ARTICLE IN PRESS

InsectBiochemistry

andMolecularBiology

0965-1748/$ - se

doi:10.1016/j.ib

�CorrespondE-mail addr

Insect Biochemistry and Molecular Biology 36 (2006) 593–602

www.elsevier.com/locate/ibmb

Geographical distribution and evolutionary history oforganophosphate-resistant Ace alleles in the olive fly (Bactrocera oleae)

Francesco Nardia,�, Antonio Carapellia, John G. Vontasb, Romano Dallaia,George K. Roderickc, Francesco Fratia

aDepartment of Evolutionary Biology, University of Siena, Via Aldo Moro 2, 53100 Siena, ItalybLaboratory of Pesticide Science, Agricultural University of Athens, Athens, Greece

cDepartment of Environmental Science Policy and Management, University of California, Berkeley, CA, USA

Received 7 March 2006; received in revised form 2 May 2006; accepted 2 May 2006

Abstract

Acetylcholinesterase (Ace) is the molecular target of organophosphate (OP) insecticides, and two mutations that confer different levels

of OP insensitivity have previously been identified in the olive fly, Bactrocera oleae. Numerous sensitive and two insensitive alleles

(including one convergent acquisition) are described from the entire worldwide distribution of the fly. Most of the variation is harbored

in the native range of the species and in the Middle East and consists of numerous low-frequency sensitive alleles. The insensitive alleles

likely came to high frequency more recently in the Mediterranean region or in the Middle East, reaching frequencies as high as 100% in

some populations, and determined a corresponding decline in overall genetic variation. We hypothesize that the major force that shaped

the current distribution of resistant and non-resistant acetylcholinesterase alleles is natural selection, likely responsible for the high

frequency of insensitive alleles in areas where organophosphates have been used extensively. We also discuss a role for historical

contingency, that can explain why sensitive alleles are absent altogether in the species ancestral range and present in areas of recent

expansion, such as California, despite the limited use of OPs.

r 2006 Elsevier Ltd. All rights reserved.

Keywords: Bactrocera oleae; Olive fly; Acetylcholinesterase; Gene flow; Organophosphate resistance; Insecticide resistance; Resistance mutations;

Resistance stacking; Allele replacement

1. Introduction

Insecticides have been used widely since WWII tocontrol populations of insect pests of importance toagriculture and public health. During this period resistanceto insecticides has arisen through a number of mechanismsin many species, and in the past decade the molecular basisof some of these mechanisms have been elucidated(reviewed by Hemingway et al., 2004).

Two important classes of insecticides, organophosphates(OPs) and carbamates, target the enzyme acetylcholines-terase (Ace, AChE; EC 3.1.1.7), which plays a key role innervous impulse transmission by hydrolyzing the neuro-

e front matter r 2006 Elsevier Ltd. All rights reserved.

mb.2006.05.002

ing author. Tel.: +390577 234420; fax: +39 0577 234476.

ess: nardifra@unisi.it (F. Nardi).

transmitter acetylcholine. OPs and carbamates are analo-gous to the substrate acetylcholine, bind to the active site ofAce, and impair the enzyme by carbamylating or phos-phorylating the active site serine (Aldridge, 1950).The olive fly (Bactrocera oleae, formerly Dacus oleae) is the

major insect pest of cultivated olives in most areas whereolives are grown commercially, and causes significantquantitative and qualitative losses in olive oil and table oliveproduction. In the Mediterranean Basin, where most oliveproduction occurs, the OP insecticide dimethoate has beenused for more than three decades to control the olive fly(Vontas et al., 2001), leading to the selection of OPresistant strains. OPs in Europe were introduced for thecontrol of the olive fly beginning in 1954 and 1955 (seeAlessandrini, 1962 for an historical reconstruction). InCalifornia, where the olive fly was first detected in 1998,

ARTICLE IN PRESSF. Nardi et al. / Insect Biochemistry and Molecular Biology 36 (2006) 593–602594

limited amounts of carbamate insecticides were initiallyapplied (2–6% of olive acreage), and since 1999 have beenreplaced by the natural product Spinosad (NationalAgricultural Statistics Service: http://www.pestmanagement.info/nass/).

The molecular basis of OPs resistance was investigatedas early as the 1970s by Tsakas, Krimbas and collaborators(Tsakas, 1977 and references therein), who suspected amechanism of resistance based on increased expression orgene duplication. More recent biochemical investigationsled to the notion that differences in OP insensitivity are dueto qualitative rather that quantitative differences in Aceactivity, and found no evidence of the previously suspectedgene duplication (Vontas et al., 2001, 2002). Furthermore,these studies supported the idea that point mutations inAce are the primary mechanism of OP insensitivity inthe olive fly (Vontas et al., 2001). This mechanism, as wellas esterase-mediated metabolic resistance (Oakeshott et al.,2005), have been proposed as mechanisms forOP resistance in a number of insect species, and at least10 key mutations have been described in insects thatinduce different levels of OP insensitivity (Menozzi et al.,2004).

Considering the 7 point mutations that are responsiblefor Ace-mediated OP resistance in higher Diptera (Musca

domestica: Walsh et al., 2001; Bactrocera oleae: Vontas etal., 2002; Drosophila melanogaster: Mutero et al., 1994;Lucilia cuprina: Chen et al., 2001), 3 are shared between D.

melanogaster and M. domestica, and one between D.

melanogaster and B. oleae (Russell et al., 2004; Menozziet al., 2004); L. cuprina appears to exhibit a differentresistance mechanism. These mutations affect sites that arelocated in the active site gorge of the enzyme, generallyintroducing a steric alteration in the active site residues thatreduce the efficiency of OP binding and Ace phosphoryla-tion.

The 2 mutations that have been isolated in resistantstrains of the olive fly confer 8-fold resistance (LR strain,single mutation) to 16-fold resistance (Attiki strain, doublemutation), with reference to the wild type (LS strain)(Vontas et al., 2002). This cumulative effect is consistentwith the notion that each single mutation confers limitedinsensitivity, while higher levels of resistance are obtainedby accumulating more, presumably independent, muta-tions on a single chromosome by intracistronic recombina-tion (Mutero et al., 1994). This mechanism is likely veryefficient given a high recombination rate, which inDrosophila is 3 orders of magnitude higher than themutation rate per codon, the highly interrupted genomeorganization of Ace, and the generalized outbreeding ofolive fly populations.

