Evidence of Nestin-Positive Cells in the Human Cutaneus Meissner and Pacinian Corpuscles

Send Orders of Reprints at [email protected]

CNS & Neurological Disorders - Drug Targets, 2012, 11, 000-000 1

1871-5273/12 $58.00+.00 © 2012 Bentham Science Publishers

Evidence of Nestin-Positive Cells in the Human Cutaneus Meissner and Pacinian Corpuscles

Marta Calavia1, Eliso Viña

1,2, Manuel Menéndez-González

1,3, Alfonso López-Muñiz

1,

Marta Alonso-Guervós4, Juan Cobo

5,6, Jesús Otero

7, Oscar Arias-Carrión

8,

José Antonio Vega*,1,9

and Olivia García-Suárez1

1Departamento de Morfología y Biología Celular, Facultad de Medicina, Universidad de Oviedo, Spain

2UCI, Hospital de Cabueñes, Gijón, Spain

3Unidad de Neurología, Hospital “Alvarez-Buylla”, Mieres, Asturias, Spain

4Servicio de Análisis de Imágenes, Hospital de Cabueñes, Gijón, Spain; Servicios Comunes de Investigación, Hospital

de Cabueñes, Gijón, Spain

5Departamento de

Cirugía y Especialidades Médico-Quirúrgicas, Hospital de Cabueñes, Gijón, Spain

6Instituto Asturiano de Odontología, Oviedo, Spain

7Unidad de Coordinación de Trasplantes y Terapia Celular, Hospital Universitario Central de Asturias, Oviedo, Spain

8Movement Disorders and Transcraneal Magnetic Stimulation Unit, Hospital General Dr. Manuel Gea González,

Secretaría de Salud, México D.F., México.

9IUOPA, Universidad de Oviedo, Spain

Abstract: Nestin is an intermediate filament protein expressed in neuroepithelial stem cells during development and it is

later replaced by cell specific neuronal or glial filaments. Nevertheless, nestin+ cells remain within adult tissues and they

can be regarded as potential neural stem cell (NSC). Nestin+ cells have been detected in Schwann cells related with

sensory corpuscles of rodent and they have been demonstrated to be NSC. We have investigated the existence of nestin+ in

human cutaneous cells Meissner and Pacinian corpuscles through the use of immunohistochemistry techniques and in situ

hybridization. S100 protein (also regarded as a marker for NSC) and vimentin (the intermediate filament of mature

Schwann cells in sensory corpuscles) were also investigated. The results show that the adult human cutaneous sensory

Meissner and Pacinian corpuscles contains a small population of Schwann-related cells (vimentin+) which on the basis of

their basic immunohistochemical characteristics (S100 protein+, nestin

+) can be potential NSCs. Cells sharing identical

immunohistochemical profile were also found in the close vicinity of Meissner corpuscles. Because their localization they

are easily accessible and may represent a peripheral niche of NSC to be used for therapeutic goals.

Keywords: Nestin, Meissner corpuscles, Pacianian corpuscles, immunohistochemistry, human skin, neural stem cell.

INTRODUCTION

The migration and differentiation of neural crest cells (NCCs) implies a sequential expression of transcription factors as well as progressive changes in trophic factors dependence (see for a review [1]). In addition, the cellular differentiation is parallel to rearrangements in citoesquelet components, resulting morphological changes based in intermediate filaments (IFs) remodelling. Thus, the maturation of nerve cells is associated to a switch in the IF proteins that fill their cytoplasm.

Nestin is a type VI IF [2, 3] which is expressed in dividing neuroepithelial stem cells during the early stages of development in the central and peripheral nervous system

*Address correspondence to this author at the Departamento de Morfología y

Biología Celular, Facultad de Medicina, Universidad de Oviedo, C/ Julián

Clavería 6, Planta 9ª, 33006 OVIEDO, Spain; Tel/Fax: +34985104097/

+34985103618; E-mail: [email protected]

[2, 4]. Upon differentiation, nestin becomes down regulated andis replaced by tissue specific IFs, neurofilaments (NFs) and glial fibrillary acidic protein (GFAP) in neurons and glial cells, respectively [2, 5-8]. Nevertheless, nestin positive cells are also present in adult tissues [7, 9, 10]. Furthermore, it has been observed that some cells re-express or up regulate nestin after injury (e.g. [11, 12]). So, the nestin existence in a given cell within adult tissues may be regarded as an evidence that that cell is still undifferentiated and capable of proliferation, differentiation and migration after re-activation [7], and therefore they are potential neural stem cells (NSC).

