European Journal of Pharmacology 700 (2013) 32–41

Contents lists available at SciVerse ScienceDirect

European Journal of Pharmacology

0014-29

http://d

n Corr

E-m

journal homepage: www.elsevier.com/locate/ejphar

Immunopharmacology and inflammation

Ethyl 30,40,50-trimethoxythionocinnamate modulates NF-kB and Nrf2transcription factors

Sarvesh Kumar a,b, Brajendra K. Singh c, Ashok K. Prasad c, Virinder S. Parmar c,Shyam Biswal b, Balaram Ghosh a,n

a Molecular Immunogenetics Laboratory, CSIR-Institute of Genomics and Integrative Biology, Mall Road, Delhi 110007, Indiab Department of Environmental Health Science, Johns Hopkins School of Public Health, Baltimore, MD 21205, USAc Bioorganic Laboratory, Department of Chemistry, University of Delhi, Delhi 110007, India

a r t i c l e i n f o

Article history:

Received 28 April 2012

Received in revised form

6 December 2012

Accepted 11 December 2012Available online 20 December 2012

Keywords:

Endothelial cell

Cell adhesion molecule

Anti-oxidant

NF-kB

Nrf2 and IkBa

99/$ - see front matter & 2012 Elsevier B.V. A

x.doi.org/10.1016/j.ejphar.2012.12.004

esponding author. Tel.: þ91 11 2766 2580; f

ail address: bghosh@igib.res.in (B. Ghosh).

a b s t r a c t

Recently, we identified a novel cinnamate analog, ethyl 30 ,40 ,50-trimethoxythionocinnamate (ETMTC) as a

potent inhibitor of cell adhesion molecules (CAMs), such as intercellular adhesion molecule-1 (ICAM-1),

vascular cell adhesion molecule-1 (VCAM-1) and E-selectin. However, its mechanism of action has not

been elucidated so far. Since, nuclear factor-kappa B (NF-kB) is the major transcription factor involved

in the regulation of ICAM-1, VCAM-1 and E-selectin expression, we determined the status of NF-kB

activation in ETMTC treated human endothelial cells. Here, we demonstrate that ETMTC inhibits TNF-a-

induced nuclear translocation and activation of NF-kB by inhibiting phosphorylation and degradation

of IkBa. The inhibition of IkBa phosphorylation and degradation by ETMTC was found to be due to its

ability to inhibit IkB kinase activity. In addition, oxidative stress is known to regulate NF-kB activation

through TNF-a signaling cascade, therefore, we examined the effect of ETMTC on TNF-a-induced

reactive oxygen species generation. We observed that ETMTC significantly inhibits TNF-a-induced

reactive oxygen species generation in endothelial cells. To further elucidate the anti-oxidant potential

of ETMTC, we examined its effect on induction of anti-oxidant genes viz. glutamate–cysteine ligase,

modifier subunit (GCLM), heme oxygenase-1 (HO1) and NAD (P)H:quinone oxidoreductase 1 (NQO1) in

human bronchial epithelial cells. Interestingly, ETMTC significantly induces the anti-oxidant genes viz.

GCLM, HO1 and NQO1 by activating nuclear factor-erythroid 2 p45-related factor 2 (Nrf2). Thus, ETMTC

could be useful towards developing potent anti-inflammatory molecules.

& 2012 Elsevier B.V. All rights reserved.

1. Introduction

Inflammation is a hallmark of many diseases like asthma, chronicobstructive pulmonary disease, acute respiratory distress syndrome,rheumatoid arthritis, atherosclerosis and cancer (Baldwin, 1996;Springer, 1994; Suchard et al., 2010). It is mediated by the expres-sion of cell adhesion molecules viz. ICAM-1, VCAM-1 and E-selectinon leukocytes. Pro-inflammatory cytokines like TNF-a, IL-1b orbacterial lipopolysaccharides (LPS) activate redox sensitive tran-scription factor, NF-kB and induce the surface expression of CAMs(Ciencewicki et al., 2008; Garg and Aggarwal, 2002; Ghosh andKarin, 2002). NF-kB is sequestered in the cytoplasm with itsinhibitory molecule (IkB). Rapid phosphorylation and degradationof IkBa allows NF-kB to translocate into the nucleus and regulatetranscription of the targeted genes. Emerging evidence suggests thatTNF-a signaling causes oxidative stress by producing reactive

ll rights reserved.

ax: þ91 11 2766 7471.

oxygen species which in turn activates NF-kB (Baeuerle andBaltimore, 1996; Baldwin, 1996, 2001; Rahman and MacNee,1998). Antioxidants and free radical quenchers have also beenshown to block the NF-kB activation (Verhasselt et al., 1999;Wakamatsu et al., 2005; Weber et al., 1995).

Nrf2 is a basic-leucine zipper (b-ZIP) transcription factorpresent in the cytoplasm; upon its activation in response toinflammatory stimulus, environmental toxicant, oxidative andelectrophilic stress, it detaches from its cytosolic inhibitor,Kelch-like ECH-associated protein 1 (Keap1) and translocates tonucleus and induces the expression of several anti-oxidantenzymes. (Nguyen et al., 2009; Nguyen et al., 2003; Nioi et al.,2003; Surh, 2008; Thimmulappa et al., 2002). Emerging literaturesuggests that there is a crosstalk between NF-kB and Nrf2.Sulforaphane, a well known Nrf2 activator inhibits NF-kB invarious cell lines (Heiss and Gerhauser, 2005; Heiss et al., 2001;Surh, 2008; Xu et al., 2005). Similarly, curcumin, a well docu-mented NF-kB inhibitor also activates Nrf2 in several types ofcultured cells. It possesses strong anti-inflammatory and antiox-idant activities (Balogun et al., 2003; Pugazhenthi et al., 2007).

S. Kumar et al. / European Journal of Pharmacology 700 (2013) 32–41 33

Activation of Nrf2 suppressed TNF-a-induced monocyte chemoat-tractant protein (MCP)-1 and VCAM-1 expression and inhibitedTNF-a-induced adhesion of monocytic U937 cell to endothelialcells (Chen et al., 2006). Disruption of Nrf2 enhances upregulationof NF-kB activity, pro-inflammatory cytokines, and ICAM-1expression and leads to pathogenesis of many inflammatorydiseases (Jin et al., 2008; Thimmulappa et al., 2006a). Therefore,pharmacological inhibition of CAMs on endothelial cells is apromising strategy for therapeutic intervention against inflam-matory disorders, it could be through inhibition of NF-kB and/oractivation of Nrf2 (Sussan et al., 2009; Thimmulappa et al., 2006b;Xu et al., 2005).

Previously, we have reported a novel aromatic ester whichexhibited potent ICAM-1 inhibitory activity on endothelial cells(Kumar et al., 2005a). We have also reported that its sulfuranalogs (thionocoumarins), when compared to its oxygenatedanalogs (coumarins), were more potent inhibitors of ICAM-1expression on endothelial cells (Kumar et al., 2005b). Recently,we designed, synthesized and evaluated the ICAM-1 inhibitoryactivity of its thio/thiono cinnamate analogs and identifiedETMTC as a potent inhibitor of CAMs (Kumar et al., 2011a). Inthe present study, we demonstrate the molecular mechanism ofaction of ETMTC.

2. Material & methods

2.1. Materials

Anti-E-selectin, Anti-ICAM-1, Anti-VCAM-1 antibodies and TNF-a,were purchased from Pharmingen, USA. Anti-mouse-IgG-FITC waspurchased from Becton & Dickinson, USA. Anti-p65, Anti- IkBa andAnti-Keap1, Anti-GAPDH antibodies were purchased from Santa CruzBiotechnology, USA. Anti-DJ-1, Anti-HO1 and Anti-NQO1antibodieswere purchased from Abcam USA. M199, L-glutamine, antibiotic andanti-mycotic solution, endothelial cell growth factor, trypsin, Puckssaline, HEPES, o-phenylenediamine dihydrochloride, ficoll-hypaque,cetitrimethyl ammonium bromide, 3-amino-1,2,4 triazole and anti-mouse IgG-HRP were purchased from Sigma Chemical Co., USA. TheICAM-1, VCAM-1, E-selectin & b-actin primer sets were synthesizedby Genset Corp., Japan. Fetal calf serum was purchased fromBiological Industries, Israel.

