Genetic analysis of the Paramecium aurelia species complex (Protozoa: Ciliophora) by classical and...

Systematics and Biodiversity 5 (4): 417–434 Issued 20 November 2007

doi:10.1017/S1477200007002307 Printed in the United Kingdom C© The Natural History Museum

Ewa Przybos1 ∗

, MaŐlgorzataPrajer

1, Magdalena

Greczek-Stachura2,

BogumiŐla Skotarczak3,

Agnieszka Maciejewska3

&Sebastian Tarcz

1

1Institute of Systematics andEvolution of Animals, PolishAcademy of Sciences,SŐlawkowska 17, 31-016 Krakow,Poland2Institute of Biology,Educational Academy,Podbrzezie 3, 31-054 Krakow,Poland3Department of Genetics,Szczecin University, Al. Piastow40b, 71-065 Szczecin, Poland

submitted April 2005

accepted December 2006

Genetic analysis of the Parameciumaurelia species complex (Protozoa:Ciliophora) by classical and molecularmethods

Abstract The Paramecium aurelia complex includes 15 species (sibling species) andis characterised by inbreeding (to varying degrees in different species), causing anincrease in intra-specific differentiation. Investigations into inter- and intraspecificdifferentiation of strains originating from remote habitats within species of the com-plex were carried out by classical inter-strain crosses and molecular analyses (RAPD–PCR fingerprints, ARDRA riboprints, RFLP–PCR analysis). RAPD analysis showed thatall species in the complex possessed characteristic band patterns and the majoritywere also polymorphic intra-specifically. A correlation exists between the degree ofinbreeding characteristic for a species with differentiation of DNA genotypes revealedby RAPD analysis within species, where inbreeders showed substantial variability ofband patterns and moderate inbreeders were highly similar. RFLP analysis (a 480bpfragment of the gene coding the Hsp 70 protein) with the application of restrictionenzyme TruII distinguished among species, while digestion with restriction enzymeAluI distinguished groups of species (clusters) and both enzymes revealed intra-species polymorphism within P. dodecaurelia. ARDRA riboprinting (using a fragmentof SSU-LSU rDNA, about 2400 bp) with restriction enzymes HhaI, AluI, HinfI, TaqIdistinguished groups of species with different band patterns. The majority of en-zymes also demonstrated intra-specific differentiation within P. dodecaurelia. TaqIalso revealed intraspecific differences in P. biaurelia and P. tetraurelia. All speciesin the P. aurelia complex showed a high percentage of surviving hybrid clones in F1

obtained by conjugation and F2 obtained by autogamy in inter-strain crosses. A lowpercentage was observed only in F2 inter-strain hybrids of P. tredecaurelia, howeverno cytological changes in the nuclear apparatuses were detected and similar bandpatterns existed in the studied strains. Future studies, including sequencing of rDNAfragments, may disclose deeper relationships of the species.

Key words Paramecium aurelia, species complex, speciation, strains, inbreedingsystem, strain crosses, molecular analysis

IntroductionParamecium, a unicellular eukaryote, is a model organism instudies on speciation, cell biology, genetics, biochemistry andmolecular biology; species in the P. aurelia complex in partic-ular having been used as model organisms in studies on speci-ation. Some species show a great intra-species polymorphism;their strains are characterised by different genotypes revealedby genetic markers. Such intra-species polymorphism may be

∗Corresponding author. Email: [email protected]

recognised as a beginning of the process of speciation. Com-parison of genomic variability may also be useful for the char-acterisation of population structures. Consequently, we haveused species in the P. aurelia complex in our research on gen-eral problems of species structure and the process of speciationin eukaryotes.

The genus Paramecium includes several taxonomic spe-cies among which ‘Paramecium aurelia’ Muller 1773 has beenthe most frequently investigated. Since Sonneborn assigned bi-nominal names to particular genetic species in 1975, it has beenknown as the Paramecium aurelia species complex; they are

417

418 Ewa Przybos et al.

sibling species, morphologically similar, but with isolated genepools. The P. aurelia complex comprises 14 species describedby Sonneborn (1975) and a 15th species (P. sonneborni) de-scribed by Aufderheide et al. (1983). The species differ indistribution, temperature preferences, conditions required foracquisition of conjugation, system of mating types inheritanceand life cycle features.

The P. aurelia complex is characterised by inbreedingoccurring in various degrees in different species (Sonneborn,1957; Landis, 1986) causing an increase in intra-species dif-ferentiation. Depending on the degree of inbreeding, strainswithin species are more or less isolated, showing a higheror lower percentage of surviving hybrid clones in inter-straincrosses. This aspect has been only fragmentarily addressedwithin a few species. For instance, some strains in P. tetraure-lia (Dippell, 1954) and P. primaurelia (Kosciuszko, 1965) havebeen investigated genetically and karyologically. Other stud-ies on karyological differentiation of strains within speciesconcern only single strains (Jones, 1956). Recent papers havecompared species within the P. aurelia complex, yet they havealways been carried out on single strains of particular speciesor only on a few species. For instance, investigations on watersalinity tolerance were conducted on only three species (Fokin& Smurov, 2001) and comparative studies within the sub-class Peniculia or within the genus Paramecium based on SSUrRNA sequences included only two species (Struder-Kypkeet al., 2000a b; Fokin et al., 2004). Nanney et al. (1998) com-pared sequence differences in the variable 23S rRNA domainfor the construction of phylogenetic relationship of Parame-cium, Tetrahymena, and Colpoda using several species of theP. aurelia complex (P. biaurelia, P. triaurelia, P. tetraurelia,P. sexaurelia, P. octaurelia, P. tredecaurelia, P. sonneborni)but the species were represented by single strains only. Simil-arly, Coleman (2005) sequenced the internal transcribed spacer(ITS) region of the nuclear ribosomal cistron of 13 species ofthe P. aurelia complex for analysis of their phylogenetic rela-tionships using either one or two strains per species. Recently,the Paramecium tetraurelia genome has also been sequenced(Dessen et al., 2001; Sperling et al., 2002; Zagulski et al.,2004).

Therefore investigations of strain relationships by inter-strain crosses within all species of the complex, and compar-ison of numerous strain genotypes revealed by RAPD (ran-dom amplified polymorphic DNA) – PCR (polymerase chainreaction) fingerprints, ARDRA (amplified ribosomal DNA re-striction analysis) riboprints, RFLP (restriction fragment poly-morphism) – PCR analysis, together with phylogenetic ana-lysis of species should disclose the structure of the complex.

It seems that knowledge of the genetic relationships ofstrains within species as well as among species is essentialfor understanding the intricacies of the Paramecium aureliaspecies complex. Here we investigate the degree of geneticdifferentiation among strains in species within the complexoriginating from remote and isolated localities (habitats) andalso relationships between species in the complex. We ex-amined cosmopolitan species such as P. primaurelia, P. bi-aurelia, P. tetraurelia, relatively rare species represented byallopatric strains recently discovered beyond the known range,

and also those previously accepted in literature (Sonneborn,1974, 1975); species such as P. pentaurelia, P. septaurelia,P. octaurelia, P. decaurelia, P. dodecaurelia, P. tredecaureliaand P. quadecaurelia (Przybos, 2005). This study encompassesall known species in the complex and includes P. undecaureliaand P. sonneborni, which are known only from single habitats.

The genetic diversity of strain genotypes within particu-lar species of the complex and species relationships within thecomplex were examined at three levels: cellular – by classicalstrain crosses and by assessing the percentage of survivingclones in F1 and F2 generations in the particular species; mo-lecular – by RAPD–PCR fingerprints, ARDRA riboprinting,RFLP analysis and subcellular – by cytological analysis ofnuclear apparatuses in inter-strain hybrids.

The aim of the study was to investigate the genetic re-lationships of the particular species composing the P. aureliacomplex as well as the rate of speciation (differentiation) ofstrains within species by inter-strain crosses and comparison ofstrain genotypes revealed by the applied molecular methods.

Materials and methodsThe following species of the P. aurelia complex were stud-ied: P. primaurelia, P. biaurelia, P. tetraurelia, P. pentaurelia,P. septaurelia, P. octaurelia, P. decaurelia, P. undecaurelia, P.dodecaurelia, P. tredecaurelia, P. quadecaurelia and P. son-neborni. Strains of each species are listed in Table 1.

Strain cultivation and crossingThe methods of Sonneborn (1970) were used for the cultiva-tion of strains, induction of conjugation and autogamy. Para-mecia were cultivated on a lettuce medium inoculated with En-terobacter aerogenes at a temperature of 24 ◦C. In the intra andinter-strain crosses, the F1 generation was obtained by conjug-ation and F2 by autogamy (using the method of daily isolationlines). The occurrence of the desired stage of autogamy (speci-mens at the stage of two macronuclear anlagen) was examinedon preparations stained with aceto-carmine. Survival of clonesin both generations was estimated from a total of 100 clones.Clones were considered survivors after passing 6–7 fissionsduring 72 hours following the separation of conjugation part-ners or postautogamous caryonids, in accordance with Chen(1956).

All possible inter- and intrastrain crosses within specieswere performed. We compared the percentage of survivingclones in the inter-strain crosses and the time of persistenceof particular generations of inter-strain hybrids. The methodshave been described in detail in Przybos (1975).

