Engineering a compact non-native state of intestinal fatty acid-binding protein

Engineering a compact non-native state of intestinal fattyacid-binding protein

Eugenia M. Clerico a, Sergio G. Peisajovich a, Marcelo Ceol|n b,Pablo D. Ghiringhelli a, Mario R. Ermacora a;*

a Departamento de Ciencia y Tecnolog|a, Universidad Nacional de Quilmes, Argentina, Roque Saenz Pen¬a 180, (1876) Bernal, Argentinab Departamento de F|sica, Facultad de Ciencias Exactas, Universidad Nacional de La Plata, C.C.67 (1900) La Plata, Argentina

Received 19 October 1999; accepted 29 November 1999

Abstract

The last three C-terminal residues (129^131) of intestinal fatty acid-binding protein (IFABP) participate in four main-chain hydrogen bonds and two electrostatic interactions to sequentially distant backbone and side-chain atoms. To assess ifthese interactions are involved in the final adjustment of the tertiary structure during folding, we engineered an IFABPvariant truncated at residue 128. An additional mutation, Trp-6CPhe, was introduced to simplify the conformationalanalysis by optical methods. Although the changes were limited to a small region of the protein surface, they resulted in anIFABP with altered secondary and tertiary structure. Truncated IFABP retains some cooperativity, is monomeric, highlycompact, and has the molecular dimensions and shape of the native protein. Our results indicated that residues 129^131 arepart of a crucial conformational determinant in which several long-range interactions, essential for the acquisition of thenative state, are established. This work suggests that carefully controlled truncation can populate equilibrium non-nativestates under physiological conditions. These non-native states hold a great promise as experimental models for proteinfolding. ß 2000 Elsevier Science B.V. All rights reserved.

Keywords: Fatty acid-binding protein; Protein folding; Protein engineering; Folding intermediate; Fluorescence; Fourth-derivativespectroscopy

1. Introduction

Although the mechanistic aspects of the processremain largely unknown, a new view of protein fold-

ing has emerged which contemplates the conforma-tional £ow of ensembles rather than conformationalchanges in speci¢c structures [1]. In the new view, alarge number of conformational trajectories, in afunnel-shaped energy landscape, progressively leadto fewer and more compact pre-native states. Mostdownhill trajectories (i.e. those that reduce energyand entropy) are productive and place folding mole-cules closer to the unique native conformation, thestate with the lowest free energy. Multiple concurrenttrajectories should make folding possible in secondsor less as observed experimentally.

As part of an e¡ort to ¢nd suitable models for

0167-4838 / 00 / $ ^ see front matter ß 2000 Elsevier Science B.V. All rights reserved.PII: S 0 1 6 7 - 4 8 3 8 ( 9 9 ) 0 0 2 4 7 - 2

Abbreviations: IFABP, intestinal fatty acid binding protein;GuHCl, guanidinium chloride; SEC, size exclusion chromatogra-phy; IEC, ionic exchange chromatography; CD, circular dichro-ism; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gelelectrophoresis ; ANS, 1-anilinonaphthalene-8-sulfonate; SAXS,small angle X-ray scattering; WT, wild-type

* Corresponding author. Fax: +54-114-365-7132;E-mail : [email protected]

BBAPRO 36047 27-1-00 Cyaan Magenta Geel Zwart

Biochimica et Biophysica Acta 1476 (2000) 203^218www.elsevier.com/locate/bba

non-native states at equilibrium, we sought to engi-neer protein variants that stop their progress in thefolding funnel before native structure formation.This work was prompted by the idea that rigid ter-tiary structure and tight packing can be preferentiallydestabilized by disrupting speci¢c tertiary interac-tions without signi¢cantly a¡ecting the overall foldof the protein backbone. This notion has a growingexperimental support, and a few examples will bebrie£y reviewed here.

A speci¢c side chain contact between helices B andG of myoglobin was purposefully disrupted by site-directed mutagenesis to stabilize a non-native state atequilibrium [2]. In this non-native state, generallynamed `molten globule', A, G, and H helices adopteda native-like overall fold, but without discernible¢xed tertiary interactions [3]. Later, a kinetic foldingintermediate of myoglobin was found to have struc-tural features similar to those described for the equi-librium molten globule [4].

Peng and Kim [5] removed the entire L-domainfrom K-lactalbumin; without L-domain contacts,the lone K-domain folded into a monomeric moltenglobule with overall native topology but lacking tight¢xed packing.

Shortle and Meeker [6] discovered that C-terminaltruncation of staphylococcal nuclease produces anequilibrium compact non-native state that retains afraction of the native secondary structure. The de-gree of compactness, as well as the K-helix content,can be modulated by changing the number of resi-dues deleted. Ca2� and pdTp, two nuclease ligands,shift the equilibrium toward the native state [7].Chemical cleavage mapping of truncated nucleasedemonstrated an overall backbone native fold inthe context of a slightly expanded structure [8].