Recently nestin+ cells have been detected in Meissner-

like corpuscles, and some closely related cells of the rat palatum [13, 14], as well as in the Schwann-related cells of the periodontal Ruffini´s endings [15]. Also, nestin

+ NSC are

present in the human inferior turbinate [16]. The Schwann-related cells in sensory corpuscles originate from neuroectodermic NCC ([17]. Therefore, we decide to investigate the occurrence of nestin-positive cells in

2 CNS & Neurological Disorders - Drug Targets, 2012, Vol. 11, No. 7 Calavia et al.

Meissner corpuscles and Pacinian corpuscles from human digital glabrous skin. The goal of this study was to analyze whether the Schwann-related cells, or other cells closely related, in cutaneous sensory corpuscles express nestin during adulthood. These studies can be interesting since if the expression of nestin is an evidence for undifferentiation of nerve cells, the nestin

+ cells from cutaneous sensory

corpuscles should be a promising source of NSC, easily accessible to be used for cellular therapy in neurological diseases.

MATERIAL AND METHODS

Material and treatment of the tissues. Skin samples were obtained from the palmar aspect of the distal phalanx of amputated hand fingers (n = 10) and during autopsy (n = 15), from subjects neurologic-disease free (age range 26 to 63 years; 8 females and 17 males). The material was collected within 3 h after amputation and within 12 h after brain death, and was obtained in the Departments of Plastic Surgery and of Pathology of the Hospital Universitario Central de Asturias (HUCA), Oviedo, Spain. The specimens were fixed in 4% formaldehyde in 0.1 M phosphate buffer saline (pH 7.4) for 24 h, dehydrated and routinely embedded in paraffin.

All material used in the present study was obtained in compliance with Spanish Law, and according to the guidelines of the Helsinki Declaration II.

Single immunohistochemistry. Deparaffinized and rehydrated sections were processed for nestin detection using the EnVision antibody kit (Dako, Copenhagen, Denmark), following supplier’s instructions. Briefly, deparaffinized and rehydrated sections were processed to avoid non-specific binding with 10% bovine serum albumin for 20 min. Sections were then incubated overnight at 4°C with a battery of monoclonal and polyclonal antibodies whose characteristics are indicated in Table 1. Thereafter, sections were incubated with an anti-rabbit or anti-mouse EnVisionsystem-labeled polymer (Dako-Cytomation) for 30 min, washed in buffer solution, and treated with peroxidase block buffer (Dako-Cytomation) for nonspecific binding. Finally, the slides were washed in buffer solution, and the immunoreaction visualized with diaminobenzidine as a chromogen. For control purposes, some sections were processed in the same way but omitting the primary antibody in the incubation and no positive immunoreactivity was observed in these conditions.

Double immunohistochemistry. Sections were processed for simultaneous detection of S100 protein-nestin, vimentin-nestin, or neuron specific enolase-nestin, Double immuno-staining was performed on 10 m thick deparaffinized and rehydrated sections. Non-specific binding was reduced by incubation for 30 minutes with a solution of 10% bovine serum albumin in TBS. The sections were then incubated overnight, at 4º C in a humid chamber with a 1:1 mixture of anti-S100 protein and anti-nestin (diluted 1:1000 and 1:100, respectively, in the blocking solution), anti-nestin and anti-vimentin antibodies (diluted 1:500 and 1:100, respectively, in the blocking solution), and anti-nestin and anti-neuron specific enolase (diluted 1:500 and 1:100, respectively, in the blocking solution). After rinsing with TBS, the sections were incubated for 1 hour with Alexa fluor 488-conjugated goat

anti-rabbit IgG (Serotec, Oxford, UK), diluted 1:1000 in TBS. Then the sections were rinsed again and incubated for another hour with Cy

TM3-conjugated donkey and mouse

antibody (Jackson-ImmunoResearch, Baltimore, MD, USA) diluted 1:50 in TBS. Both steps were performed at room temperature in a dark humid chamber. Finally, to ascertain structural details sections were counterstained with DAPI (10 ng/ml). Sections were then washed, dehydrated and mounted in Entellan. Triple immunofluorescence was detected using a Leica DMR-XA automatic fluorescence microscope coupled with a Leica Confocal Software, version 2.5 (Leica Microsystems, Heidelberg GmbH, Germany) and the captured images were processed using the software ImageJ for microscopy, version 1.41a Master Biophotonics Facility, Mac Master University Ontario (www.macbiophotonics.ca). A region of interest was drawn and we selected intensity value pairs in the cytofluorogram and we localized them in the original image applying them a mask.