Methods used in cytologicalanalysisAnalysis of nuclear apparatuses of inter-strain hybrids wascarried out by temporarily staining slides with aceto-carmine(Sonneborn, 1950) or by making permanent slides fixed inSchaudinn’s fluid with glacial acetic acid (Chen, 1944) and

The Paramecium aurelia species complex 419

Species Strain designation Geographical origin References

Paramecium primaurelia 90 standard of the species (1) USA, Pennsylvania,Bethayres

Sonneborn, 1974

SA (2) Spain, Andalusia Przybos unpublishedGA (23) Greece, Athens Przybos & Fokin, 2002RM (4) Russia, Moscow Komala & Dubis, 1966VH (21) Vietnam, Hanoi Przybos & Fokin, 1996IJ (25) Israel, Qasr-el Yehud,

River JordanPrzybos, 1995

PB (260) Poland, Carpathians,Bieszczady Mts

Komala & Przybos, 1980

Paramecium biaurelia Rieff standard of the species (31) Scotland, Rieff Beale & Schneller, 1954SS (261) Spain, Segovia Przybos, 1980RC (46) Romania, Cluj Przybos, 1968RI (34) Russia, Irkutsk Przybos & Fokin, 1996IG (41) Italy, Island of Giglio Przybos, 1998PP (75) Poland, Pomeranian

Lake District, PruszczPrzybos & Komala, 1981

PSK (65) Poland, Middle SudetesMts

Przybos & Komala, 1988

Paramecium tetraurelia S standard of the species (92) Australia, Sydney Sonneborn, 1974SM (94) Spain, Madrid Przybos, 1980ST (95) Slovakia, Carpathians,

Tatras, Strbske LakeDubis & Komala, 1963

IT (97) Istrael, Tabga Przybos, 1995J (99) Japan, Honshu Island Przybos & Fokin, 2001PK (104) Poland, Krakow Komala & Przybos, 2000

Paramecium pentaurelia 87 standard of the species (106) USA, Pennsylvania Sonneborn, 1974RAZ (115) Russia, Astrahan Nature

ReservePrzybos et al., 2004

Paramecium septaurelia 38 standard of the species (144) USA, Florida Sonneborn, 1974RA (210) Russia, Astrahan Nature

ReservePrzybos et al., 2004

Paramecium octaurelia 138 standard of the species (168) USA, Florida Sonneborn, 1974IEE (169) Israel, Ein Efek Przybos et al., 2002a

Paramecium decaurelia 223 standard of the species (194) USA, Florida Sonneborn, 1974JN (195) Japan, Nara Przybos et al., 2003b

Paramecium undecaurelia 219standard of the species (196) USA, Texas Sonneborn, 1975

Paramecium dodecaurelia 246 standard of the species (197) USA, southern state Sonneborn, 1974HHS (199) Hawaii, Honolulu Przybos & Fokin, 2003aJU (198) Japan, Ube Przybos et al., 2003bG (201) Germany, Munster Przybos & Fokin, 2003bIE (200) Italy, Elbe Island Przybos & Fokin, 2003b

Paramecium tredecaurelia 209 standard of the species (203) France, Paris Rafalko & Sonneborn,1959

321 standard of the species (204) Mexico, Taxco Rafalko & Sonneborn,1959

IKM (205) Israel, Kinet Motzkin Przybos et al., 2002bParamecium quadecaurelia 328 standard of the species (206) Australia, Emily Gap Sonneborn, 1975

AN (207) Africa, Namibia Przybos et al., 2003aParamecium sonneborni PS standard of the species (208) USA, Texas Aufderheide et al., 1983

Table 1 Strains of species of the Paramecium aurelia complex used in this study. In the second column, the numbers of strains deposited inthe collection of the Institute of Systematics and Evolution of Animals, Polish Academy of Sciences, are indicated in parentheses. Listof strains is accessible at: http://www.isez.pan.krakow.pl (Department of Experimental Zoology).


stained using Giemsa (10% Giemsa solution in 0.01 M phos-phate buffer), (cf. Przybos, 1978).

Methods used in molecular analysis

Random amplified polymorphic DNA–PCR(RAPD–PCR) analysisParamecium genomic DNA was isolated from vegetative cellsat the end of the exponential phase using QIAamp DNA MiniKit (Qiagen Germany) as described in Przybos et al. (2003c).DNA was stored at −20 ◦C until analysis. All strains used ininvestigations are listed in Table 1.

PCR amplification for RAPD analysis was carried outusing one oligonucleotide 10 mer random primer character-ized by the sequence 5′-GCAGAGAAGG-3′. This primer waschosen from a series of ten 10 mer random primers (Ro 460Roth, Karlsruhe, Germany) because it gave easily distinguish-able banding patterns for species and strains in Parameciumjenningsi (Skotarczak et al., 2004 a, b). The same primer wasalso used in several studies carried out on P. aurelia spp.(Stoeck et al., 1998, 2000a) and on P. jenningsi (Przybos et al.,1999, 2003c). Each 20 µl PCR mixture contained 2 µl of DNAtemplate, 1 × reaction QIAGEN buffer, 2.5 mM MgCl2, 200µM dNTPs, 1.5 µM primer, 1.5U of Taq DNA polymerase(QIAGEN). PCR reactions were performed according to theprogram described by Stoeck and Schmidt (1998).

PCR products (15 µl), along with the pGEM DNA mo-lecular weight marker (Promega) were run on 1.5% TBEagarose gels stained with 0.5 µg ml−1 ethidium bromide. Gen-erally, three repetitions of the PCR reaction were performedin order to assess the reproducibility of the data. All RAPDparameters were carefully standardized.

Restriction fragment length polymorphism(RFLP–PCR) analysisDNA was isolated from c. 20 cells (similar culture conditionsas described in 3a) of each of the studied strains (Table 1) usingMaster Pure DNA Purification Kit (Epicentre, USA).

A fragment (about 480 bp) of the gene coding theHsp70 protein was PCR amplified using forward primer Afor(GAGGAGAAGATTTCGATAAC) and reverse primer Arev(GCTTCATCTGGGTTGATTGA) (Biomers, Germany) as inPrzybos et al. (2003c). The reaction mixture of 50 µl finalvolume contained: 5 µl DNA isolate, Qiagen polymerase (0.05U/µl of reaction mixture), Qiagen buffer (1 × concentrated,c. 1.5 mM MgCl2/µl reaction mixture), MgCl2 (c. 0.0025MgCl2/µl reaction mixture), primers Afor and Arev in equalquantities (c. 0.5 pmol/µl of reaction mixture), dNTPs (c. 100µM/µl of reaction mixture), and water to 10 µl.

PCR products were precipitated and purified by an eth-anol (96% and 70%) and sodium acetate protocol. DNA wassuspended in 5 µl of Te buffer (pH = 8).

Digestion of amplification products was conducted usingAluI, EcoRI and TruII restrictases (Fermentas, Lithuania), eachat a concentration of c. 0.15 U per µl of reaction mixture. Themixture for restriction digestion for 1 sample (20 µl volume)contained 5 µl of the amplification product, 0.15 U enzyme/µl

of reaction mixture, 2 µl of buffer for the particular enzymeand water to 20 µl.

The digestion was carried out at 37 ◦C for 18 hours.Enzymes were inactivated at 65 ◦C.

The products of the enzyme digestion were separated byelectrophoresis in 4.5% agarose for 4 hours at 85 V togetherwith a set of DNA molecular weight markers that includedGeneRuler (Fermentas, Lithuania), SmartLadder (Eurogentec,Belgium), Marker 501 and Marker 1044 (Polgen, Poland). Gelswere stained with ethidium bromide and visualised under UVlight. The images were stored in computer memory using theprogram Biocapt (Vilbert Lourmat, France). The length of therestriction fragments obtained was evaluated using the Bio 1Dprogram (Vilbert Lourmat, France).

Amplified ribosomal DNA restriction analysis(ARDRA) (fragment of SSU-LSU rDNA)Paramecium genomic DNA was isolated from vegetative cellsat the end of the exponential phase using the QIamp DNA MiniKit (Qiagen Germany) as described in Przybos et al. (2003c)from all studied species and strains (Table 1).

For ARDRA analysis PCR, amplifications of gen-omic DNA were performed using the forward primer 5′-GAAACTGCGAATGGCTC-3′, an internal ciliate specific se-quencing primer (82F) from the 5′ end of the SSU rRNAgene (Elwood et al., 1985) and the reverse primer: 5′-TTGGTCCGTGTTTCAAGACG-3′; constructed from a re-gion of the ciliate LSU rRNA (Jerome & Lynn, 1996). Eachamplification reaction was carried out in 100 µl of reactionmixture containing 2 µl DNA template, 1 × QIAGEN PCRbuffer, 1 × Q solution, 200 µM dNTP mix, 0.4 µM of eachprimer, 2.5U of Taq DNA polymerase (QIAGEN). PCR reac-tions were performed under the following conditions: initialdenaturation 10 min at 94 ◦C, and next 40 cycles consisted ofdenaturation 1 min at 94 ◦C, annealing 2 min at 49 ◦C andextension 2 min at 72 ◦C. These cycling sequences were fol-lowed by a final extension of 10 min at 72 ◦C. A 10 µl aliquotfrom each reaction was run on 1.5% agarose gel to visualisethe PCR product.

Restriction digests were performed directly on the∼2.4 kb PCR product without precipitation of DNA after PCR.The following restriction enzymes were used: AluI, DraI,HhaI, HindIII, HinfI, EcoRV, MspI, PstI, TaqI (PROMEGA).

Digestion reactions were carried out separately for eachenzyme at 37 ◦C (65 ◦C for TaqI) for 1.5 h. The final volumeof the reaction mixture was 20 µl and contained: 10 µl PCRproduct, 5U of each restriction enzyme, 1 × reaction buffer,0.1 µg/µl acetylated BSA. Digested PCR products were runon 1.5% or 2% agarose gels for 1.5 h at 85 V.

