Pesticide Biochemistry and Physiology 81 (2005) 154–163

www.elsevier.com/locate/ypest

PESTICIDEBiochemistry & Physiology

Detection of resistance-associated point mutationsof organophosphate-insensitive acetylcholinesterasein the olive fruit fly, Bactrocera oleae (Gmelin)

Nicola J. Hawkesa,*, Robert W. Janesb, Janet Hemingwaya, John Vontasa,*,1

a School of Tropical Medicine, Pembroke Place, Liverpool L3 5QA, UKb School of Biological Sciences, Queen Mary University of London, Mile End Road, London E1 4NS, UK

Received 27 September 2004; accepted 3 November 2004

Abstract

We have recently identified two resistance-associated point mutations of organophosphate (OP)-insensitive acetyl-cholinesterase in the olive fruit fly Bactrocera oleae, the most important olive orchard pest world-wide. We have devel-oped simple PCR-restriction fragment length polymorphism assays for each mutation, utilising an AccI restriction sitecreated by Ile214Val, and a BssHII restriction site destroyed by a neutral change always accompanying the secondmutation Gly488Ser. Samples from Greece homozygous for both mutations proved the most insensitive to dimethoate.The frequencies of these mutations in field-collected samples from several countries were investigated. Ninety-three per-cent of samples from Greece and Albania, where OPs have been extensively used in B. oleae control, were homozygousfor both mutations. Resistance-associated alleles were detected at lower frequencies, but still with both mutations inconjunction in the majority of cases, in western Mediterranean countries with limited use of OPs. Samples from SouthAfrica, however, did not have either of the resistance-associated mutations. The double mutation haplotype clearly con-fers a strong selective advantage in field populations of B. oleae exposed to OPs.� 2004 Elsevier Inc. All rights reserved.

Keywords: Bactrocera oleae; Organophosphate; Acetylcholinesterase; Resistance mutations; Molecular diagnostic; Haplotype;Modelling

0048-3575/$ - see front matter � 2004 Elsevier Inc. All rights reserve

doi:10.1016/j.pestbp.2004.11.003

* Corresponding authors. Fax: +44 151 705 3369 (N.J.Hawkes).

E-mail addresses: njhawkes@liv.ac.uk (N.J. Hawkes),vontas@imbb.forth.gr (J. Vontas).

1 Present address: Laboratory of Pesticide Science, Agricul-tural University of Athens, Iera Odos 75, Athens 18855, Greece.

1. Introduction

The olive fruit fly, Bactrocera oleaeGmelin (for-merly Dacus oleae), is the most important oliveorchard pest in southern Europe, Asia, and Africa,causing severe economic losses due to reduced

d.

N.J. Hawkes et al. / Pesticide Biochemistry and Physiology 81 (2005) 154–163 155

yields and diminished quality of both fruit and oil.In the Mediterranean basin, for more than threedecades control has been based on intensive useof the organophosphorus insecticide dimethoate,because of its low residual persistence in olive oil[1], although there has more recently been a switchtowards pyrethroids and the macrocyclic lactoneSpinosad, especially in western European coun-tries [2]. The appearance of B. oleae insecticide-re-sistant populations in olive groves has seriouslythreatened olive production and we have recentlyshown that acetylcholinesterase (AChE) modifica-tion is responsible for organophosphate resistancein dimethoate-selected flies from Greece [3,4].

In insects, insensitive AChE has commonlyevolved as a resistance mechanism against organo-phosphate (OP) and carbamate insecticides. Insen-sitivity across insect species is variable, becausedifferent mutations may provide resistance anddistinct genes encode the AChE target. In mosqui-toes and the aphids Aphis gossypii and Myzus per-sicae, there are two genes encoding AChE (ace-1and ace-2), the result of an ancient duplication(probably older than the emergence of arthropods)that appears to be conserved in all taxa studied todate except the Brachyceran Dipterans Drosophila

melanogaster, Musca domestica, Lucilia cuprina,and B. oleae [5–9]. For example, although onlyone ace ortholog (ace-2) has been isolated to datefor Nephotettix cincticeps [10], resistance is notlinked with this locus, suggesting the existence ofother ace genes; and in the cattle tick Boophilus

microplus, there appear to be three ace genes [11–14].

In mosquitoes, high levels of carbamate resis-tance are conferred by the same mutation (Gly119-Ser) in the resistance-associated ace-1 locus in fieldpopulations of at least three species [15]. In Culex

tritaeniorhynchus, however, a different mutation inace-1 (Phe331Trp, Torpedo numbering) is corre-lated with OP and carbamate resistance [16]; thiscodon is also mutated in the aphid M. persicae

[8] and in the spider mite Tetranychus urticae [17].In D. melanogaster, there is only one gene

encoding AChE, ace-2 (originally ace) [18,6], andvarious point mutations have been described inresistant strains, scattered across the gene [19,20].Five mutations were reported in the ace gene from

resistant M. domestica [21]. To date, however, onlytwo mutations have been identified in B. oleae

[3,4]. Gly488Ser is unique to the olive fruit fly,whilst Ile214Val has also been detected in bothD. melanogaster and M. domestica.

