Expression of glutamate transporters in rat optic nerve oligodendrocytes

Expression of glutamate transporters in rat optic nerveoligodendrocytes

MarõÂa Domercq, MarõÂa Victoria SaÂnchez-GoÂmez, Pilar Areso and Carlos MatuteDepartamento de Neurociencias, Facultad de Medicina y OdontologõÂa, Universidad del PaõÂs Vasco, 48940 Leioa, Vizcaya,Spain

Keywords: axon±glia signalling, cell culture, glial transporters, glutamine synthetase

Abstract

To investigate the role of glutamate transport in non-synaptic glia, we characterized the expression of three major glutamatetransporters (EAAC1, GLAST and GLT-1) in rat optic nerve in situ using reverse transcription-polymerase chain reaction incombination with Western blot and immunochemistry with speci®c antibodies. GLAST was localized to interfascicularoligodendrocytes, whereas a subpopulation of cells, probably immature oligodendrocyte cells, expressed EAAC1. In contrast,astrocytes, expressed only GLT-1, consistent with the idea that this is the major glutamate transporter in this cell type. In addition, weobserved that glutamine synthetase, a key enzyme in glutamate metabolism, was localized in oligodendrocytes in situ. To examinethe properties of these glutamate transporters, we conducted uptake experiments in glial cultures. The kinetics of sodium-dependentglutamate uptake in cultured oligodendrocytes from the perinatal rat optic nerve were markedly different from those observed in type-1 astrocytes from the newborn rat cerebral cortex, with higher af®nity and lower Vmax. In both cell types, glutamate transport wasinhibited by L-trans-pyrrolidine-2,4-dicarboxylate (t-PDC). In contrast, dihydrokainate exhibited signi®cantly more uptake inhibition inoligodendrocytes than in type-1 astrocytes. These results provide evidence for the expression of functional sodium-dependentglutamate transporters in optic nerve oligodendrocytes, and suggest that this cell type may play a role in the glutamate±glutaminecycle.

Introduction

Glutamate is the major excitatory neurotransmitter in the mammalian

CNS, and its uptake is essential to maintain a low concentration of

extracellular glutamate and to prevent excitotoxicity (Choi, 1992;

Rothstein et al., 1996). Clearance of glutamate is carried out by high-

af®nity, sodium-dependent glutamate transporters localized in

neuronal and glial cell membranes. The molecular properties and

function of these transporters have recently been elucidated (for a

review see Kanai et al., 1997). At least ®ve glutamate transporters

have been cloned: GLAST (Storck et al., 1992), GLT-1 (Pines et al.,

1992), EAAC1 (Kanai & Hediger, 1992), EAAT4 (Fairman et al.,

1995) and EAAT5 (Arriza et al., 1997). Localization studies indicate

that EAAC1 is present in neurons throughout the brain (Kanai &

Hediger, 1992). GLAST was found to be abundantly expressed in

cerebellar Bergmann glia (Storck et al., 1992), while GLT-1 was

observed in astroglia throughout the brain (Danbolt et al., 1992).

Finally, EAAT4 is expressed in cerebellar Purkinje cells (Fairman

et al., 1995) and EAAT5 is located in cells of the retina (Arriza et al.,

1997). Based on these studies, EAAC1 is regarded as the major

neuronal glutamate transporter, while GLAST and GLT-1 are viewed

as the principal glial glutamate transporters (Rothstein et al., 1994).

Glutamate transporters are also located in non-synaptic regions

(Lehre et al., 1995; Choi & Chiu, 1997), but their properties as well as

the processes which they subserve are presently unclear. In the optic

nerve, it has been proposed that neurons may signal to glia along their

axons via a calcium-independent mechanism, due to reversal of

glutamate transporters present at nodes of Ranvier (Kriegler & Chiu,

1993). This feature, together with the fact that glutamate receptor

activation can lead to oligodendroglial excitotoxicity (Yoshioka et al.,

1996; Matute et al., 1997; Matute, 1998; McDonald et al., 1998),

strongly suggests that the extracellular glutamate concentration is

regulated by transporters in order to prevent oligodendrocyte cell

death and demyelination. There is little information, however, about

the type of transporters mediating glutamate uptake in axonal tracts of

the CNS.

In the present study, we analysed the expression of EAAC1,

GLAST and GLT-1, the most widely distributed glutamate

transporters, in the adult optic nerve using reverse transcription-

polymerase chain reaction (RT-PCR), Western blot analysis and

immunochemistry. The results of these experiments led us to analyse

glutamate uptake in cultured oligodendroglial cells and to compare it

with that in cultured astrocytes. Taken together, our results strongly

suggest that oligodendrocytes contribute to the maintenance of low

levels of extracellular glutamate. In addition, we found that glutamine

synthetase, a key enzyme in glutamate metabolism, was expressed in

oligodendrocytes from the optic nerve in situ.

Materials and methods

Materials

Culture reagents were purchased from Sigma (St. Louis, MO, USA)

unless otherwise stated. L-[3H]-Glutamate (speci®c activity 46 Ci/

mmol) was from Amersham Life Sciences (Buckinghamshire, UK)

and growth factors were from Alomone (Jerusalem, Israel). Drugs

L

Correspondence: C. Matute, as above. E-mail: [email protected]

Received 12 August 1998, revised 28 January 1999, accepted 11 February1999

European Journal of Neuroscience, Vol. 11, pp. 2226±2236, 1999 Ó European Neuroscience Association

acting on glutamate transporters were obtained from Tocris Cookson

(Bristol, UK) except for glutamate (Sigma).

Cerebral cortical cultures

Primary astrocyte cultures were established from the cerebral cortex

of newborn Sprague±Dawley rats and prepared according to the

procedure described by McCarthy & De Vellis (1980) with minor

modi®cations. Brie¯y, cerebral cortices were dissected from 1-day-

old rats, incubated at 37 °C for 15 min in calcium- and magnesium-

free Hank's balanced salt solution, and dissociated mechanically.

Cells were then seeded into a 75-cm2 tissue culture ¯ask precoated

with poly-D-lysine and grown in Iscove's modi®ed Dulbecco's

medium (Gibco BRL, Paisley, UK) supplemented with 10% foetal

bovine serum, 50 U/mL penicillin, 50 mg/mL streptomycin and

2.5 mg/mL amphotericin B. Cells were cultured at 37 °C in a

humidi®ed 95% air/5% CO2 incubator for 13±15 days. When cells

reached con¯uence (days 10±12), the ¯asks were shaken for 1 h

(37 °C, 200 r.p.m.) to detach microglial cells. The decanted medium

was poured into Petri dishes for bacterial cultures, to which microglia

selectively adhere. Microglia were subsequently cultured in the

astrocyte-cultured medium described above. Flasks were once again

shaken for an additional 14 h (37 °C, 200 r.p.m.) to remove O-2A

progenitor cells. The remaining cell layer, formed by type-1

astrocytes (typically > 95% of the cells), was trypsinized and the

dissociated cells were plated onto poly-D-lysine-precoated glass

coverslips (12 mm) at a density of 5 3 103 cells/well for immunocyto-

chemistry and 5 3 104 cells/well for L-[3H]-glutamate uptake experi-

ments, cultured as above, and used 3±5 days later.

