EC

GFM

*F

BhtgtothStsptsdiepaflfpSpnoSntccedbrwp

EtS

BA

SIC–

ALIM

ENTA

RY

TRA

CT

GASTROENTEROLOGY 2007;133:918–925

nteric Glial-Derived S100B Protein Stimulates Nitric Oxide Production ineliac Disease

IUSEPPE ESPOSITO,* CARLA CIRILLO,‡ GIOVANNI SARNELLI,‡ DANIELE DE FILIPPIS,*RANCESCO PAOLO D’ARMIENTO,§ ALBA ROCCO,‡ GERARDO NARDONE,‡ RAFFAELLA PETRUZZELLI,�

ICHELA GROSSO,� PAOLA IZZO,� TERESA IUVONE,* and ROSARIO CUOMO‡

Department of Experimental Pharmacology, ‡Department of Clinical and Experimental Medicine, Gastroenterology Unit, §Department of Morphological and

unctional Science, Pathology Unit, and �Department of Biochemistry and Medical Biotechnologies, University Federico II, Naples, Italy

tfeacsvstgpw

apwDSd

siaisSrcp

eikpid

gp

ackground & Aims: Enteric glia participates to theomeostasis of the gastrointestinal tract. In the cen-

ral nervous system, increased expression of astro-lial-derived S100B protein has been associated withhe onset and maintaining of inflammation. The rolef enteric glial-derived S100B protein in gastrointes-inal inflammation has never been investigated inumans. In this study, we evaluated the expression of100B and its relationship with nitric oxide produc-ion in celiac disease. Methods: Duodenal biopsypecimens from untreated and on gluten-free dietatients with celiac disease and controls were respec-

ively processed for S100B and inducible nitric oxideynthase (iNOS) protein expression and nitrite pro-uction. To evaluate the direct involvement of S100B

n the inflammation, control biopsy specimens werexposed to exogenous S100B, and iNOS protein ex-ression and nitrite production were measured. Welso tested gliadin induction of S100B-dependent in-ammation in cultured biopsy specimens deriving

rom on gluten-free diet patients in the absence orresence of the specific S100B antibody. Results:100B messenger RNA and protein expression, iNOSrotein expression, and nitrite production were sig-ificantly increased in untreated patients but not inn gluten-free diet patients vs controls. Addition of100B to control biopsy specimens resulted in a sig-ificant increase of iNOS protein expression and ni-

rite production. In celiac disease patients but not inontrols biopsy specimens, gliadin challenge signifi-antly increased S100B messenger RNA and proteinxpression, iNOS protein expression, and nitrite pro-uction, but these effects were completely inhibitedy S100B antibody. Conclusions: Enteric glial-de-ived S100B is increased in the duodenum of patientsith celiac disease and plays a role in nitric oxideroduction.

nteric glial cells (EGC) have been fully reevaluated inrecent years as a fundamental cell type involved in

he maintenance of gut microenvironment homeostasis.1

imilarly to their equivalent in the central nervous sys-

em (CNS), EGC release a wide range of neurotrophicactors accounting for development, survival, and differ-ntiation of many peripheral neurons.2 In addition, EGCre activated by inflammatory insults and may activelyontribute to an inflammatory condition via antigen pre-entation and cytokine synthesis.3 EGC represent, thus, aery important link between the nervous and immuneystems of the gut, playing a pivotal role in maintaininghe integrity of the mucosal barrier.3,4 During chronicut inflammation, EGC proliferate and release neurotro-hins, growth factors, and proinflammatory cytokines,hich, in turn, may amplify the immune response.5

One of the most interesting neurotrophins released bystroglial cells is the S100B protein, a Ca�2/Zn�2-bindingrotein localized in the cytoplasm and/or nucleus of aide range of both nervous and nonnervous tissues.6,7

espite its neurotrophic role, an aberrant production of100B has been reported to play a deleterious role inifferent neuropathologies of the CNS.8

In the brain, S100B may induce the expression ofpecific proinflammatory transcription factors9,10 induc-ng the synthesis and release of nitric oxide (NO) in anutocrine manner by astroglial cells.11 In the gut, S100Bs exclusively localized in enteroglial cells12,13 and is con-idered a specific marker of enteric glia.14 Although100B, together with other S100 proteins, have beenelated to the development and progression of colonancer,15 there are no data about the role exerted by thisrotein in human chronic gut inflammation.Celiac disease (CD) represents a paradigmatic chronic

nteropathy16 characterized by a complex inflammatorymmunoreaction with release of proinflammatory cyto-ines and NO.17 On the basis of this background, in theresent study, we evaluated the expression of S100B and

ts relationship with NO-dependent inflammation in theuodenal mucosa of CD patients.

Abbreviations used in this paper: CD, celiac disease; EGC, entericlial cells; GFD, gluten-free diet; iNOS, inducible nitric oxide synthase;-p38, phosphorilated-p38; pt-gliadin, peptic-tryptic digest of gliadin.