The aim of this study was to develop simplePCR-based assays for Gly488Ser and Ile214Valin insecticide-resistant B. oleae. These have beenvalidated with field-collected material from severalEuropean countries and from South Africa. Struc-tural modelling was used to develop a hypothesisfor the interaction of the resulting alterations.

2. Materials and methods

The insecticide susceptible LS, and the organo-phosphate resistant Attiki (16-fold resistance com-pared with LS) and LR (8-fold resistance) B. oleaestrains [22] were used in this study. Insect rearingconditions have been described previously[22,23]. Samples were collected from olive orch-ards in Greece (around Athens, and from two siteson the island of Crete), Albania (Tirana area),Italy (Posta Fibreno and Siena McCucco), Spain(Andalucia), France (Gely, Montpellier), andSouth Africa (Cape Province) (see Table 1).

Biochemical AChE insensitivity was determinedfor a set of Greek samples using methods de-scribed previously [22]. In brief, the activity of cen-trifuged homogenates of heads from individualfruit flies was measured in the presence and ab-sence of the insecticide dimethoate (0.03 mM),and the percentage residual activity in the dimeth-oate inhibited homogenate was calculated.

Genomic DNA was extracted from individualinsects using Tri reagent (Sigma–Aldrich, Poole,UK) as previously described [24]. Primers Boace3F(5 0 GCTTACCCGTGCTTATTTGG) and Boa-ce3R (5 0 AGCCAACGTATAGCCAATGC) weredesigned from the known mRNA sequence ofboache (GenBank Accession No. AF452052) toamplify a 232 bp fragment (codons 193–270) with-in exon 3. Primers Boace6F (5 0 ACACCAGCTGGGTTGGTAATC) and Boace-6R (5 0 AACGCTTGGGCATACTCATT) were designed toamplify a 106 bp product (codons 468–503) withinexon 6. Amplifications from 40 ng gDNA were

156 N.J. Hawkes et al. / Pesticide Biochemistry and Physiology 81 (2005) 154–163

performed in 1· Taq reaction buffer (PromegaUK, Southampton, UK) with a final concentra-tion of 2 mM MgCl2 and 0.5 lM of each primer,with cycling conditions 94 �C 5 min, 30 cycles of60 �C 30 s, 72 �C 45 s, 95 �C 15 s followed by72 �C 5 min. One-fifth of the amplification productwas incubated for 2 h in manufacturer�s reactionbuffer with 5 U enzyme (exon 3 products withAccI, exon 6 products with BssHII; Promega),and digestion products were electrophoresed on a2% (w/v) agarose gel. The remainder of the PCRproduct was purified using QiaQuick columns(Qiagen-UK, Crawley, UK) and either sequenceddirectly using the primers given above, or clonedinto the pGEM-Teasy vector (Promega) and sev-eral randomly chosen colonies sequenced (ensur-ing allele representation). Sequence data wereanalysed using Lasergene software (DNAStar,Madison, USA).

Modelling was performed using structures fromD. melanogaster (pdb code: 1QO9, 1DX4, [25]),

Fig. 1. Diagrammatic representation of the primer locations and mut(A) and 3 (B) amplification products. Partial sequence (5 0 and 3 0 regi

Torpedo californica (pdb code: 2ACE, [26]), Elec-trophorus electricus (pdb code: 1C2O, [27]), Mus

musculus (pdb code: 1J06, [28]), and Homo sapiens

(pdb code: 1B41, [29]). Three-dimensional struc-tures of AChE were created in VMD [30] andannotated using Drawplus4 (Serif, UK).

3. Results and discussion

3.1. PCR-RFLP assays to detect Ile214Val and

Gly488Ser resistance-associated mutations

Two resistance-associated boache mutationswere previously identified in dimethoate-selectedB. oleae strains [3,4]. In multiple alleles sequencedfrom the laboratory strains LS and LR [22], theGly488Ser mutation was always found in associa-tion with a neutral polymorphism at codon 484(Fig. 1A). The Gly488Ser mutation in itself(GGC to AGC) does not create or destroy any

ation-associated restriction site variations in B. oleae ace exon 6ons) is given for the larger exon 3 product (B).

Fig. 2. Correlation between biochemically determined acetyl-cholinesterase insensitivity and the presence of ace-1 mutationsdetected by PCR-RFLP, in samples from Greece. Biochemicalanalysis was performed according to Vontas et al. [22]. In brief,duplicate fly homogenate aliquots were incubated in thepresence (shaded bars) or absence (white bars) of 0.03 mMdimethoate and subsequently analysed for AChE activity.Individuals with greatest insensitivity towards dimethoate(retaining high levels of activity in the presence of dimethoate,Attiki collection) are homozygous for both 488Ser and 214Val(lane 6), those partially inhibited carry at least one 488Ser allele(lanes 2, 4 from LR strain, 3, 5 from Chania collection), andsusceptible insects with the highest degree of inhibition (LSstrain) are doubly wild-type (lane 1). The percentage inhibitionof acetylcholinesterase by dimethoate is given in parentheses.