Optic nerve cultures

Oligodendrocyte cultures were obtained from optic nerves of 12-day-

old Sprague±Dawley rats using the procedure described by Barres

et al. (1992). Nerves were dissected out, minced and incubated at

37 °C for 40 min with 1.25 mg/mL collagenase, 0.04 mg/mL DNase,

0.125% trypsin/0.02% EDTA in Ca2+- and Mg2+-free Hank's

balanced salt solution. The enzymatic reaction was then stopped

with 10% foetal bovine serum. The cells were centrifuged at 220 g,

and the pellet was mechanically dissociated in 10% foetal bovine

serum in Dulbecco's modi®ed Eagle's medium (Gibco BRL). The

cells were pelleted at 220 g for 10 min, resuspended in a chemically

de®ned medium (Barres et al., 1992), and seeded onto poly-D-lysine-

coated glass coverslips (12 mm diameter) at 5 3 103 and 25 3 103

cells/well for immunocytochemistry and L-[3H]-glutamate uptake

experiments, respectively. Cultures were maintained at 37 °C and 5%

CO2 for 3±7 days before use, and fresh medium was added every day.

RNA isolation and RT-PCR analysis

Total RNA was extracted from adult rat whole brain and optic nerve

samples, and from type-1 astrocyte cultures and oligodendrocyte

cultures using the guanidinium/phenol/chloroform method

(Chomczynski & Sacchi, 1987). Rat brain tissues were dissected

out from deeply anaesthetized animals and snap frozen in liquid

nitrogen. Reverse transcription into cDNA was carried out using

random hexamer primers and avian myeloblastosis virus-reverse

transcriptase as described by the supplier (USB, OH, USA).

Oligonucleotide primers used for PCR ampli®cation are described

in Table 1. Each pair of primers ef®ciently detected the corresponding

RNA transcript by RT-PCR in samples of rat brain. The reaction

mixture was heated to 95 °C for 2 min, cooled to 80 °C, and then

1.25 U Taq DNA polymerase (Dynazyme; Finnzymes, Espoo,

Finland) was added at this temperature. PCR ampli®cation was

carried out in thin-walled tubes for a total of 40 cycles as follows:

95 °C for 50 s, the average of the melting temperature of the

corresponding oligonucleotide pair + 5 °C for 50 s, 72 °C for 50 s, for

two cycles; subsequently the annealing temperature was lowered by

1 °C every second cycle until it was 9 °C lower than the starting

annealing temperature. Finally, 22 more cycles were run at the ®nal

annealing temperature. Ampli®ed products were analysed by

electrophoresis in 1.8% agarose gels and viewed with ethidium

bromide staining. A FX174 HaeIII digest was used as a size standard.

The speci®city of the ampli®ed PCR products was assessed by DNA

sequencing by using the dideoxy chain termination method (Sanger

et al., 1977). Standard protocols of the manufacturer for Taq DNA

polymerase-initiated cycle sequencing reactions with ¯uorescently

labelled dideoxynucleotide terminators (Applied Biosystems, Foster

City, CA, USA) were used. The sequencing reactions were analysed

using a 377 automated DNA sequencer (Applied Biosystems).

Western blot analysis

The speci®city of the antibodies and the expression of glutamate

transporters in rat optic nerve were assessed by immunoblotting using

adult rat hippocampus and cerebellum as controls. Af®nity-puri®ed

polyclonal antibodies to C-terminal EAAC1, N-terminal GLAST and

C-terminal GLT-1 epitopes were generously provided by Dr J.D.

Rothstein (Rothstein et al., 1994, 1996). Tissue was collected from

fresh rat brains, dissected and homogenized in 20 mM Tris±HCl

(pH 7.4), 10% sucrose, 1 mM EDTA, 5 mM EGTA, 1 mM phenyl-

methylsulphonic ¯uoride, 10 mM benzamidine, 20 mg/mL leupeptin,

and 0.1 mM pepstatin with a dounce homogenizer (Heidolph,

Germany). Following centrifugation of the homogenate (10 000 g

for 30 min), the supernatants were diluted 1 : 1 with an electrophoresis

sample buffer (Laemmli, 1970) and then boiled for 5 min. Proteins

were separated by sodium dodecyl sulphate±polyacrylamide gel

electrophoresis (SDS±PAGE, 7.5% polyacrylamide gels) and then

transferred to polyvinylidene ¯uoride membranes (Immobilon P,

Millipore) with 5% methanol in 10 mM 3-cyclohexylamino-1-

propanesulphonic acid (pH 10.5) by means of a semidry electroblotter

(Sartorius AG, Goettingen, Germany). Non-speci®c binding was

blocked for 1 h at room temperature with 10% non-fat milk and 2%

bovine serum albumin diluted in 50 mM Tris±HCl, 200 mM NaCl and

0.1% Tween-20 (pH 7.4). Blots were incubated for 48 h at 4 °C with

af®nity-puri®ed antibodies to EAAC1 (0.6 mg/mL), GLAST (0.2 mg/

mL) and GLT-1 (0.034 mg/mL) in the same buffer containing 1%

non-fat milk. After washing, blots were ®nally incubated with

horseradish peroxidase-conjugated antirabbit antibody (1 : 1000,

Sigma). Immunoreactive proteins were visualized with an enhanced

chemiluminescence substrate (Super Signal ULTRA; Pierce,

Rockford, IL, USA).

Immunochemistry

Expression of glutamate transporters was examined by immunohis-

tochemistry using the antibodies described above. All the results with

the antibody to N-GLAST were corroborated with antibodies A1 (to

amino acid residues 1±25) generously provided by Dr N.C. Danbolt

(Lehre et al., 1995). Rat optic nerve samples were dissected after

perfusing animals with 4% paraformaldehyde in 0.1 M phosphate

buffer (pH 7.4), post®xed for 2 h in the same solution, cryoprotected

in 30% sucrose and mounted with Tissue-Tek (Sakura Finetek USA,

Torrance, CA, USA). Cryostat sections (20 mm thick) were processed

for immunohistochemistry in free-¯oating sections as previously

described (Rothstein et al., 1994). Sections were preincubated (1 h)

with 4% normal goat serum diluted in 0.1% Triton X-100 and 0.02%

sodium azide in phosphate-buffered saline (PBS), and were then

incubated in the af®nity-puri®ed antitransporter protein antibody for

RGlutamate uptake in oligodendroglia 2227

Ó 1999 European Neuroscience Association, European Journal of Neuroscience, 11, 2226±2236