Table 1. Primary Antibodies Used in the Study

Antigen Origin Dilution Supplier

GFAP Mouse 1 mg/ml Boehringer-Mannheima

Nestin1 Rabbit 1:500 Abcamb

Nestin2 Rabbit 1:200 Lifespan BioSciencesc

Nestin3 Mouse 1:100 Lifespan BioSciencesc

NFP Rabbit 1:1000 Biogenesisd

NSE Mouse 1:500 Dakoe

S1004 Mouse 1:1000 Thermo Scientificf

S100 Rabbit 1:1000 Dakoe

VIM Mouse 1 g/ml Boehringer-Mannheima

GFAP: Glial fibrillary acidic protein, clone G-A-5. 1Aminiacid sequence 1481-1497 of human nestin. 2LS-B656, aminoacid sequence 1484-1500 of human nestin. 3Clone 10C2, LS-C107085.

NFP: neurofilament. NSE: neurons specific enolase. Clone BBS/NC/VI-H14, against human .

NSE S100: S100 protein. 4Clone 4C4.9; VIM: vimentin; clone 3B4. aMannheim, Germany. bAbcam, Cambridge, UK. cSeattle, WA, USA. dPoole, England, UK. eGlostrup, Denmark. fThermo Scientific, Freemont, CA, USA.

In situ hybridization. The hybridization in situ reactions were carried out using the Dako in situ hybridization detection system for biotinylated probes (Code K0601, DAKO, Denmark). Deparaffinized and rehydrated sections were incubated in target retrieval solution high pH (Dako 2011-02) in a water-bath for antigenic retrieval. Afterwards the nestin probe was applied to the sample tissue. The sequences of probes were as follows: 5’ CCCTCAGCTTTC AGGACCCCAAGCTGGAGCTGCAATTCCC 3’(sense), 5’ GGGAATTGCAGCTCCAGCTTGGGGTCCTGAAAGCTG AGGG 3’(antisense).

The slides were then incubated in hybridizer (Hybridizer Instrument for in situ hybridization, DAKO, S2450, Denmark) for denaturation at 95°C for 5 minutes and

Evidence of Nestin-Positive Cells in the Human Cutaneus Meissner CNS & Neurological Disorders - Drug Targets, 2012, Vol. 11, No. 7 3

hybridization at 67°C for about 14 hours. After incubation they were immersed in TBS bath, and incubated in stringent wash solution (Dako K0601) at 77ºC for 30 minutes. Subsequently, they were washed in TBS and were incubated with streptavidin-AP reagent for 1 hour at room temperate. Before detection with BCIP/NBT the samples was immersed in fresh TBS. Finally, the slides were mounted with glycerin, and the images were captured using an Olympus BX61 automatic microscope and processed by Olympus CAST2 software (Servicio de Microscopia Fotónica y proceso de imágenes, University of Oviedo).

Quantitative study. The percentage of sensory Meissner and Pacinian corpuscles containing cells displaying immunoreactivity for nestin was calculated in 10 sections per specimen, 100 m apart. The total number of sensory corpuscles in the entire section was determined by counting the number of sensory corpuscles displaying of S100 protein immunoreactivity. On the other hand, the area occupied by nestin

+-fluorescent cells within the corpuscle (expressed as

the percentage of the whole corpuscular area) was determined directly under the microscope using an automatic image analysis system (Quantimet 550, Leika, QWIN Program; Servicio de Análisis de Imágenes, University of Oviedo).

RESULTS

Intermediate filament proteins Meissner and Pacinian

corpuscles. The first step of our research was to investigate what types of IF are present in human cutaneous sensory corpuscles. Using simple immunohistochemistry the following IF were detected: a) neurofilaments with a pattern of immunostaing consistent with the labelling of the axon (data not shown); b) vimentin, labelling the lamellar cells and the inner core cells of Meissner and Pacinian corpuscles, respectively (data not shown); c) nestin, in cells within Meissner corpuscles (Fig. 1a-d) or closely related to them (asterisk in Fig. 1a), as well as in cells placed in the inner core of Pacinian corpuscles (Fig. 1). The occurrence of nestin

+ cells was a common feature for Meissner corpuscles

(76,3 ± 6,1%) and it presence was less frequent for Pacinian corpuscles (58,2 ± 7,2%). Positive immunostaining for GFAP was never detected (data not shown).

In comparing serial sections of Meissner corpuscles processed for detection of nestin, S100 protein and vimentin it was observed that whereas S100 protein and vimentin are present in virtually all lamellar cells, nestin was present in a small population of lamellar cells. The same applies for the inner core cells of the Pacinian corpuscles. Thus, the pattern of localization of nestin in Meissner and Pacinian corpuscles

Fig. (1). Immunohistochemical localization of nestin immunoreactivity in digital human Meissner (a-d) and Pacinian corpuscles, using

monoclonal (a, c, g) or polyclonal (b, d, e, f) antibodies against nestin. In Meissner corpuscles flattened processes of the lamellar cells

displays nestin positivity (arrows). Occasionally, cluster of nestin positive cells are observed in the vicinity of the corpuscles (astesik in a).