N.J. Hawkes et al. / Pesticide Biochemistry and Physiology 81 (2005) 154–163 157

restriction sites. However, the associated neutralalteration (GGG to GGA) destroys a site forBssHII (GCGCGC) (Fig. 1A) and could thereforepotentially be used to differentiate resistant andsusceptible alleles. The likelihood of recombina-tion between the two positions is remote, giventheir close proximity, however we tested their asso-ciation in a wider range of field samples (fromGreece, Italy, France, Spain, and South Africa)by sequencing. One hundred and one alleles weresequenced, including 38 susceptible alleles (20from Greece, 5 each from Italy and South Africa,6 from France, and 1 each from Albania andSpain). There were no sequence alterations otherthan those associated with resistance, and therewas complete concordance between the presenceof the neutral polymorphism (GGG to GGA) atcodon 484 and the resistance-associated mutationGly488Ser (GGC to AGC). Thus, we were ableto reliably determine the presence of 488Ser allelesby restriction digestion with BssHII. The presenceof full-length (106 bp) resistance-associated exon 6alleles (488Ser) was determined by gel electropho-resis of BssHII-digested amplification products,with susceptible alleles (Gly488) digesting to givebands of 50 and 56 bp (Fig. 2).

The Ile214Val mutation (ATA to GTA) createsa site for the restriction enzyme AccI (GTMKAC,where M = A/C, K = G/T; Fig. 1B). We tested thesequence conservation of the PCR-amplified frag-ments from field samples (as above) and did notidentify sequence alterations in any of 52 exon 3alleles sequenced. The presence of full-length(232 bp) susceptible exon 3 alleles (Ile214) wasdetermined by gel electrophoresis of AccI-digestedamplification products, with resistant alleles(214Val) digesting to give bands of 168 and 64 bp.

The PCR-RFLP point mutation diagnostic wascoupled with an AChE inhibition assay for a sub-set of Greek samples (an average of five insects pergenotype were investigated; Fig. 2). The remainingactivities of AChE after inhibition by dimethoatein enzyme preparations from heads of individualinsects, where the two resistance-mutations arepresent in different combinations, are shown inFig. 2 together with PCR-RFLP data. The pres-ence of resistant mutations was consistent withthe AChE residual activity data. For example,

sample 6, which was homozygous for both muta-tions, was the most insensitive to dimethoate (only17% inhibition of activity), whereas sample 1 fromthe laboratory susceptible strain LS, which washomozygous for the wild-type susceptible allele,showed 85% inhibition of activity in the presenceof dimethoate. One interesting finding was thatsample 4 (homozygous for resistance-associated

158 N.J. Hawkes et al. / Pesticide Biochemistry and Physiology 81 (2005) 154–163

mutation 488Ser but homozygous for the wild typeIle214) showed greater inhibition by dimethoate(60% inhibition) than sample 3 (49% inhibition),which was heterozygous for the presence of thetwo resistance-associated mutations (both muta-tions on the same allele, data not shown). This sug-gests that whilst the 488Ser mutant AChE conferssome resistance to dimethoate (see also sample 2),the combination of 488Ser and 214Val gives in-creased insensitivity (also seen by comparing sam-ples 3 and 5). It appears that the changes imposedon AChE structure by these two mutations in com-bination are more favourable than any alterationresulting from Gly488Ser alone, although this re-quires further investigation using a larger sampleset. This will be discussed further below.

Diagnostic assays for known point mutationsoften involve allele-specific PCR, e.g., the Anophe-les gambiae knockdown resistance mutation detec-tion assay [31]. Alternatively, non-allele-specificPCR is followed by restriction digestion (PCR-RFLP), e.g., the ace-1 mutation in multiple mos-quitoes [15,32], or determination of migrationchanges in polyacrylamide gels (e.g., the singlestrand conformational polymorphism assay[33,34]). Analytical techniques are fully reviewedby Cotton et al. [35]. We have chosen to developtwo-step PCR-RFLP procedures for B. oleae

boache mutations that should be more robust thanallele-specific PCR (frequently problematic toestablish reliably, H. Ranson, personal communi-cation), and are only slightly more time-consum-ing. Thus, these assays should be simple to use inmonitoring AChE-based resistance in field-col-lected material. However, it should be rememberedthat although the sequence conservation and thecorrelation between the two G to A transitions inexon 6 (neutral polymorphism and resistance-asso-ciated mutation) from our sampling areas wasabsolute, this should be confirmed by sequencingof alleles in any future studies of other geographi-cal areas.