© 2007 by the AGA Institute0016-5085/07/$32.00

doi:10.1053/j.gastro.2007.06.009

uuietdtdffo

aidPc

ccwifUgCun

tClsas5tmta3tpm

amImmc

p�R(mss

(icDammwSfC3sStrcgmecuimE

aobbsbIGiIG

Sfd5pia(t

BA

SIC–

ALI

MEN

TARY

TRA

CT

September 2007 ENTERIC GLIAL CELLS AND S100B IN CD 919

Materials and MethodsPatientsDuodenal biopsy specimens were taken during

pper gastrointestinal endoscopy in 22 patients withntreated CD (mean age, 34 years; range, 23– 45) serolog-

cally diagnosed on the basis of immunoglobulin (Ig)Andomysial, gliadin antibodies, and transglutaminase an-ibodies positivity and in 21 CD patients on a gluten-freeiet (GFD-CD) (mean age, 35 years; range 23–47). Twenty-hree subjects (mean age, 45 years; range, 23– 67) withyspeptic symptoms served as controls. We obtained in-ormed consent from all the participants and approvalrom the Ethics Committee of the Federico II Universityf Naples.

Diagnosis of CD was confirmed by duodenal histologyccording to the Marsh criteria.18 The degree of mucosalnflammation was further characterized by myeloperoxi-ase assay, which was significantly increased (127% � 8%;� .01) in CD patients compared with GFD-CD and

ontrols.

ProceduresOrgan culture of mucosal biopsy specimens. Ac-

ording to Coeffier et al,19 whole biopsy specimens fromontrols, CD, and GFD-CD patients, were placed in 24-ell plates for 24 hours and cultured in Dulbecco’s mod-

fied Eagle medium (DMEM) supplemented with 10%etal bovine serum (FBS), 2 mmol/L glutamine, 100/mL penicillin, 100 �g/mL streptomycin, and 1 mg/mLentamycin (Biowhittaker, Milan, Italy) at 37°C in 5%O2/95% air. The release of S100B and nitrite levels,sing the Griess reagent,20 were measured in the super-atant on the basis of different experimental conditions.

Immunohistochemistry. For S100B immunohis-ochemistry, duodenal specimens deriving from controls,D, and GFD-CD patients were fixed in buffered forma-

in, embedded in paraffin, and cut into 4-�m-thick serialections. Sections were stained with the primary S100Bntibody (1:200; NeoMarker, Fremont, CA) and counter-tained with H&E at room temperature. After 3,-minute washes, the secondary antibody was added, andhe samples were incubated at room temperature for 20

inutes. The streptavidin-horseradish peroxidase detec-ion system (Chemicon Int, Temecula, CA) was added,nd samples were incubated at room temperature. After, 5-minute washes, 50 �L chromogen was added andhe reaction terminated after 1 minute in water. Appro-riate negative controls were performed by omitting pri-ary antibody.

RNA isolation and quantitative real-time polymer-se chain reaction. Total RNA was isolated from ho-ogenized tissue using Trizol reagent (Invitrogen, Milan,

taly) according to the manufacturer’s instructions. Oneicrogram of total RNA was used to generate a comple-entary DNA (cDNA) template using a reaction mix

ontaining 4 �L 5X reverse transcriptase buffer, 2 �L p

DN6 50 �mol/L, 2 �L 100 mmol/L dithiothreitol, 0.2L 100 mmol/L dNTP mix, 4 �L 25 mmol/L MgCl2, 1 �LNAsin 20 U/�L, and 200 U MMLV reverse transcriptase

Invitrogen). The total reaction volume was 20 �L. Theixture was incubated at 25°C for 10 minutes and sub-

equently at 42°C for 45 minutes. The reaction wastopped by heating at 99°C for 3 minutes.

Quantitative real-time polymerase chain reactionPCR) was performed for S100B and �-actin on anCycler instrument from Bio-Rad Laboratories (Her-ules, CA) using the Bio-Rad iCycler IQ Real-Time PCRetection System Software (version 3.0A) to acquire and

nalyze data. Amplification of S100B and �-actin frag-ents was performed using the SYBR Green PCR masterix (Bio-Rad Laboratories).21 Primers sequences usedere S100B forward: GTGACTTCCAGGAATTCATGGC,100B reverse: CAGGAAAGGTTTGGCTGCTT; �-actinorward: CGACAGGATGCAGAAGGAGA, �-actin reverse:GTCATACTCCTGCTTGCTG. Reaction conditions wereminutes at 95°C followed by 40 cycles at 95°C for 15

econds, 55°C for 30 seconds, and 72°C for 20 seconds.100B messenger RNA (mRNA) was then normalizedo the respective control �-actin amount. To evaluateeal-time PCR efficiencies, a 10-fold serially dilutedDNA was used for each amplicon, and the slope valuesiven by the instrument were used in the following for-ula: Efficiency � [10(1/slope)] � 1. All primer sets had

fficiencies of 100% (�10%). The comparative thresholdycle method against the expression level of �-actin wassed for quantitation. The data are expressed as fold of

ncrease compared with biopsy specimens cultured inedium alone after normalization to �-actin mRNA.