The inner core of the Pacinian corpuscles (arrow in e) show intense nestin immunoreactivity, apparently localized in the processes of the

lamellar cells. Scale bar = 20 m for a-d; 50 m for e, and 20 m for f-g.


was consistent with labelling of the Schwann-related cells and/or their lamellar processes, but in these pictures the occurrence of nestin within the axons cannot be ruled out.

Characterization of the nestin positive cells in human cutaneous Meissner corpuscles. Since the precise localization of nestin within the Meissner and Pacinian corpuscles cannot be ensured with light immunohisto-chemistry, double immunofluorecence was carried combining nestin with well characterized markers of the corpuscular constituents [18, 19]. In no case nestin was co-localized with the neuronal marker NSE, thus excluding the presence of nestin in the axons (data not shown).

In adult Meissner corpuscles, nestin co-localized with S100 protein (Fig. 2a-h), but the density of nestin

+ cells

within the corpuscle ranged between 5,3% and 11,6% (mean 7,6 ± 2,7%). In some cases the nestin

+ cells were scattered

throughout the corpuscle (Fig. 2a-d), in other cases predominated at the apical or basal poles (Fig. 2c-h). The amount of nestin/S100 protein co-localization is represented graphically in the cytofluograms (Fig. 2i, j).

The main IF protein of differentiated corpuscular lamellar cells is vimentin [20]. So, we also analyzed the possible co-localization of nestin and vimentin in the Meissner corpuscles lamellar. Nestin

+/vimentin

+ cells were found within de

corpuscles (Figs. 3, 4) but its density was lower than that of nestin

+/S100 protein

+ cells, and ranged between 12,6% and

2,6% (mean values 3,1 ± 1,7%). Also, nestin+-vimentin

- cells

can be observed within the corpuscles (Fig. 4a-c), as

Fig. (2). Meissner corpuscles labelled with anti-S100 protein antibody conjugated with Alexa fluor 488 (green fluorescence), and with anti-

nestin antibody conjugated with CyTM3 (red fluorescence). When the images were overlapped there was a partial co-localization of S100

protein and nestin in a subpopulation of lamellar cells within de corpuscles. Cell nuclei display blue fluorescence for DAPI. Scale bar: 20

μm. 2D cytofluorograms from the two detection channels of S100 protein (green) and nestin (red). Each dot of the cytofluorogram represents

an intensity value pair from the two detection channels (green and red). A region of interest on the cytofluorogram around the both high

green and red signal dots had been drawn and it is represented by a mask (white dots) on the merge image.


demonstrated by the absence od co-localization observed in the cytofluograms (Fig. 4d). Finally, clusters or isolated of nestin

+/vimentin

+ and nestin

+/vimentin

- cells were observed in

the vicinity of the basal pole of the Meissner corpuscles in about 14% of the cases (Figs. 3, 4).

Characterization of the nestin positive cells in human cutaneous Pacinian corpuscles. A subpopulation of cells forming the inner core were immunoreactive for nestin (the area occupied ranging between 4,1% and 41,7%; mean 12,4 ± 4,4%). In some cases these cells were S100 protein

- (Fig.

Fig. (3). Meissner corpuscles labelled with anti-nestin antibody conjugated with Alexa fluor 488 (green fluorescence), and with anti-vimentin

antibody conjugated with CyTM3 (red fluorescence). When the images were overlapped there was a partial co-localization of nestin and

vimentin in a subpopulation of lamellar cells within de corpuscles. Clusters nestin-positive/vimentin-negative cells were observed closely

related to the basal pole of some Meissner corpuscles. Cell nuclei display blue fluorescence for DAPI. Scale bar: 20 μm for a-c; 8 m for d-f.

Fig. (4). Meissner corpuscles labelled with anti-nestin antibody conjugated with Alexa fluor 488 (green fluorescence), and with anti-vimentin

antibody conjugated with CyTM3 (red fluorescence). When the images were overlapped there was a very small co-localization of nestin and

vimentin in a subpopulation of lamellar cells within de corpuscles. Outside the corpuscles nestin-positive/vimentin-positive cells can be

observed in the dermis and basal estrate of the epidermis. Cell nuclei display blue fluorescence for DAPI. Scale bar: 20 m. 2D

cytofluorograms from the two detection channels of nestin (green) and vimentin (red) which show the almost complete absence of co-

localization of both proteins.


5a-c), and in some others were S100 protein+

(Fig. 5d-f). Regarding the co-localization with vimentin, as observed in Meissner corpuscles, two populations of inner core cells

were found: nestin+/vimentin

+ and nestin

+/vimentin

- (Fig. 6a-

f).