3.2. Application to field samples—resistance

monitoring

Samples from Greece (orchards in and aroundAthens and from 2 sites on Crete), additional

European sites (Albania, Italy, France, andSpain), and South Africa were analysed for thepresence of Ile214Val and Gly488Ser by thePCR-RFLP diagnostics developed in this study.Almost all field samples from Greece were homo-zygous for 488Ser; only one sample collected adecade ago on Crete was heterozygous. 488Serwas also detected in almost all samples fromAlbania (at a site �150 km from the Greek bor-der), at high levels in two Italian locations, andat lower frequencies in France and Spain. Themajority of these 488Ser individuals also carried214Val, although the incidence was slightly lower,with 4 individuals RR for Gly488Ser and RS forIle214Val, and 1 SS for Gly488Ser and RS forIle214Val (Table 1). Thus, this double mutationhaplotype is widespread within several Europeancountries with remarkably high frequencies ineastern Mediterranean countries such as Greece(where the annual cost of dimethoate-based chem-ical control exceeded $20 million in 1980s, involv-ing almost 75% of the olive orchards in thecountry [36]) and lower in western Mediterraneancountries, where the use of organophosphates islimited.

Samples from South Africa were the only fieldpopulation homozygous wild-type for both altera-tions in all samples assayed. This likely reflects alack of insecticide selection pressure, although itis possible that additional resistance-associatedmutations may be present in boache alleles fromthis continent, or indeed from the other areasstudied.

We have detected a surprisingly high inci-dence of the two mutations in the samples sur-veyed, collected over several years fromdifferent European sites. The probable selectiveadvantage of the double mutation (conferring�16-fold resistance [22]) over the single mutation(conferring only �8-fold resistance) means thatthe double mutation will likely spread in popula-tions subjected to intensive spraying with OPs.Since we have found 214Val in the absence of488Ser in only one field sample (from France),and a dimethoate-selected laboratory strain withintermediate resistance levels possessed the488Ser allele alone [3,4], we can speculate that488Ser was originally the first to be selected.

Table 1Incidence of resistance alleles in different countries. All field-collected samples were analysed by PCR-RFLP, and approximately half ofthese results were confirmed by sequencing of the amplified fragment

Population: description–region (collection date) Sample size (alleles) Resistance mutation allelic frequencies(hetero/homo)

% Gly488Ser % Ile214Val

GreeceLS, Susceptible lab strain 40 2.5 (1/0) 0 (0/0)LR, Resistant lab strain 40 97.5 (1/38) 0 (0/0)Attiki, Athens area 28 100.0 (0/28) 100.0 (0/28)Cr1, Chania Crete (Nov. 1993) 30 96.7 (1/28) 93.3 (2/26)Cr2, Herakleion, Crete (Oct. 2001) 36 100.0 (0/36) 100.0 (0/36)

AlbaniaAl1, Tirana area (Sept. 2002) 24 91.7 (2/20) 91.7 (2/20)

ItalyIt1, Posta Fibreno (Nov. 2002) 18 88.9 (2/14) 77.8 (4/10)It2, Siena McCucco (Sept. 2001) 28 67.9 (9/10) 64.3 (8/10)

SpainSp1, Andalucia (Nov. 2002) 18 33.3 (6/0) 27.8 (5/0)

FranceFr1 St. Gely, Montpellier (Sept. 2000) 18 27.8 (3/2) 33.3 (4/2)

South AfricaSA1, Cape Province (Oct. 2002) 12 0.0 (0/0) 0.0 (0/0)

N.J. Hawkes et al. / Pesticide Biochemistry and Physiology 81 (2005) 154–163 159

However, the greater degree of insecticide toler-ance conferred by 214Val most likely followedvery quickly. The corresponding mutation in D.

melanogaster, 199Val, confers very low levels ofAChE insensitivity alone [19] but is frequentlyfound in combination with other mutationsworld-wide [20].

The invariable presence (to date) of the neutralpolymorphism in the 488Ser resistance allele (to-gether with the absence of any other polymor-phism in the sequences examined) supports thehypothesis that this genotype arose once and sub-sequently spread, either through accidental intro-duction or fruit fly migration, since it is unlikelythat the same polymorphism would have arisenat the same time in each of several independentoriginating events. B. oleae may cover as muchas 4 km per day searching for host trees [37], anda pan-European migration is not unreasonable gi-ven that OPs were introduced more than four dec-ades ago. Those European countries represented inthis study have all utilised OP control over manyyears, although pyrethroids and the macrocyclic

lactone Spinosad are preferred currently [2].Migration of the predominant Esta21 and Estb21

amplicon underlying OP-resistance in the mos-quito Culex pipiens quinquefasciatus has beenwell-documented [38], as has the world-wide dis-persion of a single DDT-resistance allele in D. mel-

anogaster, in which a transposable elementfragment is located within the 5 0 untranslated re-gion of the cytochrome p450 monooxygenaseCyp6g1 [39].

3.3. Why is Ile214Val selected together with

Gly488Ser?