ach experiment was performed in triplicate.Protein extraction and Western immunoblot

nalysis. Proteins extracted from the homogenized bi-psy specimens (80 �g/lane) were immunoblotted withoth monoclonal anti-S100B (1:1000; AbCam, Cam-ridge, United Kingdom) and antiinducible nitric oxideynthase (iNOS) (1:2000; Pharmingen, Milan, Italy) anti-odies. After incubation with anti-mouse or anti-rabbitgG conjugated to horseradish peroxidase (1:2000; Dako,olstrup, Denmark), immunoreactive bands were visual-

zed by chemiluminescence (ECL�; Amersham, Milan,taly) on x-ray film and densitometrically analyzed with aS-700 imaging densitometer (Bio-Rad Laboratories).

Enzyme-linked immunosorbent assay for100B. Enzyme-linked immunosorbent assay (ELISA)

or S100B was carried out in the tissue supernatants asescribed by Green et al.22 Briefly, 50 �L sample plus0 �L Tris buffer were applied on a microtiter platereviously coated with monoclonal anti-S100B (AbCam)

n carbonate buffer and blocked with 1% bovine serumlbumin. After washing, peroxidase-conjugated anti-S100Dako) diluted 1:1000 was added, and incubation con-inued for 1 hour. The plate was washed, 0.2 mL of

eroxidase substrate (Fast OPD, Sigma) was added and

tTpdp

mle(fpptCpms(nvuP((4Mrn

msScc

otwgamttraSBac

aSmwl

tificcig(

BA

SIC–

ALIM

ENTA

RY

TRA

CT

920 ESPOSITO ET AL GASTROENTEROLOGY Vol. 133, No. 3

he plate incubated for a further 30 minutes in the dark.he absorbance was measured at 450 nm on a microtiterlate reader. S100B levels into the culture medium wereetermined using a standard curve of S100B and ex-ressed as nanogram/milligram protein.

Effects of exogenous S100B on iNOS and p38itogen-activated protein kinase protein expression and

ipid peroxidation. In a second set of experiments, exog-nous purified human S100B protein (0.005–5 �mol/L)23

Sigma) was added to cultured biopsy specimens derivingrom controls: iNOS protein expression and relative NOroduction were evaluated after 24 hours. To check theresence of endotoxin, purity of S100B was assessed byhe Limulus amebocyte lysate Pyrochrome assay (Capeod Inc., Falmouth, MA) according to the previouslyublished method.24 Lipid peroxidation, by measuringalonyldialdehyde levels according to the previously de-

cribed method,25 was evaluated 6 hours after S100B0.005–5 �mol/L) stimulus. In the same samples immu-oblot analysis for phosphorilated-p38 mitogen-acti-ated protein kinase (p-p38 MAPK) was also assessedsing a monoclonal anti-p38 MAPK antibody (1:5000,harmingen). NO production was evaluated after S100B

5 �mol/L) stimulus in the presence or absence of 4-[5-4-Fluorophenyl)-2-[4-(methylsulfonyl)phenyl]-1H-imidazol--yl]pyridine (SB203580 0.03–3 �mol/L) (Sigma), a p38APK selective inhibitor,26 or N-alpha-p-tosyl-L-lysinechlo-

ometyl ketone (TLCK 0.01–1 �mol/L) (Sigma), a selectiveuclear factor (NF)-�B transcription factor inhibitor.27

Effects of gliadin-digest challenge on S100BRNA and protein expression and iNOS protein expres-

ion. To evaluate further the specific involvement of100B in CD and its implications in NO production,hallenge experiments with gliadin were performed onultured biopsy specimens according to reported meth-

ds.28,29 In brief, duodenal biopsy specimens from con-rols and GFD-CD patients were incubated for 24 hoursith a 1 mg/mL peptic-tryptic digest of gliadin (pt-liadin).29 Control experiments were performed by theddition of equal amounts of medium alone. S100BRNA and protein expression were then measured in

issue, and the supernatant was analyzed for S100B pro-ein release. In addition, iNOS protein expression andelative NO production were evaluated in the presence orbsence of mouse monoclonal blocking antibody to100B30 (1:100,000 –1:1000 vol/vol dilution; clone SH-4; AbCam); an IgG anti-glial fibrillary acidic proteinntibody (1:1000 vol/vol dilution; AbCam) served asontrol.

Statistical AnalysisThe Komolgorov-Smirnov test for normality was

pplied and showed the data to be normally distributed.tatistical analysis was thus performed with ANOVA andultiple comparisons with the Bonferroni test. Resultsere expressed as the mean � SD of n experiments. The

evel of statistical significance was fixed at P � .05.

