higher than in all

other groups at Day 0 and at Day 2 (P < 0.05). Only small

differences were observed for glutathione reductase, with no

significant differences between the fish groups either at Day 2

or at Day 17 (Fig. 3e). The transcript level was significantly

higher in fish from the F-F group at Day 17 compared to fish

from the P group at Day 0 and to the P-P group at Day 2

(P < 0.05). Although no significant differences in HSP70

transcript levels were observed between any of the fish groups

at Day 2 (Fig. 3f), the transcriptional levels of this stress-

inducible gene were higher in all four groups at Day 2

compared to the initial levels at Day 0 (P < 0.013). In

addition, the transcript level was significantly lower in fish

transferred to the plant-based diet (F-P) at Day 17 compared

to the fish kept on the marine-based diet (P = 0.037).

To verify the transcriptional measurements, the levels of

four oxidative stress protein markers, CuZn SOD, Mn SOD,

catalase and GSH-Px, as well as total GSH and TBARS,

were quantified in all diet groups at Day 17 (Fig. 4). Fish

from the marine-based diet transferred to the vegetable diet

(F-P) had significantly lower total GSH levels compared to

the fish kept on a marine diet (F-F) (one-way ANOVAANOVA, Neu-

man Keuls post hoc test, P < 0.05) (Fig. 4a). Both groups

transferred to new diets had lower levels of catalase com-

pared to fish from the groups kept on their original diets

(Fig. 4c, P < 0.05). No significant differences were observed

between the four different groups for CuZn SOD (Fig. 4b),

Mn SOD (Fig. 4d), GSH-Px (Fig. 4e) or TBARS (Fig. 4f ).

The measured levels of antioxidant vitamins in the fish were

different for some of the parameters between the dietary

groups (Fig. 5).

For biomarker assessment, Spearman rank correlation

analysis was performed between the individual parameters

(n = 36; P < 0.05 significance levels mentioned below). At

Day 2, positive correlations were observed between plasma

cortisol levels and CuZn SOD and Mn SOD transcript levels

(r = 0.35 and r = 0.51, respectively, N = 36). Catalase and

HSP70, both of which showed elevated levels at Day 2, were

positively correlated to CuZn SOD (r = 0.55 and r = 0.36,

respectively). Catalase was also positively correlated to Mn

SOD (r = 0.41), whereas HSP70 was negatively correlated

to GSH-Px (r = )0.33). CuZn SOD was also positively

correlated to Mn SOD, catalase, glutathione reductase and

HSP70 (r > 0.36), while Mn SOD was positively correlated

with glutathione reductase (r = 0.48). In addition, positive

correlation was observed between GSH-Px and glutathione

reductase (r = 0.41), and negative correlation between GSH-

Px and HSP70 (r = )0.33) at Day 2.

At Day 17, plasma cortisol levels were positively correlated

to catalase and negatively correlated to GSH-Px transcript

Figure 2 Plasma cortisol levels at Day 2 and Day 17. Statistical

analyses between the treatment groups were done independently at

each sampling time. Bars represent means ± SE and significant

differences between treatment groups are represented by different

letters (one-way ANOVAANOVA, n = 9, P < 0.05).

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e424–e436 � 2010 Blackwell Publishing Ltd

levels (r = 0.37 and r = )0.55, respectively, N = 36).

TBARS was positively correlated to HSP70 transcript levels

(r = 0.46), while protein GSH-Px activity levels were posi-

tively correlated to total SOD protein (r = 0.49) and nega-

tively correlated to Mn SOD protein activity levels

(r = )0.39). Mn SOD and catalase protein activity levels

were also positively correlated to GSH levels (r = 0.44 and

r = 0.54). Comparing protein activity and transcript levels,

only catalase showed positive correlation (r = 0.35) at Day

17. No significant correlations were observed between GSH-

Px, total SOD and Mn SOD protein activity levels and their

corresponding transcript levels. Looking at the transcrip-

tional levels of the six examined genes, CuZn SOD was

positively correlated to Mn SOD, catalase, glutathione

reductase and HSP70 (r > 0.43) and negatively correlated to

GSH-Px (r = 0.45). Mn SOD was positively correlated to

catalase, glutathione reductase and HSP70 (r > 0.53), while

catalase was positively correlated to HSP70 (r = 0.67) and

negatively correlated to GSH-Px (r = )0.46). GSH-Px was

also negatively correlated to HSP70 (r = )0.41).