2.2. Cells and cell culture

Endothelial cells were isolated from human umbilical cordusing mild trypsinization (Kumar et al., 2005a). At confluence thecells were subcultured using 0.05% trypsin-0.01 M EDTA solutionand cells were used between three and four passages. Humanbronchial epithelial (Beas-2B) cells were cultured in DMEM (pH7.4) supplemented with 10% (v/v) FBS, 100 mg/l gentamicin andgenetisin. The concentration of DMSO did not exceed 0.1%. RNAwas isolated and gene expression was measured after 16 h.

2.3. Time kinetics of ICAM-1 inhibition by ETMTC

To determine the time kinetics of ICAM-1 inhibition by ETMTC,endothelial cells were treated with 70 mM ETMTC for 1–6 h priorto, simultaneously or 1–2 h after induction with TNF-a (10 ng/ml)and were further incubated for 16 h. Cell-ELISA was used formeasuring the expression of ICAM-1 on the surface of endothelialcells (Kumar et al., 2007a).

2.4. Total RNA isolation and reverse transcription polymerase chain

reaction

Endothelial cells (2�106) were incubated with or without ETMTC(70 mM) for 2 h followed by induction with TNF-a (10 ng/ml) for 4 h.Total RNA was isolated from treated endothelial cells and expressionof the transcripts for ICAM-1, VCAM-1 and E-selectin was evaluatedby RT-PCR (Kumar et al., 2007b) by using synthesized primersaccording to the published cDNA sequences to yield products of555 bp (ICAM-1), 533 bp (VCAM-1), 479 bp (E-selectin) and 661 bp(b-actin). The RT-PCR was performed following the manufacturer’sprotocol (RT-PCR system, Promega Madison). The PCR products wereanalyzed in 1% agarose gel electrophoresis and visualized by ethidiumbromide staining. Nrf2-regulated gene expression was performed byusing random hexamers and MultiScribe reverse transcriptaseaccording to the manufacturer’s recommendations (Applied Biosys-tems, Foster City, CA, USA). Quantitative real-time RT-PCR analyses ofNQO1, HO1, and GCLM were performed by using Assay-on-Demandprimers and probe sets from Applied Biosystems. Assays wereperformed using the ABI 7000 Taqman system (Applied Biosystems,Foster City, CA). b-actin was used for normalization (Kumar et al.,2011b).

2.5. Preparation of nuclear extracts

Endothelial cells (2�106) were incubated with or withoutETMTC (70 mM) for 2 h followed by induction with TNF-a (10 ng/ml) for 30 min (Kumar et al., 2007c). The cells were dislodgedusing a cell scraper, and centrifuged at 300g for 10 min. The cellpellet was resuspended in cell lysis buffer (10 mM HEPES, pH 7.9,1.5 mM MgCl2, 10 mM KCl, 1 mM PMSF, 1 mM DTT, 0.5% NonidetP40, 0.1 mM EGTA and 0.1 mM EDTA) and allowed to swell on icefor 5 min. Following centrifugation at 3300g for 15 min, thesupernatant was collected as cytoplasmic extract and stored at–70 1C. The nuclear pellet was resuspended in nuclear extractionbuffer (20 mM HEPES, 25% glycerol, 1.5 mM MgCl2, 420 mM NaCl,0.1 mM EDTA, 0.1 mM EGTA, 1 mM PMSF and 1 mM DTT) andincubated for 30 min at 4 1C. The extracted nuclei were pelleted at25,000 g (15 min at 4 1C) and the supernatant was collected asnuclear extract. The protein concentration in the extracts wasdetermined by bicinchoninic acid (BCA) method.

2.6. Preparation of total cell lysate

Endothelial cells or Beas-2B cells (2�106) were incubatedwith or without ETMTC (70 mM) for 2 h followed by inductionwith TNF-a (10 ng/ml) for 5 min (Kumar et al., 2007c). The cellswere washed with PBS, dislodged using a cell scraper, andcentrifuged at 300g for 10 min. The cell pellet was resuspendedin RIPA buffer (Tris-HCl 50 mM, NaCl 150 mM, 1 mM PMSF, 1 mMDTT, 1% Nonidet P40, 1 mM EGTA, 1 mM EDTA and cocktail ofprotein inhibitors) and allowed to swell on ice for 30 min.Following centrifugation at 25,000g for 30 min, the supernatantwas collected as total cell lysate and stored at –70 1C. The proteinconcentration in the extracts was determined by BCA proteinestimation method (Kumar et al., 2007a).

2.7. Immunoblot analysis

All immunoblots were performed using protocols as describedpreviously (Kumar et al., 2007a; Malhotra et al., 2008).

2.8. NF-kB activation assay

To determine NF-kB activation, the electrophoretic mobility shiftassay (EMSA) was performed as described earlier with some

S. Kumar et al. / European Journal of Pharmacology 700 (2013) 32–4134

modifications (Kumar et al., 2007a). Briefly, nuclear extracts wereprepared from ETMTC treated endothelial cells, 10 mg of nuclearextract was incubated with 40–80 fmoles of 32Pend labeled double-stranded NF-kB oligonucleotide (50–AGTTGAGGGGACTTTCCCAGG–30)in binding buffer (12 mM HEPES, 50 mM NaCl, 10 mM TrisCl pH7.5, 10% glycerol, 1 mM EDTA, 1 mM DTT and 1.0 mg poly dI-dC)for 30 min at RT. The DNA–protein complexes were analyzed byelectrophoresis on a 4% native polyacrylamide gel using Tris-glycine buffer pH 8.5, and visualized by autoradiography.

2.9. Measurement of intracellular reactive oxygen species generation

by flow cytometery

The TNFa-induced intracellular reactive oxygen species gen-eration in endothelial cells was measured by probe dichloroflur-orescein diacetate (DCF-DA) (Molecular Probes, Inc., USA) aspreviously reported (Kumar et al., 2007a).

2.10. Generation of stable transfectants

Beas-2B cells overexpressing ARE luciferase reporter plasmidwere obtained by transfecting Beas-2B cells with 3 mg of NQO1-ARE reporter plasmid and 0.3 mg of pUB6 empty vector (Invitro-gen, Carlsbad, CA). Stable transfectants were selected usingblasticidin at a concentration of 6 mg/ml. Stable clones wereexpanded and screened for the expression of ARE luciferase(Singh et al., 2008).

2.11. ARE reporter assay

Beas-2B cells which stably express NQO1-ARE luciferase wereseeded onto a 96-well (20000 cells/well) for 16 h and cells weretreated with indicated concentrations of ETMTC. Cells were alsotreated with DMSO, which was used as a solvent. The luciferasereporter activity was measured after 16 h exposure using theluciferase assay kit (Promega, Madison, WI). The level of increase

Fig. 1. Chemical structure of ethyl 30 ,40 ,50-trimethoxythionocinnamate (ETMTC).

Fig. 2. Kinetics of ICAM-1 inhibition by ETMTC: Endothelial cells grown to confluence in

periods. Induction was given with TNF-a (10 ng/ml) before and after treatment of the c

was given before TNF-a induction), þ indicates posttreatment (ETMTC treatment was

TNF-a treatments were given at the same time). The ICAM-1 level on the cells was m

meanþS.D. of quadruplicate wells. Data are representative of 3 independent experime

in luciferase activity reflects the degree of Nrf2 activity (Kumaret al., 2011b).

2.12. Statistical analysis

Results were given as meanþS.D. and independent two-tailedStudent’s t test was performed. Differences were consideredstatistically significant for Po0.05. All statistical analysis wasperformed using the software Microcal Origin (version 3.0; Micro-cal Software Inc., Northampton, MA) and Cell Quest Software(Becton & Dickinson, USA).