ResultsS100B mRNA and Protein ExpressionIn duodenal mucosal biopsy specimens from con-

rols, immunohistochemistry demonstrated that S100Bmmunopositivity was most readily detectable and con-ned within the submucosa, with only few EGC pro-esses extended into the mucosa (Figure 1A and 1Ai). Inontrast, in CD patients, a stronger and diffuse S100Bmmunoreactivity was present in the submucosa, to-ether with a marked S100B positivity in the mucosaFigure 1B and 1Bi). Interestingly, S100B immunostain-

Figure 1. S100B immunohisto-chemistry in duodenal mucosa. (A)S100B immunoreactivity was mainlydetectable within the submucosa ofcontrol subjects. In GFD-CD and CDpatients (B and C, respectively), astronger S100B immunopositivity waspresent in the submucosa, along witha S100B immunoreactivity in the mu-cosa (original magnification, �100). Incontrols, GFD-CD, and CD-patients(Ai, Bi, and Ci, respectively), the pat-tern of S100B-positive enteric glia isrepresented at high magnification

(�400).

im1

m

7GFCl(

tma

FSpgSeSpri*rEa

FpisUgactsG

BA

SIC–

ALI

MEN

TARY

TRA

CT

September 2007 ENTERIC GLIAL CELLS AND S100B IN CD 921

ng decreased in GFD-CD patients, in whom it wasainly localized in the submucosal glial network (Figure

C and 1Ci).Accordingly, a significant increase of both S100BRNA (24-fold, P � .01) and protein expression (399% �

igure 2. (A) S100B mRNA expression by quantitative real-time PCR.100B mRNA was increased in patients with CD, respect to GFD-CDatients and controls. The fold increases were relative to the controlroup after normalization to �-actin mRNA. Each bar shows the mean �D of 3 experiments, **P � .01. (B) Western blot analysis showing thexpression of S100B protein in controls, CD, and GFD-CD patients. The100B protein expression in tissue homogenates is shown in the upperanel, whereas, the densitometric analysis of corresponding bands isepresented in the graph. Upper panel is representative of n � 3 exper-ments. Each bar in the graph shows the mean � SD of 3 experiments.*P � .01 vs GFD-CD patients and controls. (C) Increase of S100Belease by duodenal biopies from CD vs GFD-CD patients and controls.ach bar shows the mean � SD of 3 experiments. **P � .01 vs controls

nd GFD-CD patients.

%, P � .01) was observed in CD patients compared withFD-CD and controls, respectively (Figure 2A and 2B). Inigure 2C is reported that duodenal biopsy specimens ofD patients were also able to secrete significantly higher

evels of S100B than GFD-CD and controls, respectively641% � 14%, P � .01).

Basal and S100B-Induced iNOS ProteinExpressionIn basal conditions, the expression of iNOS pro-

ein and NO production were increased in the duodenalucosa of CD patients compared with GFD-CD patients

nd controls (2537% � 21% and 247% � 6%, respectively,

igure 3. (A) Western blot analysis showing the expression of iNOSrotein in controls, CD, and GFD-CD patients. iNOS protein expression

n tissue homogenates is shown in the upper panel, whereas the den-itometric analysis of corresponding bands is represented in the graph.pper panel is representative of n � 3 experiments. Each bar in theraph shows the mean � SD of 3 experiments. **P � .01 vs controlsnd GFD-CD patients. (B) NO levels in controls, CD, and GFD-CDultured biopsy specimens. NO production was assessed measuringhe accumulation of nitrite in the culture medium at 24 hours. Each barhows the mean � SD of 6 experiments. **P � .01 vs controls andFD-CD patients.

Figure 4. (A) Western blot analysis showing the effects of exogenousS100B protein (0.005–5 �mol/L) at 24 hours in cultured duodenal bi-opsy specimens derived from controls. iNOS protein expression in tis-sue homogenates is shown in the upper panel, whereas the densito-metric analysis of corresponding bands is represented in the graph.Upper panel is representative of n � 3 experiments. Each bar in thegraph shows the mean � SD of 3 experiments. *P � .05, **P � .01 vsuntreated. (B) Effect of exogenous S100B protein (0.005–5 �mol/L) onNO production in cultured duodenal biopsy specimens derived fromcontrols. NO production was determined by measuring the accumula-tion of nitrite in the culture medium at 24 hours. Each bar shows the

m ean � SD of 6 experiments. *P � .05, **P � .01 vs untreated.

PaSd701a�3[lS

F(otuS6pub3e

F�dcdceb

FSlwpmvecptbemdw

BA

SIC–

ALIM

ENTA

RY

TRA

CT

922 ESPOSITO ET AL GASTROENTEROLOGY Vol. 133, No. 3

� .01; Figure 3). In ex vivo experiments, we found that24-hour incubation of control biopsy specimens with