In the long-term feeding trial, replacing 80% of fish meal

with plant proteins and 70% of the fish oil with a vegetable

oil blend resulted in a 9% growth reduction observed during

the production phase in seawater (Torstensen et al. 2008).

This growth reduction was mainly related to lower feed

intake during the first 3 months, because of an interaction

effect of high plant protein and vegetable oil replacement.

The present communication addresses the combined effects

of both fish meal and fish oil replacement in feed for Atlantic

(a)

(c)

(e)

(b)

(d)

(f)

Figure 3 Liver transcriptional levels of

(a) CuZn SOD, (b) Mn SOD, (c) Cata-

lase, (d) GSH-Px, (e) glutathione reduc-

tase (GR) and (f) HSP70. MNE = mean

normalized expression. Bars represent

means ± SE, and significant differences

between treatment groups are repre-

sented by different letters (one-way

ANOVAANOVA, Neuman Keuls post hoc test,

n = 9, P < 0.05).

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e424–e436 � 2010 Blackwell Publishing Ltd

salmon on the hepatic oxidative status. The results showed

that the oxidative pressure and parts of the antioxidant

defence were affected by the dietary composition, both

during long-term feeding and shortly after diet crossover.

An array of traditional and novel molecular markers of

the integrated antioxidative defence was applied to possibly

identify how the diets influenced the antioxidant defence.

One obvious way is through the dietary content of antioxi-

dant micronutrients. Liver status of vitamins C and E, as well

as astaxanthin in Atlantic salmon, is heavily influenced by

their dietary concentrations, bioavailability, as well as

interacting with other nutrients and environmental factors

(Waagbø et al. 1993; Lygren et al. 2000; Hamre et al. 2004).

This was also observed in the present study. The composi-

tions of the two diets were assumed to cover the requirement

for all nutrients (NRC (National Research Council) 1993),

through both inherent nutrients in diet ingredients and added

micronutrient premixes. The inherent levels of nutrients vary

between marine and plant feed ingredients, which include

both the supply of antioxidative nutrients and the pro-

oxidative compounds. The feed oxidative status (TBARS)

was somewhat higher in the marine diet (F diet) compared to

the plant diets (P diet), which may be because of the inherent

levels of plant antioxidants like c-tocopherol (44 mg kg)1),

while feed a-tocopherol was similar among the marine and

plant diet. In compound fish feed, vitamin C normally arises

entirely from an added stable ascorbate phosphate derivative,

and the levels were relatively similar in the present diets.

Total astaxanthin level in the plant diet was �25% lower

than in the F diet, because of the natural higher content of

this carotenoid in the present marine ingredients. This was

also reflected in the lower astaxanthin levels in the P diet fed

salmon.

In the long-term feeding trial, liver ascorbic acid was equal

among the groups despite some minor fluctuations. Liver

status and tissue saturation have been shown to adjust to

(a)

(c)

(e)

(b)

(d)

(f)

Figure 4 Liver protein markers of oxi-

dative stress at Day 17. (a) Glutathione

(GSH) (lmol g)1), (b) total SOD

(U mg)1 protein), (c) Catalase (U mg)1

protein), (d) Mn SOD (U mg)1 protein),

(e) GSH-Px (U mg)1 protein and (f)

TBARS (nmol g)1).

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e424–e436 � 2010 Blackwell Publishing Ltd

both dietary vitamin C levels and feed intake (Waagbø et al.

1993), be negatively influenced by oxidative conditions like

oxygenation (Lygren et al. 2000), while not influenced by

interacting pro- and antioxidant nutrients [Lygren et al.

2000; K. Hamre (unpublished results)].