48 h at 4 °C at a concentration of 66 ng/mL for EAAC1, 16 ng/mL for

GLAST and 148 ng/mL for GLT-1 in PBS containing 2% normal goat

serum, 0.1% Triton X-100 and 0.02% sodium azide. Immuno-

detection was carried out using biotinylated secondary antibodies

(goat antirabbit IgG; Vector Laboratories, Burlingame, CA, USA)

followed by incubation with an avidin±biotin±peroxidase complex

(Vector Laboratories) as indicated by the supplier, and developed

using a standard diaminobenzidine reaction. Antibodies to glutamine

synthetase (Transduction Laboratories, Lexington, KY, USA) and to

glutathione-S-transferase Yp subunit (GST-Yp; Biotrin Int., Dublin,

Ireland) were used at concentrations of 0.8 mg/mL and 1 : 5000,

respectively. Negative controls in all immunostaining experiments

included the omission of the primary antibody, incubation with

control, non-immune IgGs, and overnight antibody preabsorption

with a 10- and 100-fold excess of the corresponding synthetic

EAAC1, GLAST and GLT-1 peptides, and yielded no labelling.

Double immuno¯uorescent labelling experiments were carried out

at 4 °C. Sections were incubated with antibodies to glutamate

transporters GLAST or GLT-1, and with mouse monoclonal

antibodies to the following glial markers, glial ®brillary acidic

protein (anti-GFAP; 0.2 mg/mL; Boehringer Mannheim, Mannheim,

Germany) and 2¢,3¢-cyclic nucleotide 3¢-phosphodiesterase (anti-

CNPase; 1 : 100; Sigma). Primary antibody binding was viewed with

a ¯uorescein isothiocyanate (FITC)-conjugated goat antirabbit IgG

(AlexaTM 488; 1 : 200; Molecular Probes, Eugene, OR, USA) and

with biotinylated antibodies to mouse IgGs (1 : 200; Vector

Laboratories) followed by a streptavidin±tetramethyl rhodamine

isothiocyanate-conjugate (1 : 100; Chemicon, Temecula, CA, USA).

To characterize the glial cell types present in our cultures,

immuno¯uorescent labelling experiments were performed with

antibodies to GFAP (20 mg/mL; Dako DiagnoÂsticos S.A., Barcelona,

Spain) and galactocerebroside C (anti-Gal C, 5 mg/mL; Boehringer

Mannheim). Microglia were labelled with FITC-conjugated Griffonia

simplicifolia B4-isolectin (20 mg/mL, Vector Laboratories), as

previously described (Gottlieb & Matute, 1997). Cells were washed

with PBS, ®xed in 4% paraformaldehyde in PBS for 20 min, and then

processed for immunocytochemistry as described above.

L-[3H]-Glutamate uptake experiments

Sister cultures of those used for immunocytochemistry were assayed

for L-[3H]-glutamate transport. Uptake was assessed at 37 °C in

300 mL saline solution containing (in mM): NaCl, 140; KCl, 5; MgCl2,

2; CaCl2, 2; HEPES, 10; glucose, 4.5 g/L (pH 7.4). Cells were

equilibrated for 5 min in the absence or presence of uptake inhibitors,

and then incubated for 10 min with 100 nM L-[3H]-glutamate and

unlabelled glutamate (0±1000 mM). Experiments using uptake in-

hibitors were performed with 100 nM L-[3H]-glutamate. In all studies,

uptake was stopped with two washes in ice-cold PBS, followed

immediately by cell lysis in 0.1 N NaOH/0.1% Triton X-100. Aliquots

were taken for scintillation counting and for protein assays (Lowry

et al., 1951) using bovine serum albumin standards. Sodium-

dependent uptake was calculated to be the difference between the

amount of radioactivity in the presence of sodium and the amount

observed in the choline-containing buffer (sodium chloride was

substituted for equimolar concentration of choline chloride).

Preliminary studies showed that uptake was linear over at least

30 min (data not shown).

Data analysis

Eadie±Hofstee transformations of the concentration-dependence of

uptake were ®t by linear regression analysis. Statistical comparisons

were performed by repeated-measures analysis of variance (ANOVA)

with a Fisher's protected least signi®cant difference (PLSD) post hoc

analysis or by a Student's two-tailed t-test. Data are represented as the

mean 6 SEM of at least three independent experiments performed in

triplicate.

L

TABLE 1. Oligonucleotide primers and PCR conditions

Annealing MgCl2 ProductSubtype Upstream primer (5¢±3¢) Downstream primer (5¢±3¢) temperature (°C) (mM) size (bp)

EAAC1 TGGCCACTGTCCTGAGTGGG CTAGAACTGCGAGGTCTGAG 68 2.5 719GLAST CCTCTCCTCTACTTCCTGGTA CTACATCTTGGTTTCGCTGT 55 1 633GLT-1 CTTGATTTACTTTGTAGTGA AAAGGAAGCCTGTTTAGAGC 59 3.5 805

Oligonucleotide sequences were used as primers in PCR experiments. Reaction parameters were empirically determined.

FIG. 1. RT-PCR with speci®c primers for the glutamate transporters EAAC1, GLAST and GLT-1 in rat brain, optic nerve, and astrocyte and oligodendrocytecultures derived from cerebral cortex and optic nerve, respectively. RT-PCR conditions were suitable to ef®ciently amplify the corresponding transcripts in wholerat brain samples used as a positive control (rwb). The three genes are expressed in the rat optic nerve (ron), and in astrocyte (ast) and oligodendrocyte cultures(olig). Molecular standards in base pairs correspond to the FX174 HaeIII digest. The numbers on the left indicate size in base pairs.

2228 M. Domercq et al.


Results

Expression of glutamate transporters in situ

We ®rst examined the expression of RNAs encoding the glutamate

transporters EAAC1, GLAST and GLT-1 in rat optic nerve. Primers

were designed to amplify fragments from a C-terminal region of each

transporter (Table 1). The speci®c primer pairs used in these

experiments ef®ciently ampli®ed the corresponding glutamate

transporter transcripts in rat whole brain samples (Fig. 1), as shown

by gel electrophoresis and subsequent sequencing analysis. In

contrast, negative controls in which the cDNA was substituted with

water yielded no amplicons (data not shown). Analysis using RT-

PCR of RNA extracted from the adult rat optic nerve resulted in

fragments of the expected size using the primers speci®c for the

transporters EAAC1, GLAST and GLT-1 (Fig. 1).