Prat Gay et al. [9] explored methodically the con-formational e¡ect of removing C-terminal residuesfrom the 64-residue protein chymotrypsin inhibitor-2. They found that the structural hierarchy appearedat discrete chain lengths: fragments up to 40 residueswere unstructured, adding residues from 40 to 53resulted in hydrophobic collapse and secondarystructure formation, fragments larger than 53 resi-dues displayed some speci¢c tertiary interactions,and full cooperative folding required the additionof residues 63 and 64.

The above examples, selected from a larger body

of concurrent evidence, suggest that truncation mightbe used to populate non-native states in physiologi-cal solvents. Truncation, as opposed to residue re-placement, should not introduce new Van der Waalscontacts, and chain termini ^ due to a striking fea-ture of native proteins ^ are usually localized on theprotein surface [10], alleviating the need to considerextensive packing e¡ects.

We chose fatty acid-binding protein (IFABP) forour ¢rst attempt to stabilize a non-native state bytruncation. It is a 131-residue, predominantly L-pro-tein that belongs to the lipid binding protein family[11]. This family comprises intracellular and extracel-lular proteins that store, transport and increase thesolubility of hydrophobic compounds. The moleculararchitecture distinctive of the family features a L-bar-rel topology and a large central cavity that containsthe ligand binding site.

In IFABP, the L-barrel is formed by two, nearlyorthogonal, ¢ve-stranded L-sheets that limit the cen-tral cavity (Fig. 1). The bottom of the L-barrel isclosed by a twist in the sheets and the top is gatedby a short helix-turn-helix motif thought to controlligand accessibility to the large (850 Aî 3) and mostlysolvent-inaccessible internal cavity [12,13]. A delicatenet of polar and charged side chains, involved in saltbridges and hydrogen bonds, lines the cavity, whichin the apoprotein is mostly occupied by orderedwater. The protein also features a non-conventionalhorseshoe-shaped hydrophobic core that encloses thecentral cavity. IFABP is an excellent model for fold-ing studies because it is monomeric and lacks pro-lines and cysteines that may complicate the process.

After examination of IFABP X-ray structure, weformulated the hypothesis that the last few residuesof this protein are key determinants for late foldingevents. The two L-sheets of IFABP are adhered toeach other by van der Waals interactions with twomain exceptions: strand LF closes the bottom of theL-barrel with hydrogen bonds (to the adjacentstrands LE and LG) and residues 129^131 close thetop with hydrogen bonds and two side-chain saltbridges. These tertiary connections of residues 129^131 are depicted schematically in Fig. 1d. We rea-soned that removing these three residues wouldopen the barrel, set the two sheets free to slideagainst each other, and allow free rotation of side-chains at the internal interface. Since the last three


E.M. Clerico et al. / Biochimica et Biophysica Acta 1476 (2000) 203^218204

residues have charged side chains, their removalwould probably not interfere with the hydrophobiccollapse of the molecule.

Trp-6 is located beneath the last three C-terminalresidues (Fig. 1a), and the truncation per se wouldhave altered its £uorescence. To make easier thestudy by optical means, the truncated form ofIFABP prepared was W6F IFABP1ÿ128, in whichTrp-82 is the single £uorescence emitter. The full-length mutant W6F IFABP1ÿ131 was also preparedto assess the conformational impact of Trp-6 substi-tution.

The controlled truncation produced a monomericand compact non-native state of IFABP with alteredsecondary and tertiary structure, allowing the identi-¢cation of a C-terminal segment as a crucial deter-minant for folding. Although the generality of our¢ndings remains to be established, we provided anew example of C-terminal truncation leading to asevere e¡ect on the folding reaction. This e¡ect ap-parently consists of the dissociation of two informa-tional levels embedded in the folding code: one di-recting the formation of compact states and the otherdirecting the ¢ne adjustment of tertiary interactionsthat leads to the rigid and unique native state.

2. Materials and methods

2.1. General details

Solutions of GuHCl were standardized as de-scribed [14]. Urea solutions were treated with amixed bead resin, BioRex (Bio-Rad, Hercules, CA)before use. Electrospray mass spectra were acquiredon a VG Quatro II (VG Biotech, Altrinchan, UK)triple-quadrupole instrument with an electrosprayionization source. Unless otherwise indicated, puri-¢ed IFABP variants were dissolved in 0.1 M sodiumphosphate, pH 7.0. Molar extinction coe¤cients at280 nm for each IFABP variant in the denaturedstate were calculated as described [15]. The corre-sponding values for native IFABP variants were cal-culated comparing the absorbance of solutions pre-pared by adding the same amount of protein to equalvolumes of bu¡er with or without 4.0 M GuHCl.Fitting of experimental data to equations was doneusing Kaleidagraph (Synergy Software, Reading,

PA). Unfolding data were ¢tted to two- and three-state process [16] [17]. Proteolysis was performed us-ing a 1:250 trypsin:IFABP weight ratio for 45 min at25³C (selective digestion) or 24 h at 37³C (completedigestion). Molecular graphics were prepared usingMIDAS [18].