Despite similar feed vitamin E level, liver a-tocopherol

varied �20% among the dietary groups during the long-term

study, obviously influenced by interacting factors. Several

factors are suggested to affect the requirement for vitamin E,

such as water temperature, concentration of selenium and

other dietary antioxidants, the quantity and quality of the

lipid source, and the developmental stage of the fish (Hamre

& Lie 1995; Hamre et al. 1997). In a recent publication on

nutrient interactions in the antioxidant system in adult

Atlantic salmon, K. Hamre (unpublished results) showed

that liver a-tocopherol correlated positively with the dietary

vitamin E level, while negatively with the dietary lipid level

(150 versus 320 g kg)1). Further, salmon liver a-tocopherol

was negatively influenced by water superoxygenation (Ly-

gren et al. 2000) and vaccination (Lygren et al. 2001). Under

extreme conditions, like vitamin E deficiency, vitamin C may

promote a vitamin E sparing effect and thereby delay the

introduction of vitamin E deficiency symptoms (Hamre et al.

1997). In the present study, the considerable amount of

c-tocopherol in the plant feed only, was seen in the plant fed

salmon livers in a minor amount. This form of tocopherol

probably exhibited most of its antioxidant protection in the

diet until absorbed, because it is not readily retained in the

tissues like the a-tocopherol. The dietary a-tocopherol does

not possess same feed protection because it is supplemented

in a stable a-tocopheryl acetate form.

The higher feed astaxanthin in the F diet compared to the

P diet resulted in significantly higher liver concentrations in

February and June, when muscle retention was at highest

(data not shown). Both all-trans and 13-cis astaxanthin iso-

mers were elevated (Fig. 5). Besides the dietary content,

several dietary oxidative and antioxidative nutrients have

been shown to affect liver astaxanthin status positively, like

vitamin E and lipid level (Hamre et al. 2004).

Among the measured endogenous antioxidants, liver GSH

(P > F) and total SOD activity F > P) were significantly

different between the dietary groups in September and June,

respectively. These effects are coherent with the respective

change in vitamin E status and oxidative status in the diet-

ary groups at these sampling points. At the sampling in

February, after which the short-term crossover study was

performed, liver a-tocopherol and total astaxanthin concen-

trations were significantly higher in the F than in the P group,

while c-tocopherol was only observed in the P group. The

oxidative status measured as TBARS and GSH and other

recorded endogenous and nutrient antioxidants were how-

ever equal between those two dietary groups.

The observed antioxidant differences in the two experi-

mental diets, i.e. the lower levels of ash (elements), TBARS

and n-3/n-6 lipid ratio, and the higher levels of n-6 fatty acids

and c-tocopherol in the vegetable-based diet compared to the

marine diet, could affect the antioxidant defence in the fish at

dietary change. In the crossover study, salmon previously fed

the F diet was transferred to respective tanks fed the P diet

(F-P), and vice versa (P-F), ending out with two groups of

fish with diet change and two controls continuing on the

same diets (F and P).

Compared to the long-term trial, the composition of the

two experimental diets probably had only minor effects on

growth during the short-term crossover study that lasted for

only 24 days. Normally, salmon show an adaption period

after change in diet, with lower feed intakes. This was con-

firmed in the present study, where only a few of the crosse-

dover individuals sampled 2 days after the shift in feed had

food in the intestine.

Figure 5 All-trans and 13-cis astaxanthin levels in liver of ongrowing

fish from the long-term feeding trial sampled in November 2006,

February 2007 (before the crossover experiment) and in June 2007.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e424–e436 � 2010 Blackwell Publishing Ltd

A number of parameters have been used to assess oxidative

stress in animal cells, caused either by excessive production of

ROS or by reduced antioxidant defence (Armstrong 2002).

Even so, no distinct single marker of oxidative stress has been

identified in fish, probably because of a number of con-

founding factors (van der Oost et al. 2003). One reason for

this could be that most fish populations are highly outbred

with a high degree of genetic variability compared to typical

laboratory mammalian models (Di Giulio & Meyer 2008).

Superoxide dismutases (SOD) are metalloenzymes that cat-

alyse the dismutation of superoxide anion (O2·)) into O2 and

hydrogen peroxide (H2O2) (Fridovich 1986). The CuZn SOD

(SOD1) is localized in the cytosol and nucleus, while Mn

SOD (SOD2) is located within the mitochondrial matrix.