As expected, the high pressure of selection imposed byinsecticide treatments has driven the spread of resistantmutations both in frequency and geographic range(ffrench-Constant et al., 2004). In some cases, insecticideresistant alleles were described that evolved only oncewithin a species and then spread, as in the case of B2

esterase in Culex pipiens (Raymond et al., 1991; Guille-maud et al., 1996), and the Cyp6g1-mediated DDTresistance in D. melanogaster (Daborn et al., 2002). Inother cases, resistant mutations have evolved more thanonce independently in different populations, as Rdl inTribolium castaneum (Andreev et al., 1999) and Bemisia

tabaci (Anthony et al., 1995), para-type voltage gatedsodium channel in B. tabaci (Alon et al., 2006), the Acevariants in C. pipiens (Weill et al., 2003), and multipleresistance mutations in Myzus persicae (Field and Foster,2002; Anstead et al., 2005).In the case of resistant Ace alleles in the olive fly, the

importance of positive selection has been demonstrated byHawkes et al. (2005), who showed a clear correspondencebetween intense OP usage in Italy and the Balkans and ahigh frequency of resistance-associated mutations in thearea. Nevertheless, strong positive selection is not the onlyevolutionary force that could influence the distribution andfrequency of resistant alleles. Ace resistance-associatedpoint mutations often compromise the kinetics of acet-ylcholine hydrolysis (Fournier and Mutero, 1994), whichcan lead to significant associated fitness costs for resistantphenotypes in the absence of the insecticide (Roush andMcKenzie, 1987). However, the low alteration of the Aceprotein by certain point mutations (Fournier and Mutero,1994), or the combination of mutations in the same proteinin a way that one resistant mutation possibly alleviatesdetrimental effects of another, might also reduce the fitnesscost associated with the resistant alleles (Shi et al., 2004)and allow their persistence even in the absence ofinsecticide pressure.In addition, historical contingency may help explain

geographical patterns of resistance alleles in species inwhich gene flow is limited or interrupted due to geogra-phical barriers where resistance-associated mutations maynot spread efficiently.Here, we describe and analyze DNA sequence data

associated with Ace variability in olive fly populationsworldwide in the light of the recent understanding ofthe genetics and biochemistry of acetylcholine-mediatedOP resistance (Vontas et al., 2001, 2002; Hawkes et al.,2005) and the historical phylogeography and populationgenetics of the olive fly (Nardi et al., 2003, 2005;Augustinos et al., 2005). With these data we can address3 questions about the molecular evolution of OPsresistance in the olive fly that also have general rele-vance to concepts regarding the evolution of insecticideresistance (ffrench-Constant, 1999; ffrench-Constantet al., 2004): (1) What are the mechanisms that deter-mine the present distribution of resistance alleles, andwhat role, if any, is played by historical contingency? (2) Isresistance the result of a single acquisition that spreadsubsequently to different areas or rather a result of mul-tiple convergent acquisitions? (3) When and where didresistance mutations occur, and how does stacking of low-resistance mutations give rise to highly resistant chromo-somes?

ARTICLE IN PRESSF. Nardi et al. / Insect Biochemistry and Molecular Biology 36 (2006) 593–602 595

2. Material and methods

Olive fly (Bactrocera oleae) specimens were collectedfrom infested olive groves spanning the distribution of theolive fly worldwide; details of the collecting localities anddates are given in Table 1. Briefly, a number of infestedolives were hand picked or obtained at olive oil-squeezingplants; olives were kept in the laboratory until larvaeemerged and developed into adulthood. Adults were feedon a liquid vitamin diet for one week before being killed.To limit the possibility that siblings are collected, oliveswere gathered from different trees in each location. TotalDNA was extracted from single heads using the DNeasyTissue Kit (Quiagen) or a generic method based onProteinase K digestion. Individuals correspond to thosegenotyped in Nardi et al. (2005) with the exceptions ofpopulations from Adana, Malcesine and Bari.

Following partial sequencing of the genomic regionencoding for Ace in B. oleae (data not shown) two primerpairs were designed to specifically amplify two regions thatnearly completely include exons III and VI (with referenceto D. melanogaster genomic organization) that carrythe two mutations previously observed to be involvedin OP insecticide resistance (Vontas et al., 2002):BoAce_518F: TACTCAATTTCACTTTCAGCACTC;BoAce_1040R: CAACTCACCGACAATAGCG; BoA-ce_1424F: CAGCTGGGTTGGTAATCC and BoA-ce_1519R: TAGTGCACGGAAGCTCC. Numbers referto the position of the 30nucleotide with respect to the B.

oleae Ace sequence AF452052 (Vontas et al., 2002). Afterprimer removal the amplified fragments correspond to521 bp of 543 bp in exon III and 94 bp of putative 150 bp inexon VI. PCR conditions were 94 1C for 1min, 56 1C for1min 10 s, 72 1C for 1min 30 s, for 35 cycles, using aproofreading enzyme mix (Expand High Fidelity: Roche)