Fig. (5). Transverse sections of cutaneous Pacinian corpuscles, which has been labelled with anti-S100 protein antibody conjugated with

Alexa fluor 488 (green fluorescence), and with anti-nestin antibody conjugated with CyTM3 (red fluorescence). When the images were

overlapped there was a partial and variable co-localization of S100 protein and nestin in a subpopulation of lamellar cells within the inner

core of the corpuscles. Cell nuclei display blue fluorescence for DAPI. Scale bar: 20 m.

Fig. (6). Transverse sections of cutaneous Pacinian corpuscles, which has been labelled with anti-nestin antibody conjugated with Alexa

fluor 488 (green fluorescence), and with anti-vimentin antibody conjugated with CyTM3 (red fluorescence). When the images were

overlapped there was a partial and variable co-localization of nestin and vimentin in a subpopulation of lamellar cells within the inner core of

the corpuscles. Cell nuclei display blue fluorescence for DAPI. Scale bar: 20 m.


Nestin in situ hybridization. To provide further evidence for the expression of nestin in lamellar cells within adult human cutaneous sensory corpuscles we have performed an in situ hybridization study using a specific probe for human nestin. A faint but specific signal was observed within the Meissner (Fig. 7a-d) and Pacinian (Fig. 7e-f) corpuscles. The patterns of expression were consistent with the expression of nestin in the lamellar cells of Meissner corpuscles, and the inner core cells of the Pacinian corpuscles.

DISCUSSION

In the last decade several studies have demonstrate the occurrence of multipotent undifferentiated cells in most of the adult organs. They include dormant NSC derived from the neural crest which have a high plasticity and they have demonstrated to be able to generate both neurons and glial cells [21].They are present in developing and adult dorsal root ganglia [8, 22, 23], enteric nervous system [24] or sympathetic ganglia [25].

In spite of these interesting findings which demonstrate the presence of NSC niches outside the central nervous system, the availability of those cells to be used as possible sources for therapeutic applications is not realistic. Thus, the search for more easily accessible niches of potential NSC [13, 16], have recently reported the occurrence of NSC within Meissner corpuscles and Merkel cell-neurite complexes located in the hard palate of adult Wistar rats, and within the respiratory epithelium of human adult inferior turbinate, respectively. Because these cells and the lamellar cells of the Meissner corpuscles and the inner core cells of Pacinian corpuscles share a common origin from NCCs [17]. We explored the presence of NSC originated from NCC in these cutaneous sensory organs. After the elegant studies carried out by Saxod [17] it is well known that cells coating the dendritic zone of the peripheral branch of sensory axon in sensory corpuscles originate from NCC, and they represent their most peripheral migration [1]. At present these cells are regarded as non-myelinating Schwann cells [18].

Most of the studies identified NSC derived from NCC due to their expression of nestin, S100 protein, and p75

NTR

Fig. (7). Localization of transcription of mRNAs for nestin in human Meissner and Pacinian corpuscles. CISH in Meissner corpuscles (a-c)

showed that the hybridization is positive in the lamellar processes of a subpopulation of lamellar cells (arrows). In control sections sense

probe no positive reaction can be detected. In Pacinian corpuscles (e-f) expression of nestin was detected in the lamellar cells of the inner

core, but some images (f) suggest expression also in the central axon. c: capsule, oc: outer core, ic: inner core. Scale bar: 20 m.


[8, 13, 16, 24, 26]. In the present study we have identified nestin

+/S100 protein

+ cells and nestin

-/S100 protein

+ cells

within a high proportion of cutaneous Meissner and Pacinian corpuscles, 76% and 58% respectively. Furthermore, previous studies from our group and others [19, 27] have detected p75

NTR in the lamellas cells of Meissner and

Pacinian corpuscles, as well as other proteins regarded as proper of the NSC, like TrkB [22, 28]. Thus, all together these data claim for the presence of NSCs in human cutaneous sensory corpuscles.