Analysis of molecular dataThe Bio1D++ program (Vilbert Lourmat, France) was used tocalculate intra- and inter-species relationships on the basis ofthe similarity of DNA band patterns obtained by the RAPDmethod, according to the Nei and Li (1979) similarity coeffi-cient i.e. a = 2nxy/(nx + ny) where nx and ny are the number


of bands in lane ‘x’ and ‘y’, respectively, and nxy the numberof shared bands between the two lanes. Dendrograms wereproduced from the similarity values in the matrix using theUPGMA (unweighted pair group match average) algorithm.UPGMA is a phenetic distance method (Nei, 1987; Page &Holmes, 1998; Graur & Li, 2000) employing a sequential clus-tering algorithm. The results of electrophoresis of DNA frag-ments obtained by RFLP and ARDRA methods were enteredinto the database as 0 (absence of a band) and 1 (presence). Theprofiles were compared by means of a similarity index com-puted according to the formula of Nei and Li (1979). Next, thematrices of distances were subjected to cluster analysis. Thepatterns of clusters were found by means of the Ward method.The matrices were also illustrated with multidimensional scal-ing (Manly, 1986).

Results

CrossesGenerally, a high percentage of surviving clones was observedin F1 (obtained by conjugation) and F2 (obtained by autogamy)generations in the inter-strain crosses within the studied speciesof the P. aurelia complex (Table 2), i.e. Paramecium primaure-lia, P. biaurelia, P. tetraurelia, P. pentaurelia, P. septaurelia,P. octaurelia, P. decaurelia, P. dodecaurelia and P. quadecaure-lia The strains used in the crosses originated from geographic-ally distant collecting sites (Table 1) and were always crossedwith the standard strain of the particular species and in differ-ent combinations with each other. For comparison, survival inintra-strain crosses is presented. Some strains in P. tetraureliarepresented one mating type only, so it was impossible to ob-

tain F1 by conjugation in intra-strain crosses and inter-strainhybrids (Table 2) as both crossed strains were restricted to thesame mating type.

A low percentage of surviving hybrid clones was ob-served in F2 generation of P. tredecaurelia, i.e. 24% in thecross of standard strains 209 × 321 (strain from France, ge-netically restricted to odd mating type × strain from Mexico,genetically restricted to even mating type, they can react onlywith each other), and 26% in the cross of IKM (strain from Is-rael, restricted to even mating type) × 209 (strain from France).However, no cytological changes in the nuclear apparatuses inthe inter-strain hybrids in both generations were observed onslides (Giemsa stain), so we do not see what was the causeof such low percentage of surviving clones. Sonneborn (1974)also observed a low percentage of surviving hybrid clones inF2 generation in the inter-strain cross (strains 209 × 321) of P.tredecaurelia.

The fission rate in intra- and inter-strain crosses was sim-ilar among F1 lines leading to viable F2 generations. Autogamyin the studied hybrid lines appeared after a similar number offissions as in parental lines. No disorder was observed in thecourse of the life cycle of the hybrids.

RAPD fingerprint analysis [Figs 1–4]Paramecium primaureliaThe basic band pattern characteristic for the species is com-prised of bands at 350, 900 and 1500 bp appearing in thestudied strains originating from different collecting sites, evenfrom different continents. Comparison of all band patterns ofthe particular strains distinguished three different genotypeswithin this species (Figs 1A, 2A). The first genotype (PpI)appears in strains 90 (USA, Pennsylvania) and RM (Russia,

Fig. 1 RAPD fingerprints of species of the Paramecium aurelia complex. M – molecular pGEM marker, molecular weight of the marker DNAbands are given in bp. Agarose gel and schematic representation of band patterns. A. Strains of P. primaurelia : 1–90, 2-RM, 3-SA, 4-PB,5-GA, 6-IJ, 7-VH; B. Strains of P. biaurelia: 1- Rieff, 2-PSK, 3-PP, 4-SS, 5-IG, 6-RC, 7-RI; C. Strains of P. pentaurelia: 1–87, 2-RAZ andstrains of P. septaurelia: 3–38, 4-RA; D. Strain of P. undecaurelia: 1–219; strains of P. tredecaurelia: 2- 209, 3- IKM; strains of P.quadecaurelia : 4–328, 5- AN; strain of P. sonneborni : 6-Ps. E. Strains of P. tetraurelia: 1-S, 2-J, 3-PK, 4-SM, 5-ST, 6-IT; F. Strains of P.octaurelia: 1–138, 2-IEE and strains of P. decaurelia: 3–223, 4-JN; G. Strains of P. dodecaurelia: 1–246, 2-HHS, 3-JU, 4-IE, 5-G.


Species StrainF1

(by conjugation)F2

(by autogamy) Species StrainF1

(by conjugation)F2

(by autogamy)

P.prim 90 × 90 100 98 P.tetr PK × S 100 98P.prim SA × SA 100 100 P.tetr SM × ST One mating typeP.prim GA × GA 98 86 P.tetr SM × IT One mating typeP.prim RM × RM 97 98 P.tetr SM × J 98 94P.prim VH × VH 100 100 P.tetr SM × PK One mating typeP.prim IJ × IJ 98 98 P.tetr ST × IT One mating typeP.prim PB × PB 98 98 P.tert J × PK 100 96P.prim SA × 90 100 92 P.tetr ST × PK One mating typeP.prim GA × 90 100 98 P.tetr J × IT 100 100P.prim RM × 90 100 100 P.tetr PK × IT One mating typeP.prim VH × 90 98 94 P.tetr ST × J One mating typeP.prim IJ × 90 100 98 P. pent 87 × 87 100 100P.prim PB × 90 100 82 P. pent RAZ × RAZ 100 100P.prim SA × GA 96 92 P. pent RAZ × 87 100 100P.prim SA × RM 100 100 P.sept 38 × 38 One mating type 100P.prim SA × VH 100 98 P.sept RA × RA One mating type 100P.prim SA × IJ 98 98 P.sept RA × 38 100 94P.prim SA × PB 98 80 P.oct 138 × 138 100 100P.prim GA × RM 98 92 P.oct IEE × IEE 100 100P.prim RM × VH 100 96 P.oct IEE × 138 100 100P.prim VH × IJ 96 80 P. dec 223 × 223 100 100P.prim IJ × PB 100 98 P. dec JN × JN 100 100P.prim VH × GA 98 97 P. dec JN × 223 100 100P. bi 2 × 2 98 96 P. undec 219 × 219 100 100P. bi SS × SS 98 98 P. dodec 246 × 246 One mating type 100P. bi RC × RC 100 94 P. dodec HHS × HHS One mating type 100P. bi RI × RI 96 90 P. dodec JU × JU One mating type 100P. bi IG × IG 100 98 P. dodec G × G 100 96P. bi PSK × PSK 100 98 P. dodec IE × IE 100 100P. bi SS × 2 100 92 P. dodec HHS × 246 90 88P. bi RC × 2 100 98 P. dodec JU × 246 100 68P. bi RI × 2 100 96 P. dodec G × 246 100 80P. bi IG × 2 100 82 P. dodec IE × 246 98 96P. bi PSK × 2 100 90 P. dodec JU × HHS 95 93P. bi SS × RI 100 94 P. dodec IE × G 98 94P. bi PSK × IG 100 96 P. dodec JU × G 100 98P. bi RC × SS 100 78 P. dodec JU × IE 98 95P.tetr S × S 100 100 P. dodec HHS × G 100 96P.tetr SM × SM One mating type 100 P. dodec HHS × IE 100 100P.tetr ST × ST One mating type 100 P.tredec 209 × 321 100 24P.tetr IT × IT One mating type 100 P.tredec IKM × IKM One mating type 100P.tetr J × J One mating type 100 P.tredec IKM × 209 100 26P.tetr PK × PK One mating type 100 P.quadec 328 × 328 100 96P.tetr SM × S 100 88 P.quadec AN × AN 100 100P.tetr ST × S 100 100 P.quadec An × 328 100 96P.tetr IT × S 100 98 P.sonneb PS × PS 100 100P.tetr J × S 100 96

Table 2 Survival (percentage) in intra- and interstrain crosses of the Paramecium aurelia spp. complex

Moscow), their band patterns showing 82% similarity in thecluster analysis. The second genotype (PpII) represented bystrain SA (Spain, Andalusia) is characterised by a specificband pattern. The third genotype (PpIII) appears in strains PB(Poland, Bieszczady Mts), GA (Greece, Athens), IJ (Israel,

River Jordan), and VH (Vietnam, Hanoi). However, strains PBand GA seem more related to each other (96% similarity) thanto strains VH and IJ (approximately of 80% similarity). StrainsVH and IJ show 74% similarity in their band patterns. A strainfrom Spain (SA) shows the greatest difference in band pattern


Fig. 2 Intraspecies dendrograms of P. primaurelia (A), P. biaurelia (B), P. tetraurelia (E), P. octaurelia (F1), P. decaurelia (F2) and P.dodecaurelia (G) strains, based on RAPD fingerprinting.

in comparison with both groups of strains, with about 40%band pattern similarity to strains 90 and RM and only 30%similarity to strains from the third genotype group (PB, GA,IJ, VH).

Paramecium biaureliaWithin P. biaurelia large variation in band patterns character-istic for the particular strains was found and several genotypes

were detected: PbI characteristic for strain designated Rieff,Scotland; Pb II for strain PSK, Poland (southern part), SudetesMts; Pb III for strain PP, Poland (northern part), PomeranianLake District; PbIV for strain SS, Spain, Segovia; PbV forstrain IG, Italy, Island of Giglio; PbVI for two strains, onestrain RC, Romania, Cluj and the second strain RI, Russia,Irkutsk. The only band appearing in all strains is at about 300bp (Fig. 1B). A dendrogram (Fig. 2B) presents the relationships


Fig. 3 Dendrogram presenting the relationships of species of the P. aurelia complex constructed on the basis of RAPD fingerprints of thestandard strains representing the particular species.