3. Results

3.1. Time kinetics of ICAM-1 inhibition by ETMTC

ETMTC as shown in Fig. 1 has been tested for cellular compat-ibility and cytotoxicity as discussed earlier (Kumar et al., 2011a).ETMTC upto 100 mM concentration has no adverse effect on cellsviability. Most of the experiments in the present studied werecarried out at 70 mm or lower concentration. The inhibition ofICAM-1 by ETMTC was found to be time dependent (Fig. 2). Asshown in Fig. 2, ETMTC inhibited ICAM-1 expression when addedprior to or simultaneously with TNF-a induction. However, whenit was added after TNF-a induction, the inhibition of ICAM-1expression was not significant (Fig. 2). Thus, for further experi-ments we chose 4 h pre-treatment for ETMTC. In another experi-ment, we found that the effect of ETMTC was reversible over aperiod of time and the cells were fully capable of responding toTNF-a induction, this indicates that ETMTC does not cause anypermanent change in endothelial cells (data not shown).

3.2. ETMTC decreases transcript levels of ICAM-1, VCAM-1 and

E-selectin

ETMTC was found to be effective in inhibiting ICAM-1 expressionwhen it was added prior to or simultaneously with TNF-a, implyingthat it may interfere with some early signaling events in response toTNF-a. The activation of cell adhesion molecules takes place at thelevel of transcription. To understand the mechanism responsible forinhibition of ICAM-1, VCAM-1 and E-selectin by ETMTC, we exam-ined whether it blocks the induction of their transcript levels. Asshown in Fig. 3, the unstimulated endothelial cells or cells treated

96 well plates were incubated with or without ETMTC (70 mM) for indicated time

ells with ETMTC at given time points,—indicates pretreatment (ETMTC treatment

given after TNF-a induction) and 0 indicates simultaneous treatment (ETMTC &

easured by cell-ELISA as described in Materials and Methods. Values shown are

nts.

S. Kumar et al. / European Journal of Pharmacology 700 (2013) 32–41 35

with ETMTC alone, there were low levels of ICAM-1 mRNA, andundetectable levels of VCAM-1 and E-selectin mRNA. Stimulationwith TNF-a led to a robust increase in ICAM-1, VCAM-1 andE-selectin transcripts (Fig. 3A and B, lane 2, 6 and 2), while 4 hpre-treatment with ETMTC prior to TNF-a induction led to asignificant reduction in the induced transcript levels (Fig. 3A andB, lane 4, 8 and 4). Neither TNF-a nor ETMTC altered constitutiveb-actin mRNA levels (Fig. 3B). The densitometric analyses of theresults in Fig. 3A and B were shown as bar graph in Fig. 3C. Theseresults demonstrated that ETMTC inhibited the TNFa-inducedtranscription of ICAM-1, VCAM-1 and E-selectin genes.

3.3. ETMTC inhibits TNF-a induced nuclear translocation of p65

Previous studies have demonstrated that NF-kB is a keytranscription factor for TNF-a induced expression of ICAM-1,VCAM-1 and E-selectin on endothelial cells. The activation ofNF-kB requires the translocation of the p65 subunit of NF-kBfrom the cytoplasm to the nucleus (Baldwin, 1996). We, therefore,measured the levels of p65 in the cytoplasm and in the nucleus ofETMTC treated cells using western blot. It was observed that therewere low levels of p65 in the nucleus of the unstimulated cells orcells treated with ETMTC alone (Fig. 4A, left blot, lanes 1 & 3)while high levels of p65 were observed in the cytoplasm (Fig. 4A,right blot, lanes 1 & 3). Upon treatment with TNF-a, the levels ofp65 in the cytoplasm decreased (Fig. 4A, right blot, lane 2) whileits levels increased in the nucleus (Fig. 4A, left blot, lane 2). On theother hand, upon treatment of the cells with ETMTC for 4 h priorto induction with TNF-a, the levels of p65 did not decrease in thecytoplasm (Fig. 4A, right blot, lane 4) and there was no con-comitant increase in the p65 levels in the nucleus (Fig. 4A, leftblot, lane 4). Equal loading of protein amounts was visualized byGAPDH (Fig. 4, lower blot). These results therefore indicate thatETMTC inhibited the translocation of p65 from cytoplasm to the

0

2

4

6

8

10

12

1 2 3 4

Arb

itary

Den

sito

met

ricU

nits

02468

101214

1 2

Arb

itary

Den

sito

met

ricU

nits

TNF- α - + - +ETMTC - - + +

- +- -

VICAM-1

M 1 2 3 4 M 5 6 7 8

TNF- α − + − + − + − +ETMTC − − + + − − + +

ICAM-1 VCAM-1

Fig. 3. ETMTC inhibits TNFa-induced transcripts of ICAM-1, VCAM-1 and E-selectin: Endoth

with TNF-a (10 ng/ml)) for 2 h. After this the total RNA of the cells was isolated and an

unstimulated cells; Lanes 2 & 6, stimulated with TNF-a; Lane 3 & 7, ETMTC alone; Lanes

ICAM-1, VCAM-1 & E-selectin transcripts were densitometrically scanned using AlphaIm

levels expressed in similar conditions. Data are representative of 3 independent exper

nucleus, and hence may be responsible for preventing the induc-tion of ICAM-1, VCAM-1 and E-selectin. Densitometric analysiswas shown in Fig. 4B.

3.4. ETMTC inhibits TNF-a induced activation of NF-kB

When NF-kB translocates from cytoplasm to the nucleus itbinds to DNA and activates NF-kB dependent genes. To study theeffect of ETMTC on NF-kB activation, electrophoretic mobilityshift assays were performed as described in Materials and Meth-

ods. As shown in Fig. 4C, there was a low level of NF-kB inunstimulated cells (lane 2). Upon stimulation with TNF-a therewas an increased level of NF-kB, thus causing substantial retarda-tion in the mobility of the labeled oligonucleotide (lane 3).The specificity of the NF-kB DNA complex induced by TNF-awas confirmed in control experiments. Incubation with excessunlabeled NF-kB inhibited the formation of the complex, whereascompetition with excess of irrelevant oligonucleotides, Oct-1 andSP-1, did not inhibit the complex formation (compare lane 7 withlanes 6 and 8, respectively). ETMTC alone had no effect on thebasal level of NF-kB (lane 4). In contrast, the treatment of cellswith ETMTC (70 mM) for 4 h prior to induction with TNF-a causeda substantial decrease in the level of NF-kB binding (lane 5). Tofurther confirm the NF-kB inhibitory activity of ETMTC, weperformed NF-kB reporter gene assay. For this, we transfectedA549, a lung epithelial cell line, with pNF-kB-d2EGFP, a GFPreporter plasmid as mentioned in Materials and Methods. It wasobserved that TNF-a induces GFP expression by more than threefold over the control. However, pre-treatment of A549 cells withETMTC for 4 h prior to TNF-a stimulation completely abolishedthe TNFa-induced expression of GFP (Fig. 4D). These results,therefore, demonstrate that ETMTC inhibits the TNF-a inducedNF-kB activation.

3 40

2

4

6

8

10

12

1 2 3 4

Arb

itary

Den

sito

met

ricU

nits

- ++ +

- + - +- - + +

CAM-1 E-selectin

M 1 2 3 4 M 5 6 7 8

− + − + − + − +− − + + − − + +

E-selectin β-actin

elial cells were incubated with or without ETMTC (70 mM for 4 h prior to induction

alyzed by RT-PCR. In Fig. 3 A & B; Lane M, marker fX174 HaeIII digest; Lane 1 & 5,

4 & 8, stimulated with TNF-a after ETMTC pre-treatment for 2 h. C, The intensity of

ager gel documentation system (Biorad, USA) and normalized with that of b-actin

iments.