Gly488Ser is predicted to confer insecticide tol-erance through steric hindrance, the larger sidechain of serine distorting the active site pocket[3,4] and preventing access to the insecticide.Alone, it confers 8-fold resistance [22]. We havefound here that in almost all field-collected samplesfrom Europe, Gly488Ser occurs in conjunctionwith Ile214Val, and together this combination con-fers 16-fold resistance [22]. The selective advantage

160 N.J. Hawkes et al. / Pesticide Biochemistry and Physiology 81 (2005) 154–163

of the double mutation haplotype is clear, and theresulting homozygous mutant AChE retains morethan 80% of residual activity in the presence ofinsecticide (sample 6, Fig. 2), whereas the Gly488-Ser homozygous mutant has only 40% of residualactivity (sample 4, Fig. 2). One explanation is sim-ply that Ile214Val confers additional tolerance,through decreased binding to the insecticide, asidentified by Shi et al. [40]. However, structuralmodelling proposes the following, more complex,hypothesis for the selection of this combinationof mutations, suggesting that Ile214Val may allevi-ate to some extent detrimental effects of Gly488Serupon acetylcholine processing, although thismodel is as yet unsupported by direct experimentaldata.

Although Gly488Ser appears to reduce inhibi-tion by relatively large insecticide molecules, itmay also adversely affect access by acetylcholine,albeit to a lesser extent. In addition, a potentialhydrogen bond between the Oc of the 488Serand the amide proton of the adjacent Gly420 [Tor-pedo 328] could hamper the movement required ofthe catalytic Glu419 [Torpedo 327], for forming thecovalently bonded intermediate both in substrateturnover and organophosphate inhibition. Hence,Gly488Ser, whilst limiting the harmful effects ofinsecticide, may also confer sub-optimal acetylcho-line turnover. Substrates, whose size prevents themfrom forming the acylation intermediate duringthe hydrolysis event, are believed to undergo a sec-ondary catalysis process, employing Glu290 [Tor-pedo 199] and water acting directly in a basecatalysis [41]. This however requires a water mole-cule to be present in a position adjacent to theGlu290 [Torpedo 199].

Ile214 [Torpedo 129] is not situated in the activesite gorge but lies in a deep indent of its own, in veryclose proximity to Trp138 [Torpedo 84]. At posi-tions equivalent to 214 in boAChE in many otherspecies where the primary AChE amino acid se-quence is known, valine is actually the wild-typeresidue [42–47]. In all structures where valine ispresent, andwherewater solventmolecule positionshave also been determined (six in total; 2ACE,1B41, examined here, and the other structures re-ported in [48]), a water molecule is found buried in-side the indent, adjacent to Trp138 (HOH694 in the

2ACE structure, Fig. 3). The structure (1DX4),where solvent positions are determined and whichhas the bulkier isoleucine, does not have a watermolecule buried in the same way. It may be easierto bury water into the indent adjacent to the activesite gorge when the (smaller) valine side chain ispresent, than when isoleucine is present.

Trp138 has been proposed as a key residue inregulating the escape of the first product of thehydrolysis reaction from the active site gorge,through a possible ‘‘back door’’ [49,50]. Movementof the back door Trp138 [Torpedo 84] would have tobe regulated by its surrounding residues, perhaps byisoleucine at adjacent position 214. Rotation of theisoleucine side chain could permit the tryptophan tomove, enabling the products of the reaction to es-cape the active site. However, with a mutation tovaline and a smaller side chain, the more mobiletryptophan (also proposed by Shi et al. [40]) wouldallow reaction products to escape more easily. Con-versely, the adjacent water molecule could accessthe active site to charge the Glu290 [Torpedo 199]for a subsequent catalysis round using the alterna-tive pathway. In the background of an effectivewild-type catalytic process, this mechanism wouldbe of little advantage, and thus we would not expectto find Ile214Val alone (we found Ile214Val as a sin-gle mutation in only one field-collected sample).However, if catalytic activity were compromised(by steric hindrance imposed by Gly488Ser), thesmall change from isoleucine to valine at position214 might be sufficient to improve neurotransmitterturnover by facilitating the alternative acetylcho-line catalytic process. We propose therefore thatthe tight linkage between Ile214Val and Gly488Serarose because this combination of mutations con-fers insecticide insensitivity whilst being less detri-mental to the normal function of AChE thanGly488Ser alone, and continued insecticide pres-sure resulted in the spread of this haplotype. How-ever, we emphasise that this hypothesis requiresexperimental confirmation through expressionand in vitro mutagenesis studies.

In conclusion, we have developed simple PCR-RFLP assays that have detected a high incidenceof insecticide resistance-mutations in B. oleae ace

across Mediterranean countries. The mutationGly488Ser in B. oleae is almost always accompa-

Fig. 3. The figure shows the catalytic triad residues Ser291 [Torpedo 200], His532 [Torpedo 440], and Glu419 [Torpedo 327], andadjacent to this glutamate the Gly420 [Torpedo 328]. The residues mutated in the organophosphate-resistant B. oleae 488Ser [Torpedo396], formerly glycine, and 214Val [Torpedo 129], formerly Isoleucine, are shown at the extremes of the figure. Trp138 [Torpedo 84]lines the active site gorge of the AChE, and the path of this gorge runs approximately up from the bottom centre of the figure overHis532 [Torpedo 440]. To the right, flanked by Trp138 [Torpedo 84] and 214Val [Torpedo 129], is the indent adjacent to the gorge, withthe conserved water, HOH694, buried away from the solvent. This water may gain entry to the active site via the ‘‘back door’’ and beinvolved in a general acid–base catalysis with Glu290 [Torpedo 199].