Fig. 4 Dendrogram presenting the relationships of species of the P. aurelia complex constructed on the basis of RAPD fingerprints of thestrains representing all revealed genotypes within the particular species.

of strains within P. biaurelia, three main groups of strains canbe distinguished. Strains Rieff and PSK show 74% similarity(first group), strains RC and RI also show 75% similarity oftheir band patterns (second group), and strains SS and IG showonly 45% similarity (third group). The groups of strains showlow similarity to each other. It is also interesting to comparethe band patterns of strains from the same country e.g. twoPolish strains, PSK and PP (southern and northern Poland),show 50% similarity of band patterns.

Paramecium tetraureliaThe band patterns of the studied strains are polymorphic withinspecies (Fig. 1E). Some strains are characterised by similarbands, however, only two bands (e.g. about 550 and 600 bp)appear in all studied strains and can be recognised as com-posing the basic band pattern of the species. Parameciumtetraurelia strains cannot be precisely divided into separategenotype groups as their band patterns differ from each otherwithin the particular groups in one or more bands. However,


three genotypes can be distinguished, each composed of geo-graphically isolated strains. Strains S (Sydney, Australia) andPK (Poland) form one genotype group (PtI), strains J (Japan)and SM (Spain) form the second group(PtII), and the strainsST (Slovakia) and IT (Israel) compose the third group (PtIII).Group I and II demonstrate some similarity to each other. Thedifference within the first group appears in the band patternof the strain from Australia as two extra bands at about 2150and 2400 bp, the strains show 82% similarity. In the secondgroup, four extra bands at about 900, 1400, 2100, and 2400bp appear in the pattern of the strain from Spain, both strainsJ and SM show 75% similarity. In the third genotype group,in the pattern characteristic for the IT strain the extra bands at400 and 800 bp can be seen as well as a missing band at about1200 bp which is present in the ST strain, the strains exibit75% similarity. A tree diagram (Fig. 2E) constructed on thebasis of the cluster analysis of the fingerprint similarity patternpresents relationships of groups of strains. Strains S (Sydney)and SM from Spain show about 70% similarity, both strains tothe strain from Poland (PK) show about 65% similarity, andall three strains show 55% similarity to the strain from Japan.This group of strains shows only 45% similarity to the othergroup of strains ST (Slovakia) and IT (Israel), and both strains(ST and IT) show 55% similarity of band patterns.

Paramecium pentaureliaBoth P. pentaurelia strains used in the present work (strain 87from USA, Pennsylvania and strain RAZ from Russia, Astra-han Nature Reserve) revealed the same genotypes (Fig. 1C).The strains show 100% similarity of band patterns.

Paramecium septaureliaBoth strains of this species, one from the USA (strain 38,Florida) and second from Russia (RA, from Astrahan NatureReserve) are characterised by similar band patterns showing94% similarity and differ by only one extra band at about1300 bp in the pattern of the Russian strain (Fig. 1C).

Paramecium octaureliaParamecium octaurelia strains from the USA (138, Florida)and Israel (IEE, Ein Efek) showed different band patterns,only one similar band appeared in the patterns of both strainsat about 1100 bp and the similarity of their band patterns isonly 13% (Figs 1F, 2F1).

Paramecium decaureliaThe basic band pattern characteristic for the species comprisesseveral bands seen in both studied strains, in strain 223 (stand-ard strain of the species, from USA) and in JN strain (Japan)(Fig. 1F). The only difference between patterns is the presenceof extra bands (430, 470, and 1100 bp) in strain 223. Figure2F2 presents the close relationship of both strains, with 75%similarity of band patterns.

Paramecium undecaureliaThe band pattern characteristic for strain 219 from Texas, USAis presented in Fig. 1D.

Paramecium dodecaureliaConsiderable polymorphism was revealed in P. dodecaureliastrains originating from different collecting sites on different

continents (Fig. 1G). The basic band pattern characteristic forthe species and appearing in all strains comprises bands atabout 900 and 1200 bp. It is difficult to group the strains intoparticular groups of genotypes as band patterns are substan-tially differentiated. Each strain represents a different geno-type, the first (Pdd I) appears in strain 246 from USA, thesecond (PddII) in strain HHS from Hawaii, the third (PddIII)in strain JU from Japan, the forth (PddIV) in strain IE fromItaly, and the fifth (PddV) in strain G from Germany. Figure3G presents the relationships of strains. Strains 246 (USA) andG (Germany) show similarity of 35%, strains HHS (Hawaii),JU(Japan) and IE (Italy) show similarity of 45% of their bandpatterns, and both groups show low similarity of about 23% toeach other.

Paramecium tredecaureliaParamecium tredecaurelia strains 209 (France, Paris) and IKM(Israel, Kinet Motzkin) showed generally similar band pat-terns. They differ by the presence of only one band at about1000 bp in the strain from Israel and show 92% similarity ofband patterns (Fig. 1D).

Paramecium quadecaureliaParamecium quadecaurelia strains 328 (Australia, Emily Gap)and AN (Africa, Namibia) showed generally similar band pat-terns, they differ only in two bands (diagram) and show simil-arity of 86 % (Fig. 1D).

Paramecium sonneborniOnly one known strain from Texas was used. The characteristicband pattern is presented in Fig. 1D.

A dendrogram (with homology coefficient 1%[UPGMA]) presenting the relationships of the studied spe-cies of the P. aurelia complex (Fig. 3) was constructed on thebasis of RAPD fingerprints of the standard strains represent-ing the particular species. Band patterns of P. primaurelia andP. pentaurelia show 35 % similarity, and are about 33% similarto the P. septaurelia band pattern. The P. tredecaurelia bandpattern shows 25% similarity to the previous ones. These spe-cies compose one species group. The second cluster comprisesseveral species, among them P. biaurelia and P. tetraureliashowing 50% similarity of band patterns, both species ex-hibit about 37% similarity to the P. undecaurelia band pattern.P. quadecaurelia and P. sonneborni show similarity of 60% ofband patterns, and both species appear 32% similar to theP. dodecaurelia band pattern. The next group within thiscluster comprises P. octaurelia and P. decaurelia showingabout 45% similarity of band patterns. Both groups of spe-cies (clusters) show low (about 20%) similarity of their bandpatterns.

Another dendrogram (with homology coefficient 1%[UPGMA]) presenting the relationships of the studied spe-cies of the P. aurelia complex (Fig. 4) was constructed onthe basis of RAPD fingerprints of the strains representing allrevealed genotypes in the species of the P. aurelia complex.Strains of some species cluster together on the dendrogram,like those of P. biaurelia (strains Rieff, PSK, PP, SS, IG andRC), representing all genotypes in the species; their band pat-terns show 60–90% similarity. Strains 246, JU, HHS and IE


Fig. 5 RFLP analysis (fragment of about 480 bp of the gene coding for the Hsp 70 protein) of species of the Paramecium aurelia complex. M –molecular marker, Marker 501 (Polgen, Poland), molecular weight of the marker DNA bands in bp. Band patterns on agarose gel afterdigestion with restriction enzymes: TruII, AluI, Eco RI. Strains of P. primaurelia: 1–90, 2-SA, 3-GA, 4-RM, 5-VH, 6-IJ, 7-PB; Strains of P.biaurelia: 1-Rieff, Scotland, 2-SS, 3-RC, 4-RI, 5-IG, 6-PP, 7-PSK; Strains of P. tetraurelia: 1-SM, 2-ST, 3-IT, 4-J, 5-PK, 6-S; Strains of P.pentaurelia: 1–87, 2-RAZ; Strains of P. septaurelia: 1–38, 2-RA; Strains of P. octaurelia: 1–138, 2-IEE; Strains of P. decaurelia: 1–223,2-JN: Strain of P. undecaurelia 219; Strains of P. dodecaurelia: 1–246; 2-HHS, 3-JU, 4-G, 5-IE: Strains of P. tredecaurelia: 1–209, 2-IKM;Strains of P. quadecaurelia:1–328, 2-AN.

of P. dodecaurelia group together showing similarity of 40–60%, only strain G of P. dodecaurelia appears separately onthe dendrogram. Strains of P. tetraurelia comprise one group(S, PK, and ST) together with strain 138 of P. octaurelia. Sim-ilarity of their band patterns is about 50%. Strains 90 and VHrepresenting different genotypes of P. primaurelia appear in thedendrogram in one cluster with those of other species in thecomplex, namely 38 of P. septaurelia, 219 of P. undecaurelia,209 of P. tredecaurelia, and RAZ of P. pentaurelia. However,strain SA of P. primaurelia appears separately being closer tostrains of P. biaurelia. Strain 328 of P. quadecaurelia and theonly known strain of P. sonneborni show 60% similarity ofband patterns. Strain 223 of P. decaurelia groups together withthe previous species.

RFLP analysis (Figs 5–7)A fragment of the gene coding the Hsp 70 protein (about 480bp) isolated from all studied strains (Table 1) of the P. aureliacomplex was digested (methods 3b) by restriction enzymesAluI, EcoRI, TruII (Fermentas, Lithuania) (Fig. 5).