100B (0.005–5 �mol/L) increased in a concentration-ependent fashion both iNOS protein expression (157% �% [S100B 0.005 �mol/L], P � .05; 743% � 10% [S100B.05 �mol/L], 1149% � 16% [S100B 0.5 �mol/L], and900% � 12% [S100B 5 �mol/L], P � .01) (Figure 4A)nd relative NO production (65.5% � 2.5% [S100B 0.005mol/L], 213.8% � 4.8% [S100B 0.05 �mol/L], P � .05;97.4% � 9% [S100B 0.5 �mol/L] and 749% � 2.6%S100B 5 �mol/L], P � .01) as compared with unstimu-ated biopsy specimens (Figure 4B). Also, incubation with100B (0.005–5 �mol/L) resulted in a concentration-

igure 5. (A) Effect of 6 hours incubation of exogenous S100B protein0.005–5 �mol/L) on malonyldialdehyde levels, as marker of lipid per-xidation, in cultured duodenal biopsy specimens derived from con-rols. Each bar shows the mean � SD of 6 experiments. °°P � .01 vsntreated. (B) Western blot analysis showing the effect exogenous100B protein (0.005–5 �mol/L) on p-p38 MAPK protein expression athours in cultured duodenal biopsy specimens derived from controls.-p38 MAPK protein expression in tissue homogenates is shown in thepper panel, whereas the densitometric analysis of correspondingands is represented in the graph. Upper panel is representative of n �experiments. Each bar in the graph shows the mean � SD of 3

xperiments. *P � .05, **P � .01 vs untreated.

igure 6. Inhibitory effect of p38 MAPK inhibitor SB203580 (0.03–3mol/L) (A) and NF-�B inhibitor TLCK (0.01–1 �mol/L) (B) on the pro-uction of NO induced by exogenous S100B protein (5 �mol/L) inultured duodenal biopsy specimens derived from controls. NO pro-uction was determined by measuring the accumulation of nitrite in theulture medium at 24 hours. Each bar shows the mean � SD of 6xperiments. **P � .01 vs untreated; °°P � .01 vs S100B-treated

iopsy specimens. b

igure 7. (A) S100B mRNA expression by quantitative real-time PCR.100B mRNA was increased at 24 hours in GFD-CD specimens chal-

enged with pt-gliadin (1 mg/mL) but not in controls. S100B mRNA levelsere quantified relative to �-actin levels. No significant differences in ex-ression of the housekeeping gene (�-actin) were found between treat-ent groups. Each bar shows the mean � SD of 3 experiments. **P � .01

s controls and GFD-CD patients. (B) Western blot analysis showing theffect of pt-gliadin (1 mg/mL) on S100B protein expression at 24 hours inultured duodenal biopsy specimens derived from controls and GFD-CDatients. The S100B protein expression in tissue homogenates is shown inhe upper panel, whereas the densitometric analysis of correspondingands is represented in the graph. Upper panel is representative of n � 3xperiments. Each bar in the graph shows the mean � SD of 3 experi-ents. **P � .01 vs untreated. (C) Increased S100B release at 24 hours byuodenal biopsy specimens from controls and GFD-CD patients culturedith pt-gliadin. No effect was observed in control biopsy specimens. Each

ar shows the mean � SD of 3 experiments. **P � .01 vs untreated.

d([a5ae60.s[�.��m�

sewg

Po

iafpass[r[a(avb

sndcptctcc

mtswCaEmr

ncatttvtipot

F(1cipri*m1vbddu

BA

SIC–

ALI

MEN

TARY

TRA

CT

September 2007 ENTERIC GLIAL CELLS AND S100B IN CD 923

ependent increase in malonyldialdehyde production385.7% � 5.5% [S100B 0.005 �mol/L], 836.5% � 9.6%S100B 0.05 �mol/L], 1433% � 16% [S100B 0.5 �mol/L],nd 2693.6% � 20% [S100B 5 �mol/L], P � .01) (FigureA). The lipid peroxidation increase was accompanied byparallel and significant increase in p-p38 MAPK protein

xpression (161% � 8% [S100B 0.005 �mol/L], P � .05;77% � 4% [S100B 0.05 �mol/L], 1561% � 18% [S100B.5 �mol/L], and 3146% � 29% [S100B 5 �mol/L], P �

01) (Figure 5B). The effect of S100B (5 �mol/L) wasignificantly inhibited by SB203580 (29.7% � 4.1%SB203580 0.03 �mol/L], 49.3% � 3.5% [SB203580 0.3mol/L], and 72.6% � 5.8% [SB203580 3 �mol/L], P �

01) and TLCK (49.3% � 4.8% [TLCK 0.01 �mol/L], 66.0%5.1% [TLCK 0.1 �mol/L], and 80.0% � 4.4% [TLCK 1

mol/L], P � .01), both added to cultured biopsy speci-ens deriving from controls, 30 minutes before S100B (5mol/L) challenge (Figure 6A and 6B).

Gliadin-Induced S100B Production and iNOSProtein Expression in GFD-CD BiopsySpecimensA significant increase of S100B mRNA was ob-

erved when GFD-CD cultured biopsy specimens werexposed to pt-gliadin (�35-fold, P � .01), but this effectas not observed in controls (Figure 7A). Similarly, bothliadin-induced S100B protein expression (189.3% � 7.21%,

igure 8. (A) Western blot analysis showing the effect of pt-gliadin1 mg/mL), in the presence or absence of S100B antibody (1:100,000–:1000, vol/vol dilution), on iNOS protein expression at 24 hours inultured duodenal biopsy specimens derived from GFD-CD patients.