Because the optic nerve is devoid of neuronal cell bodies, and

axons are not known to contain RNA, it is most likely that the PCR

ampli®ed products arise from RNA present in glial cells. To con®rm

this idea and to determine the phenotype of the cells expressing the

three glutamate transporters examined, we carried out Western blot

analysis and immunohistochemical experiments in rat optic nerve

sections. The speci®city of the antibodies has been assessed

previously (Rothstein et al., 1994, 1996) and was corroborated by

Western blot analysis of control samples. Thus, antibodies to EAAC1

recognized a » 69-kDa protein in hippocampus homogenates, antisera

to GLAST recognized a » 65-kDa protein in cerebellum homo-

genates, and antisera to GLT-1 recognized a » 72-kDa protein in

hippocampus homogenates (Fig. 2). The larger molecular bands may

correspond to dimers and/or larger aggregates, as shown previously

(Haugeto et al., 1996). In rat optic nerve homogenates, a high level of

GLAST and GLT-1 expression was detected, whereas EAAC1 was

expressed at lower levels (Fig. 2). In all instances, the apparent size of

the transporters was similar in the optic nerve and the brain areas

examined. However, the levels of expression were higher in the latter.

Immunohistochemistry with antibodies to EAAC1, GLAST and

GLT-1 strongly stained morphologically different types of glial cells

in rat optic nerve (Fig. 3). EAAC1 was detected in relatively few cells

that had no particular orientation, with round or elongated shape, and

a variable number (between one and ®ve) of branches (Fig. 3A and

B). A representative sample of EAAC1+ cells was drawn using a

camera lucida (see Fig. 5 below). GLAST was expressed in small

rounded cells with no visible processes frequently grouped forming

short rows of cells orientated parallel to axonal ®bres (Fig. 3C), a

feature that corresponds to interfascicular oligodendrocytes (Peters

et al., 1991). Finally, the expression of GLT-1 was detected in cells

randomly distributed among neuronal ®bres. These cells exhibited

stellate morphology with small somata and a large number of radial

processes (Fig. 3D), typical features of the ®brous astrocytes reported

to be present in the white matter (Peters et al., 1991).

Double-labelling experiments con®rmed the expression of GLAST

in CNPase-stained oligodendrocytes and GLT-1 mainly in GFAP+

astrocytic processes (Fig. 4). The EAAC1+ cells were not labelled

with astroglial (GFAP), oligodendroglial (CNPase) or microglial

(Griffonia simplicifolia B4-isolectin) markers, and their morphology

was comparable to that of a representative sample of GST-Yp+ cells

(Fig. 5), a marker of immature oligodendrocytes (Gensert &

Goldman, 1996).

Glutamine synthetase in rat optic nerve

To test the possibility that glial cells in the optic nerve metabolize the

glutamate taken up into these cells, we analysed the expression of

glutamine synthetase in the optic nerve using immunohistochemistry.

Our results, in accordance with previous data (Tansey et al., 1991),

showed that optic nerve glutamine synthetase was expressed in

oligodendrocytes and ®brous astrocytes (Fig. 6). Glutamate synthe-

tase in the latter cell type was particularly abundant in the optic

chiasm (Fig. 6B).

Glutamate transport assays in cultured glial cells

We next investigated the kinetics of sodium-dependent glutamate

transport in oligodendrocyte cultures obtained from optic nerves of

12-day-old rats. After 3 days in vitro, cultures consisted almost

exclusively of Gal C+ oligodendrocytes, as previously described

(Matute et al., 1997). In addition, we used astrocyte cultures from

newborn rat cerebral cortex as a positive control and to compare the

kinetics of glutamate transporters in both cell types.

Kinetic analysis showed signi®cant differences in sodium-

dependent glutamate uptake by oligodendrocytes versus type-1

R

FIG. 2. Western blot analysis of the glutamate transporter subtypes expressed in the rat optic nerve. Samples (25 mg of protein per lane) were subjected to SDS±PAGE, and immunoblotted with antibodies raised against synthetic peptides corresponding to EAAC1, GLAST and GLT-1 (Rothstein et al., 1994, 1996). Thelevels of EAAC1, GLAST and GLT-1 were lower in the rat optic nerve than in the hippocampus (EAAC1 and GLT-1) and cerebellum (GLAST), the regions usedas positive controls. hpc, hippocampus; cb, cerebellum; on, optic nerve from rat brain.

Glutamate uptake in oligodendroglia 2229


astrocytes. The apparent glutamate Km and the maximal velocity

(Vmax) values in oligodendrocytes were 5.2 6 0.8 mM and

1.28 6 0.14 nmol/min/mg protein, much lower than those in type-1

astrocytes, 91 6 4.5 mM and 25.6 6 1.04 nmol/min/mg protein, re-

spectively (Fig. 7A and B). In contrast, total glutamate uptake by

microglial cultures (95% pure or greater) derived from mixed glial

cultures from newborn rat cerebral cortex was lower than 0.05% of

that measured in type-1 astrocyte and oligodendrocyte cultures.

The relative ef®cacy of glutamate transporter inhibitors and the

ionic dependence of glutamate transport in the two types of glial

cultures are shown in Fig. 7C. We observed that in both astrocyte and

oligodendrocyte cultures, L-[3H]-glutamate uptake was almost

completely abolished by preincubation with L-trans-pyrrolidine-2,4-

dicarboxylate (t-PDC, 500 mM), a transportable inhibitor of glutamate

uptake, indicating that the observed ef¯ux is mostly due to a

transporter-mediated mechanism. In contrast, dihydrokainate (DHK,

1 mM), a non-transportable inhibitor of the glutamate transporter

GLT-1, inhibited glutamate uptake to only a small degree in

astrocytes (23.5%; P < 0.05), while it almost completely blocked it

in oligodendrocytes (84.8%). Substitution of extracellular sodium

with choline inhibited the glutamate response by over 95% in both

astrocytes and oligodendrocytes. Taken together, these data indicate

that oligodendrocytes and type-1 astrocytes exhibit high-af®nity

sodium-dependent glutamate transport, although its ef®ciency

appears to be different in the two cell types.

Expression of glutamate transporter subtypes in vitro

RT-PCR of RNA extracted from cultured astrocytes and oligo-

dendrocytes resulted in the ampli®cation of EAAC1, GLAST and

GLT-1 (Fig. 1). Although the cultures used in these experiments were

highly enriched in either type-1 astrocytes or oligodendrocytes, the

high sensitivity of the PCR technique does not provide information as

to whether the ampli®ed transcripts are expressed by the main cell

types present in those cultures or by contaminant cells. To address

this problem, we analysed these cultures using immunochemistry

with speci®c antibodies to each of the three glutamate transporters

(Rothstein et al., 1994, 1996). Type-1 astrocytes were immuno-

labelled with antibodies to GLAST and GLT-1, but not EAAC1

(Fig. 8). In contrast, the three transporters were expressed in a very

small subpopulation of cells present in the astrocyte cultures, which

were GFAP+, phase-dark and stellate in morphology, and therefore

identi®ed as type-2 astrocytes (Fig. 8).

L

FIG. 3. Immunohistochemical staining in the rat optic nerve with antibodies to EAAC1 (A and B), GLAST (C) and GLT-1 (D). EAAC1 was expressed in a smallsubpopulation of cells. GLAST was present in interfascicular oligodendrocytes, whereas GLT-1 was restricted to ®brous astrocytes. Scale bar, 50 mm (A,C and D),10 mm (B).