N.J. Hawkes et al. / Pesticide Biochemistry and Physiology 81 (2005) 154–163 161

nied by Ile214Val and we propose a structuralmodel to explain the possible selective advantageof this double mutation allele which suggests thatpotentially detrimental effects on acetylcholinecatalysis conferred by Gly488Ser are substantiallyalleviated by Ile214Val.

Acknowledgments

We thank Dr. Poppy Christofides (The Gou-landris Natural History Museum, Soil Ecologyand Biotechnology Laboratory, Kifissia, Greece),Dr. Kim Hoelmer (European Biological ControlLaboratory, US Dept. Agriculture, Montpellier,France), and Dr. Nardi Francesco (Biologia Evo-lutiva, Universita degli studi di Siena, Italy) forproviding field-collected B. oleae samples, Dr. Hil-ary Ranson for constructive comments on themanuscript and Anita McBride and Amanda Ballfor technical assistance with sequencing. We alsothank anonymous reviewers for their helpfulsuggestions.

References

[1] P. Cabras, A. Angioni, V.L. Garau, M. Melis, F.M. Pirisi,M. Karim, E.V. Minelli, Persistence of insecticide residuesin olives and olive oil, J. Agric. Food Chem. 45 (1997)2244.

[2] G.E. Haniotakis, Olive pest control: present status andprospects, Proceedings of the IOBC/WPRS Conference,Integrated Protection of Olive Crops, 2003, Chania, Crete.

[3] J.G. Vontas, M.J. Hejazi, N.J. Hawkes, N. Cosmidis, M.Loukas, J. Hemingway, Resistance-associated point muta-tions of organophosphate insensitive acetylcholinesterase,in the olive fruit fly Bactrocera oleae, Insect Mol. Biol. 11(2002) 329.

[4] J.G. Vontas, M.J. Hejazi, N.J. Hawkes, N. Cosmidis, M.Loukas, R.W. Janes, J. Hemingway, Corrigendum, InsectMol. Biol. 12 (2003) 413.

[5] C.A. Malcolm, D. Bourguet, A. Ascolillo, S.J. Rooker,C.F. Garvey, L.M. Hall, N. Pasteur, M. Raymond, Asex-linked Ace gene, not linked to insensitive acetylcho-linesterase-mediated insecticide resistance in Culex pipiens,Insect Mol. Biol. 7 (1998) 107.

[6] M. Weill, P. Fort, A. Berthomieu, M.P. Dubois, N.Pasteur, M. Raymond, A novel acetylcholinesterase genein mosquitoes codes for the insecticide target and is non-homologous to the ace gene in Drosophila, Proc. R. Soc.Lond. 269 (B) (2002) 2007.

162 N.J. Hawkes et al. / Pesticide Biochemistry and Physiology 81 (2005) 154–163

[7] F. Li, Z.J. Han, Two different genes encoding acetylcho-linesterase existing in cotton aphid (Aphis gossypii),Genome 45 (2002) 1134.

[8] T. Nabeshima, T. Kozaki, T. Tomita, Y. Kono, An aminoacid substitution on the second acetylcholinesterase in thepirimicarb-resistant strains of the peach-potato aphid,Myzus persicae, Biochem. Biophys. Res. Commun. 307(2003) 15.

[9] Z. Chen, R. Newcomb, E. Forbes, J. McKenzie, P.Batterham, The acetylcholinesterase gene and organo-phosphorus resistance in the Australian sheep blowfly,Lucilia cuprina, Insect Biochem. Mol. Biol. 31 (2001)805.

[10] T. Tomita, O. Hidoh, Y. Kono, Absence of proteinpolymorphism attributable to insecticide-insensitivity ofacetylcholinesterase in the green rice leafhopper, Neph-

otettix cincticeps, Insect Biochem. Mol. Biol. 30 (2000)325.

[11] G.D. Baxter, S.C. Barker, Acetylcholinesterase cDNA ofthe cattle tick, Boophilus microplus: characterisation androle in organophosphate resistance, Insect Biochem. Mol.Biol. 28 (1998) 581.

[12] R. Hernandez, H. He, A.C. Chen, G.W. Ivie, J.E. George,G.G. Wagner, Cloning and sequencing of a putativeacetylcholinesterase cDNA from Boophilus microplus

(Acari: Ixodidae), J. Med. Entomol. 36 (1999) 764.[13] G.D. Baxter, S.C. Barker, Analysis of the sequence and

expression of a second putative acetylcholinesterase cDNAfrom organophosphate-susceptible and organophosphate-resistant cattle ticks, Insect Biochem. Mol. Biol. 32 (2002)815.

[14] K.B. Temeyer, R.B. Davey, A.C. Chen, Identification of athird Boophilus microplus (Acari: Ixodidae) cDNA pre-sumptively encoding an acetylcholinesterase, J. Med.Entomol. 41 (2004) 259.