2.2. Production of WT IFABP, W6F IFABP1ÿ131,and W6F IFABP1ÿ128 variants

The WT IFABP gene cloned into pET-11a (Nova-gen, Madison, WI) was kindly provided by AlanKleinfeld [19]. Truncations and amino acid substitu-tions were done by site-speci¢c PCR mutagenesis andPCR combinations of overlapping fragments [20].The external sense primer matched the T7 promoterfrom pET-11a. To prepare the full-length variant theexternal reverse primer matched the last 22 bases ofthe wild-type gene and had a 3P extension with aBamHI site. To prepare the variant truncated at ami-no acid 128, the external reverse primer was: ccta-gaattcttaaaagatccgcttggcctcca. The stop codon isunderlined. Phe-6 was introduced by the followingtwo primers: (a) gatggcactttcaaagtagaccg; and (b)gtctactttgaaagtgccatcaa (the mutagenic codons areunderlined). PCR products were cloned intopGEM-T (Promega, Madison, WI). pET-11a andpGEM-T with the wild-type and variant genes,respectively, were used to transform E. coliBL21(DE3), and a screening for protein expressionwas performed by SDS-PAGE. The variants clonedin pGEM-T showed high level of constitutive expres-sion and IPTG induction was unnecessary, whereasWT IFABP required 1 mM IPTG for optimal induc-tion. The primary structure of IFABP variants wascon¢rmed by DNA sequencing and mass spectrome-try analysis of the expressed products.

2.3. Protein puri¢cation

The puri¢cation was performed at 4³C. E. coli cellsexpressing each IFABP variant were grown at 37³Cto OD600 = 1^2 and harvested by centrifugation. WTIFABP was harvested after an extra 3-h inductionwith 1 mM IPTG. The cell pellet (8^10 g) was mixedwith 2.5 vols. of 10 M urea, 10 mM NaCl, 10 mMTris-HCl, 5 mM DTT, pH 9.2 and stirred for 30 min.The resulting solution was centrifuged 30 min at


E.M. Clerico et al. / Biochimica et Biophysica Acta 1476 (2000) 203^218 205

Fig. 1. Intramolecular interactions of residues 129^131 of IFABP. (a) Full-length IFABP with residues 129^131 shown in red and W6in yellow. (b) IFABP truncated at residue 128. (c) Ribbon structure of IFABP showing the orientation of side chains 129^131 andtheir contacts to sequentially distant L-strands. (d) Diagram of the hydrogen bonds and salt bridges disrupted by truncation in W6FIFABP1ÿ128.



14 000 rpm, and the supernatant was diluted withone volume of 6.7 M urea, 100 mM Tris-aceticacid, pH 9.2 and loaded into a 2.5U10-cm FastFlow Q-Sepharose column (Pharmacia, Upsala, Swe-den) equilibrated with the same bu¡er. Elution wasperformed with a 100-ml linear gradient between theequilibration bu¡er and 6.7 M urea, 100 mM aceticacid, adjusted to pH 4.0 with Tris. Fractions contain-ing IFABP were pooled and mixed with 8 ml of FastFlow S-Sepharose previously equilibrated with pH4.0 bu¡er. The pH of the mixture was adjusted to4.0 with acetic acid and the protein was allowed tobind to the matrix (1 h). The resulting slurry waspacked into a 1.5U5.0-cm column and washed with6.7 M urea, 10% glycerol, 25 mM sodium phosphate,pH 4. The column was eluted with 6.7 M urea, 10%glycerol, 25 mM sodium phosphate, pH 8.5. Frac-tions containing IFABP were pooled and extensivelydialyzed against 50 mM sodium phosphate, 10%glycerol, pH 7.8. WT IFABP and W6F IFABP1ÿ131

were recovered soluble at high concentrations andafter a 30-min centrifugation at 20 000 rpm werebrought to 50% glycerol and stored at 320³C untiluse. W6F IFABP1ÿ128 was less soluble and precipi-tated above about 2 mg/ml. The precipitate was sep-arated by a 30-min centrifugation at 20 000 rpm andthe supernatant was handled as above. All proteinvariants were more than 95% pure as judged bySDS-PAGE analysis.

2.4. ANS binding

ANS binding to IFABP was monitored at 22³C bymeasuring the enhancement of £uorescence emissionat 480 nm upon excitation at 350 nm [21]. The ex-citation and emission band-pass were 8 and 4 nm,respectively. Stock solutions of ANS were freshlyprepared in 0.1 M sodium phosphate, pH 7.0, andthe dye concentration was established by UV absorp-tion at 350 nm (O= 4950 cm31 M31 ; [22]). Full-length variants were assayed at 6 WM concentration.The concentration of W6F IFABP1ÿ128 was 17 WM.ANS was added incrementally to the stirred cuvetteand allowed to equilibrate for 2^3 min after eachaddition. The entire spectrum from 400 to 600 nmwas recorded for each concentration point. Bounddye showed a strong emission maximum at 480 nm.At this wavelength the contribution of the free dye

£uorescence was negligible in the range tested (freeANS in water exhibited a much weaker emissioncentered at 550 nm). The readings at 480 nm weretabulated and the binding parameters of the interac-tion calculated as described by Johnson and Frazier[23]. A single binding site was assumed [21].