A common feature for all NSC, independently of their localization, is the expression of nestin. Nestin in an IF with structural similarities to type III (vimentin, desmin) and especially type IV (neurofilaments –NFPs-, -internexin) IF proteins, which led to its classification as a type IV IF protein [29, 30]. Nevertheless, due to low degree of protein sequence homology of the core domain in comparison to the other five IF types nestin were defined as a new type (VI) of IF [2, 3, 31] and it was first identified in neuroepithelial stem cells [32]. It preferentially forms IFs by assembly with a variety of other IF, particularly vimentin and -internexin [33]. The co-localization of nestin and vimentin we have observed in the putative corpuscular NSC may be due to this particular mode of nestin assembly within the cytoskeletal network. When NCC mature, nestin is replaced by tissue specific IFs, i.e. GFAP in glial cells [2]. Nevertheless, the IF present in mature peripheral glial cells vary from one type cell to another. The Schwann cells, the satellite cells in sensory and vegetative ganglia express vimentin and never GFAP [34-37], while the glial cells in the enteric nervous system are rich in GFAP [38]. The lamellar cells of the Meissner corpuscles, and the cells forming the inner core of the Pacinian corpuscles, are specialized non-myelinating Schwann-related cells and they share most of the immunohistochemical characteristics with Schwann cell [18, 19], thus they express vimentin vs GFAP [20, 39-41]. It can be assumed therefore that in some glial cells nestin switch to vimentin rather than GFAP. The expression of GFAP in the terminal Schwann cells has been capricious, and it depends of the king of antibody used to label it [35].

CONCLUSIONS

The present results demonstrate that adult human cutaneous sensory corpuscles contain a small population of nestin

+ cells, and on the basis of their basic

immunohistochemical characteristics (S100 protein+, nestin

+)

they can be identified as a subpopulation of Schwann-related cells, originated from NCCs, and therefore potential NSCs. Because their localization they are easily accessible through a minimal cutaneous biopsy since the hand and foot fingers contain high densities of sensory corpuscles. This study may serve as a baseline for future studies aimed to differentiate the cells we have identified here -which could be used for therapeutic goals- from both neurons and glial cells. Of special interest it will be to study whether these cells are present in patients with peripheral nerve or spinal cord severances because previous studies have reported that the sensory corpuscles from clinically denervated cutaneous territories retain most of their immunohistochemical properties [42, 43].

ABBREVIATIONS

GFAP = Glial fibrillary acidic protein

NCCs = Neural crest cells

NFs = Neurofilaments

NSC = Neural stem cells

CONFLICT OF INTEREST

The authors confirm that this article content has no conflicts of interest.

ACKNOWLEDGEMENTS

Authors thank to Sergio López-Velasco for his help in the preparation of the manuscript.

REFERENCES

[1] Reed-Geaghan, E.G.; Maricich, S.M. Peripheral somatosensation: a touch of genetics. Curr. Opin. Genet. Dev., 2011, 21, 240-248.

[2] Lendahl, U.; Zimmerman, L.B.; McKay, R.D. CNS stem cells express a new class of intermediate filament protein. Cell, 1990,

60, 585-595. [3] Liem, R.K. Molecular biology of neuronal intermediate filaments.

Curr. Opin. Cell Biol., 1993, 5, 12-16. [4] Herrmann, H.; Aebi, U. Intermediate filaments: molecular

structure, assembly mechanism, and integration into functionally distinct intracellular Scaffolds. Annu. Rev. Biochem., 2004, 73,

749-789. [5] Kato, T.; Yokouchi, K.; Li, Z.; Fukushima, N.; Kawagishi, K.;

Moriizumi, T. Calretinin-immunoreactive neurons in rostral migratory stream: neuronal differentiation. Neuroreport, 1999, 10,

2769-2772. [6] Rice, A.C.; Khaldi, A.; Harvey, H.B.; Salman, N.J.; White, F.;

Fillmore, H.; Bullock, M.R. Proliferation and neuronal differentiation of mitotically active cells following traumatic brain

injury. Exp. Neurol., 2003, 183, 406-417. [7] Wiese, C.; Rolletschek, A.; Kania, G.; Blyszczuk, P.; Tarasov,

K.V.; Wersto, R.P.; Boheler, K.R.; Wobus, A.M. Nestin expression--a property of multi-lineage progenitor cells? Cell Mol.

Life Sci., 2004, 61, 2510-2522. [8] Vukojevic, K.; Petrovic, D.; Saraga-Babic, M. Nestin expression in

glial and neuronal progenitors of the developing human spinal ganglia. Gene Expr. Patterns, 2010, 10, 144-151.

[9] Johansson, C.B.; Lothian, C.; Molin, M.; Okano, H.; Lendahl, U. Nestin enhancer requirements for expression in normal and injured

adult CNS. J. Neurosci. Res., 2002, 69, 784-794. [10] Li, L.; Mignone, J.; Yang, M.; Matic, M.; Penman, S.; Enikolopov,

G.; Hoffman, R.M. Nestin expression in hair follicle sheath progenitor cells. Proc. Natl. Acad. Sci. USA, 2003, 100, 9958-9961.