M 1 2 3 4 M 1 2 3 4

Nuclear ExtractsNuclear Extracts Cytoplasmic ExtractsCytoplasmic Extracts

TNF-α − + − + − + − +ETMTC − − + + − − + +

GAPDH

4 3 2 1 M 1 2 3 4

1 2 3 4 5 6 7 8

− − + − + + + +− − − + + − − −

TNF-αETMTCCompetitor − − − − − Oct1 NF-κB SP1

NF-κB

0

50

100

150

200

250

Mea

n Lu

min

isce

nce

Inte

snity

TNF-α - + - +ETMTC - - + +

*

* *

02468

101214

1 2 3

Arb

itora

ryD

ensi

tom

etric

Uni

ts

0

2

4

6

8

10

1 2 3 4

Arb

iatr

ayD

ensi

tom

etric

Uni

ts

TNF-α - + - - + - +ETMTC - - +

4++ - - + +

* *

*

*

Fig. 4. A, ETMTC inhibits TNFa-induced nuclear translocation of p65: The endothelial cells were incubated with or without ETMTC (70 mM) for 2 h followed by induction with

TNF-a (10 ng/ml) for 30 min. The nuclear and cytoplasmic extracts were prepared and immunoblotting was performed as described in the Material and Methods. Lane M,

Marker, Bio-rad broad range; Lane 1, unstimulated cells; Lane 2, stimulated with TNF-a; Lane 3, ETMTC alone; Lane 4, stimulated with TNF-a after pre-treatment with

ETMTC for 2 h. GAPDH was used to check the purity of extracts and also used as loading control. B, The intensity of bands were densitometrically scanned using

AlphaImager gel documentation system (Biorad, USA) and normalized with that of GAPDH levels expressed in similar conditions. C, ETMTC inhibits TNFa-induced NF-kB

activation: EMSA was performed as described in Material and Methods. Lane 1, free probe; Lane 2, unstimulated cells; Lane 3, stimulated with TNF-a; Lane 4, ETMTC alone;

Lane 5, stimulated with TNF-a after ETMTC pre-treatment for 4 h; Lane 6 & 8, cold chase with non specific oligos Oct-1 & SP-1, respectively; Lane 7, specific oligos NF-kB. D,

ETMTC inhibits NF-kB dependent reporter gene expression: A549 cells were transfected with pNF-kB-luc as mentioned in Material and Methods. Bar 1, unstimulated cells; Bar

2, stimulated with TNF-a; Bar 3, ETMTC alone; Bar 4, stimulated with TNF-a after ETMTC pre-treatment for 2 h. Data are representative of 3 independent experiments.nSignificantly different from unstimulated cells; nn significantly different from stimulated cells after ETMTC treatment (Pr0.05).

S. Kumar et al. / European Journal of Pharmacology 700 (2013) 32–4136

3.5. ETMTC inhibits TNF-a induced IkB-a degradation

and phosphorylation

To determine the effect of ETMTC on IkBa degradation, total celllysate was prepared from the ETMTC treated cells. Using western blotanalysis, we demonstrated that the degradation of IkBa took place ina time dependent manner with a maximum degradation at 15 minafter the TNF-a induction. Interestingly, after 30 min of TNF-ainduction the levels of IkBa starts to reappear and at 60 min it issubstantially visible (Fig. 5A, left side). The pretreatment of endothe-lial cells with ETMTC significantly inhibited IkBa degradation in a

time dependent manner (Fig. 5A, right side). As shown in Fig. 5A rightside, pretreatment with ETMTC followed by induction with TNF-aeven after 15 min the intensity of IkBa was significantly visible(compare lane 4, in right vs. left blot). However, ETMTC alone had noeffect on the basal level of IkB-a (Fig. 5A, right side, lane 1). As IkBadegradation is dependent on its phosphorylation, thus, we deter-mined the status of its phosphorylation upon pre-treatment withETMTC. As shown in Fig. 5B, the intensity of phosphorylated IkBasignificantly increased after induction with TNF-a (compare lane 2 vs.lane 1). Interestingly, the pretreatment of endothelial cells withETMTC for 4 h prior to induction with TNF-a, ETMTC significantly

0

1

2

3

4

5

6

7

8

1 2 3 4

Arbi

tary

Den

sito

met

ric U

nits

TNF- - + - +ETMTC - - + +

I B

- + + + + + - + + + + +ETMTC - - - - - - + + + + + +

0 5 15 30 60 0 5 15 30 60

- + - +ETMTC - - + +

1 2 3 4

- + - +ETMTC - - + +

pI B

TNF- inductionin min

M 1 2 3 4 5 6 M 1 2 3 4 5 6

TNF-

TNF-

TNF-

Fig. 5. ETMTC inhibits TNFa-induced IkB-a phosphorylation and degradation: A, Total cell lysate was prepared and analyzed for IkBa phosphorylation and degradation as described

in the Materials and Methods. A, Time kinetics of IkBa degradation. B, IkBa phosphorylation: Lane 1, unstimulated cells; Lane 2, stimulated with TNF-a; Lane 3, ETMTC alone; Lane

4, stimulated with TNF-a after ETMTC pre-treatment for 2 h. The data presented is one of the three independent experiments. C, The intensity of bands were densitometrically

scanned using AlphaImager gel documentation system (Biorad, USA) and normalized with that of b-tubulin levels expressed in similar conditions. D, ETMTC inhibits TNFa-induced

IkB kinase activity: Endothelial cells were treated with ETMTC (70 M) and stimulated with TNF-a total cell lysates were prepared. The ability of immunoprecipitates assayed to

directly phosphorylate GST-IkBa fusion proteins in the presence of [g32P] ATP in-vitro kinase assay was performed as mentioned in Materials and Methods. Lane 1, unstimulated

cells; Lane 2, stimulated with TNF-a; Lane 3, ETMTC alone; Lane 4, stimulated with TNF-a after ETMTC pre-treatment for 2 h. Data are representative of 3 independent

experiments. n Significantly different from unstimulated cells; nnsignificantly different from stimulated cells after ETMTC treatment (Pr0.05).

0

10

20

30

40

50

60

Mea

n Fl

uore

scen

ce In

tens

ity

TNF- α - + - +ETMTC - - + +

*

* *

Fig. 6. ETMTC inhibits TNF-a-induced reactive oxygen species production: Confluent

human endothelial cells were treated with ETMTC (70 mM) for 2 h, cells were

loaded with DCF-DA dye (10 mM) for 30 min and were further stimulated with

TNF-a (10 ng/ml) for 30 min. Cells were washed with ice-cold PBS and collected

for acquisition as mentioned in Materials and Methods. The data presented as

meanþS.D. of three independent experiments after auto-fluorescence was sub-

tracted from treated conditions. Bar 1, unstimulated cells; Bar 2, stimulated with

TNF-a; Bar 3, ETMTC alone; Bar 4, stimulated with TNF-a after ETMTC pre-

treatment for 2 h. Cell Quest software was used for statistical analysis.nSignificantly different from unstimulated cells; nnsignificantly different from

stimulated cells after ETMTC treatment (Pr0.05).

S. Kumar et al. / European Journal of Pharmacology 700 (2013) 32–41 37

inhibited phosphorylated IkBa (compare lane 4 vs. lane 2) whileETMTC alone had no effect on the basal levels of phosphorylated IkBa(lane 3). Equal loading of protein amount was shown by b-tubulin(Fig. 5B, lower panel) and densitometric analysis was shown inFig. 5C.

3.6. ETMTC inhibits TNF-a induced kinase activity of IkB kinase (IKK)

It has been shown that IKK is required not only for TNF-a inducedphosphorylation and degradation of IkBa but also for NF-kB activa-tion (DiDonato et al., 1997; Zandi et al., 1997). Since ETMTC inhibitsIkBa phosphorylation and NF-kB activation, thus, we examined theeffect of ETMTC on TNF-a induced IKK activation. Stimulation ofendothelial cells with TNF-a increased the IKK kinase activity (Fig. 5D,lane 2). In contrast, pre-treatment of cells with ETMTC (70 mM) for4 h before TNF-a stimulation resulted in a significant decrease in thekinase activity of IKK (Fig. 5D, compare lane 4 vs. lane 2). This resultshows that ETMTC inhibits IkBa phosphorylation and NF-kB activa-tion by inhibiting IKK kinase activity.