2.5. Size exclusion chromatography

Experiments were carried out at 22³C with anFPLC system (Pharmacia), an UV detector set at280 or 220 nm and a Superose 12 column equilibrat-ed with 0.1 M sodium phosphate, pH 7.0 and di¡er-ent GuHCl concentrations. Stokes radii (RS) werecalculated from a calibration curve of standard pro-teins according to [24].

2.6. Small angle X-ray scattering

Measurements were carried out at the LaboratorioNacional de Luz Sincroton, Campinas, Brazil(1.37 GeV, 60^100 mA, D11A-SAXS line). Thewavelength used was 1.68 Aî and the sample todetector distance was set to 614 mm. The 1-D-PSDdetector had 8.0 cm active length. Data werecorrected for sample absorption, and for beam inten-sity.

2.7. CD spectroscopy

CD spectra were obtained at 22³C using an AvivDS-62 spectropolarimeter (Lakewood, NJ). Sampleswere in 5 mM sodium phosphate, 100 mM potassium£uoride, pH 7.0, with or without 4.0 M GuHCl.Under non-denaturing conditions, protein concentra-tion was 30.6, 42.2, 9.7 WM for WT IFABP, W6FIFABP1ÿ131, and W6F IFABP1ÿ128, respectively. In4.0 M GuHCl, W6F IFABP1ÿ128 was 191.3 WM.Data were collected every 1.0 nm over 1-s intervalswith a 1.5-nm bandwidth. Ten scans were averagedfor each sample, and the blank-subtracted averagespectra were smoothed using a second-order Sa-vitzky^Golay polynomial ¢lter and a 10-point, sym-metric sliding window [25]. Secondary structure cal-culations were performed with the suite of programsCD-Structure provided by S.Y. Venyaminov [26] andwith the programs described in the review by N.J.Green¢eld [27].



2.8. Fluorescence measurement

IFABP variants were unfolded in GuHCl andequal volumes were added to a series of tubes withincreasing GuHCl concentrations as to yield 1^2 WMprotein in 0.05^4.9 M GuHCl. After equilibration(2^3 h), a complete series of spectra (from 300 to420 nm at 1-nm intervals and 8-nm band-pass) foreach protein variant was acquired with a ISS SLM-4800 or a K2 ISS instruments (ISS, Champaign, IL)in the ratio mode. Excitation was at 290 nm (4-nmband-pass). A standard tryptophan solution of ex-actly known concentration was prepared in 4.9 MGuHCl and measured in parallel to the WT IFABPunfolding curve. WT IFABP in 4.9 M GuHClyielded a £uorescence spectrum indistinguishable inshape and intensity from the spectrum of an equimo-lecular concentration of free tryptophan. Therefore,all IFABP samples were considered completely un-folded in 4.9 M GuHCl, and the intensity of theunfolded spectra was used to normalize each series(emission at 355 nm = 1.0 arbitrary unit of £uores-cence intensity per tryptophan residue in the un-folded spectrum). In this way, relative £uorescenceintensities of each variant at all wavelengths andGuHCl concentrations could be directly compared.

2.9. Fourth-derivative spectroscopy

Absorption spectra (240^340 nm, 0.1-nm samplinginterval, 1.6 nm/s) were obtained with a ShimadzuUV160A spectrophotometer (Tokyo, Japan) andsaved as ASCII ¢les. The instrument executes anautocalibration routine at each time that is turnedon. According to the manufacturer, the wavelengthreproducibility of the instrument is 0.1 nm or better.Benzene vapor spectra were taken periodically tocheck the instrument performance and calibration.Twenty spectra for each sample were averaged, blanksubtracted, and scaled to the corresponding molarextinction coe¤cient (determined as describedabove). A smoothing routine was applied to thedata by using a Savizky-Golay ¢lter with a 4th de-gree polynomial and a 30-point moving window cen-tered at the calculated value [25]. Two or more in-dependent (di¡erent days) measurements were madefor each variant. Preliminary smoothing with di¡er-ent windows and polynomials of di¡erent degree in-

dicated that the chosen routine allowed good peakresolution with negligible shape distortion. The 4thderivative spectra were calculated applying twosuccessive cycles of 2nd order derivation, v2A/vV2 = (Ai�2032Ai+Ai320)/2vV2, as described [14].Since data were evenly spaced at 0.1-nm intervals,vV was 1.0 nm. Programs in C language were writtento perform data averaging, smoothing and derivativecalculations.

3. Results

3.1. Protein expression and puri¢cation

WT IFABP, W6F IFABP1ÿ131 and W6FIFABP1ÿ128 were overexpressed in E. coli. WTIFABP fractionated soluble in the cytoplasm, W6FIFABP1ÿ128 appeared almost exclusively in inclusionbodies, and W6F IFABP1ÿ131 was found equally dis-tributed between the two fractions (not shown). Torender soluble and purify the three IFABP variants,a single protocol was devised that included 6.7 Murea in the lysis and chromatographic bu¡ers. Afterpuri¢cation, the IFABPs were refolded by exchangeand dilution into a non-denaturing bu¡er, underconditions that maximize the yield of soluble mono-meric proteins. By ESI-MS, the puri¢ed variants hadthe expected mass within 1 Da.