NOS protein expression in tissue homogenates is shown in the upperanel, whereas the densitometric analysis of corresponding bands isepresented in the graph. Upper panel is representative of n � 3 exper-ments. Each bar in the graph shows the mean � SD of 3 experiments.*P � .01 vs untreated; °°P � .01 vs untreated. (B) Effect of pt-gliadin (1g/mL), in the presence or absence of S100B antibody (1:100,000–1:000, vol/vol dilution) and glial fibrillary acidic protein antibody (1:1000,ol/vol dilution), on NO production at 24 hours in cultured duodenaliopsy specimens derived from GFD-CD patients. NO production wasetermined by measuring the accumulation of nitrite in the culture me-ium. Each bar shows the mean � SD of 6 experiments. **P �. 01 vs

intreated; °°P � .01 vs untreated.

� .01) and secretion (357.7% � 13%, P � .01) werebserved in GFD-CD patients only (Figure 7B and 7C).

Moreover, challenge with pt-gliadin led to a significantncrease of iNOS protein (1818.6% � 20.2%) expressionnd NO production (1583% � 20%) in biopsy specimensrom GFD-CD patients. Interestingly, these effects wererevented by preincubation with the anti-S100B specificntibody (1:100,000 –1:1000, vol/vol dilution), which re-ulted in a significant inhibition of iNOS protein expres-ion (34.2% � 2.3% [Ab S100B 1:100000], 60.6% � 3.1%Ab S100B 1:10000], and 75.7% �3.5% [Ab S100B 1:1000]espectively, P � .01) and NO production (38.3% � 2.9%Ab S100B 1:100000], 52.0% � 2.8% [Ab S100B 1:10000],nd 80.7% � 5% [Ab S100B 1:1000] respectively, P � .01)Figure 8A–B). Nitrite production was not affected by theddition of glial fibrillary acidic protein antibody (1:1000,ol/vol dilution) before gliadin challenge in GFD-CDiopsy specimens (Figure 8B).

DiscussionThe traditional assumption is that enteric glia

erves as a supportive or nutritive element for entericeurons. Here, we provide evidence that enteric glia isirectly involved in chronic duodenal inflammation oc-urring in CD and that increased S100B mRNA androtein expression are accompanied with both iNOS pro-ein expression and relative NO release. The few dataompelling the role of S100B in the intestine indicatehat this protein is exclusively localized in enteroglialells,12–14 representing a specific marker for the identifi-ation and activation of this cell population.

Several studies demonstrate that, in the brain, S100Bay induce the expression of specific proinflammatory

ranscription factors, such as NF-�B, which promote theynthesis of NO.9 –11 We found that S100B expressionas significantly increased in the duodenal mucosa ofD patients and that the degree of its expression isssociated to the extent of iNOS expression. AlthoughGC hypertrophy has been described during gut inflam-ation,5 our results suggest that S100B plays an active

ole at least in part in NO-dependent inflammation.The administration of exogenous S100B protein to

oninflamed duodenal biopsy specimens deriving fromontrols resulted indeed in both iNOS protein expressionnd NO release, indicating that micromolar concentra-ions of this protein are able to participate to inflamma-ory status even in healthy duodenum. Noteworthy, inhe CNS, S100B has been suggested to act through in-olvement of MAPK9 signaling pathways and NF-�B ac-ivation.10 This is in agreement with our previous find-ngs demonstrating that exogenous S100B-induced iNOSrotein expression and NO production occur throughxidative stress induction and relative p38 MAPK activa-ion in rodent macrophages.31

A growing body of evidence indicates that increased

NOS protein expression and the relative NO levels play

asmseppovt

ricagttgbpts

sbtfaeip

tpcafp

mpesoticspr

1

1

1

1

1

1

1

1

1

1

2

2

2

2

BA

SIC–

ALIM

ENTA

RY

TRA

CT

924 ESPOSITO ET AL GASTROENTEROLOGY Vol. 133, No. 3

role in the etiophatogenesis of CD.32 In the presenttudy, we show that, in the human duodenum, S100B

ediates a significant increase in lipid peroxidation as-ociated with a marked increase in p-p38 MAPK proteinxpression. It is widely known that, in different cell types,38 MAPK phosphorilation induces iNOS protein ex-ression and NO release via NF-�B involvement.33–35 Inur hands, both SB203580 and TLCK, p38 MAPK acti-ation, and NF-�B inhibitors,26,27 respectively, were ableo inhibit S100B-dependent NO production.