Table 1

Details of collection

Area Country Location

Pakistan Pakistan Cherat

Pakistan Pakistan Malakan

Africa Kenya Burguret

Africa South Africa Paarl mo

Mediterranean Portugal Paradela

Mediterranean France Les mate

Mediterranean Italy Malcesin

Mediterranean Italy Montecu

Mediterranean Italy Portofer

Mediterranean Italy Bari

Mediterranean Italy Catania

Mediterranean Greece Athens

Middle East Turkey Osmaniy

Middle East Turkey Adana

Middle East Israel Haifa

America Mexico Ensenad

America California, USA Santa Ba

Geographic coordinates given as decimal degrees. Year refers to the olive seas

according to the manufacturer specifications. PCR pro-ducts were gel purified (Wizard SV Gel and PCR Clean-UpSystem: Promega) and both strands were sequenced usingPCR primers on an automatic sequencer (Beckman8000XL). Electropherograms were checked by eye anddouble peaks were scored. Sequences not showing doublepeaks were recorded as homozygotes, and accepted assuch. Sequences showing double peaks (1–6 per sequence inour dataset) were recorded as heterozygotes, and subjectedto cloning. Approximately 10% of the homozygotes werealso subjected to cloning as a control. Following 10minincubation with Taq polymerase (Promega) in PCR bufferwith nucleotides added, purified PCR products were clonedusing the Original TA Cloning Kit (Invitrogen). Three to 5clones for each transformation were sequenced on bothstrands using universal primers for the vector. In somecases, where some recombination among clones wasdetected, up to 10 clones were sequenced to resolveunambiguously the 2 alleles. All sequences were importedinto MACCLADE (Maddison and Maddison, 2000) andaligned manually.Networks, and relative nesting clades, were recon-

structed for both datasets using Statistical Parsimony (asimplemented in TCS: Clement et al., 2000). Outgroupweight was recorded for all alleles and nesting clades basedon an analysis of whole datasets and on reduced datasets,following the exclusion of resistant alleles. The associationbetween nesting clades and geographic locations wasdetermined using GEODIS (Posada et al., 2000) with10 000 permutations of genotypes among locations. Theminimum number of recombination events among alleles atboth exons was estimated according to Hudson andKaplan (1985) as implemented in DNAsp (Rozas et al.,2003). The probability of random union among gameteswas estimated for the 2 exons in each population and areas

Coordinates (lat./long.) Year

33.48/71.55 2003

d 34.33/71.56 2003

forest �4.06/39.67 2002

untain �33.07/18.97 2002

41.51/–6.27 2001

lles 43.73/3.82 2001

e 45.77/10.8 2001

cco 43.47/11.43 2001

raio 42.82/10.32 2001

41.13/16.85 2001

37.51/15.07 2001

37.98/23.73 2002

e 37.08/36.25 2002

37.02/35.33 2002

31.72/34.6 2003

a 31.86/–116.6 2002

rbara 34.42/–119.7 2002

on in the area considered.

ARTICLE IN PRESSF. Nardi et al. / Insect Biochemistry and Molecular Biology 36 (2006) 593–602596

following the exact Hardy–Weinberg test of Haldane(1954) as implemented in GENEPOP (Raymond and Rousset,1995).

In order to study the levels and hierarchical distributionof genetic variability, we grouped samples according tosampling locality (populations) and major geographicregions or areas: Pakistan, Africa, Middle East, Mediter-ranean, and America. Values of gene diversity wereestimated for all populations and areas for both datasetsusing ARLEQUIN (Schneider et al., 2000). The hierarchicalpartition of genetic variability within populations, amongpopulations within areas, and among areas was exploredby AMOVA (1000 permutations, default search strategy inARLEQUIN).

3. Results

The almost complete sequence of exons III and VI of theBactrocera oleae acetylcholinesterase (Ace) gene wasdetermined for a total of 5 individuals for each of 17populations as fully resolved diploid data, giving 170sequences for each exon (Table 1; GenBank accession nos.DQ499479–DQ499510; individual genotypes are availableas Supplementary online material). The number ofindividuals studied, though possibly limited in order toestimate the frequency of individual alleles with highprecision, is sufficient to detect all alleles present at afrequency above 0.1/0.2 in populations/groups (Gregorius,1980). The sequences encompass the previously describedsites of point mutations responsible for OP resistance:Ile214Val in exon III and Gly488Ser in exon VI (Vontas etal., 2002). The 17 populations cover all areas where theolive fly is found worldwide. The collections include themost common and widely distributed variety of olive fly aswell as the variety asiatica, endemic to Pakistan.

A total of 25 different alleles were found for exon III(coded A–Y in Table 2), which differ by 1–7 nucleotidesubstitutions distributed across 16 variable sites. Allmutations are synonymous with the exception of anA4G transition in first codon position that determinesthe change of an Isoleucine for a Valine in alleles A and W.Alleles A and W, which differ by 6 synonymous substitu-tions, carry the mutation Ile214Val responsible for OPresistance, while the remaining 23 alleles are associatedwith the wild type non-resistant form.

Seven variants were found for exon VI (coded a to g inTable 2) that differ by 1–5 nucleotide substitutionsdistributed across 6 variable sites. All mutations aresynonymous with the exception of a single G4A transitionin first codon position that determines the change of aGlycine for a Serine in allele b. Allele b, carrying theGly488Ser mutation, is resistant to OP while the remaining6 are associated with the wild-type non-resistant form.

As the 2 exons have been amplified by PCR indepen-dently, we do not have direct information about their phaseon the chromosomes. Nevertheless, this information can bedetermined in those individuals that are homozygotes in at

least one exon. In our data, of 132 (77%) chromosomesresolved, Ab is the most frequent combination (38%).Focusing on the amino acid sequence, i.e., considering

only the presence of resistance-associated mutations, wecould assess the phase of 146 chromosomes (86%), ofwhich 61% are LS (from the name of the reference strainfrom which the variant was described; no resistancemutation present), 1.4% are LR (single-resistant mutation,Gly488Ser), 34% are Attiki (double-resistant mutation,Ile214Val and Gly488Ser), and 3.4% belong to a yetundescribed class (reported as heterozygous in a singleFrench individual by Hawkes et al., 2005) that carry theresistance mutation Ile214Val but not Gly488Ser. Thischromosome, following its apparent distribution, wasnamed WestMed.Resistance and non-resistance alleles at both exons are

not uniformly distributed across the geographical range ofthe olive fly (Fig. 1). The resistant forms were not sampledin any Pakistani and African samples, and had a low tomoderate (50%) frequency in the Middle East and themore recently established invasive populations in America.The highest proportion of resistance alleles was observed inthe Mediterranean area, where frequencies approach 100%in Greece and central/southern Italy, but decreasing tobelow 30% in France and 0% in Portugal.Populations show between 1 and 8 allelic variants at