[11] Lin, R.C.; Matesic, D.F.; Marvin, M.; McKay, R.D.; Brustle, O. Re-expression of the intermediate filament nestin in reactive

astrocytes. Neurobiol. Dis., 1995, 2, 79-85. [12] Namiki, J.; Tator, C.H. Cell proliferation and nestin expression in

the ependyma of the adult rat spinal cord after injury. J. Neuropathol. Exp. Neurol., 1999, 58, 489-498.

[13] Widera, D.; Zander, C.; Heidbreder, M.; Kasperek, Y.; Noll, T.; Seitz, O.; Saldamli, B.; Sudhoff, H.; Sader, R.; Kaltschmidt, C.;

Kaltschmidt, B. Adult palatum as a novel source of neural crest-related stem cells. Stem Cells, 2009, 27, 1899-1910.

[14] Widera, D.; Heimann, P.; Zander, C.; Imielski, Y.; Heidbreder, M.; Heilemann, M.; Kaltschmidt, C.; Kaltschmidt, B. Schwann cells

can be reprogrammed to multipotency by culture. Stem Cells Dev., 2011, 20, 2053-2064.

[15] Saito, S.; Suzuki, A.; Nozawa-Inoue, K.; Kawano, Y.; Hoshino, M.; Saito, C.; Maeda, T. Immunohistochemical detection of nestin

in the periodontal Ruffini endings of the rat incisor. Neurosci. Lett., 2009, 449, 195-200.

[16] Hauser, S.; Widera, D.; Qunneis, F.; Muller, J.; Zander, C.; Greiner, J.; Strauss, C.; Lüningschrör, P.; Heimann, P.; Schwarze,

H.; Ebmeyer, J.; Sudhoff, H.; Araúzo-Bravo, M.J.; Greber, B.;


Zaehres, H.; Schöler, H.; Kaltschmidt, C.; Kaltschmidt, B. Isolation

of novel multipotent neural crest-derived stem cells from adult human inferior turbinate. Stem Cells Dev., 2012, 21, 742-756.

[17] Saxod, R. Ontogeny of the cutaneous sensory organs. Microsc. Res. Tech., 1996, 34, 313-333.

[18] Vega, J.A.; Haro, J.J.; Del Valle, M.E. Immunohistochemistry of human cutaneous Meissner and pacinian corpuscles. Microsc. Res.

Tech., 1996, 34, 351-361. [19] Vega, J.A.; Garcia-Suarez, O.; Montano, J.A.; Pardo, B.; Cobo,

J.M. The Meissner and Pacinian sensory corpuscles revisited new data from the last decade. Microsc. Res. Tech., 2009, 72, 299-309.

[20] Vega, J.A.; Del Valle, M.E.; Haro, J.J.; Naves, F.J.; Calzada, B.; Uribelarrea, R. The inner-core, outer-core and capsule cells of the

human Pacinian corpuscles: an immunohistochemical study. Eur. J. Morphol., 1994, 32, 11-18.

[21] Dupin, E.; Sommer, L. Neural crest progenitors and stem cells: from early development to adulthood. Dev. Biol., 2012, 366, 83-95.

[22] Li, H.Y.; Say, E.H.; Zhou, X.F. Isolation and characterization of neural crest progenitors from adult dorsal root ganglia. Stem Cells,

2007, 25, 2053-2065. [23] Singh, R.P.; Cheng, Y.H.; Nelson, P.; Zhou, F.C. Retentive

multipotency of adult dorsal root ganglia stem cells. Cell Transplant., 2009, 18, 55-68.

[24] Azan, G.; Low, W.C.; Wendelschafer-Crabb, G.; Ikramuddin, S.; Kennedy, W.R. Evidence for neural progenitor cells in the human

adult enteric nervous system. Cell Tissue Res., 2011, 344, 217-225. [25] Shi, H.; Cui, H.; Alam, G.; Gunning, W.T.; Nestor, A.;

Giovannucci, D.; Zhang, M.; Ding, H.F. Nestin expression defines both glial and neuronal progenitors in postnatal sympathetic

ganglia. J. Comp. Neurol., 2008, 508, 867-878. [26] Yuan, T.F.; Arias-Carrion, O. Adult neurogenesis in the

hypothalamus: evidence, functions, and implications. CNS Neurol. Disord. Drug Targets, 2011, 10, 433-439.

[27] Vega, J.A.; Del Valle, M.E.; Haro, J.J.; Calzada, B.; Suarez-Garnacho, S.; Malinovsky, L. Nerve growth factor receptor

immunoreactivity in Meissner and Pacinian corpuscles of the human digital skin. Anat. Rec., 1993, 236, 730-736.

[28] Calavia, M.G.; Feito, J.; Lopez-Iglesias, L.; de Carlos, F.; Garcia-Suarez, O.; Pérez-Piñera, P.; Cobo, J.; Vega, J.A. The lamellar cells

in human Meissner corpuscles express TrkB. Neurosci. Lett., 2010, 468, 106-109.