[15] M. Weill, G. Lutfalla, K. Mogensen, F. Chandre, A.Berthomieu, C. Berticat, N. Pasteur, A. Philips, P. Fort,M. Raymond, Insecticide resistance in mosquito vectors,Nature 423 (2003) 136.

[16] T. Nabeshima, A. Mori, T. Kozaki, Y. Iwata, O. Hidoh,S. Harada, S. Kasai, D.W. Severson, Y. Kono, T. Tomita,An amino acid substitution attributable to insecticide-insensitivity of acetylcholinesterase in a Japanese enceph-alitis vector mosquito, Culex tritaeniorhynchus, Biochem.Biophys. Res. Commun. 313 (2004) 794.

[17] Y. Anazawa, T. Tomita, T. Aiki, T. Kozaki, Y. Kono,Sequence of a cDNA encoding acetylcholinesterase fromsusceptible and resistant two-spotted spider mite, Tetrany-chus urticae, Insect Biochem. Mol. Biol. 33 (2003) 509.

[18] D. Fournier, F. Karch, J.M. Bride, L.M.C. Hall, J.-B.Berge, P. Spierer, Drosophila melanogaster acetylcholines-terase gene, structure evolution and mutations, J. Mol.Evol. 210 (1989) 15.

[19] A. Mutero, M. Pralavorio, J.M. Bride, D. Fournier,Resistance associated point mutations in insecticide-insen-sitive acetylcholinesterase, Proc. Natl Acad. Sci. (USA) 91(1994) 5922.

[20] P. Menozzi, M.A. Shi, A. Lougarre, Z.H. Tang, D.Fournier, Mutations of acetylcholinesterase which conferinsecticide resistance in Drosophila melanogaster popula-tions, BMC Evol. Biol. 5 (2004) 4.

[21] S.B. Walsh, T.A. Dolden, G.D. Moores, M. Kristensen,T. Lewis, A.L. Devonshire, M.S. Williamson, Identifica-tion and characterisation of mutations in housefly (Musca

domestica) acetylcholinesterase involved in insecticideresistance, Biochem. J. 359 (2001) 175.

[22] J.G. Vontas, N. Cosmidis, M. Loukas, S. Tsakas, M.J.Hejazi, A. Ayoutanti, J. Hemingway, Altered acetylcho-linesterase confers organophosphate resistance in the olivefruit fly Bactrocera oleae, Pestic. Biochem. Physiol. 71(2001) 124.

[23] N. Cosmidis, Study of the selection at the alcoholdehydrogenase locus in the olive fruit fly, Ph.D. thesis(in Greek), (1995) Agricultural University of Athens,Greece.

[24] M.G. Paton, S.H.P.P. Karunaratne, E. Giakoumaki, N.Roberts, J. Hemingway, Quantitative analysis of geneamplification in insecticide resistant Culex mosquitoes,Biochem. J. 346 (2000) 17.

[25] M. Harel, G. Kryger, T.L. Rosenberry, W.D. Mallender,T. Lewis, R.J. Fletcher, J.M. Guss, I. Silman, J.L.Sussman, Three-dimensional structures of Drosophila mel-

anogaster acetylcholinesterase and of its complexes withtwo potent inhibitors, Protein Sci. 9 (2000) 1063.

[26] M.L. Raves, M. Harel, Y-P. Pang, I. Silman, A.P.Kozikowski, J.L. Sussman, Structure of acetylcholinester-ase complexed with the nootropic alkaloid, (�)-huperzineA, Nat. Struct. Biol. 41 (1997) 57.

[27] Y. Bourne, P. Taylor, Z. Radic, P. Marchot, Structuralinsights into ligand interactions at the acetylcholinesteraseperipheral anionic site, EMBO J. 22 (2003) 1.

[28] Y. Bourne, J. Grassi, P.E. Bougis, P. Marchot, Confor-mational flexibility of the acetylcholinesterase tetramersuggested by X-ray crystallography, J. Biol. Chem. 274(2000) 30370.

[29] G. Kryger, M. Harel, K. Giles, L. Toker, B. Velan, A.Lazar, C. Kronman, D. Barak, N. Ariel, A. Shafferman,I. Silman, J.L. Sussman, Structures of recombinant nativeand E202Q mutant human acetylcholinesterase complexedwith the snake-venom toxin fasciculin-II, Acta Crystallogr.D 56 (2000) 1385.

[30] W. Humphrey, A. Dalke, K. Schulten, VMD: visualmolecular dynamics, J. Mol. Graph. 14 (1996) 33.

[31] D. Martinez-Torres, F. Chandre, M.S. Williamson, F.Darriet, J-B. Berge, A.L. Devonshire, P. Guillet, N.Pasteur, D. Pauron, Molecular characterisation of pyre-throid knock-down resistance (kdr) in the major malariavector Anopheles gambiae s.s., Insect Mol. Biol. 7 (1998)179.

[32] M. Weill, C. Malcolm, F. Chandre, K. Mogensen, A.Berthomieu, M. Marquine, M. Raymond, The uniquemutation in ace-1 giving high insecticide resistance iseasily detectable in mosquito vectors, Insect Mol. Biol. 13(2004) 1.