In optic nerve oligodendrocyte cultures, the three transporters

analysed were present at all the stages examined (3 h to 3

days after seeding), as shown in Fig. 9. The subcellular

distribution of each glutamate transporter was different. EAAC1

was located in the soma and proximal and distal processes,

while GLAST was present in the soma and proximal parts of the

oligodendroglial branches, and GLT-1 was restricted to the

soma.

R

FIG. 4. Immuno¯uorescent double-labelling of CNPase and GLAST (A and A¢, and B and B¢, respectively), and GFAP and GLT-1 (C and D, respectively) inlongitudinal sections of the adult rat optic nerve. Each pair of photographs was taken from the same ®eld. The GLAST transporter was present in CNPase+

oligodendrocytes (small arrows) and GLT-1 was mainly located in GFAP+ astrocytic processes (large arrows). Scale bar, 50 mm.

FIG. 5. Camera lucida drawings of a representative group of EAAC1+ and GST-Yp+ cells. Notice the morphological similarity between both groups of cells.Although some of the cells appear quite complex in morphology, they are still much simpler than multibranched astrocytes or microglial cells, and can be clearlydistinguished from interfascicular oligodendrocytes. Scale bar, 50 mm.



No immunolabelling with antibodies to EAAC1, GLAST or GLT-1

was observed in any of the microglial cultures assayed (not shown), a

characteristic that correlates well with the lack of signi®cant

glutamate uptake observed in these cells.

Discussion

The main ®nding of this work is that oligodendroglia from rat optic

nerve express glutamate transporters both in situ and in vitro.

Cultured oligodendroglia in vitro exhibit sodium-dependent gluta-

mate transport with a higher af®nity and lower ef®ciency, compared

to type-1 astrocytes.

L

FIG. 6. Immunohistochemical staining in the rat optic nerve (A) and opticchiasm (B) with antibodies to glutamine synthetase. The enzyme was localizedmainly in interfascicular oligodendrocytes (arrowheads) and in a subpopula-tion of ®brous astrocytes (arrows). Scale bar, 50 mm.

FIG. 7. Properties of glutamate transport in cultured type-1 astrocytes andoligodendrocytes. (A and B) Eadie±Hofstee plots of concentration depen-dence of sodium-dependent L-[3H]-glutamate uptake in type-1 astrocytes (A)and oligodendrocytes (B). Uptake velocity (in nmol/min/mg protein) wasmeasured using 100 nM radiolabelled glutamate and increasing concentra-tions of unlabelled glutamate (0.1±1000 mM). For astrocytes: Vmax = 25.6 n-mol/min/mg protein; Km = 91 mM; r2 = 0.99. For oligodendrocytes:Vmax = 1.28 nmol/min/mg protein; Km = 5.8 mM; r2 = 0.94. Symbols representmeans 6 SEM of at least three independent experiments performed in tripli-cate. (C) The pharmacological pro®le and ionic dependence of L-[3H]-gluta-mate uptake. Uptake of 100 nM L-[3H]-glutamate was assessed in thepresence of the indicated amount of inhibitor and expressed as a percentageof the uptake rate in the corresponding control culture type. Transport inboth cell types was inhibited by t-PDC (500 mM) and when sodium was sub-stituted by choline. In contrast, DHK (1 mM) exhibited signi®cantly more in-hibition of transport in oligodendrocyte cultures than in type-1 astrocytecultures (84.8% versus 23.5%, respectively; P < 0.01 by two-tailed Student'st-test). Bars represent means 6 SEM (n = 3) of at least three independent ex-periments performed in triplicate. *P < 0.05 by ANOVA with Fisher's PLSDpost hoc analysis.



Glutamate transporters were differentially expressed inmacroglial cells in situ

Since the cloning of glutamate transporter cDNAs, several localiza-

tion studies in the CNS have been carried out (e.g. Rothstein et al.,

1994; Chaudhry et al., 1995; Lehre et al., 1995; Furuta et al., 1997).

However, characterization of the expression of glutamate transporters

in different types of glial cells is incomplete, and there is little

information regarding the expression of these transporters in

oligodendrocytes in particular.

We found that several types of glutamate transporters were

expressed by optic nerve macroglial cells in situ. Thus, RT-PCR

experiments indicated that RNAs encoding EAAC1, GLAST and

GLT-1 were present in the rat optic nerve. These results were

con®rmed by Western blot analysis showing the expression of

GLAST, GLT-1, and to a lesser degree, EAAC1 proteins in adult rat

optic nerve. Accordingly, immunohistochemistry revealed that a

small subpopulation of cells expressed EAAC1. Recently, Choi &

Chiu (1997) also reported the expression of EAAC1 in the rat optic

nerve by Western blot analysis and suggested that this transporter

might be located in axons. Our results con®rm that EAAC1 is

expressed in this region, and show that rather than in axons, EAAC1

was expressed by a population of immature cells. These cells were

similar in shape to cells labelled with an antibody to GST-Yp, a

marker of immature oligodendrocytes in adult rat subcortical white

matter (Gensert & Goldman, 1996). Furthermore, the appearance of

EAAC1+ cells was also comparable to that of the cells stained with

antibodies to NG-2 chondroitin sulphate proteoglycan (not shown), a

speci®c marker of oligodendrocyte progenitor cells (Levine & Card,

1987; Stallcup & Beasley, 1987). Together, these observations

suggest that EAAC1 is expressed in immature cells of the

oligodendroglial lineage.

In addition, we found that astrocytes in this region express only

GLT-1 and interfascicular oligodendrocytes expressed GLAST. To

our knowledge, the present report is the ®rst describing the expression

of glutamate transporters in cells of the oligodendroglial lineage in

situ. It is unlikely that the immunoreactivity observed with the

antibodies employed in the present study was due to cross-reactivity

with unrelated proteins, because they have been shown to be highly

speci®c for their corresponding antigens under the experimental

conditions used (Rothstein et al., 1994; Lehre et al., 1995; Rothstein

et al., 1996).

Differences in glutamate transport between oligodendrocytesand astrocytes

In the present study, we observed that cultured oligodendrocytes, like

astrocytes, exhibited sodium-dependent transport of glutamate. The

differences observed in the kinetics of glutamate uptake suggest that

the glutamate transporters involved may be different or, alternatively,

that they are differently regulated in each type of cell.