exon III (Table 2), and 1–4 at exon VI. Levels of genediversity are as high as 0.96 (exon III, population PaarlMtn.) and 0.71 (exon VI, populations Osmaniye and SantaBarbara). For continental areas, African and MiddleEastern samples show the highest variation (gene diversity0.94 and 0.91 for exon III, respectively; 0.56 and 0.57 forexon VI), with the single exception of exon VI in theAmerican group that shows even higher levels of genediversity (0.60). Pakistani (var. asiatica) and Mediterra-nean samples show a more limited variability. In theMediterranean area this is due to the presence of resistancealleles A and b at very high frequencies (68% and 64% atexon III and VI, respectively) that replace the number oflow-frequency alleles found in most other locations. This isparticularly conspicuous in Greek and central/southernItalian populations, where values of gene diversity drop to0.49 at both exons (Table 3).For the two alleles that carry the resistance mutation at

exon III, one (A) is very abundant, with a frequency of39% overall, and is present in 11/17 populations, while theother (W) is found in one single heterozygous individual inpopulation Catania (overall frequency 0.6%). Resistantallele A (exon III) is found in homozygosity in 26/170individuals and in heterozygosity in 14/170, resistant alleleW is found in one single individual in heterozygous form.Resistant allele B (exon VI) is found in homozygosity in 23/170 individuals and in heterozygosity in 18/170.No population shows significant deviation from HW

equilibrium at either of the two exons. The loci areconsidered to be independent as the phase was unknownfor most chromosomes. When populations are grouped

ARTICLE IN PRESS

Table

2

Distributionofresistance

andnon-resistance

alleles

inthe2exonsandin

thepopulationsstudied

Location

ExonIII

ExonVI

AB

CD

EF

GH

IJ

KL

MN

OP

QR

ST

UV

WX

Ya

bc

de

fg

Cherat

81

110

Malakand

82

10

PaarlMtn

21

11

21

11

10

BurguretFst

33

12

11

18

Haifa

12

32

11

91

Osm

aniye

11

31

11

11

51

31

Adana

41

41

55

Athens

10

28

Bari

10

10

Catania

91

19

Montecuccoa

91

19

Portoferraio

64

36

1

Malcesine

82

37

Les

Matelles

25

11

17

21

Paradela

82

10

Ensenada

43

36

4

St.Barbara

33

12

15

31

1

Ile214Val

Ile214Val

Gly488Ser

Alleles

are

coded

A–Y

forexonIIIandato

gforexonVI,asin

thetext.Alleles

thatcarryresistance-associatedmutations(A

,W,b)are

inbold,andthecorrespondingaminoacidmutationisindicated

below

each.See

Table

1fordetailsofcollectinglocalities.

aSameaslocationMcC

uccoin

Hawkes

etal.(2005).

F. Nardi et al. / Insect Biochemistry and Molecular Biology 36 (2006) 593–602 597

ARTICLE IN PRESSF. Nardi et al. / Insect Biochemistry and Molecular Biology 36 (2006) 593–602598

according to geographical regions, Mediterranean samplesappear not to be in equilibrium (exon III: p ¼ 0:001; exonVI: p ¼ 0:020), as do African samples at exon VI(p ¼ 0:026).

The hierarchical partition of genetic variability, studiedusing an AMOVA approach, illustrates that most of the

Table 3

Gene diversity (with standard deviation) measured separately for exons III and

horizontal lines)

Location Exon III

Cherat 0.38 (70.18) Pakistani group: 0.35 (70.12)

Malakand 0.36 (70.16)

Burguret forest 0.84 (70.08) African group: 0.94 (70.03)

Paarl mountain 0.96 (70.06)

Paradela 0.36 (70.16)

Les matelles 0.76 (70.13)

Malcesine 0.36 (70.16)

Montecucco 0.20 (70.15)

Portoferraio 0.53 (70.09)

Bari 0.00 (70.00)

Catania 0.20 (70.15) Mediterranean group: 0.49 (7Athens 0.00 (70.00)

Osmanyie 0.93 (70.08)

Adana 0.73 (70.10) Middle Eastern group: 0.91 (7Haifa 0.89 (70.08)

Ensenada 0.73 (70.07) American group: 0.77 (70.05)

Santa Barbara 0.84 (70.08)

See Table 1 for details of collecting localities.

Fig. 1. Distribution of resistance-associated mutations at exons III (left

half of each pie) and VI (right). Black indicates the presence of the

mutation, dashed black indicates the single occurrence of the alternative

resistance allele W in the population from Catania. Numbers indicate the

occurrence of resistant alleles at exon III/exonVI out of ten alleles per

exon sampled per population.

observed diversity at both exons is found within popula-tions (56.9% and 44.1% at exons III and VI, respectively),but a significant portion of the variation can be found alsoamong populations within areas (28.4%; 31.4%) andamong areas (14.7%; 24.4%).The evolutionary relationships between the 25 alleles

found for exon III and the 7 found at exon VI werereconstructed using Statistical Parsimony and are shown inthe networks in Fig. 2. Both networks are rather compact,with a maximum of two mutational steps between closestpairs of extant alleles, and both show evidence ofrecombination. This is more evident for exon III, giventhe higher overall number of alleles; the minimum numberof recombination events (Rm: Hudson and Kaplan, 1985)was estimated as 4 for exon III and 1 for exon VI. NestedClade analysis does not provide evidence for any significantassociation between clades and geographic locations withthe exception of a number of rare alleles present in singlelocations. No allele or nesting group sums to 0.95 outgroupweight, which would be used to suggest the root of thenetwork. Repeating the analysis with the exclusion ofresistant alleles did not significantly change the result.Despite the low correspondence between higher level

nesting clades and geographic locations, the analysis doesprovide some information about the origin and distribu-tion of certain alleles. Of particular importance in thisrespect is the distribution and abundance of extant allelesgiven what is known about the historical distribution of theolive fly.With regards to exon III, all samples from Pakistan, the

most genetically isolated group, carry alleles that arealmost exclusive, and separated by no more than 2

IV for each population and for each geographical region (divided by blank

Exon VI

0.00 (70.00) Pakistani group: 0.00 (70.00)

0.00 (70.00)

0.38 (70.18) African group: 0.56 (70.06)