Subsequently, H2O2 is reduced to H2O by glutathione per-

oxidases (GSH-Px) in the cytosol or by catalase in the per-

oxisomes. SOD, catalase and GSH-Px, together with

glutathione-S-transferases (GST) and glutathione reductase,

are easily induced by oxidative stress, and the activity levels

of these enzymes have therefore been used to quantify oxi-

dative stress in cells (van der Oost et al. 2003). The initial

transcriptional levels of CuZn SOD suggest that the P diet

mediated a lower superoxide production in the examined

liver cells, because this gene was lower expressed in liver of

fish from the P group at the start of the crossover experiment

(Day 0). The reason for this differential expression is not

known, but we have observed that the baseline transcript

levels of several oxidative stress relevant genes in untreated

salmon are asymmetrically expressed in liver of fish fed

soybean oil-based diets compared to fish fed fish oil–based

diets. These genes include GSH-Px, p-class GST, HSP70,

metallothionein, CYP1A, CYP2M1, CYP3A and PPARc

(unpublished results), in line with previous studies showing

differences in salmonid hepatic gene expression following

replacement of dietary fish oil and fish meal with plant

ingredients (Jordal et al. 2005; Panserat et al. 2008; Tor-

stensen et al. 2009). In particular, changes have been seen in

the transcriptional levels of genes involved in metabolic

pathways such as energy metabolism, fatty acid metabolism

and detoxification.

Plant feed reduced the transcriptional levels of CuZn SOD

in salmon transferred from the marine- to the plant-based

diet (F-P) at Day 2, suggesting that the cells were more

susceptible to oxidative stress (lower protection) in this

group. This finding was also supported by the Mn SOD

transcript data at Day 17, indicating lower protection against

mitochondrial oxidative stress in fish fed a marine-based diet

transferred to a plant-based diet. The ingredients in the P diet

may mediate lower ROS production and thus reduced oxi-

dative stress in liver cells of the fish fed P diet, as also dem-

onstrated in the long-term study. These results were,

however, not supported by the liver total SOD and Mn SOD

enzyme activities, as measured at Day 17, further empha-

sizing the low correlation often seen between mRNA and

protein abundances, especially for long-lived proteins

(Anderson & Seilhamer 1997). Only catalase displayed a

significant positive correlation between activity and tran-

scriptional levels (Spearmen rank order correlation). Both

liver glutathione (GSH) levels and catalase activity were

significantly lower in the F-P group compared to the F-F

group at Day 17, clearly suggesting that the transfer to a

plant-based diet affected the antioxidant defence in the fish.

The antioxidant GSH plays a central role in protecting cells

from oxidative modification in proteins, lipids and DNA.

Processes that induce GSH depletion, either via GSH con-

jugation or via oxidation of GSH to glutathione disulphide

(GSSG), alter the mechanism of natural cellular defence

against ROS. Thus, GSH depletion may render the cells more

vulnerable to oxidative stress. Reduced levels of catalase

activity at Day 17 in the F fish transferred to the P diet may

also result from altered b-oxidation of fatty acids in the

peroxisomes. The transcriptional levels of catalase at Day 17,

however, were not significantly different between the four

dietary groups, even though the mRNA pattern resembled

the protein pattern.

At Day 17, the transcriptional levels of GSH-Px were sig-

nificantly increased in fish from both groups crossed-over to

new diets. The GSH-Px protein activity assay did not verify

this increased expression, most likely because the mRNA

assay quantify the levels of plasma GSH-Px (GPx3), whereas

the protein assay quantifies the total level of selenocystein

GSH-Px, which includes four selenium-dependent GSH-Pxs

in mammals (Di Giulio &Meyer 2008). Clearly, the new diets

at this time point created a need to detoxify increased cellular

levels of H2O2 or to reduce fatty acid peroxides (LOOH).

GSH-Px can, unlike catalase, also reduce lipid peroxides (Di

Giulio & Meyer 2008). This finding suggests that adaptation

to new diets affected the hepatic levels of polyunsaturated

fatty acids (PUFAs), one of the most studied targets of ROS.

Thus, GSH-Px mRNA seems to be a good bioindicator of

dietary oxidative stress in liver of salmon. The increased levels

of GSH-Px in these individuals may have contributed to a

reduced stress level, as suggested by the significantly lower

levels of plasma cortisol in fish from the P-F group.