Patterns obtained by cleavage with enzyme TruII werecharacteristic and unique for the particular species; they didnot show intra-species differentiation with the exception ofParamecium dodecaurelia. Within that species only strainsfrom Europe, i.e. from Germany (G) and Italy (IE) showedsimilar band patterns, other strains 246 (USA), HHS (Hawaii),and JU (Japan) revealed different band patterns. Band patternsof the studied species obtained by cleavage with enzyme AluIwere not characteristic and unique for the particular species,


1.8Nei & Li distance, Ward clustering

1.6

1.4

1.2

1.0

Dis

tanc

e lin

kage

0.8

0.6

0.4

0.2

0.012(JU) 12(IEG)

12(HHS)12(246)

78

4 1413 11

2 510

1

Fig. 6 Dendrogram of band pattern similarity (Nei & Li distance, Ward clustering) of the studied species, based on RFLP analysis. Numbersdesignate particular species, i.e. 1-P. primaurelia, 2-P. biaurelia, 4-P. tetraurelia, 5-P. pentaurelia, 7-P. septaurelia, 8-P. octaurelia, 10-P.decaurelia, 11-P. undecaurelia, 12-P. dodecaurelia (JU strain, IE, G strains, HHS strain 246 strain), 13-P. tredecaurelia, 14-P.quadecaurelia.

1.2

1.0

0.8

0.6

0.4

0.2

0.0

-0.2

-0.4

-0.6

-0.8

-1.0

-1.2

-1.4-1.2 -1.0 -0.8 -0.6 -0.4 -0.2 0.0

Dimension 1

0.2 0.4 0.6 0.8 1.0 1.2

12(IEG)

14

12(HHS)

13

1110

5

1

2

12(248)

12(JU)

7

48

Dim

ensi

on 2

Fig. 7 Similarity matrix of the studied species demonstrated by means of multidimensional scaling. Clusters of species obtained by clusteranalysis are encircled. Results of RFLP analysis. Designations of species and strains as in Fig. 6.


but showed some differences distinguishing groups of species,although intraspecies differentiation was found only withinP. dodecaurelia. Similar band patterns appeared in the firstgroup of species, i.e. P. primaurelia, P. pentaurelia, P. de-caurelia, P. undecaurelia, P. tredecaurelia and P. quadecaure-lia, and in two strains of P. dodecaurelia (246-USA and HHS–Hawaii). Similar band patterns were found in P. tetraurelia,P. septaurelia and P. octaurelia, comprising the second group.Only one band appeared in P. biaurelia and European strainsof P. dodecaurelia (G from Germany and IE from Italy); thesewere placed in the third group of species. The strain of P. do-decaurelia from Japan (JU) is characterised by bands at 204,63 and 35 bp and is unique, forming a fourth group. OnlyP. dodecaurelia showed intra-species differentiation revealingthree types of band patterns. Band patterns of all studied spe-cies were similar after cleavage with enzyme EcoRI whichdoes not differentiate species.

A dendrogram based on band patterns from the RFLPanalysis with application of two restriction enzymes discernedthree clusters of species (Fig. 6), one composed of P. tet-raurelia, P. octaurelia with P. septaurelia and strain JU ofP. dodecaurelia. The second cluster includes P. undecaurelia,strain HHS of P. dodecaurelia, P. tredecaurelia, P. quadecaure-lia, and strains IE and G of P. dodecaurelia. The third cluster(connected with the second one) comprises P. primaurelia,P. decaurelia, P. pentaurelia, strain 246 of P. dodecaureliaand P. biaurelia. The same groups of species can be seen inFig. 7 presenting clusters of species obtained by cluster ana-lysis. Substantial intra-species polymorphism was revealed inP. dodecaurelia; strains of this species belong to three clusters.

ARDRA analysis (Figs 8–10)We amplified a fragment of about 2400 bp of SSU –LSUribosomal RNA gene, with the internal transcribed spacers(ITS). Some restriction enzymes (DraI, HindIII, and PstI) didnot cleave the DNA of the studied species of the P. aureliacomplex.

EcoRV did not produce different restriction patterns inthe studied species (Fig. 8) as well as MspI, with the exceptionof P. dodecaurelia. MspI revealed an extra band in patterns ofIE and G strains (Fig. 8G, band patterns numbers 4 and 5).AluI, HhaI, HinfI, and TaqI produced different band patternscharacteristic for groups of species (Fig. 8). AluI differentiatedfour groups, the first including P. primaurelia, P. biaurelia,P. tetraurelia, P. pentaurelia, P. septaurelia P. octaurelia,P. decaurelia, P. quadecaurelia and P. sonneborni; the secondgroup – P. undecaurelia, and the third group – P. tredecaurelia.The band pattern of P. dodecaurelia differs from those of otherspecies and is also differentiated intraspecifically. The latterconstitutes the fourth group. HhaI produced three groups, thefirst included P. primaurelia, P. pentaurelia, P. septaurelia,P. quadecaurelia and P. sonneborni; the second P. biaurelia,P. undecaurelia, P. tredecaurelia and strains HHS, JU, IE andG of P. dodecaurelia, the third P. tetraurelia, P. octaurelia andP. decaurelia, and strain 246 of P. dodecaurelia. HinfI dif-ferentiated three groups, the first comprised P. primaurelia,P. tetraurelia, P. octaurelia, P. decaurelia, P. undecaurelia,

P. dodecaurelia, P. tredecaurelia and P. quadecaurelia, thesecond included P. biaurelia, P. pentaurelia and P. septaurelia,and the third P. sonneborni. TaqI differentiated several groups,the first comprised P. primaurelia, P. pentaurelia and P. unde-caurelia, the second P. biaurelia, P. septaurelia, P. tredecaure-lia, P. quadecaurelia and P. sonneborni. It is interesting thatin the case of this enzyme, intra-species differentiation is seenwithin P. biaurelia, two strains; RC (Romania) and RI (Rus-sia) showed differed band patterns (one extra band) from thosecharacteristic for the other strains of the species. The thirdgroup of species is composed of P. tetraurelia (with a differentband pattern for strain ST lacking one band), P. octaurelia,P. decaurelia, and strains 246 and HHS of P. dodecaurelia.Band patterns of the other P. dodecaurelia strains differ frompatterns characteristic for other species of the complex andshow strong intra-species differentiation. Strains 246 and HHSshow similar patterns to the third group of species, and strainJU has a very divergent band pattern as well as strains IE andG (with identical band pattern).

A dendrogram of band patterns similarity based onADRRA analysis with the application of enzymes AluI, HhaI,HinfI, TaqI shows two clusters of species (Fig. 9). Onecluster is composed of strains JU, G, and HHS of P. do-decaurelia. The second cluster includes several species, someforming subclusters. One subcluster includes P. primaurelia,P. quadecaurelia and P. pentaurelia with the closely relatedP. septaurelia, P. sonneborni and P. tetraurelia. It is divided intotwo groups, one composed only of strain ST, and the secondgroup (designated J) includes five other strains of P. tetraurelia,P. octaurelia, and P. decaurelia all having identical band pat-terns. The second subcluster is composed of P. biaurelia di-vided into two groups, one group with two strains RC andRI sharing an identical band pattern differing from patterns ofother strains of the species, and the second group of five otherstrains of P. biaurelia with identical band patterns, P. trede-caurelia, P. undecaurelia. The third subcluster is composedof strains IE and 246 of P. dodecaurelia. Figure 10 presents asimilarity matrix of the studied species demonstrated by meansof multidimensional scaling. It clearly shows the existence oftwo clusters, one with strains G, HHS, and JU of P. dodecaure-lia, and the other with the remaining species, with an internalsubgroup of two strains (IE and 246) of P. dodecaurelia. Againsubstantial polymorphism was revealed within P. dodecaure-lia.

DiscussionRecently, DNA-based molecular marker techniques have beenwidely applied in studies revealing the genetic diversity of spe-cies. Among these is the RAPD technique, used on inverteb-rates (Vandewoestijne & Baguette, 2002; Van Doninck et al.,2004), vertebrates (Mamuris et al., 2002; Stepniak et al., 2002),plants (Huang et al., 2000; Ulloa et al., 2003; Su et al., 2003;Ma et al., 2004), and unicellular organisms (Sedinova et al.,2003), among these ciliates, e.g. Tetrahymena thermophila(Lynch et al., 1995; Brickner et al., 1996), Euplotes sp. (Kusch& Heckman, 1996; Chen et al., 2000), Uronychia sp. (Chen


Fig. 8 ARDRA riboprint patterns (SSU-LSU rDNA fragment of about 2400 bp) after digestion with restriction enzymes EcoRV, MspI, AluI, HhaI,HinfI, TaqI of species of the Paramecium aurelia complex, agarose gel. M - molecular pGEM marker, molecular weight of the marker DNAbands are given in bp. A. Strains of P. primaurelia : 1–90, 2-RM, 3-SA, 4-PB, 5-GA, 6-IJ, 7-VH; B. Strains of P. biaurelia: 1- Rieff, 2-PSK,3-PP, 4-SS, 5-IG, 6-RC, 7-RI; C. Strains of P. pentaurelia: 1–87, 2-RAZ and strains of P. septaurelia: 3–38, 4-RA; D. Strain of P.undecaurelia: 1–219; strains of P. tredecaurelia: 2–209, 3-IKM; strains of P. quadecaurelia 4–328, 5-AN; strain of P. sonneborni : 6-Ps; E.Strains of P. tetraurelia : 1-S, 2-J, 3-PK, 4-SM, 5-ST, 6-IT; F. Strains of P. octaurelia: 1–138, 2-IEE and strains of P. decaurelia: 3–223, 4-JN;G. Strains of P. dodecaurelia: 1–246, 2-HHS, 3-JU, 4-IE, 5-G.

et al., 2003), Diophrys sp. (Chen & Song, 2002), Stentor co-eruleus (Kusch, 1998) and Gonostomum affine (Foissner et al.2001). Several molecular studies concerning DNA fragmentanalyses (ARDRA, RAPD) as well as comparisons of genesequences (rRNA) in protozoa were summarised by Schlegeland Meisterfeld (2003).