0.00 (70.00)

0.00 (70.00)

0.51 (70.16)

0.47 (70.13)

0.20 (70.15)

0.60 (70.13)

0.00 (70.00)

0.05) 0.20 (70.15) Mediterranean group: 0.49 (70.04)

0.36 (70.16)

0.71 (70.12)

0.03) 0.56 (70.07) Middle Eastern group: 0.57 (70.09)

0.20 (70.15)

0.53 (70.09) American group: 0.60 (70.08)

0.71 (70.12)

ARTICLE IN PRESS

Fig. 2. Evolutionary relationships among alleles found at exons III (panel

A) and VI (panel B) reconstructed using statistical parsimony. The

collection locality (by geographic region) of alleles is color coded

(blue ¼ Pakistan; green ¼ Africa; yellow ¼Middle East; red ¼Mediter-

ranean; pink ¼ America). Dashed circles identify alleles carrying the

resistance-associated mutations.

F. Nardi et al. / Insect Biochemistry and Molecular Biology 36 (2006) 593–602 599

mutational steps, with B being the most frequent. We cantherefore regard allele B as typical and ancestral for thegroup from Pakistan. The same can be said for a group ofpredominantly Mediterranean alleles (C, W, N, K) ofwhich C is the most common and likely the ancestral allele.Mediterranean samples carry also allele A, at highfrequency, but this allele has an independent, andunrelated, origin. Alleles observed in the invasive Americansamples are generally of Mediterranean or Middle Easternorigin. Allele B is shared between the two oldest and mostdifferentiated groups, Pakistan and Africa, and this issuggestive that the root of the network is B or an alleleclose to B.

The 2 resistant alleles at exon III (A and W) do notappear to share a recent evolutionary history. Allele W,rare and geographically localized, originated from allele C,typical of most Mediterranean populations. Allele A,which is found today at high frequency throughoutGreece and south/central Italy, derives from allele G,most commonly found in the Middle East; allele G isrelated to alleles Y and I, which are restricted to the MiddleEast.

The situation for exon VI is less well resolved given themore limited number of alleles (Fig. 2). As a is the mostcommon allele, occupies a central part in the network, andis present in all areas including Pakistan, it is most likelythe oldest allele in the exon VI network. Alleles c, g and ederive from this allele and are found in all regions, but theirprevalence of Africa and Middle East suggest theyprobably differentiated in these areas. The resistance alleleb likely derived from f, which is rare but found today inOsmaniye (Turkey) and Portoferraio (on a small island offthe Italian coast).

4. Discussion

4.1. Genetic variation and structure

Analysis of the sequences of the Ace gene revealed richergenetic variation at the nucleotide level than expectedbased on the amino acid sequences. The Pakistani samples,representative of B. oleae var. asiatica, carry only 3 and 1alleles at exon III and VI, respectively, resulting in a genediversity of 0.35 and 0.0, respectively. This observation isconcordant with the low levels of genetic diversity observedat neutral loci (Nardi et al., 2005), and is consistent withthe notion that var. asiatica is a rather small and perhapsrelict group. Most of the nucleotide variation in Ace wasobserved in African and Middle Eastern samples, againparalleling the results obtained using neutral markers.Africa appears to be the source area for the species with theexclusion of var. asiatica. The high overall variabilityfound in the Middle East, an area likely colonized in morerecent times, suggests that this area could have played amajor role in the diversification of B. oleae, possibly as acrossroad between all major areas where the species ispresent (Nardi et al., 2005). For populations in theMediterranean region that broadly correspond to areasthat have been exposed to OP insecticides, the pattern isvery different, with significantly lower levels of genediversity. This observation is consistent with the proposedextensive selective sweep that led to the replacement ofmultiple different non-resistance variants which coexist atlow to moderate frequencies in other populations. Thisphenomenon parallels what has been observed in the sheepbowfly Lucilia cuprina when one compares alleles found inextant versus pre-insecticide museum samples (Newcombet al., 2005). The high relative variability observed in theinvasive American samples was unexpected, because thesesame populations show a low level of variation inmicrosatellite and mitochondrial markers, as predicted bya founder event associated with a long-range invasion(Nardi et al., 2005).Despite the generally high levels of genetic variability

observed in B. oleae populations little geographic structur-ing can be observed. A comparison of the geographicdistribution of Ace variation with that for the ND1mitochondrial gene (Nardi et al., 2005), illustrates thispoint (the two datasets are of comparable size and havemore than 85% of the individuals in common). In contrastto the limited structuring in Ace, strong structure appearsin ND1, particularly when comparing broad continentalareas. In both datasets some differentiation can beobserved in the Pakistan region and for 1 or more localitiesin Africa, while the remaining populations from the MiddleEast, Mediterranean and America appear mixed to variousdegrees. However, in the ND1 mitochondrial network thesamples from Pakistan and Africa form 2 exclusive 1-stepclades that join in an exclusive 2-step clade, while for Aceno single mid- to high-frequency allele or nesting clade isrestricted to a single locality or larger geographical area.

ARTICLE IN PRESSF. Nardi et al. / Insect Biochemistry and Molecular Biology 36 (2006) 593–602600

The different patterns observed here for Ace and ND1 are,at least in part, predicted based on the different mechan-isms of inheritance of the 2 markers that correspond to alonger average coalescence time for nuclear markerscompared to mitochondrial genes, leading to a less-structured distribution of alleles in nuclear loci.