In addition to the above-mentioned effects, the transcrip-

tional data also suggest that the fish have been affected by

handling stress, because both the catalase and HSP70 mRNA

levels were higher in all four dietary groups at Day 2

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e424–e436 � 2010 Blackwell Publishing Ltd

compared to the control at Day 0. Stress proteins such as

HSP70 are primarily acute-phase chaperone proteins that are

up-regulated during proteolysis and participate in folding

and transport of newly synthesized proteins. Environmental,

chemical and physiological stress as well as oxidative stress

can all lead to increased synthesis of heat-shock proteins

(HSPs) in animals (Halliwell & Gutteridge 1999; Kalmar &

Greensmith 2009). HSPs are generally considered to be good

indicators of cellular stress in animals (Wegele et al. 2004)

and although their induction may be fast, the turnover is

slower and the proteins tend to accumulate upon prolonged

cellular stress (Schlenk et al. 2008). Two isoforms of HSP70

exist in the cytosol of mammalian cells, a constitutively

expressed 73 kDa form (HSC70) and a stress-inducible

70 kD form (HSP70) (Wegele et al. 2004), whereas several

isoforms of the inducible form have been found in teleostean

fishes (discussed in Iwama et al. 1998). In fish, however,

Iwama et al. (2004) questioned the use of HSPs as indicators

of stressed states and suggested that their use as biomarkers

of stress in teleosts is premature. Zarate & Bradley (2003)

examined how HSPs responded to hatchery stress in the

Atlantic salmon and concluded that HSP70 is not a sensitive

indicator to aquacultural disturbances like feed deprivation,

anaesthesia, capture stress, crowding stress, formalin,

hyperoxia and hypoxia. The current study, however, clearly

suggest that HSP70 mRNA can be a good indicator of

handling stress in Atlantic salmon.

In conclusion, this study showed that components in the

plant-based diet, such as tocopherols and astaxanthin, can

affect the antioxidative defence system in Atlantic salmon

compared to traditional diets based on marine ingredients,

both acutely after a shift in feed and chronically after long-

term feeding.

We thank Arnor Gullanger (IMR, Matre Aquaculture

Research Station) for fish husbandry and Jacob Wessels,

Leikny Fjeldstad and Hui-shan Tung (NIFES) for help with

technical work and molecular analyses. This study was fun-

ded by the IP-EU project �AQUAMAX� (016249-2) and by

the National Institute of Nutrition and Seafood Research

(NIFES), Bergen, Norway.

Anderson, L. & Seilhamer, J. (1997) A comparison of selected

mRNA and protein abundances in human liver. Electrophoresis,

18, 533–537.

Armstrong, D. (2002) Oxidative stress, biomarkers and antioxidant

protocols. In: Methods in Molecular Biology (Walker, J.M. ed),

pp.1–322. Humana Press, Totowa, NJ, USA.

Bell, J.G., Cowey, C.B., Adron, J.W. & Shanks, A.M. (1985) Some

effects of vitamin E and selenium deprivation on tissue enzyme

levels and indices of tissue peroxidation in rainbow trout (Salmo

gairdneri). Br. J. Nutr., 53, 149–157.

CEN (Comite Europeen de Normalisation) (2000) F. Determination

of vitamin E by high performance liquid chromatography -

Measurement of alpha-, beta-, gamma- and delta-tocopherols.

Reference: EN 12822.

Choi, S.-W., Corroher, R. & Friso, S. (2009) Nutrients and DNA

methylation. In: Nutrients and Epigenetics (Choi, S.-W. & Friso, S.

eds), pp. 105–125. CRC Press, Boca Raton, FL, USA.

Di Giulio, R.T. & Meyer, J.N. (2008) Reactive oxygen species and

oxidative stress. In: The Toxicology of Fishes (Di Giulio, R.T. &

Hinton, D.E. eds), pp. 273–324. CRC Press, Boca Raton, FL,

USA.

Espe, M., Lemme, A., Petri, A. & El-Mowafi, A. (2006) Can Atlantic

salmon (Salmo salar) grow on diets devoid of fish meal? Aqua-

culture, 255, 255–262.

Francis, G., Makkar, H.P.S. & Becker, K. (2001) Antinutritional

factors present in plant-derived alternate fish feed ingredients and

their effects in fish. Aquaculture, 199, 197–227.

Fridovich, I. (1986) Superoxide dismutases. Adv. Enzymol., 58, 61–

97.

Fridovich, I. (2004) Mitochondria: are they the seat of senescence?