3.2. Binding studies

ANS binds to IFABP with a 1:1 stoichiometry,and the large resulting enhancement of ANS £uores-cence quantum yield can be conveniently exploited tomeasure the a¤nity of the binding site [21]. In addi-tion, the higher solubility of the dye in water allowsto titrate IFABP at ligand concentrations well abovethe critical micelle concentration of long-chain fattyacids, which is essential to measure binding to siteswith decreased a¤nity. As shown in Fig. 2, WTIFABP and W6F IFABP1ÿ131 showed, within exper-imental error, identical saturation curves, with ap-parent dissociation constants (Kd) of 0.99 and 0.77WM, respectively. These values compare with the low-est values reported by Kirk et al. for WT IFABP[28], indicating that the W6CF replacement doesnot signi¢cantly disturb the native IFABP conforma-



tion. W6F IFABP1ÿ128 bound ANS with Kd = 41.4WM (Fig. 2), which is too high to be safely assignedto the binding to the native-like IFABP lipid bindingsite. Many native and non-native proteins bind non-speci¢cally ANS at surface crevices, hydrophobicclefts or molten cores with Kd values in the 20^200WM range (for a recent list see [29]).

3.3. Aggregation state compactness and molecularshape

A preliminary assessment of backbone £exibilityand packing was performed by incubation withtraces of trypsin [30]. SDS-PAGE of the digestsshowed that W6F IFABP1ÿ128 was readily degradedto short peptides, whereas WT IFABP and W6FIFABP1ÿ131 were completely resistant (not shown).The increased susceptibility to proteolytic attackand the tendency to form inclusion bodies mentionedabove gave the ¢rst evidence of a defective fold forW6F IFABP1ÿ128.

The aggregation state and hydrodynamic behaviorof the IFABP variants were investigated by size ex-clusion chromatography (SEC). Under non-denatur-ing conditions, wild-type, W6F IFABP1ÿ131 andW6F IFABP1ÿ128 displayed, within experimental er-ror, very similar chromatographic pro¢les, consistentwith monomeric and monodisperse proteins. TheStokes radii (RS) ranged between 19.7 and 20.6 Aî

(Table 1), as determined from the corresponding elu-tion volumes and a calibration curve made withstandard proteins. The calculated RS of a sphericalnative protein with the size of IFABP is 19.35 Aî [24].The small discrepancy between the experimental and

the calculated RS can be accounted for by the asym-metric shape of IFABP.

The size and shape of these variants were furtherexamined by small angle X-ray scattering (SAXS).W6F IFABP1ÿ128 was studied at 2 mg/ml becauseat higher concentrations there was visible aggrega-tion. Although 2 mg/ml was close to the limit ofthe instrument sensitivity and a moderate curvatureof the Guinier plot at low Q values evidenced thepresence of some dimeric and aggregated forms, thedata could be ¢t to a straight line down to Q = 0.1Aî 31. This allowed unambiguous calculations of theRS of the monomer. For all variants, the results were

Fig. 2. Binding of ANS to IFABP variants. Wild-type (6 WM;¢lled circles), W6F IFABP1ÿ131 (6 WM; empty circles), andW6F IFABP1ÿ128 (17 WM; squares) were incubated in the pres-ence of ANS and the £uorescence emission recorded as de-scribed in Section 2. To calculate e, the fraction of IFABPmolecules carrying the ligand, a single binding site was assumed[21].

Table 1Size and shape of IFABP variantsa

IFABP RS RG a b = c a/b

W6F1ÿ131 20.6 þ 0.1 15 þ 1 15.7 20.9 1.33W6F1ÿ128 19.7 þ 0.2 17 þ 2 17.4 23.8 1.37WT 20.6 þ 0.1 14.2 þ 0.8 15.0 19.8 1.32WT (unfolded) 36.4 þ 0.4 ^ ^ ^ ^aRS was determined by SEC (see Section 2). RG was calculated from Guinier's plots of small angle X-ray scattered intensities (notshown). The best geometric model consistent with the data was an oblate ellipsoid of revolution with the a, b, and c axes given. Unitsare Aî . Unfolded WT IFABP was analyzed in 8 M GuHCl. Standard deviations are given. Theoretical values of RS (calculated fromcalibration curves, [24]), RG, and axes (calculated from crystallographic coordinates) deviated less than 7% from the experimental re-sults.



compatible with molecules shaped as oblate ellip-soids of revolution. Within experimental error, full-length IFABP variants showed volumes and axes ingood agreement with the corresponding crystallo-graphic parameters (Table 1). From this low-resolu-tion analysis, it can be concluded that W6FIFABP1ÿ131 is indistinguishable in size and shapefrom WT IFABP. On the other hand, W6FIFABP1ÿ128 may be slightly expanded, although thedi¡erence with WT IFABP is too small to be consid-ered conclusive. The overall shape of the three var-iants seems to be the same.