4.2. Ace resistance distribution

This analysis of distribution of Ace resistance-associatedalleles confirms Hawkes et al.’s (2005) result for theMediterranean region, and extends the observation to aglobal perspective, including ancestral and recent invasivepopulations. The highest proportion of resistant alleles werefound in Greece and central/southern Italy, areas where theolive fly has been under strong selective pressure due to theextensive use of OP insecticides (Haniotakis, 2003; Vontas etal., 2001); this observation is consistent with the scenariothat selection played a major role in the spread of resistantalleles. However, other data, including the distribution andhistory of resistance alleles, and the levels of gene flow in theMediterranean for this species (Augustinos et al., 2005;Nardi et al., 2005), suggest that the situation could be morecomplex. This possibility is also supported by the fact thatneutral markers suggest that Mediterranean samples form alarge almost panmictic population (Nardi et al., 2005). Bycontrast, these populations are not in Hardy–Wainbergequilibrium at both Ace exons, indicating that some non-equilibrium process is ongoing (the only other occurrence ofH–W disequilibrium in our dataset, exon VI alleles inAfrican samples, is attributable to non-resistance allele ewhich reaches high frequencies in Kenya but not in SouthAfrica). For example, because the olive fly has a continuousdistribution in the Mediterranean and shows high levels ofgene flow, an allele that is found at very high frequency inone area would be predicted to spread, particularly in theabsence of positive selection. This is not always the case. Forexample, allele A is fixed in most Central/Southern Italianpopulations and the Balkans, and absent altogether in otherpopulations of the same area (within-area, among-popula-tion AMOVA values of 28.42 and 31.42 at exon III and VI).This observation is not concordant with the notion of highgene flow, and suggests that other evolutionary forces areinvolved. Fitness costs may be associated with the resistancemutations, as suggested by their effect upon acetylcholineprocessing (Vontas et al., 2001), and such costs might beresponsible for limiting the expansion of resistance muta-tions outside the area where the olive fly is under direct OPsselective pressure, even in the presence of moderate to highgene flow. Alternatively, Hawkes et al. (2005) based onstructural modeling suggested that the I214V resistantmutation may reduce adverse effects on acetylcholinecatalysis introduced by G488, possibly restoring fitness forthe double mutation allele. This hypothesis could possiblyexplain the unexpectedly high frequency of the doublemutation allele (34%), given the 1.4% and 3.4% of alleles

containing the single Gly488Ser and Ile214Val mutations,respectively.Our historical reconstruction also suggests a role for

historical contingency, as the complete lack of resistantalleles in Africa and Pakistan seems to be due tomechanisms other than that proposed by Hawkes et al.(2005), that was based on reduced insecticide selectionpressure in these areas. Our previous historical analysis ofolive fly populations (Nardi et al., 2005) indicates thatPakistan and Africa are the 2 regions where olive flies havehad the longest presence. Pakistan hosts a subspecies, var.asiatica, that appears to be genetically isolated from theremaining B. oleae group. African populations, thoughsomewhat genetically isolated today from other olive flypopulations, are most likely the ancestral source fromwhich European olive flies originated. The historicalpattern of range expansion is therefore directed fromAfrica to the Middle East to the Mediterranean. Becausethe resistant mutations seem to have originated in theMiddle East or the Mediterranean in recent times (seebelow), we propose that these alleles have never beenpresent in Africa or Pakistan, and therefore their absencetoday is due to historical contingency, rather than anabsence of selection based on reduced insecticide use.Similarly, in recently established American populations

the presence of resistance alleles, though at intermediatefrequencies, is likely attributable to the historical origin ofthese populations from the Mediterranean area, ratherthan to direct selection due to OPs. In fact, OPs are notregistered in California for the control of this pest,although they may have had a very limited application inthe initial phase of the colonization to prevent theestablishment of olive fly in these areas. That the allelefrequencies in American populations do not correspondexactly to the frequencies of their presumed origin in theMediterranean may be due to genetic drift during theinvasion process. The absence or limited use of OPapplications in California would also relieve, in the longterm, the invasive populations from the strong directionalpressure towards maintenance of the resistance.

4.3. Single/multiple origin of resistance

At exon III, 2 different alleles carry the mutationIle214Val (alleles A, W) suggesting 2 independent acquisi-tions for this mutation. At exon VI 1 allele carries themutation 488Ser (allele b). At each exon, only 1 resistance-associated mutations has spread and replaced non-resistantalleles in the central Mediterranean. The second resistanceallele at Exon III (W) is extremely rare and localized, andapparently has not spread beyond the island of Sicily.

4.4. Origin and spread of the mutations responsible for

increase insensitivity to OPs

Based on our reconstruction of allele genealogies (Fig. 2)it is possible to make hypotheses concerning both the

ARTICLE IN PRESSF. Nardi et al. / Insect Biochemistry and Molecular Biology 36 (2006) 593–602 601

temporal and geographical origin of resistant alleles A, Wand b. It should be noted that even if the allele networks doprovide insight in the geographic origins of these muta-tions, the current distribution of alleles observed today isthe outcome of not only random coalescence and popula-tion processes, but also potentially strong selection, andtherefore the regular methods and interpretative toolsbased on the expectation of random coalescence processescannot be applied directly here. To overcome this problem,and still try to hypothesize the origin of the resistancealleles, we considered not only the geographical distribu-tion of the resistant allele themselves, but also thegeographical distributions of the alleles from which theresistance alleles are derived. Our reasoning is that the non-resistant, synonymous, ancestral alleles should not besubject to any particular directional selection, and there-fore the distribution of these ancestral alleles might bettertrack the geographic and temporal origin of olive fliescarrying resistance alleles.

With regard to exon III, the most common resistantvariant A is likely derived from a group of alleles (e.g., G)that are typical to the Middle Eastern region, and possiblyto the very south/eastern part of Turkey, where the 2populations Adana and Osmanyie are located. Assumingthat the mutation most likely happened in an area wherethe precursor alleles are present, we hypothesize that alleleA arose in the Middle East. The subsequent spread of thisallele westward toward the Mediterranean area may havebeen driven by selection from the beginning, provided OPinsecticides were used in the Middle East to such a degreeto balance the presumed fitness costs of carrying theresistance mutation. Alternatively, the movement of alleleA may have been passive in the initial phase, following theexpansion of the olive fly in the Mediterranean, and drivenby selection only more recently. By contrast, the otherresistant allele at Exon III (W) is found only in Catania,and is likely derived from an allele (C) that is generallywidespread in the Mediterranean area. That allele C(ancestor to resistance allele W) is not related to allele G,(ancestor of the widespread resistant allele A), and thatalleles C and G are found in different regions, suggest thatthe origins of the 2 resistant alleles are independent.