RAPD analysis has been used in studies on intra-speciesdifferentiation in Paramecium, revealing different genotypeswithin the P. aurelia complex, i.e. P. triaurelia, P. pentaurelia,P. sexaurelia and P. novaurelia (Stoeck et al., 1998, 2000a).The method proved useful in identification of species in theP. aurelia complex (Stoeck & Schmidt, 1998) and was alsoapplied to other species of genus Paramecium, i.e. P. neph-ridiatum, P. calkinsi, P. dubosqui, P. woodruffi (Fokin et al.,1999a, b), and P. schewiakoffi (Fokin et al., 2004), and in recentresearch on the existence of sibling species as in the case of

P. jenningsi (Przybos et al., 1999, 2003; Skotarczak et al.,2004a, b) and P. caudatum (Stoeck et al., 2000b). This methodrevealing diversity within morphotypes is important as, ac-cording to Nanney et al. (1998) ‘the large molecular diversityis obscured by morphological conservatism associated withconstraints of ancient designs’.

Our results of the RAPD-PCR analysis showed that spe-cies of the Paramecium aurelia complex could be differen-tiated inter- and intraspecifically by their band patterns. Themajority of species revealed intraspecific polymorphism asthe presence of several genotypes with different band pat-terns (e.g. P. primaurelia, P. biaurelia, P. tetraurelia), whileother species showed a high similarity of genotypes (P. pen-taurelia, P. septaurelia, P. decaurelia, P. tredecaurelia andP. quadecaurelia). Substantial variation of band patternswas found within P. octaurelia and P. dodecaurelia. Such


Nei & Li distance, Ward clustering0.7

0.6

0.5

0.4

0.3

Dis

tanc

e lin

kage

0.2

0.1

0.012(JU)

12(G)12(HHS)

12(IE)12(246) 4(ST)

P.s7

514

11113

2*2**

J***

Fig. 9 Dendrogram of band pattern similarity (Nei & Li distance, Ward clustering) of the studied species, based on ARDRA riboprinting (AluI,HhaI, HinfI, TaqI enzymes). Designations: 1 – P. primaurelia, 2∗ – strains RC and RI of P. biaurelia with identical band patterns butdifferent from other strains by one extra band, 2∗∗ – the other strains of P. biaurelia; J∗∗∗ – strains of P. tetraurelia (excluding strainST), P. octaurelia, P. decaurelia, all with identical band patterns; 4(ST) – strain ST of P. tetraurelia, 5 – P. pentaurelia, 7 – P. septaurelia,11 – P. undecaurelia, 12 – P. dodecaurelia (JU strain, G strain, HHS strain, IE strain, 246 strain), 13 – P. tredecaurelia, 14 – P.quadecaurelia, P.s. – P. sonneborni.

Fig. 10 Similarity matrix of the studied species demonstrated by means of multidimensional scaling. Clusters of species obtained by clusteranalysis are encircled. Results of ARDRA riboprinting (AluI, HhaI, HinfI, TaqI enzymes). Designations as in Fig. 9.


polymorphism may be connected with the degree of inbreeding(extreme inbreeding) characteristic for the above-mentionedspecies; other species with low differentiation are characterisedby moderate levels of inbreeding. The dendrograms presentthe relationships of species within the P. aurelia complex(Figs 3, 4); both are constructed on the basis of RAPD fin-gerprints but differ by the number of strains taken into consid-eration. The first dendrogram (Fig. 3) constructed only on thebasis of RAPD fingerprints of the standard strains represent-ing the particular species revealed two groups of species; thefirst comprises P. primaurelia, P. pentaurelia, P. septaurelia,P. tredecaurelia, and the second the remaining species of thecomplex. Both groups show low similarity in their band pat-terns. The second dendrogram (Fig. 4) constructed on the basisof RAPD fingerprints of the strains representing all genotypeswithin the studied species provides a greater resolution of rela-tionships of both species and strains. Strains of P. dodecaureliabelong to separate clusters.

RFLP analysis (a fragment of about 480 bp of a gene cod-ing the Hsp 70 protein) with the application of the restrictionenzyme TruII also distinguished particular species of the com-plex and revealed intraspecific differentiation, although the lat-ter was limited to P. dodecaurelia. Application of restrictionenzyme AluI places species into several groups i.e. one groupcomposed of P. primaurelia, P. pentaurelia, P. decaurelia,P. undecaurelia, P. tredecaurelia, P. quadecaurelia, and strain246 of P. dodecaurelia, a second including P. tetraurelia,P. septaurelia, P. octaurelia, and a third with P. biaurelia andtwo strains (Germany, Italy) of P. dodecaurelia (Figs 6, 7).RFLP-PCR of a large segment of nuclear ribosomal DNA andinternal transcribed spacers analysis (with several restrictionenzymes) was also used for identifying and distinguishing sib-ling species in the Tetrahymena pyriformis complex; RFLP–PCR seems to be an alternative to traditional technique foridentifying species by mating with living reference specimensor isoenzyme analysis (Jerome & Lynn, 1996). RFLP–PCRhas been used on its own or in combinations with RAPD fin-gerprinting in investigations on the flagellate Euglena agilis(Zakrys, 1997) and on plants (Parani et al., 1997).

The method of ARDRA riboprinting (using a highly con-served rDNA fragment) with the application of restriction en-zymes HhaI, AluI, HinfI and TaqI distinguished several groupsof species (Figs 9, 10) within the P. aurelia complex withdifferent band patterns. AluI, HhaI, TaqI and MspI revealedintra-specific polymorphism within P. dodecaurelia, and TaqIalso differentiated within P. biaurelia and P. tetraurelia. Adendrogram of band patterns similarity of the studied speciesbased on ARDRA analysis produced two species clusters. Onecluster is composed of strains JU, G, and HHS of P. dodecaure-lia, the second cluster includes several species forming severalsubclusters with an internal subgroup with two strains IE and246 of P. dodecaurelia. Stoeck et al. (2000b) wrote in a pa-per concerning P. caudatum ‘unpublished results of differentP. aurelia sibling species investigated by ARDRA showed thatthese P. aurelia syngens are characterised by different riboprintpatterns’. We have tried to find differences between 15 speciesof the P. aurelia complex. Riboprinting of small subunit RNAgenes was also applied in Entamoeba spp. and intraspecific

variation was detected by Clark and Diamond (1997). Theysupposed ‘. . . riboprinting can be a useful tool for the rapididentification and assessment of relatedness among species in abroad range of organisms’ and ARDRA analysis was recentlyused for rapid identification of rumen ciliates (Regensbogen-ova et al., 2004).

The molecular methods (RAPD, RFLP and ARDRA) re-vealed the existence of groups of species within the P. aureliacomplex. Paramecium primaurelia, P. pentaurelia, P. septaure-lia in one group, P. undecaurelia and P. tredecaurelia as asecond group, P. tetraurelia, P. octaurelia and P. decaureliaas another, and P. dodecaurelia very polymorphic. The alloca-tion of species of the complex into different groups was alreadyproposed by Sonneborn (1957, 1966, 1975) according to typesof mating type inheritance. The groups also differ in antigensystems and the occurrence of endosymbionts. Our study withthe application of molecular methods placed P. primaureliaand P. pentaurelia together in one group. Similarly, accordingto Sonneborn (1975) both species show a caryonidal systemof mating type inheritance, and the odd mating type ofP. primaurelia reacts moderately with the even mating typeof P. pentaurelia (not yielding viable F2 generation).

The intraspecies differentiation within P. dodecaureliais remarkable and was revealed by all the applied molecu-lar methods. It may be connected with the characteristic de-gree of inbreeding in this species. Sonneborn had already in1957 associated several features of Paramecium aurelia spp.life history (type of mating type determination, occurrenceof autogamy, selfing, the length interval of sexual immaturityafter conjugation) with the degree of inbreeding. Nanney et al.(1998) studied the relative molecular distances separating spe-cies within genus Paramecium by comparing sequence (190bases) divergence in a variable D2 domain of 23S rRNA andalso investigated some species of the P. aurelia complex. Theyfound that ‘the aurelia complex constitutes a tight (dense) evol-utionary cluster’ in the tree constructed by the authors. Theyalso suggested that ‘Although intraspecific D2 polymorphismwas not observed, one would not be surprised . . . to find D2polymorphism within an aurelia species if studies were madeof large samples of strains from widely separated collectionsites’. In the present paper we used the strains from such re-mote sites. The molecular methods applied in the present workrevealed relationships of species and intraspecies polymorph-isms. Such polymorphism can be recognised as symptom ofthe process of speciation.

All the species of the P. aurelia complex studied showeda high percentage of surviving clones in F1 and F2 genera-tions in inter-strain crosses. A low percentage was observedonly in P. tredecaurelia in F2. No cytological changes inthe nuclear apparatuses in the inter-strain hybrids were ob-served. Sequencing of rDNA fragments of the studied strains ofP. tredecaurelia may perhaps shed light on this problem aswell as on the substantial polymorphism of strains observed inP. dodecaurelia (Tarcz et al. unpublished). Recently, the in-ternal transcribed spacer (ITS) region of nuclear ribosomal cis-tron for 13 species of the P. aurelia complex was sequenced,and the set of 111–116 ITS2 nucleotide positions relativelyconserved were derived for comparative analysis (Coleman,


2005). Intrasyngen homogeneity was revealed but the authorused only one strain, 246 of P. dodecaurelia and one or twostrains representing other species (syngens). We plan to invest-igate several strains of P. dodecaurelia originating from remotecollecting sites, which proved divergent in our molecular char-acterisation.

Future studies comprising sequencing of DNA fragmentsof strains from all species of the complex may reveal deeperrelationships among the species. These will be elaborated infuture work.

AcknowledgementsThis research was supported financially by the Grant No. 2P04C 01126 of the Ministry of Science and Information Society Technologies,Warsaw, Poland, acknowledged by the authors.