3.4. Circular dichroism analysis

The CD spectrum of WT IFABP (Fig. 3A) exhib-ited the maximum at 198^200 nm and the minimumnear 215 nm typical of L-proteins [26,31], and itsshape and intensity agreed with previously publishedIFABP data [32]. W6F IFABP1ÿ131 showed the samepeaks, but with a moderately decreased intensity.Considering that absorption bands from aromaticresidues can have strong in£uence on the intensityof the far-UV CD signal [33,34], this decrease ismost likely attributable to the lower Trp content.

Much more important changes in the CD tracewere observed for W6F IFABP1ÿ128 : the intensityat 200 nm was close to zero, a moderately positivedichroic signal appeared at about 196 nm, and the216 nm negative band was broadened and blueshifted. These changes were not the result of fullunfolding as shown by comparison with the CDtrace of the GuHCl denatured protein (Fig. 3A).The far-UV CD spectrum of W6F IFABP1ÿ128 seemsneither compatible with a signi¢cant persistence ofthe native L-structure nor with an increased K-helixcontent. Higher K-helix content should have ap-peared as a larger positive signal at 190^200 nmand a more negative signal at 208^220 nm, respec-tively.

The W6F IFABP1ÿ128 spectrum could not beproperly ¢tted to a linear combination of the W6FIFABP1ÿ131 and GuHCl-unfolded W6F IFABP1ÿ128

spectra. Therefore, we attempted to estimate the sec-ondary structure using a variety of methods de-scribed in the literature that assume a linear combi-nation of the spectra from pure secondary structureelements. These methods di¡er in the way they esti-

mate the combination and in the basis spectra thatare used in the ¢tting. A comprehensive descriptionof the methods, their underlying principles and per-formance can be found in recent reviews [26,27]. TheCD data of IFABP were analyzed by constrainedmultilinear regression using the programs LIN-COMB, GpF, and CDESTIMATE [35^37], convexconstant algorithm [35], ridge regression [38], varia-ble selection [39], variable selection-self-consistent[40], and neural nets using the programs NN andK2 [41,42]. Most of the above methods estimatedthe L-structure content of WT IFABP between 20^40%. Since IFABP has 73% of its residues involvedin antiparallel L-strands [12], this result constitutes asevere underestimation. It has been shown beforethat these programs vary greatly in their ability to

Fig. 3. CD spectra of IFABP variants. (A) Far UV. (B) Aro-matic region. 9, WT IFABP; - - -, W6F IFABP1ÿ131 ; WWWWWW,W6F IFABP1ÿ128 ; 9-9, W6F IFABP1ÿ128 in 4 M GuHCl.Raw data were smoothed by one convolution with a second-de-gree polynomial and a ten-point sliding window.



predict L-structure and that they perform better onpredominantly helical proteins [27]. The subsequentanalysis of the IFABP variants was performed onlywith the three methods that predicted reasonablywell the total L content of WT IFABP. These pro-grams were LINCOMB and G pF (limited to threevariables (K, L, and random) and the convex con-straint algorithm. On average, these three methodspredicted 70, 63, and 53% L-structure for WTIFABP, W6F IFABP1ÿ131 and W6F IFABP1ÿ128 re-spectively. However, visual inspection of the ¢ttedand experimental spectra (not shown) evidenced amoderated agreement in shape, but with signi¢cantdeviations in intensity and position of the peaks. Forthis reason, we believe that these results should beconsidered only as qualitative evidence that W6FIFABP1ÿ128 has altered or signi¢cantly reduced sec-ondary structure compared with WT IFABP.

On the other hand, the overall features of the W6FIFABP1ÿ128 spectrum are reminiscent of those fromsome spectra of partially folded proteins at equilib-rium, in which the signal at 200 nm is signi¢cantlydiminished [43,44]. Most interestingly, the spectrumof W6F IFABP1ÿ128 is similar to that from an earlykinetic folding intermediate of the cellular retinoicacid binding protein I, another member of the lipidbinding protein family with the IFABP L-clam fold[34].

Near-UV CD spectra of IFABPs are shown in Fig.3B. The wild-type spectrum was in general agree-ment, in shape and intensity, with previously pub-lished data [32,45]. A direct comparison betweenwild-type and mutants IFABPs was not feasible giv-en the di¡erences in tryptophan content. Therefore,the comparison was limited to the two single-Trpvariants. Two broad CD bands, with opposite signs,centered at 262 and 286 nm in the W6F IFABP1ÿ131

spectrum, were replaced by a complex negative bandcentered at 280 nm in the spectrum of W6FIFABP1ÿ128, suggesting a signi¢cant change in thetertiary structure of the truncated variant.