The kinetic pro®le of glutamate uptake in type-1 astrocytes was

similar to that previously described (see Schousboe & Westergaard,

1995), and suggests that glutamate transport was primarily mediated

R

FIG. 8. Immunocytochemical staining of the astroglial marker GFAP (A), and the glutamate transporters EAAC1 (B), GLAST (C) and GLT-1 (D) in a mixed glialculture containing type-1 and type-2 astrocytes. Type-1 astrocytes (arrowheads) expressed only GLAST and GLT-1. In contrast, type-2 astrocytes (arrows)expressed the three transporters analysed. Scale bar, 25 mm.



by GLAST in this cell type. This idea is supported by the fact that

glutamate transport had a Km of 91 6 4.5 mM, which is similar to that

observed in studies of GLAST expression in Xenopus oocytes (77 mM;

Storck et al., 1992), and that DHK (1 mM), a selective and potent

blocker of GLT-1-mediated transport (Arriza et al., 1994), only

induced a slight inhibition of L-glutamate uptake. Accordingly,

GLAST was found to be expressed in cultured astrocytes. It appears

then, that GLT-1, which we also observed in astrocytes, contributes to

glutamate transport to a minor degree in astrocytes in vitro.

Consistent with this idea, DHK had only negligible effects on

astrocyte cultures (Garlin et al., 1995; Swanson et al., 1997). Our

results correlate well with previous ®ndings demonstrating the

presence of GLAST mRNA and GLT-1 mRNA in cultured astrocytes

from different regions of rat brain including the cerebral cortex

(Kondo et al., 1995), and with data indicating that undifferentiated

astrocytes express GLAST and that under certain culture conditions

they may also express GLT-1 (Swanson et al., 1997).

In oligodendrocytes, the Km of glutamate uptake was 5.2 6 0.8 mM,

suggesting that a different type of glutamate transporter is involved.

Because expression studies in liposomes/HeLa cells have indicated

that the Km for L-glutamate uptake mediated by GLT-1 is 2 mM (Kanai

& Hediger, 1992), and DHK was an ef®cient and selective inhibitor

of this transporter subtype, it is likely that glutamate uptake in

oligodendrocytes in vitro is mediated primarily by this transporter.

However, DHK did not completely block glutamate uptake, not

excluding the minor participation of other glutamate transporter

subtypes. In addition to GLT-1, we also observed that EAAC1 and

GLAST were expressed in immature and mature oligodendroglial

cells, a ®nding that is consistent with a previous report (Kondo et al.,

1995) and recent preliminary evidence (Wang et al., 1997). There-

fore, it appears that these two transporters also participate in

glutamate clearance by oligodendrocytes, although our L-glutamate

uptake assays suggest that their overall contribution may be minor.

Overall, the kinetic characteristics of glutamate uptake in cultured

oligodendrocytes were more similar to those described in neurons

than in astrocytes. Whether these differences are related to the

glutamate transporters expressed or to the cell phenotypes remains

the subject of ongoing studies.

The expression of glutamate transporters in oligodendroglia from

adult optic nerve in situ was different than that in oligodendrocyte

cultures from the same area, where we observed expression of

EAAC1, GLAST and GLT-1 at all stages examined. Because

glutamate transporter expression is developmentally regulated

(Ullesvang et al., 1997), the differences could be due to the

differences between the age of the animals used (P12 rats for

oligodendrocytes cultures versus adult rats for immunohisto-

chemistry). It is also conceivable that the expression of GLT-1 is

regulated differently in vitro than in vivo, where oligodendrocytes

contact axons and astrocytes and have a different extracellular milieu.

The latter is critical regarding the glutamate concentration bathing the

oligodendrocytes, which in our cultures was » 10±15 mM (data not

shown), whereas in white matter tracts this concentration may be

signi®cantly lower (Miele et al., 1996). This higher concentration of

glutamate in vitro may account for the increased expression of

L

FIG. 9. Immunocytochemical staining of the oligodendroglial marker Gal C (A), and the glutamate transporters EAAC1 (B), GLAST (C) and GLT-1 (D) indifferentiated oligodendrocyte cultures at 3 days in vitro. The vast majority of the cells in these cultures expressed the oligodendrocyte marker Gal C and the threetransporters analysed. Scale bar, 25 mm.



glutamate transporter types in these cultured cells. Recently, the

expression of GLT-1 has been reported in neuronal hippocampal

microcultures (Mennerick et al., 1998), whereas neuronal labelling in

situ was not reported in earlier studies, suggesting that GLT-1

expression may be subject to regulation by culture environment.

Functional signi®cance of glutamate transporters in rat opticnerve

The current understanding of glutamate signalling in the CNS

indicates that the extracellular glutamate concentration must be

spatially and temporally regulated to terminate glutamate receptor

activation and to protect neurons from excitotoxicity, hence necessi-

tating the proper functioning of glutamate carriers at and around

synapses (Choi, 1992; Rothstein et al., 1996; Tanaka et al., 1997).

However, the role of glutamate transport in non-synaptic areas is not

presently understood.

Oligodendrocytes, like neurons, are also highly vulnerable to

glutamate, and the associated toxicity is caused by sustained activation

of AMPA and kainate receptors (Yoshioka et al., 1996; Matute et al.,

1997; Matute, 1998; McDonald et al., 1998). It is therefore

conceivable that the glutamate transporters expressed by astrocytes

and oligodendrocytes in the white matter maintain the extracellular

glutamate concentration below levels that are potentially toxic to

oligodendrocytes. In axonal tracts, glutamate can be released into the

extracellular space from astrocytes (Martin, 1992; Levi & Gallo,

1995), and from the axons after propagation of action potentials

(Weinreich & Hammerschlag, 1975) by reversal of glutamate

transporters at the nodes of Ranvier (Kriegler & Chiu, 1993). Thus,

impaired glutamate clearance in white matter may affect the viability

of oligodendrocytes. Because oligodendrocytes are the primary

damaged cell type in multiple sclerosis (Prineas & McDonald,

1997), it is possible that aberrant functioning of glutamate transporters

contributes to this leukoencephalopathy. Interestingly, a recently

mapped multiple sclerosis susceptibility locus involves the gene

encoding GLAST (Becker et al., 1997).

In the mammalian CNS, glutamate released from neurons is taken

up by astrocytes and rapidly converted to glutamine due to the

presence of glutamine synthetase in such cells. Glutamine is then

released and taken up into neurons where it undergoes amidation to

form glutamate and ammonia (Benjamin & Quastel, 1972, 1975).

Neuron terminals appear to be completely dependent on this cycle to

replenish the neurotransmitter pool of glutamate (Laake et al., 1995).

Recent studies have found that glutamine synthetase colocalizes with

GLAST transporter in MuÈller glial cell processes ensheathing

glutamatergic synapses (Derouiche & Rauen, 1995). The fact that

oligodendrocytes in the optic nerve express glutamine synthetase and

GLAST suggests that this cell type may participate in the glutamate±

glutamine cycle and provide axons with glutamine, as a source for

glutamate. Indeed, glutaminase immunoreactivity has been described

in axons and adaxonal glia in the cray®sh giant nerve ®bre (McKinnon

et al., 1995).