The authors also thank Ms Marta Surmacz for excellent tech-nical assistance.

ReferencesAUFDERHEIDE, K.J., DAGGETT, P.-M. & NERAD, T.A. 1983. Parame-

cium sonneborni n. sp., a new member of the Paramecium aureliaspecies-complex. Journal of Protozoology 30, 128–131.

BEALE, G. & SCHNELLER, M. 1954. A ninth variety of Parameciumaurelia. Journal of General Microbiology 11, 57–58.

BRICKNER, J.H., LYNCH, T.J., ZEILINGER, D. & ORIAS, E. 1996. Iden-tification, mapping and linkage analysis of randomly amplifiedDNA polymorphisms in Tetrahymena thermophila. Genetics 143,811–821.

CHEN, T.T. 1944. Staining nuclei and chromosomes in protozoa. StainTechnology 19, 83–90.

CHEN, T.T. 1956. Varieties and mating types in Paramecium bursaria.II. Variety and mating types found in China. Journal of Experi-mental Zoology 132, 255–268.

CHEN, Z. & SONG, W. 2002. Characterization and identification of theDiophrys species (Protozoa, Ciliophora, Hypotrichida) based onRAPD fingerprinting and ARDRA riboprinting. European Journalof Protistology 38, 383–391.

CHEN, Z., SONG, W. & WARREN, A. 2000. Studies on six Euplotes spp.(Ciliophora: Hypotrichida) using RAPD fingerprinting, includinga comparison with morphometric analyses. Acta Protozoologica39, 209–216.

CHEN, Z., SONG, W. & WARREN, A. 2003. Species separation andidentification of Uronychia spp. (Hypotrichia: Ciliophora) usingRAPD fingerprinting and ARDRA riboprinting. Acta Protozoolo-gica 42, 83–90.

CLARK, C.G. & DIAMOND, L.S. 1997. Intra-specific variation andphylogenetic relationships in the genus Entamoeba as revealed byriboprinting. Journal of Eukaryotic Microbiology 44, 142–154.

COLEMAN, A. 2005. Paramecium aurelia revisited. Journal of Euka-ryotic Microbiology 52, 68–77.

DESSEN, P., ZAGULSKI, M., GROMADKA, R., PLATTNER, H.,KISSMEHL, R., MEYER, E., BETERMIER, M., SCHULTZ, J.E.,LINDER, J.U., PEARLMAN, R.E., KUNG, C., FORNEY, J., SATIR,B.H., VAN HOUTEN, J.L., KELLER, A-M., FROISSARD, M., SPER-LING, L. & COHEN, J. 2001. Paramecium genome survey: a pilotproject. Trends in Genetics 17, 306–308.

DIPPELL, R.V. 1954. A preliminary report on the chromosomal consti-tution of certain variety 4 races of Paramecium aurelia. Caryologia260 (suppl.), 1109–1111.

DUBIS, K. & KOMALA, Z. 1963. Syngens of Paramecium aurelia in thewater reservoir of the Tatra Mountains. Folia biologica (Krakow)11, 309–313.

ELWOOD, H.J., OLSEN, G.J. & SOGIN, M.L. 1985. The small subunitrDNA gene sequences from the hypotrichous ciliates Oxytricha

nova and Stylonychia pustulata. Molecular Biology and Evolution2, 399–410.

FOISSNER, W., STOECK, T., SCHMIDT, H. & BERGER, H. 2001. Bio-geographical differences in a common soil ciliate, Gonostomumaffine (Stein), as revealed by morphological and RAPD-fingerprintanalysis. Acta Protozoologica 40, 83–97.

FOKIN, S.I., PRZYBOS, E., CHIVILEV, S.M., BEIER, C.L., MATTHIAS,H., SKOTARCZAK, B., WODECKA, B. & FUJISHIMA, M. 2004. Mor-phological and molecular investigations of Paramecium sche-wiakoffi sp. nov. (Ciliophora, Oligohymenophorea) and currentstatus of distribution and taxonomy of Paramecium spp. EuropeanJournal of Protistology 40, 225–243.

FOKIN, S.I. & SMUROV, A.O. 2001. Salinity tolerance of Paramecium(Ciliophora, Peniculia): phylogenetical aspect. Proceedings of Zo-ological Institute of Russian Academy of Sciences 289, 83–88.

FOKIN, S.I., STOECK, T. & SCHMIDT, H.J. 1999a. Rediscovery ofParamecium nephridiatum Gelei, 1925 and its characteristics.Journal of Eukaryotic Microbiology 46, 416–426.

FOKIN, S.I., STOECK, T. & SCHMIDT, H.J. 1999b. Paramecium dubo-scqui Chatton, Brachon, 1933. Distribution, ecology and tax-onomy. European Journal of Protistology 35, 161–167.

GRAUR, D. & LI, W-H. 2000. Fundamentals of Molecular Evolution.Sinauer Associates, Sunderland, MA.

HUANG, S.C., TSAI, C.C. & SHEU, C.S. 2000. Genetic analysis ofChrysanthemum hybrids based on RAPD molecular markers.Botanical Bulletin of Academia Sinica 41, 257–262.

JEROME, C.A. & LYNN, D.H. 1996. Identifying and distinguishingsibling species in the Tetrahymena pyriformis complex (Cilio-phora, Oligohymenophorea) using PCR/RFLP analysis of nuclearribosomal DNA. Journal of Eukaryotic Microbiology 43, 492–497.

JONES, K.W. 1956. Nuclear differentiation in Paramecium. Ph.D.Thesis, University of Wales, Aberystwyth, GB.

KOMALA, Z. & DUBIS, K. 1966. Syngens of Paramecium aurelia insome regions of Moscow and Leningrad. Folia biologica (Krakow)14, 227–228.

KOMALA, Z. & PRZYBOS, E. 1980. Investigations on the Parameciumaurelia species complex in the Duszatyn Lakes. Folia biologica(Krakow) 28, 195–200.

KOMALA, Z. & PRZYBOS, E. 2000. Further investigations on the zo-oplankton of water bodies in the Botanical Garden of the Jagiello-nian University in Krakow. Folia biologica (Krakow) 48, 49–51.

KOSCIUSZKO, H. 1965. Karyologic and genetic investigations of syn-gen 1 of Paramecium aurelia. Folia biologica (Krakow) 13, 339–368.

KUSCH, J. 1998. Local and temporal distribution of different genotypesof pond-dwelling Stentor coeruleus. Protist 149, 147–154.

KUSCH, J. & HECKMANN, K. 1996. Population structure of Euplotesciliates revealed by RAPD fingerprinting. Ecoscience 3, 378–384.

LANDIS, W.G. 1986. The interplay among ecology, breeding systems,and genetics in the Paramecium aurelia and Paramecium bursariacomplexes. In: CORLISS, J.P. & PATTERSON, D., Eds., Progress inProtistology 1. Biopress, Bristol, pp. 287–307.

LYNCH, T.J., BRICKNER, J., NAKANO, K.J. & ORIAS, E. 1995. Geneticmap of randomly amplified DNA polymorphisms closely linked tothe mating type locus of Tetrahymena thermophila. Genetics 141,1315–1325.

MA, R., YLI-MATTILA, T. & PULLI, S. 2004. Phylogenetic relation-ships among genotypes of world-wide collection of spring andwinter ryes (Secale cereale L.) determined by RAPD-PCR mark-ers. Hereditas 140, 210–221.

MAMURIS, Z., SFOUGARIAS, A.I., STAMATIS, C. & SUCHENTRUNK, F.2002. Assessment of genetic structure of greek brown hare (Lepuseuropeus) populations based on variation in random amplifiedpolymorphic DNA (RAPD). Biochemical Genetics 40, 323–338.

MANLY, B.F.J. 1986. Multivariate Statistical Methods. A Primer.Chapman and Hall, London, New York.

NANNEY, D.L., PARK, C., PREPARATA, R. & SIMON, E.M. 1998. Com-parison of sequence differences in a variable 23S rRNA domain


among sets of cryptic species of ciliated protozoa. Journal of Eu-karyotic Microbiology 45, 91–100.

NEI, M. 1987. Molecular evolutionary genetics. Columbia UniversityPress, New York.

NEI, M. & LI, W-H. 1979. Mathematical model for studying geneticvariation in terms of restriction endonucleases. Proceedings ofNational Academy Sciences 76, 5260–5273.

PAGE, R.D.M. & HOLMES, E.C. 1998. Molecular evolution. A phylo-genetic approach. Blackwell Science Ltd., Oxford.

PARANI, M., LAKSHMI, M., ELANGO, S., RAM, N. & ANURATHA,C.S. 1997. Molecular phylogeny of mangroves II. Intra- and inter-specific variation in Avicennia.

PRZYBOS, E. 1968. The occurrence of syngens of Paramecium aureliain Rumania. Folia biologica (Krakow) 16, 131–136.

PRZYBOS, E. 1975. Genetic studies of Paramecium jenningsi strains(Diller, Earl 1958). Folia biologica (Krakow) 23, 425–471.

PRZYBOS, E. 1978. Cytological and karyological studies of Parame-cium jenningsi. Folia biologica (Krakow) 26, 25–29.

PRZYBOS, E. 1980. Distribution of species of the Paramecium aureliacomplex in Spain. Folia biologica (Krakow) 28, 405–412.

PRZYBOS, E. 1995. Species of the Paramecium aurelia complex inIsrael (Ciliophora, Protista). Israel Journal of Zoology 41, 205–206.

PRZYBOS, E. 1998. New habitats of Paramecium biaurelia in Italy.Folia biologica (Krakow) 46, 87–89.