Although EGC are part of the very complex immuno-egulatory effectors in the gut,3 their importance in themmune response to immunogenic stimuli is pivotal be-ause these cells establish a strategically first defense linegainst foreign antigens, ie, foods, toxins, invading or-anisms.3 Similarly to their equivalent in the CNS, en-eroglial cells represent a very important cell type becausehey are involved in immune response by acting as anti-en-presenting cells.3 This is in agreement with a growingody of evidence indicating that EGC are a crucial com-onent of the innate, nonspecific mucosal defense sys-em, which regulates the expression of cytokines andeveral immunomodulatory molecules.36

On the basis of these considerations, could the ob-erved S100B up-regulation and relative glial activatione an epiphenomenon of gut chronic inflammatory sta-us, or is S100B a possible cytokine working as “drivingorce” during CD? To answer these questions, we evalu-ted whether pt-gliadin stimulates enteroglial-mediatedxpression of S100B protein and relative NO-dependentnflammation in biopsy specimens deriving from GFD-CDatients.

Gliadin challenge in the biopsy specimens taken fromhese patients demonstrated that (1) S100B mRNA androtein expression and secretion are significantly in-reased by pt-gliadin exposure; and that (2) the specificnti-S100B antibody, added to the biopsy specimens be-ore pt-gliadin challenge, significantly inhibited iNOSrotein expression and NO production.A very intriguing connection between S100B and CDay be highlighted by the observation that an aberrant

roduction of this protein, which is genetically over-xpressed in the trysomic chromosome 21 in Downyndrome,37 may be related to the higher susceptibilityf those patients to also develop CD.38 Although fur-her investigations are needed to understand better thentimate connection between enteric glia and immuneells during chronic duodenal inflammation, our datauggest that EGC, via S100B up-regulation, activelyarticipate in the NO-dependent inflammation occur-ing in CD.

References

1. Giaroni C, De Ponti F, Casentino M, et al. Plasticity in the entericnervous system. Gastroenterology 1999;117:1438–1458.

2. Sariola H, Saarma M. Novel functions and signalling pathways for

GDNF. J Cell Sci 2003;116:3855–3862.

3. Ruhl A, Nasser Y, Sharkey KA. Enteric glia. NeurogastroenterolMotil 2004;16:44–49.

4. Bush TG, Savidge TC, Freeman TC, et al. Fulminant jejuno-ileitisfollowing ablation of enteric glia in adult transgenic mice. Cell1998;93:189–201.

5. Cornet A, Savidge TC, Cabarrocas J, et al. Enterocolitis inducedby autoimmune targeting of enteric glial cells: a possible mech-anism in Crohn’s disease? Proc Natl Acad Sci U S A 2001;98:13306–13311.

6. Haimoto H, Hosoda S, Kato K. Differential distribution of immu-noreactive S100 � and S100 proteins in normal nonnervoushuman tissue. Lab Invest 1987;57:489–498.

7. Zimmer DB, Van Eldik LJ. Tissue distribution of rat S100 � andS100 and S100 binding proteins. Am J Physiol 1987;252:285–9.

8. Van Eldik LJ, Wainwright MS. The Janus face of glial-derivedS100B: beneficial and detrimental functions in the brain. RestorNeurol Neurosci 2003;21:97–108.

9. Goncalves DS, Lenz G, Karl J, et al. Extracellular S100B proteinmodulates ERK in astrocyte cultures. Neuroreport 2000;11:807–809.

0. Lam AG, Koppal T, Akama KT, et al. Mechanism of glial activationby S100B: involvement of the transcription factor NF-B. Neuro-biol Aging 2001;22:765–772.

1. Hu J, Ferreira A, Van Eldik LJ. S100 induces neuronal cell deaththrough nitric oxide release from astrocytes. J Neurochem 1997;69:2294–2301.

2. Rhul A. Glial cells in the gut. Neurogastroenterol Motil 2005;17:777–790.

3. Ferri GL, Probert L, Cocchia D, et al. Evidence for the presence ofS-100 protein in the glial component of the human enteric ner-vous system. Nature 1982;297:409–412.

4. Neunlist M, Aubert P, Bonnaud S, et al. Enteric glia inhibit intes-tinal epithelial cell proliferation partly through a TGF-1-depen-dent pathway. Am J Physiol Gastrointest Liver Physiol 2007;292:231–241.

5. Bronckart Y, Decaestecker C, Nagy N, et al. Development andprogression of malignancy in human colon tissue are correlatedwith expression of specific Ca(2�)-binding S100 protein. HistolHistopatol 2001;16:707–712.

6. Dewar DH, Ciclitira PJ. Clinical features and dignosis of celiacdisease. Gastroenterology 2005;128:19–24.

7. Murray IA, Daniels I, Coupland K, et al. Increased activity andexpression of iNOS in human duodenal enterocytes from patientswith celiac disease. Am J Physiol Gastrointest Liver Physiol2002;283:319–326.

8. Marsh MN, Bjarnason I, Shaw J, et al. Studies of intestinallymphoid tissue. XIV—HLA status, mucosal morphology, perme-ability and epithelial lymphocyte populations in first-degree rela-tives of patients with coeliac disease. Gut 1990;31:111–114.

9. Coeffier M, Miralles-Barrachina O, Le Pessot F, et al. Influence ofglutamine on cytokine production by human gut in vitro. Cytokine2001;13:148–154.