At exon VI, the geographic origin of resistant allele bcannot be reconstructed in such detail because the smallnumber of observed alleles limits the resolution of thenetwork. The geographic distribution of allele b and itspresumed ancestors does suggest that allele b possiblyarose in the Mediterranean or Middle East region at large.

All resistant alleles likely evolved relatively recently andpossibly after the major diversification responsible for theobserved (and synonymous) variability at both exons.Several lines of evidence support this scenario: all threeresistant alleles occupy a marginal position in the net-works; resistant alleles are not found in Pakistan andAfrica, which are the presumed ancestral populations of B.

oleae; the resistant mutations likely evolved in the MiddleEast or in the Mediterranean region; and the direction of

range expansion in the species has been from Africa to theMediterranean. Thus, we suggest that the appearance ofresistant mutations occurred after the expansion of olive flyin the Mediterranean.Comparing alleles A and W at exon III, we speculate

that the appearance of A preceded that of W. Assuming asimple random process of expansion for a new alleles, nodifferential selection (A and W are synonymous), and nobarrier to gene flow in the area, the diffusion of an alleleshould be largely proportional to its age. Thus, the highfrequency and broad geographic distribution of allele Acompared to that of allele W, would suggest that allele A isolder.Given the uncertainty of the location/time of appearance

of resistant allele b at exon VI, it is not possible toreconstruct the timing and location of the recombinationalevents that led to the assembly of the Attiki chromosomethat carry the double mutation (Ab). Further work in thisarea would be well rewarded.

Acknowledgments

We wish to thank all colleagues who helped with samplecollection: Elleunorah Allsopp, Augustino Bento, Marie-Claude Bon, Silvia Ciolfi, Elisa Aldrighetti, GiorgioNuzzaci, Pasquale Delli Paoli, Massimo Cristofaro andKim Hoelmer. Marshall Johnson and Hannah Nadelprovided information on olive fly control in California.This paper also benefited from the comments of the Editorand two anonymous Referees. This research was supportedby the University of Siena, the Italian Ministry forUniversity and Research, the United States Departmentof Agriculture, the University of California, the Monte deiPaschi di Siena Foundation, and the Hellenic SecretariatGeneral for Research and Technology.

Appendix A. Supplementary materials

Supplementary data associated with this article can befound in the online version at doi:10.1016/j.ibmb.2006.05.002.

References

Aldridge, W.N., 1950. Some properties of specific cholinesterase with

particular reference to the mechanism of inhibition by diethyl p-

nitrophenyl thiophosphate (E 605) and analogues. J. Biochem.

(Tokyo) 46, 451–460.

Alessandrini, M.E., 1962. Insecticide residues in olive oils and table olives

from efforts to control the olive fly. Residue Rev. 1, 92–111.

Alon, M., Benting, J., Lueke, B., Ponge, T., Alon, F., Morin, S., 2006.

Multiple origins of pyretroid resistance in sympatric biotypes of

Bemisia tabaci (Hemiptera: Aleyrodidae). Ins. Biochem. Mol. Biol. 36,

71–79.

Andreev, D., Kreitman, M., Phillips, TW., Beeman, RW., ffrench-

Constant, RH., 1999. Multiple origins of cyclodiene insecticide

resistance in Tribolium castaneum (Coleoptera: Tenebrionidae). J.

Mol. Evol. 48, 615–624.

ARTICLE IN PRESSF. Nardi et al. / Insect Biochemistry and Molecular Biology 36 (2006) 593–602602

Anstead, J.A., Williamson, M.S., Denholm, I., 2005. Evidence for multiple

origins of identical insecticide resistance mutations in the aphid Myzus

persicae. Insect Biochem. Mol. Biol. 35, 249–256.

Anthony, N.M., Brown, J.K., Markham, P.G., ffrench-Constant, R.H.,

1995. Molecular analysis of cyclodiene resistance-associated mutations

among populations of the sweer potato whitefly Bemisia tabaci. Pestic.

Biochem. Physiol. 51, 220–228.

Augustinos, A.A., Mamuris, Z., Stratikopoulos, E.E., D’Amelio, S.,

Zacharopoulou, A., Mathiopoulos, K.D., 2005. Microsatellite analysis

of olive fly populations in the Mediterranean indicates a westward

expansion of the species. Genetica 125, 231–241.

Chen, Z.Z., Newcomb, R., Forbes, E., McKenzie, J., Batterham, P., 2001.

The acerylcholinesterase gene and organophosphorous resistance in

the Australian sheep bowfly, Lucilia caprina. Insect Biochem. Mol.

Biol. 31, 805–816.

Clement, M., Posada, D., Crandall, K., 2000. TCS: a computer program

to estimate gene genealogies. Mol. Ecol. 9, 1657–1660.

Daborn, P.J., Yen, J.L., Bogwitz, M.R., Le Goff, G., Feil, E., Jeffers, S.,

Tijet, N., Perry, T., Heckel, D., Batterham, P., Feyereisen, R., Wilson,

T.G., ffrench-Constant, R.H., 2002. A single P450 allele associated

with insecticide resistance in Drosophila. Science 297, 2253–2256.

ffrench-Constant, R.H., 1999. Target site mediated insecticide resistance:

what questions remain? Insect Biochem. Mol. Biol. 29, 397–403.

ffrench-Constant, R.H., Daborn, P.J., Le Goff, G., 2004. The genetics and

genomics of insecticide resistance. TIG 20, 163–170.

Field, LM., Foster, S.P., 2002. Amplified esterase genes and their

relationship with other insecticide resistance mechanism in English

field populations of the aphid Myzus persicae (Sulzer). Pest Manage.

Sci. 58, 894–899.

Fournier, D., Mutero, A., 1994. Modification of acetylcholinesterase as a

mechanism of resistance to insecticide. Comput. Biochem. Physiol. C.

Pharmacol. Toxicol. Endocrinol. 108, 19–31.

Guillemaud, T., Rooker, S., Pasteur, N., Raymond, M., 1996. Testing the

unique amplification event and the wordwide migration hypothesis of

insecticide resistance genes with sequence data. Heredity 77, 535–543.

Gregorius, H.R., 1980. The probability of losing an allele when diploid

genotypes are sampled. Biometrics 36, 632–652.