3.5. Fluorescence studies

As judged from the crystallographic model, theenvironment of Trp-82, deeply buried and sur-rounded by Phe and other non-polar side chains,should be strongly hydrophobic. However, the ob-

served Stokes shifts of WT IFABP and W6FIFABP1ÿ131 (mass center of the emission at 340and 341.7 nm, respectively, Fig. 4A) were somewhatlarger than the expected for such hydrophobic envi-ronment. The red shift suggests that a native contactis perturbing the emission. The e¡ect may be causedby Arg-106, a buried charge at 4 Aî of the Trp-82ring in the crystallographic model. Judging from thebluer maximum (mass center at 336.1 nm) of W6FIFABP1ÿ128, the truncation eliminated the perturbinginteraction (or reorganized the hydrophobic cluster

Fig. 4. Fluorescence spectra of IFABP variants. (A) 9, WTIFABP; - - -, W6F IFABP1ÿ131 ; WWWWWW, W6F IFABP1ÿ128 ; -WWW-,WT IFABP in 4.9 M GuHCl; 9-9, W6F IFABP1ÿ128 in 4.9M GuHCl. (B) Comparison between the W6F IFABP1ÿ128 £uo-rescence spectrum and representative spectra recorded along theGuHCl-induced unfolding transition of W6F IFABP1ÿ131.Squares, W6F IFABP1ÿ128 ; circles, W6F IFABP1ÿ131 ; triangles,W6F IFABP1ÿ131 in 4.9 M GuHCl; spectra of W6FIFABP1ÿ131 at the indicated molar GuHCl are labeled. Excita-tion was at 290 nm with a 4-nm band-pass. Spectra were nor-malized for protein concentration.



that surrounds Trp-82) yielding a Stokes shift char-acteristic of buried tryptophans (Fig. 4A). Concom-itantly, the W6F IFABP1ÿ128 emission peak was sig-ni¢cantly broadened (V4 nm wider at half-heightcompared with the peak from W6F IFABP1ÿ131),which is indicative of signi¢cant conformational het-erogeneity. Thus, based on the £uorescence results,W6F IFABP1ÿ128 is far from the unfolded state andclearly in one or more compact non-native confor-mations able to shield Trp-82 from the solvent.

To assess if a mixture of native and unfolded mol-ecules (or an equilibrium intermediate in the foldingpathway) could produce the £uorescence spectrum ofW6F IFABP1ÿ128, we examined the spectra of W6FIFABP1ÿ131 along the unfolding transition (see be-low). Some of the relevant spectra are shown inFig. 4B. We found no W6F IFABP1ÿ131 spectrummatching the one from W6F IFABP1ÿ128.

3.6. UV-absorption analysis

Because of the poor separation of the absorptionbands, direct inspection of protein UV spectra isusually not informative about details of protein ter-tiary structure. However, spectral resolution is en-hanced after numerical derivatization, because sharpbands greatly predominate over broad components[46]. This technique has been successfully appliedto the conformational study of proteins [47^50].Fourth-derivative maxima are located at nearly thesame position as in the corresponding zero-orderspectra, with amplitude inversely proportional tothe fourth-power of the width of the original bands[46].

Fourth-derivative UV spectra of wild-type, W6FIFABP1ÿ131, W6F IFABP1ÿ128, and relevant trypsindigests (as models for the fully unfolded polypeptide)are shown in Fig. 5. As seen in native and digestedWT IFABP (Fig. 5A), unfolding and solvent expo-sure caused a large blue shift in most peaks. Below270 nm, the shift monitors exposure of Phe residues[46]. In the 270^285-nm range, signals from Phe, Tyrand Trp overlap, but the large blue shift observed forthe peak at about 280 nm, which upon unfoldingmoves to about 276 nm, is most likely due to thesolvent exposure of Tyr groups [46]. Both Trp andTyr contribute to the peak at 285 nm, which moved3 nm to the blue upon digestion. In native proteins,

two pure Trp signals (Lb and La bands) overlap atabout 290 nm; these signals are partially resolvedupon Trp exposure to water because the Lb compo-nent moves to the blue and La moves to the red [51].The spectrum of digested WT IFABP clearly showedthe shift of the Lb component to the blue and theappearance of a weak component that we tentativelyassigned to the less intense La band (at 289 and 294nm, respectively).

W6F IFABP1ÿ131 and WT IFABP fourth deriva-tive spectra were similar, with changes in the inten-sity above 280 nm due to the di¡erence in Trp con-tent (Fig. 5A). This result agrees with the ANSbinding, CD, £uorescence and hydrodynamic datapresented above, con¢rming that W6F IFABP1ÿ131

is a good native control for the comparison withthe truncated variant.

W6F IFABP1ÿ128 peaks below 270 nm wereslightly blue-shifted and less intense compared toW6F IFABP1ÿ131, but these changes were far lesspronounced than those corresponding to the un-folded peptides of W6F IFABP1ÿ128 (Fig. 5B). TheW6F IFABP1ÿ128 bands at about 280 and 285 nm(Tyr+Trp) were shifted to the blue by approximately0.5 nm compared with the corresponding peaks ofW6F IFABP1ÿ131. In addition, the 285-nm bandwas signi¢cantly more intense. The bluer positioncan be accounted for by an increased solvent expo-

Fig. 5. Fourth derivative UV spectra of IFABP variants. (A)9, WT IFABP; - - -, W6F IFABP1ÿ131 ; 9-9, trypsin digest ofWT IFABP. (B) - - -, W6F IFABP1ÿ131 ; WWWWWW, W6F IFABP1ÿ128 ;9-9, trypsin digest of W6F IFABP1ÿ128. Processing of zero or-der UV spectra, normalized for protein concentration, was per-formed as described in Section 2.