PRZYBOS, E. 2005. Recent data on the distribution of species of theParamecium aurelia complex in Europe. Folia biologica (Krakow)53, in press.

PRZYBOS, E., HORI, M. & FOKIN, S.I. 2003a. Strains of Parameciumquadecaurelia from Namibia, Africa. Genetic and molecular stud-ies. Acta Protozoologica 42, 357–360.

PRZYBOS, E. & FOKIN, S.I. 1996. New habitats of species of the Para-mecium aurelia complex in Russia and Vietnam. Folia biologica(Krakow) 44, 107–109.

PRZYBOS, E. & FOKIN, S.I. 2001. Species of the Paramecium aureliacomplex in Japan. Folia biologica (Krakow) 49, 105–106.

PRZYBOS, E. & FOKIN, S.I. 2002. Further studies on the Parameciumaurelia species complex in Greece. Folia biologica (Krakow) 50,179–180.

PRZYBOS, E. & FOKIN, S.I. 2003a Paramecium dodecaurelia strainsfrom Hawaii. Folia biologica (Krakow) 51, 225–226.

PRZYBOS, E. & FOKIN, S. 2003b. Habitats of Paramecium dodecaure-lia in Europe. Protistology 3, 136–137.

PRZYBOS, E., FOKIN, S., STOECK, T. & SCHMIDT, H.J. 1999. Occur-rence and ecology of Paramecium jenningsi strains. Folia biologica(Krakow) 47, 53–59.

PRZYBOS, E., FUJISHIMA, M. & NAKAOKA, Y. 2003b. Parameciumdecaurelia and Paramecium dodecaurelia from the P. aurelia spp.complex in Japan. Folia biologica (Krakow) 51, 223–224.

PRZYBOS, E. & KOMALA, Z. 1981. Species of the Paramecium aureliacomplex in Northern Poland. Folia biologica (Krakow) 29, 141–149.

PRZYBOS, E. & KOMALA, Z. 1988. Studies on the Paramecium aureliaspecies complex in the Middle Sudetes of Poland. Folia biologica(Krakow) 36, 183–194.

PRZYBOS, E., NEVO, E. & PAVLICEK, T. 2002a. Distribution of speciesof the Paramecium aurelia complex in Israel. Acta Protozoologica41, 293–295.

PRZYBOS, E., NEVO, E. & PAVLICEK, T. 2002b. Paramecium trede-caurelia of the Paramecium aurelia complex in Israel. Folia bio-logica (Krakow) 50, 221–222.

PRZYBOS, E., RAUTIAN, M. & POTEKHIN, A. 2004. First Europeanrecord of Paramecium septaurelia and the discovery of newEuropean habitats of P. pentaurelia and P. sexaurelia in Russia(Astrakhan and Volgograd regions). Folia biologica (Krakow) 52,87–90.

PRZYBOS, E., SKOTARCZAK, B. & WODECKA, B. 2003c. Phylogeneticrelationships of Paramecium jenningsi strains (classical analysisand RAPD studies). Folia biologica (Krakow) 51, 185–195.

RAFALKO, M. & SONNEBORN, T.M. 1959. A new syngen (13) ofParamecium aurelia consisting of stocks from Mexico, Franceand Madagascar. Journal of Protozoology 6 (Suppl.), 30.

REGENSBOGENOVA, M., KISIDAYOVA, S., MICHALOWSKI, T.,JAVORSKY, P., MOON-VAN DER STAAY, S.Y., MOON-VAN DER

STAAY, G.W.M., HACKSTEIN, J.H.P., MCEWAN, N.R., JOUANY, J-P.,NEWBOLD, J.C. & PRISTAS, P. 2004. Rapid identification of rumenProtozoa by restriction analysis of amplified 18 S rRNA gene. ActaProtozoologica 43, 219–224.

SCHLEGEL, M. & MEISTERFELD, R. 2003. The species problem inprotozoa revisited. European Journal of Protistology 39, 349–355.

SEDINOVA, J., FLEGER, J., EY, P. & KULDA, J. 2003. Use of ran-dom amplified polymorphic DNA (RAPD) analysis for the iden-tification of Giardia intestinalis subtypes and phylogenetic treeconstruction. Journal of Eukaryotic Microbiology 50, 198–203.

SKOTARCZAK, B., PRZYBOS, E., WODECKA, B. & MACIEJEWSKA, A.2004a. Sibling species within Paramecium jenningsi. Acta Proto-zoologica 43, 29–35.

SKOTARCZAK, B., PRZYBOS, E., WODECKA, B. & MACIEJEWSKA,A. 2004b. Random amplified polymorphic DNA fingerprintingas a marker for Paramecium jenningsi strains. Folia biologica(Krakow) 52, 117–124.

SONNEBORN, T.M. 1950. Methods in general biology and geneticsof Paramecium aurelia. Journal of Experimental Zoology 113,87–148.

SONNEBORN, T.M. 1957. Breeding systems, reproductive methodsand species problem in Protozoa. In: MAYR, E., Ed., The speciesproblem. AAAS, Washington, DC., pp. 155–324.

SONNEBORN, T.M. 1966. A non-conformist genetic system in Para-mecium Aurelia. American Zoology 6, 589.

SONNEBORN, T.M. 1970. Methods in Paramecium research. In:PRESCOTT, D.M., Ed., Methods in cell physiology 4. AcademicPress, New York, pp. 242–339.

SONNEBORN, T.M. 1974. Paramecium aurelia. In: KING, R.C., Ed.,Handbook of Genetics 2. Plenum Press, New York, pp. 469–594.

SONNEBORN, T.M. 1975. The Paramecium aurelia complex of four-teen sibling species. Transections of American Microscopical So-ciety 94, 155–178.

SPERLING, L., DESSEN, P., ZAGULSKI, M., PEARLMAN, R.E.,MIGDALSKI, A., GROMADKA, R., FROISSARD, M., KELLER, A-M.& COHEN, J. 2002. Random sequencing of Paramecium somaticDNA. Eukaryotic Cell 1, 341–352.

STEPNIAK, E., ZAGALSKA, M.M. & SWITONSKI, M. 2002. Use ofRAPD technique in evolution studies of four species in familyCanidae. Journal of Applied Genetics 43, 489–499.

STOECK, T., PRZYBOS, E., KUSCH, J. & SCHMIDT, H.J. 2000a. Intra-species differentiation and level of inbreeding of different siblingspecies of the Paramecium aurelia complex. Acta Protozoolgica39, 15–22.

STOECK, T., PRZYBOS, E. & SCHMIDT, H.J. 1998. A comparison of ge-netics with inter-strain crosses and RAPD-fingerprints reveals dif-ferent population structures within the Paramecium aurelia com-plex. European Journal of Protistology 43, 348–355.

STOECK, T. & SCHMIDT, H.J. 1998. Fast and accurate identification ofEuropean species of the Paramecium aurelia complex by RAPD-fingerprints. Microbial Ecology 35, 311–317.

STOECK, T., WELTER, H., SEITZ-BENDER, D., KUSCH, J. & SCHMIDT,H.J. 2000b. ARDRA and RAPD-fingerprinting reject the siblingspecies concept for the Phylogenetic relationships of the subclassPeniculia (Oligohymenophorea, Ciliophora) inferred from smallsubunit rRNA gene sequences. Journal of Eukaryotic Microbio-logy 47, 419–429.

STRUDER-KYPKE, M.C., WRIGHT, A.-D., FOKIN, S.I. & LYNN, D.H.2000a. Phylogenetic relationships of the genus Paramecium in-ferred from small subunit rRNA gene sequences. Molecular Phylo-genetics and Evolution 14, 122–130.

STRUDER-KYPKE, M.C., WRIGHT, A.-D., FOKIN, S.I. & LYNN,D.H. 2000b. Phylogenetic relationships of the subclass Peniculia


(Oligohymenophorea, Ciliophora) inferred from small subunitrRNA gene sequences. Journal of Eukaryotic Microbiology 47,419–429.

SU, H., QU, L-J., HE, K., ZHANG, Z., WANG, J., CHEN, Z. & GU, H.2003. The great wall of China: a physical barrier to gene flow?Heredity 90, 212–219.

ULLOA, O., ORTEGA, F. & CAMPOS, H. 2003. Analysis of geneticdiversity in red clover (Trifolium pratense L.) breeding populationsas revealed by RAPD genetic markers. Genome 46, 529–535.

VANDEWOESTIJNE, S. & BAGUETTE, M. 2002. The genetic structure ofendangered populations in the cranberry fritillary, Boloria aquilon-aris (Lepidoptera, Nymphalidae): RAPDs vs allozymes. Heredity89, 439–445.

VAN DONINCK, K., SCHON, I., MARTENS, K. & BACKELJAU, T. 2004.Clonal diversity in the ancient asexual ostracod Darwinula steven-soni assessed by RAPD-PCR. Heredity 93, 154–160.

ZAGULSKI, M., NOWAK, J.K., LE MOUEL, A., NOWACKI, A., MIG-DALSKI, A., GRAMADKA, M., NOEL, B., BLANC, I., DESSEN, P.,WINCKER, P., KELLER, A-M., COHEN, J., MEYER, E. & SPER-LING, L. 2004. High coding density on the largest Parame-cium tetraurelia somatic chromosome. Current Biology 14, 1397–1404.

ZAKRYS, B. 1997. The taxonomic consequences of morpholo-gical and genetic variability in Euglena agilis Carter (Eugleno-phyta): species or clones in Euglena? Acta Protozoologica 36,157–169.

Genetic analysis of the Paramecium aurelia species complex (Protozoa: Ciliophora) by classical and...

Documents

Transcript of Genetic analysis of the Paramecium aurelia species complex (Protozoa: Ciliophora) by classical and...