3.7. ETMTC inhibits intracellular reactive oxygen species generation

Emerging evidence suggests that reactive oxygen species cancontribute to diverse signaling pathways. TNF-a induced oxidativestress activates inflammatory signaling pathway, including NF-kB invascular cells (Wang et al., 1996). As ETMTC inhibits TNF-a inducedNF-kB activation, therefore, we examined the effect of ETMTC onTNF-a induced reactive oxygen species generation in endothelialcells. The TNF-a induced intracellular reactive oxygen species

generation in endothelial cells was measured by probe dichlorofluor-escein diacetate (DCF-DA) as mentioned in the Materials and Methods.

As shown in Fig. 6, there was an approximately two folds increase inthe generation of free radicals upon stimulation of cells with TNF-a.In contrast, treatment of endothelial cells with ETMTC for 4 h prior to

S. Kumar et al. / European Journal of Pharmacology 700 (2013) 32–4138

induction with TNF-a completely abolished reactive oxygen speciesgeneration (Fig. 6), while ETMTC alone had no effect on generation ofreactive oxygen species. Taken together, these results suggest thatETMTC is a potent inhibitor of NF-kB, it does so by inhibiting IKKkinase activity and reactive oxygen species generation.

3.8. ETMTC potentially activates Nrf2-regulated anti-oxidant genes

in epithelial cells

The strong experimental evidence indicates the potential crosstalk between NF-kB and Nrf2 pathway. The potential NF-kBinhibitors showed strong Nrf2 activation or vice-versa (Balogunet al., 2003). To further investigate the anti-oxidant potential of

GAPDH

NQO1

HO1

Lum

inis

cenc

e (R

U)

0

2

4

6

8

10

12

14

RFC

in N

rf2-

regu

late

d ge

nes

GCLMHO1

NQO1

Conc. of ETMTC µM

Conc. of ETMTC

00.20.40.60.8

11.21.41.6

DMSO SFN 0.01 0.1 1 5 10 20

NQO1/GAPDH 0.11 0.77 0.67 0.82

HO1/GAPDH 0.45 1.0 1.18 1.74

DMSO SFN 5 µM 10 µM

DMSO SFN 5 µM 10 µM

Arb

itory

Den

sito

met

ric U

nits NQO1

HO1Keap1 DJ-1

Conc. of ETMTC

Fig. 7. Anti-oxidant potential of ETMTC: A, ETMTC induces Nrf2-regulated anti-oxidant gen

NQO1 was analyzed by qRT-PCR as a surrogate marker of Nrf2 activity in ETMTC (0.01–20

normalization. B, ETMTC is more potent than SFN at 10 mM concentration. C, ETMTC induce

regulated genes NQO1, and HO1 was further confirmed by western blots. D, ETMTC modul

and DJ-1 were quantified by western blots. E, The intensity of bands were densitometrically

with that of GAPDH levels expressed in similar conditions. F, ETMTC increases the levels of NQ

transfected Beas-2B cells after treatment with ETMTC or SFN as positive control or DMSO

ETMTC, we measured induction of Nrf2-regulated anti-oxidantgenes viz. GCLM, HO1 and NQO1 in human epithelial cells assurrogate markers for Nrf2 activation. We treated normal humanbronchial epithelial cells (Beas-2B) with ETMTC at differentconcentrations (0.01–20 mM) for 16 h and analyzed the expres-sion of GCLM, HO1 and NQO1 by quantitative RT-PCR (qRT-PCR).We included sulforaphane, a well known potent activator of Nrf2,as a positive control. As shown in Fig. 7A, ETMTC caused aconcentration dependent increase in the induction of Nrf2-regulated genes. The initial induction was observed at 1 mMconcentration and a robust increase in mRNA expression ofanti-oxidant genes was observed at 20 mM. There was a signifi-cant induction in the Nrf2-regulated genes viz. GCLM, HO1 andNQO1 at 10 mM concentration of ETMTC (Fig. 7A) which was

Keap1

DJ-1

GAPDH

0

2

4

6

8

RFC

in N

rf2-

regu

late

d ge

nes

GCLMHO1NQO1

0

4

8

12

16

Conc. of ETMTC µM

Conc. of ETMTC

DMSO SFN ETMTC

DMSO SFN 0.01 0.1 1 5 10

0.24 0.16 0.05 0.06 Keap1/GAPDH

0.81 0.96 1.17 1.52 DJ1/2APDH

DMSO SFN 5 µM 10 µM

*

*

*

*

es in human epithelial cells: The expression of Nrf2-regulated genes GCLM, HO1, and

mM) treated Beas-2B cells as mentioned in Material and methods. b-actin was used for

s Nrf2-regulated anti-oxidant gene expression at protein level: The expression of Nrf2-

ates Nrf2 regulators, Keap1 & DJ-1 expression: The expression of Nrf2 regulators Keap1

scanned using AlphaImager gel documentation system (Biorad, USA) and normalized

O1-ARE luciferase activity. NQO1-ARE luciferase activity was measured by using stably

as solvent. n Significantly different from DMSO treated cells (Pr0.05).

0

2

4

6

8

10

12

DMSO ETMTC NAC NAC + ETMTC

RFC

in N

rf2-

regu

late

d ge

nes

GCLMHO1NQO1

Fig. 8. Activation of Nrf2 genes by ETMTC is reactive oxygen species dependent.

Human bronchial epithelial cells (Beas-2B) were treated with ETMTC (10 mM) in

the presence of an antioxidant, N-acetylcystiene (10 mM, NAC). Cells were

harvested 24 h after the treatment, and the Nrf2-driven expression of NQO1,

HO-1, and GCLM was quantified. b-actin was used for normalization. Data are

representative of three independent experiments. Values shown are the mean

(S.D. of triplicate wells (Pr0.05)).

S. Kumar et al. / European Journal of Pharmacology 700 (2013) 32–41 39

found to be higher than sulforaphane at the same concentration(Fig. 7B). To confirm further, we determined the effect of ETMTCon the expression of HO1 and NQO1 proteins. Using immunoblotanalysis against HO1 and NQO1, we found that ETMTC signifi-cantly induces the protein levels of HO1 and NQO1 (Fig. 7C) in aconcentration dependent manner. Equal loading of protein amountwas visualized by equally expressing proteins GAPDH (Fig. 7C,lower blot) and densitometric analysis was shown in Fig. 7E.

3.9. ETMTC potentially modulates expression of Nrf2 regulator

Keap1 & DJ-1 are considered as Nrf2 regulators; Keap1 is acytoplasmic inhibitor of Nrf2 which negatively regulates Nrf2activity, while DJ-1 stabilizes Nrf2 protein by interfering with Keap1and known as a positive regulator of Nrf2 (Malhotra et al., 2008). Wedetermined the effect of ETMTC on expression of these Nrf2regulators. Using immunoblot analysis against Keap1 and DJ-1, wefound that there was significantly low levels of Keap1in ETMTCtreated cells (Fig. 7D, upper blot, compare lane 3 & 4 with lane 1)and it significantly increased the protein levels of DJ-1 (Fig. 7D,middle blot). Equal loading of protein amount was visualized byGAPDH (Fig. 7D, lower blot) and densitometric analysis was shownin Fig. 7E. These results indicate the ability of ETMTC to positivelyregulate DJ-1 expression and negatively regulate Keap1 expression.