N.J. Hawkes et al. / Pesticide Biochemistry and Physiology 81 (2005) 154–163 163

[33] A.G. Zhang, J.B. Dunn, J.M. Clark, An efficient strategyfor validation of a point mutation associated with acetyl-cholinesterase sensitivity to azinphosmethyl in Coloradopotato beetle, Pestic. Biochem. Physiol. 65 (1999) 25.

[34] N. Anthony, T. Unruh, D. Ganser, R. ffrench-Constant,Duplication of the Rdl GABA receptor subunit gene in aninsecticide-resistant aphid, Myzus persicae, Mol. Gen.Genet. 260 (1998) 165.

[35] R.G.H. Cotton, E. Edkins, S. Forrest (Eds.), MutationDetection—A Practical Approach, Oxford UniversityPress, Oxford, UK, 1998.

[36] N. Chaniotakis, Protection of olive orchards in organicfarming, Proceedings of the National Conference ofOrganic Farming in Kalamata (1994) 135.

[37] R.E. Rice, Bionomics of the olive fruit fly Bactrocera

(Dacus) oleae, UC Plant Prot. Quarterly 10 (2000) 1.Available from: <www.uckac.edu/ppq/PDF/00July.pdf>.

[38] M. Raymond, A. Callaghan, P. Fort, N. Pasteur, World-wide migration of amplified insecticide resistance genes inmosquitoes, Nature 350 (1991) 151.

[39] P.J. Daborn, J.L. Yen, M.R. Bogwitz, G. Le Goff, E. Feil,S. Jeffer, N. Tijet, T. Perry, D. Heckel, P. Batterham, R.Feyereisen, T.G. Wilson, R.H. ffrench-Constant, A singlep450 allele associated with insecticide resistance in Dro-

sophila, Science 297 (2002) 2253.[40] M.A. Shi, A. Lougarre, C. Alies, I. Fremaux, Z.H. Tang,

J. Stojan, D. Fournier, Acetylcholinesterase alterationsreveal the fitness cost of mutations conferring insecticideresistance, BMC Evol. Biol. 4 (2004) 5.

[41] T. Selwood, S.R. Feaster, M.J. States, A.N. Pryor, D.M.Quinn, Parallel mechanisms in acetylcholinesterase-cata-lyzed hydrolysis of choline esters, J. Am. Chem. Soc. 115(1993) 10477.

[42] M. Schumacher, S. Camp, Y. Maulet, M. Newton, K.Macpheequigley, S.S. Taylor, T. Friedmann, P. Taylor,Primary structure of Torpedo californica acetylcholinester-

ase deduced from its cDNA sequence, Nature 319 (1986)407.

[43] S. Simon, J. Massoulie, Cloning and expression ofacetylcholinesterase from Electrophorus—splicing patternof the 30 exons in vivo and in transfected mammalian cells,J. Biol. Chem. 272 (1997) 33045.

[44] T.L. Rachinsky, S. Camp, Y. Li, T.J. Ekstrom, M.Newton, P. Taylor, Molecular-cloning of mouse acetyl-cholinesterase—tissue distribution of alternatively splicedmessenger-RNA species, Neuron 5 (1990) 317.

[45] H. Soreq, R. Ben-Aziz, C.A. Prody, S. Seidman, A. Gnatt,L. Neville, J. Lieman-Hurwitz, E. Lev-Lehman, D. Ginz-berg, Y. Lipidot-Lifson, H. Zakut, Molecular-cloning andconstruction of the coding region for human acetylcholin-esterase reveals a g + c-rich attenuating structure, Proc.Natl Acad. Sci. (USA) 87 (1990) 9688.

[46] N. Anthony, T. Rocheleau, G. Mocelin, H.J. Lee, R.ffrench-Constant, Cloning, sequencing and functionalexpression of an acetylcholinesterase gene from the yellowfever mosquito, Aedes aegypti, FEBS Lett. 368 (1995) 461.

[47] K.Y. Zhu, J.M. Clark, Cloning and sequencing of a cDNAencoding acetylcholinesterase in Colorado potato beetle,Leptinotarsa decemlineata (Say), Insect Biochem. Mol.Biol. 25 (1995) 1129.

[48] G. Koellner, G. Kryger, C.B. Millard, I. Silman, J.L.Sussman, T. Steiner, Active-site gorge and buried watermolecules in crystal structures of acetylcholinesterase fromTorpedo californica, J. Mol. Biol. 296 (2000) 713.

[49] D.R. Ripoll, C.H. Faerman, P.H. Axelsen, I. Silman, J.L.Sussman, An electrostatic mechanism for substrate guid-ance down the aromatic gorge of acetylcholinesterase,Proc. Natl Acad. Sci. (USA) 90 (1993) 5128.

[50] C. Bartolucci, E. Perola, L. Cellai, M. Brufani, D. Lamba,‘‘Back Door’’ opening implied by the crystal structure of acarbamoylated acetylcholinesterase, Biochemistry 38(1999) 5714.