In summary, we have demonstrated that oligodendrocytes express

glutamate transporters in vitro and in situ. These results support the

idea that glutamate serves as an axon-to-glial signal and provide

evidence that the glutamate±glutamine cycle may modulate the

concentration of periaxonal glutamate in a manner similar to that

described for perisynaptic regions.

Acknowledgements

We are grateful to D.J. Fogarty for reviewing the manuscript, and to Dr J.D.Rothstein (Johns Hopkins University, Baltimore) and Dr N.C. Danbolt (Oslo

University, Norway) for the gift of polyclonal antibodies to the glutamatetransporters examined. This work was supported by grants from the GobiernoVasco (94/106, 96/17) and the Ministerio de EducacioÂn y Cultura (PB94-1377). M.D. held a fellowship from the Gobierno Vasco.

Abbreviations

CNPase, 2¢,3¢-cyclic nucleotide 3¢-phosphodiesterase; DHK, dihydrokainate;FITC, ¯uorescein isothiocyanate; Gal C, galactocerebroside C; GFAP, glial®brillary acidic protein; GST-Yp, glutathione-S-transferase Yp subunit;PBS, phosphate-buffered saline; RT-PCR, reverse transcription-polymerasechain reaction; SDS±PAGE, sodium dodecyl sulphate±polyacrylamide gelelectrophoresis; t-PDC, L-trans-pyrrolidine-2,4-dicarboxylate.

References

Arriza, J.L., Eliasof, S., Kavanaugh, M.P. & Amara, S.G. (1997) Excitatoryamino acid transporter 5, a retinal glutamate transporter coupled to achloride conductance. Proc. Natl Acad. Sci. USA, 94, 4155±4160.

Arriza, J.L., Fairman, W.A., Wadiche, J.I., Murdoch, G.H., Kavanaugh, M.P.& Amara, S.G. (1994) Functional comparisons of three glutamatetransporter subtypes cloned from human motor cortex. J. Neurosci., 14,5559±5569.

Barres, B.A., Hart, I.K., Coles, H.S.R., Burne, J.F., Voyvodic, J.T.,Richardson, W.D. & Raff, M.C. (1992) Cell death and control of cellsurvival in the oligodendrocyte lineage. Cell, 70, 31±46.

Becker, K.G., Mattson, D.H., Powers, J.M., Gado, A.M. & Biddison, W.E.(1997) Analysis of a sequenced cDNA library from multiple sclerosislesions. J. Neuroimmunol., 77, 27±38.

Benjamin, A.M. & Quastel, J.H. (1972) Localizations of amino acids in brainslices from the rat. Biochem. J., 128, 631±646.

Benjamin, A.M. & Quastel, J.H. (1975) Metabolism of amino acids andammonia in rat brain cortex slices in vitro: a possible role of ammonia inbrain function. J. Neurochem., 25, 197±206.

Chaudhry, F.A., Lehre, K.P., van Lookeren Campagne, M., Ottersen, O.P.,Danbolt, N.C. & Storm-Mathisen, J. (1995) Glutamate transporters in glialplasma membranes: highly differentiated localizations revealed byquantitative ultrastructural immunocytochemistry. Neuron, 15, 711±720.

Choi, D.W. (1992) Excitotoxic cell death. J. Neurobiol., 23, 1261±1276.Choi, I. & Chiu, Y. (1997) Expression of high-af®nity neuronal and glial

glutamate transporters in the rat optic nerve. Glia, 20, 184±192.Chomczynski, P. & Sacchi, N. (1987) Single-step method of RNA isolation by

acid guanidinium thiocyanate-phenol-chloroform extraction. Anal.

Biochem., 162, 156±159.Danbolt, N.C., Storm-Mathisen, J. & Kanner, B.I. (1992) A [Na+ + K+]

coupled L-glutamate transporter puri®ed from rat brain is located in glialcell processes. Neuroscience, 51, 295±310.

Derouiche, A. & Rauen, T. (1995) Coincidence of L-glutamate/L-aspartatetransporter (GLAST) and glutamine synthetase (GS) immunoreactions inretinal glia: evidence for coupling of GLAST and GS in transmitterclearance. J. Neurosci. Res., 42, 131±143.

Fairman, W.A., Vanderberg, R.J., Arriza, J.L., Kavanaugh, M.P. & Amara,S.G. (1995) An excitatory amino-acid transporter with properties of aligand-gated channel. Nature, 375, 599±603.

Furuta, A., Rothstein, J.D. & Martin, L.J. (1997) Glutamate transporter proteinsubtypes are expressed differentially during rat CNS development. J.

Neurosci., 17, 8363±8375.Garlin, A.B., Sinor, A.D., Sinor, J.D., Jee, S.H., Grinspan, J.B. & Robinson,

M.B. (1995) Pharmacology of sodium-dependent high-af®nity L-[3H]-glutamate transport in glial cultures. J. Neurochem., 64, 2572±2580.

Gensert, J.M. & Goldman, J.E. (1996) In vivo characterization of endogenousproliferating cells in adult rat subcortical white matter. Glia, 17, 39±51.

Gottlieb, M. & Matute, C. (1997) Expression of ionotropic glutamate receptorsubunits in glial cells of the hippocampal CA1 area following transientforebrain ischemia. J. Cereb. Blood Flow Metabol., 17, 290±300.

Haugeto, .O., Ullesvang, K., Levy, L.M., Chaudry, F.A., HonoreÂ, T., Nielsen,M., Lehre, K.P. & Danbolt, N.C. (1996) Brain glutamate transporterproteins form homomultimers. J. Biol. Chem., 271, 27 715±27 722.

Kanai, Y. & Hediger, M.A. (1992) Primary structure and functionalcharacterization of a high-af®nity glutamate transporter. Nature, 360,467±471.

Kanai, Y., Trotti, D., Nussberger, S. & Hediger, M.A. (1997) The high af®nityglutamate transporter family: structure, function, and physiological

RGlutamate uptake in oligodendroglia 2235


relevance. In Reith, M.E.A. (ed.), Neurotransmitter Transporters: Structure,Function, and Regulation. Humana, Totowa, pp. 171±213.

Kondo, K., Hashimoto, H., Kitanaka, J., Sawada, M., Suzumara, A.,Marunouchi, T. & Baba, A. (1995) Expression of glutamate transportersin cultured glial cells. Neurosci. Lett., 188, 140±142.

Kriegler, S. & Chiu, S.Y. (1993) Calcium signaling of glial cells alongmammalian axons. J. Neurosci., 13, 4229±4245.

Laake, J.H., Slyngstad, T.A., Haug, F.M.S. & Ottersen, O.P. (1995) Glutaminefrom glial cells is essential for the maintenance of the nerve terminal pool ofglutamate: immunogold evidence from hippocampal slice culture. J.Neurochem., 65, 871±881.

Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature, 227, 680±685.