Nrf2 increases the expression of HO1, NQO1 and GCLM bybinding to the ARE present in the promoter regions of these genes(Giudice et al., 2010). We determined whether activation ofNrf2-regulated anti-oxidant genes by ETMTC is Nrf2 dependentor not. We measured the expression of the luciferase gene underthe control of NQO1-ARE sequence using stably transfected Beas-2B cells treated with ETMTC. The exposure of Beas-2B cells toETMTC resulted in a significant concentration-dependent increasein luciferase activity as measured by the chemiluminescence-based assay (Fig. 7F). There was basal luciferase activity in DMSOtreated cells. Sulforaphane, a positive control, induces approxi-mately 6-fold higher luciferase activity than DMSO control at10 mM concentration, while at the same concentration ETMTCinduces Z2.5 fold higher than sulforaphane. The induction inluciferase activity by ETMTC is concentration dependent.The transcriptional activation of antioxidant genes through anARE is largely dependent upon Nrf2, suggesting that ETMTCupregulates antioxidant genes via Nrf2 activation. Taken together,ETMTC has demonstrated its potential as a potent antioxidant andNrf2 activator in cell culture system.

3.10. Activation of Nrf2 by ETMTC is dependent on reactive oxygen

species generation

The activation of Nrf2 by various electrophiles and compoundsthat are Michael acceptors is attributed to changes in reactiveoxygen species production and/or redox environment and/ordirect cysteine modification in Keap1 (McMahon et al., 2010;Nguyen et al., 2009). We examined whether ETMTC activates Nrf2by generating reactive oxygen species or redox changes. Beas-2Bcells were co-incubated with ETMTC and with or withoutN-acetylcysteine (NAC, 10 mM), and the expression of GCLM,NQO1, and HO1 was measured 24 h later. We found that ETMTCpotentially increases the expression of Nrf2-regulated antioxidantgenes in the absence of NAC (Fig. 8). In the presence of NAC,ETMTC failed to induce Nrf2-regulted genes. There was nosignificant induction in Nrf2-regulated genes in the presence ofNAC. Taken together, these results suggest that the activation ofNrf2 by ETMTC is dependent on reactive oxygen species or redoxchanges. Further studies are required to determine whetherETMTC activates Nrf2 by direct thiol modification of Keap1.

4. Discussion

Leukocyte mediated inflammatory response is the key event inmultiple inflammatory diseases including asthma, acute respira-tory distress syndrome, rheumatoid arthritis, and atherosclerosis(Butcher, 1991; Osborn, 1990). Therefore, pharmacological inhibi-tion of CAMs on endothelial cells is a promising strategy fortherapeutic intervention of inflammatory disorders Weiser et al.(1997). A number of small molecules, such as glucocorticoids,aspirin, acetylsalicylate, serine proteinase, natural molecules andproteasome inhibitors have been shown to inhibit TNFa inducedcell adhesion molecule expression (Brostjan et al., 1997; Kumaret al., 2007a; Neuner et al., 1997; Pierce et al., 1996; Weber et al.,1995). Here, for the first time, we demonstrated the anti-inflammatory and antioxidant potential of a natural derivative,ETMTC. We demonstrated for the first time that ETMTC inhibitedTNFa-induced transcripts of CAMs through inhibiting NF-kBsignaling pathway. The experimental evidence suggests a poten-tial cross talk between NF-kB and Nrf2 pathway (Surh and Na,2008). To further explore the cross talk between NF-kB and Nrf2pathway, we determined the effect of ETMTC on Nrf2 signalingcascade by using our recently developed unique high through putluciferase based reporter assay system for measuring Nrf2 activityin human epithelial cells Kumar et al., 2011a. We have demon-strated that ETMTC significantly induced Nrf2-regulated anti-oxidant genes in human epithelial cells. ETMTC was found to bemore potent than sulforaphane, a well known Nrf2 activator inactivating Nrf2-targeted genes. Furthermore, we have elucidatedthat activation of Nrf2-regulated genes by ETMTC is reactiveoxygen species dependent. It is likely that at lower concentrationof ETMTC (10 mM), it might generate a tiny amount of reactiveoxygen species which could be sufficient to activate Nrf2 (Fig. 7).In fact, several chemopreventive agents trigger Nrf2 activationsignaling with a concomitant repression of NF-kB signaling. Mostof these Nrf2 activators behave like elctrophiles by producing atiny amount of reactive oxygen species which is sufficient toactivate Nrf2 signaling (Liu et al., 2007; Wakabayashi et al., 2010).Thus, we suggest that ETMTC could affect both NF-kB and Nrf2 ineither epithelial or endothelial cells.

Most of the NF-kB inhibitors, such as salicylates (Pierce et al.,1996) and curcumin inhibited NF-kB activation by inhibitingdegradation of IkB proteins through blocking the activation ofIkB kinase. These molecular mechanisms appear similar to thoseshown by ETMTC in this study. Furthermore, in comparisonwith the known anti-inflammatory clinical drugs, such as aspirin

S. Kumar et al. / European Journal of Pharmacology 700 (2013) 32–4140

(IC50 6000 mM), mesalamine (IC50 16,000 mM) and phenyl methi-mazole (IC50 500 mM), ETMTC showed greater potency in inhibitingthe TNF-a induced expression of adhesion molecules and NF-kBactivation at significantly lower concentration. Likewise, when com-pared with other clinically used anti-inflammatory drugs, such asdiclofenac, N-acetylcysteine and pyrrolidone dithiocarbamate that areeffective at concentrations of 750 mM, 100 mM and 1000 mM, respec-tively, ETMTC showed better potential at 70 mM (Sakai, 1996; Weberet al., 1994) In addition, previously reported NF-kB inhibitors,differentially inhibited the expression of cell adhesion molecules.PDTC inhibits cytokine-induced expression VCAM-1 but not ICAM-1or E-selectin at same concentration i.e. 50 mg/ml (Marui et al., 1993).Sodium salicylate selectively inhibits VCAM-1 and ICAM-1 with amarginal effect on E-selectin at a concentration of 10 mM (Pierceet al., 1996). Aspirin also inhibits cytokine-induced expression ofVCAM-1 and E-selectin without affecting ICAM-1 expression. Incontrast, ETMTC inhibited TNFa-induced ICAM-1, VCAM-1 andE-selectin by blocking NF-kB activation through inhibiting IKKactivity at a significantly lower concentration than the above men-tioned NF-kB inhibitors.

Further, we compared the efficacy of ETMTC (sulfur derivative,known thio/thiono cinnamates) with reported natural parentcompound, present in Piper longum, i.e. ETMC (oxygen derivative)(Kumar et al., 2005a). ETMTC was found to be more potent thanETMC in inhibiting TNFa-induced expression of cell adhesionmolecules (Kumar et al., 2005a). We performed similar experi-ments on ETMC and found similar trend of data, ETMC alsoinhibited TNFa-induced expression of cell adhesion moleculesand NF-kB activation by blocking IkB kinase activation but attwice higher concentration than ETMTC (data not shown).Thiono-cinnamates have better inhibitory activities than cinna-mates because of sulfur in their structures. It has been welldocumented in literature that sulfur-containing compounds arebiologically more active than their oxygen containing counter-parts (Fimognari et al., 2009). As both are members of the sameperiodic table, sulfur and oxygen share similarities in chemicalreactivity. However, sulfur’s position being lower in the periodictable, it endows its compounds with distinct properties that areadvantageous to biological systems. For example, thiols aresuperior nucleophiles compared with alcohols and also serve asversatile activating groups in thio-ester biochemistry. Disulfidebonds (RS–SR) are more stable than peroxide bonds (RO–OR), andbiology has taken advantage of this stability by using disulfidebonds as structural features of proteins. The presence of thiols intheir structures could be responsible for their better biologicalactivities including anti-inflammatory/antioxidant properties(Chevion et al., 2000; Rahman et al., 2006).

In conclusion, ETMTC inhibits TNF-a-induced NFkB signaling andactivates Nrf2-regulated anti-oxidants genes. The results demon-strate the ability of ETMTC as a potential anti-inflammatory & anti-oxidant molecule. Thus, ETMTC could be used as a template fordeveloping therapeutic lead compounds for various inflammatorydiseases.