Haldane, J.B/S., 1954. An exact test of randomness of mating. J. Genet.

52, 631–635.

Haniotakis, G.E., 2003. Olive pest control: present status and prospects.

In: Proceedings of the IOBC/WPRS Conference. Integrated Protec-

tions of Olive Crops, Chania, Crete.

Hawkes, N.J., Janes, R.W., Hemingway, J., Vontas, J., 2005. Detection of

resistance-associated point mutations of organophosphate-insensitive

acetylcholinesterase in the olive fruit fly, Bactrocera oleae (Gmelin).

Pestic. Biochem. Physiol. 81, 154–163.

Hemingway, J., Hawkes, N.J., McCarrol, L., Ranson, H., 2004. The

molecular basis of insecticide resistance in mosquitoes. Ins. Biochem.

Mol. Biol. 34, 653–665.

Hudson, R.R., Kaplan, N.L., 1985. Statistical properties of the number of

recombination events in the history of a sample of DNA sequences.

Genetics 111, 147–164.

Maddison, D.R., Maddison, W.P., 2000. MacClade 4: Analysis of

Phylogeny and Character Evolution, Version 4.0. Sinauer Associates,

Sunderland, MA, USA.

Menozzi, P., Shi, M.A., Lougarre, A., Tang, Z.H., Fournier, D., 2004.

Mutations of acetylcholinesterase which confer insecticide resistance in

Drosophila melanogaster populations. BMC Evol. Biol. 4, 4.

Mutero, A., Pralavorio, M., Bride, J.M., Fournier, D., 1994. Resistance-

associated point mutations in insecticide insensitive acetylcholinester-

ase. Proc. Natl. Acad. Sci. USA 91, 5922–5926.

Nardi, F., Carapelli, A., Dallai, R., Frati, F., 2003. The mitochondrial

genome of the olive fly Bactrocera oleae: two haplotypes from distant

geographic locations. Insect Mol. Biol. 12, 605–611.

Nardi, F., Carapelli, A., Dallai, R., Roderick, GK., Frati, F., 2005.

Population structure and colonizations history of the olive fly,

Bactrocera oleae (Diptera, Tephritidae). Mol. Ecol. 14, 2729–2738.

Newcomb, R.D., Gleeson, D.M., Yong, C.G., Russell, R.J., Oakeshott,

J.G., 2005. Multiple mutations and gene duplications conferring

organophosphorous insecticide resistance have been selected at the

Rop-1 locus of the sheep bowfly, Lucilia cuprina. J. Mol. Evol. 60,

207–220.

Oakeshott, J.G., Devonshire, A.L., Claudianos, C., Sutherland, T.D.,

Horne, I., Campbell, P.M., Ollis, D.L., Russell, R.J., 2005. Comparing

organophosphorus and carbamate insecticide resistance mutations in

cholin- and carboxyl-esterases. Chem. Biol. Interact. 157–158,

269–275.

Posada, D., Crandall, K.A., Templeton, A.R., 2000. GeoDis: a program

for the cladistic nested analysis of the geographical distribution of

genetic haplotypes. Mol. Ecol. 9, 487–488.

Raymond, M., Rousset, F., 1995. GENEPOP (version 3.3): population

genetics software for exact tests and ecumenicism. J. Heredity 86,

248–249.

Raymond, M., Callaghan, A., Fort, P., Pasteur, N., 1991. Worldwide

migration of amplified insecticide resistance genes in mosquitoes.

Nature 350, 151–153.

Roush, R.T., McKenzie, J.A., 1987. Ecological genetics of insecticide and

acaricide resistance. Annu. Rev. Entomol. 32, 361–380.

Rozas, J., Sanchez-DelBarrio, J.C., Messeguer, X., Rozas, R., 2003.

DnaSP, DNA polymorphism analyses by the coalescent and other

methods. Bioinformatics 19, 2496–2497.

Russell, R.J., Claudianos, C., Campbell, P.M., Horne, I., Sutherland,

T.D., Oakeshott, J.G., 2004. Two major classes of target site

insensitivity mutations confer resistance to organophosphate and

carbamate insecticides. Pestic. Biochem. Physiol. 79, 84–93.

Schneider, S., Roessli, D., Excoffier, L., 2000. Arlequin ver 2.000: A

Software for Population Genetics Data Analysis. Genetic and

Biometry Laboratory, University of Geneva, Geneva.

Shi, M.A., Lougarre, A., Alies, C., Fremaux, I., Tang, Z.H., Stojan, J.,

Fournier, D., 2004. Acetylcholinesterase alterations reveal the fitness

cost of mutations conferring insecticide resistance. BMC Evol. Biol. 4,

5.

Tsakas, S.C., 1977. Genetics of Dacus Oleae. VIII. Selection for the

amount of acetylcholinesterase after organophosphate treatment.

Evolution 3, 901–904.

Vontas, J.G., Cosmidis, N., Loukas, M., Tsakas, S., Hejazi, M.J.,

Ayoutanti, A., Hemingway, J., 2001. Altered acetylcholinesterase

confers organophosphate resistance in the olive fruit fly Bactrocera

oleae. Pestic. Biochem. Physiol. 71, 124–132.

Vontas, J.G., Hejazi, M.J., Hawkes, N.J., Cosmidis, N., Loukas, M.,

Hemingway, J., 2002. Resistance-associated point mutations of

organophosphate insensitive acetylcholinesterase, in the olive fruit fly

Bactrocera oleae. Insect Mol. Biol. 11, 329–336.

Walsh, S.B., Dolden, T.A., Moores, G.D., Kristensen, M., Lewis, T.,

Devonshire, A.L., Williamson, M.S., 2001. Identification and char-

acterization of mutations in housefly (Musca domestica) acetylcholi-

nesterase involved in insecticide resistance. Biochem. J. 359, 175–181.

Weill, M., Lutfalla, G., Mogensen, K., Chandre, F., Berthomieu, A.,

Berticat, C., Pasteur, N., Philips, A., Fort, P., Raymond, M., 2003.

Insecticide resistance in mosquito vectors. Nature 423, 136–137.