Lehre, K.P., Levy, L.M., Ottersen, O.P., Storm-Mathisen, J. & Danbolt, N.C.(1995) Differential expression of two glial glutamate transporters in the ratbrain: quantitative and immunocytochemical observations. J. Neurosci., 15,1835±1853.

Levi, G. & Gallo, V. (1995) Release of neuroactive amino acids from glia. InKettenmann, H. & Ransom, B.R. (eds), Neuroglia. Oxford University Press,New York, pp. 815±826.

Levine, J.M. & Card, J.P. (1987) Light and EM localization of a cell surfaceantigen (NG-2) in the rat cerebellum. J. Neurosci., 7, 2711±2720.

Lowry, O.H., Rosebrough, N.H., Farr, A.L. & Randall, R.J. (1951) Proteinmeasurement with the Folin phenol reagent. J. Biol. Chem., 193, 265±275.

Martin, D.L. (1992) Synthesis and release of neuroactive substances by glialcells. Glia, 5, 81±94.

Matute, C. (1998) Characteristics of acute and chronic kainate excitotoxicdamage to the optic nerve. Proc. Natl Acad. Sci. USA, 95, 10 229±10 234.

Matute, C., SaÂnchez-GoÂmez, M.V., MartõÂnez-MillaÂn, L. & Miledi, R. (1997)Glutamate receptor-mediated toxicity in optic nerve oligodendrocytes. Proc.Natl Acad. Sci. USA, 94, 8830±8835.

McCarthy, K.D. & De Vellis, J. (1980) Preparation of separate astroglial andoligodendroglial cell cultures from rat cerebral tissue. J. Cell. Biol., 85,890±902.

McDonald, J.W., Althomsoms, S.P., Hyre, K.L., Choi, D.W. & Goldberg,M.P. (1998) Oligodendrocytes from forebrain are highly vulnerable toAMPA/kainate receptor-mediated excitotoxicity. Nature Med., 4, 291±297.

McKinnon, E., Hargittal, P., Grossfeld, R.M. & Lieberman, E.M. (1995)Glutamine cycle enzymes in the cray®sh giant nerve ®ber: implications foraxon-to-glia signaling. Glia, 14, 198±208.

Mennerick, S., Dhond, R.P., Benz, A., Xu, W., Rothstein, J.D., Danbolt, N.C.,Isenberg, K.E. & Zorumski, C.F. (1998) Neuronal expression of theglutamate transporter GLT-1 in hippocampal microcultures. J. Neurosci.,18, 4490±4499.

Miele, M., Berners, M., Boutelle, M.G., Kusakabe, H. & Fillenz, M. (1996)The determination of the extracellular concentration of brain glutamateusing quantitative microdialysis. Brain Res., 707, 131±133.

Peters, A., Palay, S.L. & Webster, H.D. (1991) The neuroglial cells. In Peters,

A., Palay, S.L. & Webster, H.D. (eds), The Fine Structure of the NervousSystem. Oxford University Press, New York, pp. 273±311.

Pines, G., Danbolt, N.C., Bjoras, M., Zhang, Y., Bendahan, A., Eide, L.,Koepsell, H., Storm-Mathisen, J., Seeberg, E. & Kanner, B.I. (1992)Cloning and expression of a rat brain L-glutamate transporter. Nature, 360,464±467.

Prineas, J.W. & McDonald, W.I. (1997) Demyelinating diseases. In Graham,D.I. & Lantos, P.L. (eds), Green®eld's Neuropathology. Oxford UniversityPress, New York, pp. 813±896.

Rothstein, J.D., Dykes-Hoberg, M., Pardo, C., Bristol, L.A., Jin, L., Kuncl,R.W., Kanai, Y., Hediger, M.A., Wang, Y., Schielke, J.P. & Welty, D.F.(1996) Knockout of glutamate transporters reveals a major role forastroglial transport in excitotoxicity and clearance of glutamate. Neuron,16, 675±686.

Rothstein, J.D., Martin, L., Levey, A.I., Dykes-Hoberg, M., Jin, L., Wu, D.,Nash, N. & Kuncl, R.W. (1994) Localization of neuronal and glialglutamate transporters. Neuron, 13, 713±725.

Sanger, F., Nicklen, S. & Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl Acad. Sci. USA, 74, 5463±5467.

Schousboe, A. & Westergaard, N. (1995) Transport of neuroactive aminoacids in astrocytes. In Kettenmann, H. & Ransom, B.R. (eds), Neuroglia.Oxford University Press, New York, pp. 246±258.

Stallcup, W.B. & Beasley, L. (1987) Bipotential glial precursor cells of theoptic nerve express the NG-2 proteoglycan. J. Neurosci., 7, 2737±2744.

Storck, T., Schulte, S., Hofmann, K. & Stoffel, W. (1992) Structure, expression,and functional analysis of a Na+-dependent glutamate/aspartate transporterfrom rat brain. Proc. Natl Acad. Sci. USA, 89, 10 955±10 959.

Swanson, R.A., Liu, J., Miller, J.W., Rothstein, J.D., Farell, K., Stein, B.A. &Longuemare, M.C. (1997) Neuronal regulation of glutamate transportersubtype expression in astrocytes. J. Neurosci., 1, 932±940.

Tanaka, K., Watase, K., Manabe, T., Yamada, K., Watanabe, M., Takahashi,K., Iwama, H., Nishikawa, T., Ichihara, N., Kikuchi, T., Okuyama, S.,Kawashima, N., Hori, S., Takimoto, M. & Wada, K. (1997) Epilepsy andexacerbation of brain injury in mice lacking the glutamate transporter GLT-1. Science, 276, 1699±1702.

Tansey, F.A., Farooq, M. & Cammer, W. (1991) Glutamine synthetase inoligodendrocytes and astrocytes: new biochemical andimmunocytochemical evidence. J. Neurochem., 56, 266±272.

Ullesvang, K., Lehre, K.P., Storm-Mathisen, J. & Danbolt, N.C. (1997)Differential developmental expression of the two rat brain glutamatetransporter proteins GLAST and GLT-1. Eur. J. Neurosci., 9, 1646±1655.

Wang, J., Gan, X.D., Chung, J.H., Volpe, J.J. & Rosenberg, P.A. (1997)Strong expression of the neuronal glutamate transporter EAAC1 in ratoligodendrocytes in culture. Soc. Neurosci. Abstr., 23, 1916.

Weinreich, D. & Hammerschlag, R. (1975) Nerve impulse-enhanced release ofamino acids from non-synaptic regions of peripheral and central nervetrunks of bullfrog. Brain Res., 84, 137±142.

Yoshioka, A., Bacskai, B. & Pleasure, D. (1996) Pathophysiology ofoligodendroglial excitotoxicity. J. Neurosci. Res., 46, 427±437.

L2236 M. Domercq et al.


Expression of glutamate transporters in rat optic nerve oligodendrocytes

Documents

Transcript of Expression of glutamate transporters in rat optic nerve oligodendrocytes