Acknowledgments

Authors acknowledge the help of St. Stephen’s Hospital, Delhifor providing the umbilical cords. This work was partly funded bythe Council of Scientific and Industrial Research (CSIR, India)Grant NWP0033 (to B.G.), NIH Grants-NIEHS-P50ES015903, P01ES018176 and ES03819 (SB) and by the University of Delhi toProfessor V.S. Parmar, Ashok K. Prasad and Brajendra K. Singh.The Council of Scientific and Industrial Research (CSIR, New Delhi,India) is highly acknowledged for financial support.

References

Baeuerle, P.A., Baltimore, D., 1996. NF-kappa B: ten years after. Cell 87, 13–20.Baldwin Jr., A.S., 1996. The NF-kappa B and I kappa B proteins: new discoveries

and insights. Annu. Rev. Immunol. 14, 649–683.Baldwin Jr., A.S., 2001. Series introduction: the transcription factor NF-kappa B and

human disease. J. Clin. Invest. 107, 3–6.Balogun, E., Hoque, M., Gong, P.F., Killeen, E., Green, C.J., Foresti, R., Alam, J.,

Motterlini, R., 2003. Curcurnin activates the haem oxygenase-1 gene viaregulation of Nrf2 and the antioxidant-responsive element. Biochem. J. 371,887–895.

Brostjan, C., Anrather, J., Csizmadia, V., Natarajan, G., Winkler, H., 1997. Gluco-corticoids inhibit E-selectin expression by targeting NF-kappa B and not ATF/c-Jun. J. Immunol. 158, 3836–3844.

Butcher, E.C., 1991. Leukocyte-endothelial cell recognition: three (or more) stepsto specificity and diversity. Cell 67, 1033–1036.

Chen, X.L., Dodd, G., Thomas, S., Zhang, X., Wasserman, M.A., Rovin, B.H., Kunsch, C.,2006. Activation of Nrf2/ARE pathway protects endothelial cells from oxidantinjury and inhibits inflammatory gene expression. Am. J. Physiol. Heart Circ.Physiol 290, H1862–1870.

Chevion, S., Roberts, M.A., Chevion, M., 2000. The use of cyclic voltammetry for theevaluation of antioxidant capacity. Free Radical Biol. Med. 28, 860–870.

Ciencewicki, J., Trivedi, S., Kleeberger, S.R., 2008. Oxidants and the pathogenesis oflung diseases. J. Allergy Clin. Immunol 122, 456–468, quiz 469-470.

DiDonato, J.A., Hayakawa, M., Rothwarf, D.M., Zandi, E., Karin, M., 1997. Acytokine-responsive Ikappa B kinase that activates the transcription factorNF-kappa B. Nature 388, 548–554.

Fimognari, C., Lenzi, M., Hrelia, P., 2009. Apoptosis induction by sulfur-containingcompounds in malignant and nonmalignant human cells. Environ. Mol.Mutagen 50, 171–189.

Garg, A.K., Aggarwal, B.B., 2002. Reactive oxygen intermediates in TNF signaling.Mol. Immunol. 39, 509–517.

Ghosh, S., Karin, M., 2002. Missing pieces in the NF-kappa B puzzle. Cell, 109Suppl. S81–S96.

Giudice, A., Arra, C., Turco, M.C., 2010. Review of molecular mechanisms involvedin the activation of the Nrf2-ARE signaling pathway by chemopreventiveagents. Trans. Factors: Methods Protoc., 37–74.

Heiss, E., Gerhauser, C., 2005. Time-dependent modulation of thioredoxin reduc-tase activity might contribute to sulforaphane-mediated inhibition of NF-kappa B binding to DNA. Antioxid. Redox. Signal 7, 1601–1611.

Heiss, E., Herhaus, C., Klimo, K., Bartsch, H., Gerhauser, C., 2001. Nuclear factorkappa B is a molecular target for sulforaphane-mediated anti-inflammatorymechanisms. J. Biol. Chem. 276, 32008–32015.

Jin, W., Wang, H., Yan, W., Xu, L., Wang, X., Zhao, X., Yang, X., Chen, G., Ji, Y., 2008.Disruption of Nrf2 enhances upregulation of nuclear factor-kappa B activity,proinflammatory cytokines, and intercellular adhesion molecule-1 in the brainafter traumatic brain injury. Mediators Inflamm. 2008, 725174.

Kumar, S., Arya, P., Mukherjee, C., Singh, B.K., Singh, N., Parmar, V.S., Prasad, A.K.,Ghosh, B., 2005a. Novel aromatic ester from Piper longum and its analoguesinhibit expression of cell adhesion molecules on endothelial cells. Biochem-istry 44, 15944–15952.

Kumar, S., Sharma, A., Madan, B., Singhal, V., Ghosh, B., 2007a. Isoliquiritigenininhibits Ikappa B kinase activity and ROS generation to block TNF-alphainduced expression of cell adhesion molecules on human endothelial cells.Biochem. Pharmacol. 73, 1602–1612.

Kumar, S., Singh, B.K., Arya, P., Malhotra, S., Thimmulappa, R., Prasad, A.K., Van derEycken, E., Olsen, C.E., Depass, A.L., Biswal, S., Parmar, V.S., Ghosh, B., 2011a.Novel natural product-based cinnamates and their thio and thiono analogs aspotent inhibitors of cell adhesion molecules on human endothelial cells. Eur. J.Med. Chem. 46, 5498–5511.

Kumar, S., Singh, B.K., Kalra, N., Kumar, V., Kumar, A., Prasad, A.K., Raj, H.G., Parmar,V.S., Ghosh, B., 2005b. Novel thiocoumarins as inhibitors of TNF-alpha inducedICAM-1 expression on human umbilical vein endothelial cells (HUVECs) andmicrosomal lipid peroxidation. Bioorg. Med. Chem. 13, 1605–1613.

Kumar, S., Singh, B.K., Pandey, A.K., Kumar, A., Sharma, S.K., Raj, H.G., Prasad, A.K.,Van der Eycken, E., Parmar, V.S., Ghosh, B., 2007b. A chromone analog inhibitsTNF-alpha induced expression of cell adhesion molecules on human endothe-lial cells via blocking NF-kappa B activation. Bioorg. Med. Chem. 15,2952–2962.

Kumar, S., Singhal, V., Roshan, R., Sharma, A., Rembhotkar, G.W., Ghosh, B., 2007c.Piperine inhibits TNF-alpha induced adhesion of neutrophils to endothelialmonolayer through suppression of NF-kappa B and Ikappa B kinase activation.Eur. J. Pharmacol. 575, 177–186.

Kumar, V., Kumar, S., Hassan, M., Wu, H., Thimmulappa, R.K., Kumar, A., Sharma,S.K., Parmar, V.S., Biswal, S., Malhotra, S.V., 2011b. Novel chalcone derivativesas potent Nrf2 activators in mice and human lung epithelial cells. J. Med.Chem. 54, 4147–4159.

Liu, Y.C., Hsieh, C.W., Wu, C.C., Wung, B.S., 2007. Chalcone inhibits the activation ofNF-kappa B and STAT3 in endothelial cells via endogenous electrophile. LifeSci. 80, 1420–1430.

Malhotra, D., Thimmulappa, R., Navas-Acien, A., Sandford, A., Elliott, M., Singh, A.,Chen, L., Zhuang, X., Hogg, J., Pare, P., Tuder, R.M., Biswal, S., 2008. Decline inNRF2-regulated antioxidants in chronic obstructive pulmonary disease lungsdue to loss of its positive regulator, DJ-1. Am. J. Respir. Crit. Care Med. 178,592–604.

S. Kumar et al. / European Journal of Pharmacology 700 (2013) 32–41 41

Marui, N., Offermann, M.K., Swerlick, R., Kunsch, C., Rosen, C.A., Ahmad, M.,Alexander, R.W., Medford, R.M., 1993. Vascular cell adhesion molecule-1(VCAM-1) gene transcription and expression are regulated through anantioxidant-sensitive mechanism in human vascular endothelial cells. J. Clin.Invest. 92, 1866–1874.

McMahon, M., Lamont, D.J., Beattie, K.A., Hayes, J.D., 2010. Keap1 perceives stressvia three sensors for the endogenous signaling molecules nitric oxide, zinc,and alkenals. Proc. Nat. Acad. Sci. USA 107, 18838–18843.