Aging Cell, 3, 13–16.

Gaedicke, S., Zhang, X.N., Schmelzer, C., Lou, Y.J., Doering, F.,

Frank, J. & Rimbach, G. (2008) Vitamin E dependent microRNA

regulation in rat liver. FEBS Lett., 582, 3542–3546.

Halliwell, B. & Gutteridge, M.C. (1999) Free Radicals in Biology and

Medicine. 3rd edn. Oxford Science Publication, Oxford, NY, USA,

pp. 1-936.

Hamre, K. & Lie, Ø. (1995) Minimum requirement of vitamin E for

Atlantic salmon (Salmo salar) at startfeeding. Aquacult. Res., 26,

175–184.

Hamre, K., Waagbø, R., Berge, R.K. & Lie, Ø. (1997) Vitamins C

and E interacts in juvenile Atlantic salmon (Salmo salar, L.). Free

Rad. Biol. Med., 22, 137–149.

Hamre, K., Naess, T., Espe, M., Holm, J.C. & Lie, Ø. (2001) A

formulated diet for Atlantic halibut (Hippoglossus hippoglossus, L.)

larvae. Aquacult. Nutr., 7, 123–132.

Hamre, K., Christiansen, R., Waagbø, R., Maage, A., Torstensen,

B., Lygren, B., Lie, Ø., Wathne, E. & Albrektsen, S. (2004)

Antioxidant vitamins, minerals and lipid levels in diets for Atlantic

salmon (Salmo salar, L.): effects on growth performance and fillet

quality. Aquacult. Nutr., 10, 113–123.

Iwama, G.K., Thomas, P.T., Forsyth, R.B. & Vijayan, M.M. (1998)

Heat shock protein expression in fish. Rev. Fish Biol. Fish., 8,

35–56.

Iwama, G.K., Afonso, L.O.B., Todgham, A., Ackerman, P. &

Nakano, K. (2004) Are HSPs suitable for indicating stressed states

in fish? J. Exp. Biol., 207, 15–19.

Jordal, A.E.O., Torstensen, B.E., Tsoi, S., Tocher, D.R., Lall, S.P. &

Douglas, S.E. (2005) Dietary rapeseed oil affects the expression of

genes involved in hepatic lipid metabolism in Atlantic salmon

(Salmo salar L.). J. Nutr., 135, 2355–2361.

Jordal, A.-E.O., Lie, Ø. & Torstensen, B.E. (2007) Complete

replacement of dietary fish oil with a vegetable oil blend affect liver

lipid and plasma lipoprotein levels in Atlantic salmon (Salmo salar

L.). Aquacult. Nutr., 13, 114–130.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e424–e436 � 2010 Blackwell Publishing Ltd

Kalmar, B. & Greensmith, L. (2009) Induction of heat shock pro-

teins for protection against oxidative stress. Adv. Drug Del. Rev.,

61, 310–318.

Karalazos, V., Bendiksen, E.A., Dick, J.R. & Bell, J.G. (2007) Effects

of dietary protein, and fat level and rapeseed oil on growth and

tissue fatty acid composition and metabolism in Atlantic salmon

(Salmo salar L.) reared at low water temperatures. Aquacult. Nutr.,

13, 256–265.

Lygren, B., Hamre, K. & Waagbø, R. (1999) Effects of dietary pro-

and antioxidants on some protective mechanisms and health

parameters in Atlantic salmon (Salmo salar). J. Aquat. Anim.

Health, 11, 211–221.

Lygren, B., Hamre, K. & Waagbø, R. (2000) Effect of induced

hyperoxia on the antioxidant status of Atlantic salmon Salmo salar

L. fed three different levels of dietary vitamin E. Aquacult. Res., 31,

401–407.

Lygren, B., Hjeltnes, B. & Waagbø, R. (2001) Immune response and

disease resistance in Atlantic salmon (Salmo salar L.) fed three

levels of dietary vitamin E and the effect of vaccination on the liver

status of antioxidant vitamins. Aquacult. Int., 9, 401–411.

Mæland, A. & Waagbø, R. (1998) Examination of the qualitative

ability of some cold water marine teleosts to synthesise ascorbic

acid. Comp. Biochem. Physiol., 121A, 249–255.