[29] Herrmann, H.; Aebi, U. Intermediate filaments and their associates: multi-talented structural elements specifying cytoarchitecture and

cytodynamics. Curr. Opin. Cell Biol., 2000, 12, 79-90. [30] Michalczyk, K.; Ziman, M. Nestin structure and predicted function

in cellular cytoskeletal organisation. Histol. Histopathol., 2005, 20, 665-671.

[31] Guerette, D.; Khan, P.A.; Savard, P.E.; Vincent, M. Molecular evolution of type VI intermediate filament proteins. BMC Evol.

Biol., 2007, 7, 164.

[32] Herrmann, H.; Strelkov, S.V.; Burkhard, P.; Aebi, U. Intermediate

filaments: primary determinants of cell architecture and plasticity. J. Clin. Invest., 2009, 119, 1772-1783.

[33] Steinert, P.M.; Chou, Y.H.; Prahlad, V.; Parry, D.A.; Marekov, L.N.; Wu, K.C.; Jang, S.I.; Goldman, R.D. A high molecular

weight intermediate filament-associated protein in BHK-21 cells is nestin, a type VI intermediate filament protein. Limited co-

assembly in vitro to form heteropolymers with type III vimentin and type IV alpha-internexin. J. Biol. Chem., 1999, 274, 9881-

9890. [34] Vega, J.A.; Rodriguez, C.; Medina, M.; del Valle-Soto, M.E.;

Hernandez, L.C. Expression of cytoskeletal proteins in glial cells of dorsal root ganglia. Cell Mol. Biol., 1989, 35, 635-641.

[35] Lukas, Z.; Draber, P.; Bucek, J.; Draberova, E.; Viklicky, V.; Dolezel, S. Expression of phosphorylated high molecular weight

neurofilament protein (NF-H) and vimentin in human developing dorsal root ganglia and spinal cord. Histochemistry, 1993, 100,

495-502. [36] Byers, M.R.; Maeda, T.; Brown, A.M.; Westenbroek, R.E. GFAP

immunoreactivity and transcription in trigeminal and dental tissues of rats and transgenic GFP/GFAP mice. Microsc. Res. Tech., 2004,

65, 295-307. [37] Nascimento, R.S.; Santiago, M.F.; Marques, S.A.; Allodi, S.;

Martinez, A.M. Diversity among satellite glial cells in dorsal root ganglia of the rat. Braz. J. Med. Biol. Res., 2008, 41, 1011-1017.

[38] Jessen, K.R.; Mirsky, R. Glial cells in the enteric nervous system contain glial fibrillary acidic protein. Nature, 1980, 286, 736-737.

[39] Vega, J.A.; Zubizarreta, J.J.; del Valle, M.E.; Hernandez, L.C.; Bengoechea, M.E.; Pérez-Casas, A. Immunohistochemical study of

cat Pacinian corpuscles: co-localization of vimentin- and S-100 protein-like in the inner core. Cell Mol. Biol., 1990, 36, 415-420.

[40] Haro, J.J.; Vega, J.A.; del Valle, M.E.; Calzada, B.; Zaccheo, D.; Malinovsky, L. Immunohistochemical study of sensory nerve

formations in human glabrous skin. Eur. J. Morphol., 1991, 29, 271-284.

[41] Del Valle, M.E.; Cabal, A.; Alvarez-Mendez, J.C.; Calzada, B.; Haro, J.J.; Collier, W.; Vega, J.A. Effect of denervation on lamellar

cells of Meissner-like sensory corpuscles of the rat. An immunohistochemical study. Cell Mol. Biol., 1993, 39, 801-807.

[42] Lopez, S.M.; Perez-Perez, M.; Marquez, J.M.; Naves, F.J.; Represa, J.; Vega, J.A. p75 and TrkA neurotrophin receptors in

human skin after spinal cord and peripheral nerve injury, with special reference to sensory corpuscles. Anat. Rec., 1998, 251, 371-

383. [43] Marquez, J.; Perez-Perez, M.; Naves, F.J.; Vega, J.A. Effect of

spinal cord and peripheral nerve injury on human cutaneous sensory corpuscles. An immunohistochemical study. J. Peripher.

Nerv. Syst., 1997, 2, 49-59.

Received: June 12, 2012 Revised: August 1, 2012 Accepted: August 15, 2012

Evidence of Nestin-Positive Cells in the Human Cutaneus Meissner and Pacinian Corpuscles

Documents

Transcript of Evidence of Nestin-Positive Cells in the Human Cutaneus Meissner and Pacinian Corpuscles