Neuner, P., Klosner, G., Pourmojib, M., Knobler, R., Schwarz, T., 1997. Pentoxifyllinein vivo and in vitro down-regulates the expression of the intercellularadhesion molecule-1 in monocytes. Immunology 90, 435–439.

Nguyen, T., Nioi, P., Pickett, C.B., 2009. The Nrf2-antioxidant response elementsignaling pathway and its activation by oxidative stress. J. Biol. Chem. 284,13291–13295.

Nguyen, T., Sherratt, P.J., Pickett, C.B., 2003. Regulatory mechanisms controllinggene expression mediated by the antioxidant response element. Annu. Rev.Pharmacol. Toxicol. 43, 233–260.

Nioi, P., McMahon, M., Itoh, K., Yamamoto, M., Hayes, J.D., 2003. Identification of anovel Nrf2-regulated antioxidant response element (ARE) in the mouseNAD(P)H: quinone oxidoreductase 1 gene: reassessment of the ARE consensussequence. Biochem. J. 374, 337–348.

Osborn, L., 1990. Leukocyte adhesion to endothelium in inflammation. Cell 62, 3–6.Pierce, J.W., Read, M.A., Ding, H., Luscinskas, F.W., Collins, T., 1996. Salicylates

inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesionmolecule expression, and neutrophil transmigration. J. Immunol. 156,3961–3969.

Pugazhenthi, S., Akhov, L., Selvaraj, G., Wang, M., Alam, J., 2007. Regulation ofheme oxygenase-1 expression by demethoxy curcuminoids through Nrf2 by aPI3-kinase/Akt-mediated pathway in mouse beta-cells. Am. J Physiol. Endo-crinol. Metab 293, E645–655.

Rahman, I., Biswas, S.K., Kirkham, P.A., 2006. Regulation of inflammation and redoxsignaling by dietary polyphenols. Biochem. Pharmacol. 72, 1439–1452.

Rahman, I., MacNee, W., 1998. Role of transcription factors in inflammatory lungdiseases. Thorax 53, 601–612.

Sakai, A., 1996. Diclofenac inhibits endothelial cell adhesion molecule expressioninduced with lipopolysaccharide. Life Sci. 58, 2377–2387.

Singh, A., Boldin-Adamsky, S., Thimmulappa, R.K., Rath, S.K., Ashush, H., Coulter, J.,Blackford, A., Goodman, S.N., Bunz, F., Watson, W.H., Gabrielson, E., Feinstein, E.,Biswal, S., 2008. RNAi-mediated silencing of nuclear factor erythroid-2-relatedfactor 2 gene expression in non-small cell lung cancer inhibits tumor growthand increases efficacy of chemotherapy. Cancer Res. 68, 7975–7984.

Springer, T.A., 1994. Traffic signals for lymphocyte recirculation and leukocyteemigration: the multistep paradigm. Cell 76, 301–314.

Suchard, S.J., Stetsko, D.K., Davis, P.M., Skala, S., Potin, D., Launay, M., Dhar, T.G.,Barrish, J.C., Susulic, V., Shuster, D.J., McIntyre, K.W., McKinnon, M., Salter-Cid, L.,2010. An LFA-1 (alphaLbeta2) small-molecule antagonist reduces inflammationand joint destruction in murine models of arthritis. J. Immunol. 184,3917–3926.

Surh, Y.J., 2008. NF-kappa B and Nrf2 as potential chemopreventive targets of someanti-inflammatory and antioxidative phytonutrients with anti-inflammatoryand antioxidative activities. Asia Pac. J. Clin. Nutr. 17 (1), 269–272.

Surh, Y.J., Na, H.K., 2008. NF-kappa B and Nrf2 as prime molecular targets forchemoprevention and cytoprotection with anti-inflammatory and antioxidantphytochemicals. Genes Nutr. 2, 313–317.

Sussan, T.E., Rangasamy, T., Blake, D.J., Malhotra, D., El-Haddad, H., Bedja, D., Yates, M.S.,Kombairaju, P., Yamamoto, M., Liby, K.T., Sporn, M.B., Gabrielson, K.L., Champion,H.C., Tuder, R.M., Kensler, T.W., Biswal, S., 2009. Targeting Nrf2 with thetriterpenoid CDDO-imidazolide attenuates cigarette smoke-induced emphysemaand cardiac dysfunction in mice. Proc. Nat. Acad. Sci. USA 106, 250–255.

Thimmulappa, R.K., Lee, H., Rangasamy, T., Reddy, S.P., Yamamoto, M., Kensler, T.W.,Biswal, S., 2006a. Nrf2 is a critical regulator of the innate immune response andsurvival during experimental sepsis. J. Clin. Invest. 116, 984–995.

Thimmulappa, R.K., Mai, K.H., Srisuma, S., Kensler, T.W., Yamamato, M., Biswal, S.,2002. Identification of Nrf2-regulated genes induced by the chemopreventiveagent sulforaphane by oligonucleotide microarray. Cancer Res. 62, 5196–5203.

Thimmulappa, R.K., Scollick, C., Traore, K., Yates, M., Trush, M.A., Liby, K.T., Sporn, M.B.,Yamamoto, M., Kensler, T.W., Biswal, S., 2006b. Nrf2-dependent protection fromLPS induced inflammatory response and mortality by CDDO-Imidazolide. Bio-chem. Biophys. Res. Commun. 351, 883–889.

Verhasselt, V., Vanden Berghe, W., Vanderheyde, N., Willems, F., Haegeman, G.,Goldman, M., 1999. N-acetyl-L-cysteine inhibits primary human T cellresponses at the dendritic cell level: association with NF-kappa B inhibition.J. Immunol. 162, 2569–2574.

Wakabayashi, N., Slocum, S.L., Skoko, J.J., Shin, S., Kensler, T.W., 2010. When NRF2talks, who’s listening? Antioxid. Redox. Signal 13, 1649–1663.

Wakamatsu, K., Nanki, T., Miyasaka, N., Umezawa, K., Kubota, T., 2005. Effect of asmall molecule inhibitor of nuclear factor-kappa B nuclear translocation in amurine model of arthritis and cultured human synovial cells. Arthritis Res.Ther. 7, R1348–1359.

Wang, C.Y., Mayo, M.W., Baldwin Jr., A.S., 1996. TNF- and cancer therapy-inducedapoptosis: potentiation by inhibition of NF-kappa B. Science 274, 784–787.

Weber, C., Erl, W., Pietsch, A., Strobel, M., Ziegler-Heitbrock, H.W., Weber, P.C.,1994. Antioxidants inhibit monocyte adhesion by suppressing nuclearfactor-kappa B mobilization and induction of vascular cell adhesionmolecule-1 in endothelial cells stimulated to generate radicals. Arterioscler.Thromb. 14, 1665–1673.

Weber, C., Erl, W., Pietsch, A., Weber, P.C., 1995. Aspirin inhibits nuclear factor-kappa B mobilization and monocyte adhesion in stimulated human endothe-lial cells. Circulation 91, 1914–1917.

Weiser, M.R., Gibbs, S.A.L., Hechtman, H.B., Issekutz, P.L.C., Issekutz, T.B., 1997.In Adhesion Molecules in Health and Disease. Ed, NewYork. Marcel Dekker Inc,p. 55–86.

Xu, C., Shen, G., Chen, C., Gelinas, C., Kong, A.N., 2005. Suppression of NF-kappa Band NF-kappa B-regulated gene expression by sulforaphane and PEITC throughIkappa B alpha, IKK pathway in human prostate cancer PC-3 cells. Oncogene24, 4486–4495.

Zandi, E., Rothwarf, D.M., Delhase, M., Hayakawa, M., Karin, M., 1997. The Ikappa Bkinase complex (IKK) contains two kinase subunits, IKKalpha and IKKbeta,necessary for Ikappa B phosphorylation and NF-kappa B activation. Cell 91,243–252.