0. Di Rosa M, Radomski M, Carnuccio R, et al. Glucocorticoidsinhibit the induction of nitric oxide synthase in macrophages.Biochem Biophys Res Commun 1990;172:1246–1252.

1. Casabianca A, Orlandi C, Fraternale A, et al. Development of areal-time PCR assay using SYBR Green I for provirus load quan-tification in a murine model of AIDS. J Clin Microbiol 2004;42:4361–4364.

2. Green AJ, Keir G, Thompson EJ. A specific and sensitive ELISA formeasuring S-100b in cerebrospinal fluid. J Immunol Methods1997;205:35–41.

3. Adami C, Bianchi R, Pula G, et al. S100B-stimulated NO produc-tion by BV-2 microglia is independent of RAGE transducing activitybut dependent on RAGE extracellular domain. Biochim Biophys

Acta 2004;1742:169–177.

2

2

2

2

2

2

3

3

3

3

3

3

3

3

3

DcI

a

PGS

BA

SIC–

ALI

MEN

TARY

TRA

CT

September 2007 ENTERIC GLIAL CELLS AND S100B IN CD 925

4. Lindsay GK, Roslansky PF, Novitsky T. Single-step, chromogeniclimulus amebocyte assay for endotoxin. J Clinic Microbiol 1989;27:947–951.

5. Mihara M, Uchiyama M. Determination of malonaldehyde precur-sor in tissue by thiobarbituric acid test. Anal Biochem 1978;86:271–278.

6. Cuenda A, Rouse J, Doza YN, et al. SB 203580 is a specificinhibitor of a MAP kinase homologue, which is stimulated bycellular stresses and interleukin-1. FEBS Lett 1995;364:229–233.

7. Kim H, Lee HS, Chang KT, et al. Chloromethyl ketones blockinduction of nitric oxide synthase in murine macrophages bypreventing activation of nuclear factor-B. J Immunol 1995;154:4741–4748.

8. Maiuri L, Ciacci C, Ricciardelli I, et al. Association between innateresponse to gliadin and activation of pathogenic T cells in coeliacdisease. Lancet 2003;362:30–37.

9. De Ritis G, Occorsio P, Auricchio S, et al. Toxicity of wheat flourproteins and protein-derived peptides for in vitro developing in-testine from rat fetus. Pediatr Res 1979;13:1255–1261.

0. Eriksen JL, Druse MJ. Astrocyte-mediated trophic support of de-veloping serotonin neurons: effects of ethanol, buspirone, andS100B. Brain Res Dev Brain Res 2001;131:9–15.

1. Esposito G, De Filippis D, Cirillo C, et al. Astroglial-derived S100protein stimulates the expression of nitric oxide synthase inrodent macrophages through p38 MAP kinase activation. Life Sci2006;78:2707–2715.

2. Daniels I, Cavill D, Murray IA, et al. Elevated expression of iNOSmRNA and protein in celiac disease. Clin Chim Acta 2005;356:134–142.

3. Kao SJ, Lei HC, Kuo CT, et al. Lipoteichoic acid induces nuclear

factor-B activation and nitric oxide synthase expression via i

phosphatidylinositol 3-kinase, Akt, and p38 MAPK in RAW 264.7macrophages. Immunology 2005;115:366–374.

4. Vega-Ostertag M, Casper K, Swerlick R, et al. Involvement ofp38 MAPK in the up-regulation of tissue factor on endothelialcells by antiphospholipid antibodies. Arthritis Rheum 2005;52:1545–1554.

5. Guikema BJ, Ginnan R, Singer HA, et al. Catalase potentiatesinterleukin-1-induced expression of nitric oxide synthase in ratvascular smooth muscle cells. Free Radic Biol Med 2005;38:597–605.

6. Wood JD. Enteric neuroimmunophysiology and pathophysiology.Gastroenterology 2004;127:635–657.

7. Griffin WS, Stanley LC, Ling C, et al. Brain interleukin 1 and S-100immunoreactivity are elevated in Down syndrome and Alzheimerdisease. Proc Natl Acad Sci U S A 1989;86:7611–7615.

8. Gale L, Wimalaratna H, Brotodiharjo A, et al. Down’s syndromeis strongly associated with celiac disease. Gut 1997;40:492–496.

Received February 16, 2006. Accepted May 31, 2007.Address requests for reprints to: Rosario Cuomo, MD, Professor,

epartment of Clinical and Experimental Medicine, Gastroenterologi-al Unit, University Federico II, Via Sergio Pansini 5, 80131 Naples,taly. e-mail: rcuomo@unina.it; fax: (39) 0817463892.

Supported by research funds from the Italian Ministry of Universitynd Research (COFIN Projects No. 2004062155 to G.S. and R.C.).The authors thank Dr Pietro Micheli and Dr Pasquale Somma, of the

athologic Anatomy and Histology Service of “Domenico Cotugno”eneral Hospital, for their contribution to this work and Dr Rosannacala for helping with the preparation of the manuscript.Conflict of interest: All authors disclose that there is no conflict of

nterest.