Mattick, J.S. & Makunin, I.V. (2005) Small regulatory RNAs in

mammals. Hum. Mol. Gen., 14, R121–R132.

NRC (National Research Council) (1993) Nutrient Requirements of

Fish. National Academy Press, Washington DC. USA.

van der Oost, R., Beyer, J. & Vermeulen, N.P.E. (2003) Fish bio-

accumulation and biomarkers in environmental risk assessment: a

review. Environ. Toxicol. Pharmacol., 13, 57–149.

Ørnsrud, R., Wargelius, A., Sæle, Ø., Pittman, K. & Waagbø, R.

(2004) Influence of egg vitamin A status and egg incubation tem-

perature on subsequent development of the early vertebral column

in Atlantic salmon fry. J. Fish Biol., 64, 399–417.

Panserat, S., Kolditz, C., Richard, N., Plagnes-Juan, E., Piumi, F.,

Esquerre, D., Medale, F., Corraze, G. & Kaushik, S. (2008)

Hepatic gene expression profiles in juvenile rainbow trout

(Oncorhynchus mykiss) fed fishmeal or fish oil-free diets. Br. J.

Nutr., 100, 953–967.

Rimbach, G. & De Pascual-Teresa, S. (2005) Application of nutri-

genomics tools to analyze the role of oxidants and antioxidants in

gene expression. In: Nutrigenomics (Rimbach, G., Fuchs, J. &

Packer, L. eds), pp. 1–12. Taylor & Francis, Boca Raton, FL, USA.

Schlenk, D., Handy, R., Steinert, S., Depledge, M.H. & Benson, W.

(2008) Biomarkers. In: The Toxicology of Fishes (Di Giulio, R.T. &

Hinton, D.E. eds), pp. 683–731. CRC Press, Boca Raton, FL,

USA.

Schmedes, A. & Hølmer, G. (1989) A new thiobarbituric acid

(TBARs) method for determining free malondialehyde (MDA)

and hydroperoxides selectively as a measure of lipid peroxidation.

J. Am. Oil Chem., 66, 813–817.

Torstensen, B.E., Bell, J.G., Rosenlund, G., Henderson, R.J., Graff,

I.E., Tocher, D.R., Lie, Ø. & Sargent, J.R. (2005) Tailoring of

Atlantic salmon (Salmo salar L.) flesh lipid composition and sen-

sory quality by replacing fish oil with a vegetable oil blend.

J. Agricult. Food Chem., 53, 10166–10178.

Torstensen, B.E., Espe, M., Sanden, M. et al. (2008) Novel pro-

duction of Atlantic salmon (Salmo salar) protein based on com-

bined replacement of fish meal and fish oil with plant meal and

vegetable oil blends. Aquaculture, 285, 193–200.

Torstensen, B.E., Nanton, D.A., Olsvik, P.A., Sundvold, H. &

Stubhaug, I. (2009) Gene expression of fatty acid binding proteins

(FABPs), fatty acid transport proteins (cd36 and FATP) and

b-oxidation related genes in Atlantic salmon (Salmo salar L.) fed

fish oil or vegetable oil. Aquacult. Nutr., 15, 440–451.

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N.,

De Paepe, A. & Speleman, F. (2002) Accurate normalization of

real-time quantitative RT-PCR data by geometric averaging of

multiple internal control genes. Genome Biol., 3:RESEARCH0034.

Vielma, J., Koskela, J., Ruohonen, K., Jokinen, I. & Kettunen, J.

(2003) Optimal diet composition for European whitefish (Coreg-

onus lavaretus): carbohydrate stress and immune parameter

responses. Aquaculture, 225, 3–16.

Waagbø, R., Glette, J., Nilsen, E.R. & Sandnes, K. (1993) Dietary

vitamin C, immunity and disease resistance in Atlantic salmon

(Salmo salar). Fish Physiol. Biochem., 12, 61–73.

Wegele, H., Muller, L. & Buchner, J. (2004) Hsp70 and Hsp90 - a

relay team for protein folding. Rev. Physiol. Biochem. Pharmacol.,

151, 1–44.

Zarate, J. & Bradley, T.M. (2003) Heat shock proteins are not sen-

sitive indicators of hatchery stress in salmon. Aquaculture, 223,

175–187.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e424–e436 � 2010 Blackwell Publishing Ltd