sure, but the increase in intensity (band sharpening inthe zero order spectrum) suggests the existence ofspeci¢c non-native interactions or environment in-volving Trp and/or Tyr. These changes are incompat-ible with full unfolding (which, as seen in the digest,would produce a 3^4-nm blue shift of the 280- and285-nm peaks). Finally, the maximum at 290 nmdeserves special attention: it was more intense andred shifted in W6F IFABP1ÿ128 than in W6FIFABP1ÿ131, which again suggests a non-nativemore hydrophobic environment for Trp-82. Theabove UV absorption results suggest, in agreementwith the £uorescence results, that the conformationof W6F IFABP1ÿ128 di¡ers substantially from boththe unfolded and the native state of IFABP.

3.7. Equilibrium unfolding transitions monitored by£uorescence

Monitored by £uorescence, WT IFABP unfoldedthrough a cooperative transition centered at 1.46 MGuHCl and with a vGH2O of unfolding of 5.23 kcalmol31 (Fig. 6, top panel; Table 2). In the presence of3-fold molar excess of palmitate, it was dramaticallymore stable: vvGH2O � 2:39 kcal mol31 (all vvGH2O

values in this paper refer to the di¡erence in stabilitybetween the indicated variant or condition and theWT IFABP). These results are in excellent agreementwith previous reports for the unfolding of apo-IFABP monitored by £uorescence and CD, and forthe e¡ect of the ligand upon the transition [52]. SinceIFABP was puri¢ed in the unfolded state and thetransition was measured starting from GuHCl dena-tured protein, these results also con¢rmed the fullreversibility of the process [52]. The analysis was re-peated with GuHCl denatured IFABP previously ex-tracted with hexane; there was no signi¢cant di¡er-ence in vGH2O and m values compared with theunextracted control (Table 2). Hence, the proteinspuri¢ed can be considered essentially free of ligand.

As shown by the unfolding parameters of W6FIFABP1ÿ131 (Fig. 6, middle panel; Table 2), theTrpCPhe substitution causes a very large decreasein stability (vvGH2O � 32:22 kcal mol31) with a con-comitant decrease in m (the vGH2O dependence onGuHCl concentration) and in Cm. Despite this largedecrease in stability, the folding of W6F IFABP1ÿ131

is not compromised because the vGH2O remains suf-

¢ciently large (3.01 kcal mol31). As anticipated bythe ANS binding data (see above), in the presenceof palmitate, W6F IFABP1ÿ131 was stabilized by 1.32kcal mol31 (vvGH2O � 30:90 kcal mol31).

The data for W6F IFABP1ÿ128 indicated that theC-terminal truncation, in the context of theTrpCPhe substitution, causes additional destabiliza-tion (vvGH2O � 32:66 kcal mol31). However, judg-ing from the £uorescence data (Fig. 6, bottompanel), the truncated protein still exhibits the char-acteristic all-or-none transition of folded proteinswith a Cm = 1.21 M. At the concentration tested forthe other variants, palmitate had no signi¢cant e¡ectupon the transition.

3.8. Equilibrium unfolding transitions monitored bySEC

The eventual presence of equilibrium intermediateswas assessed by measuring RS as a function ofGuHCl (Fig. 6). The reversibility of the transitionwas con¢rmed unfolding the IFABP variants in 5 MGuHCl and then re-equilibrating the samples atselected intermediate GuHCl concentrations beforechromatography. This procedure yielded RS that

Table 2Parameters for the GuHCl-induced equilibrium unfolding ofIFABP variants monitored by £uorescencea

IFABP Cm m vGH2O

WT 1.46 3.59 þ 0.33 5.23 þ 0.60WT (extracted) 1.45 4.16 þ 0.42 6.04 þ 0.75WT (+fatty acid) 1.69 4.50 þ 0.28 7.62 þ 0.53W6F1ÿ131 1.10 2.73 þ 0.11 3.01 þ 0.20W6F1ÿ131 (+fattyacid)

1.25 3.46 þ 0.28 4.33 þ 0.35

W6F1ÿ128 1.21 2.12 þ 0.06 2.57 þ 0.09W6F1ÿ128 (+fattyacid)

1.25 1.86 þ 0.05 2.33 þ 0.07

aIFABP variants were unfolded in GuHCl and then equilibrat-ed in 0.1 M sodium phosphate, pH 7.0 containing 0.05^4.9 MGuHCl. Protein concentration was 1^2 WM. Excitation was at290 nm and emission was measured at 330 nm. Fluorescencedata were ¢tted to a two-state model (Fig. 6). Units are M,kcal mol31 M31, kcal mol31 for Cm, m, and vGH2O, respec-tively. The denaturant concentration that causes 50% unfoldingwas calculated as Cm � vGH2O=m. When indicated, IFABP in5 M GuHCl was previously extracted overnight with 5 vols. ofhexane or supplemented with a 3-fold molar excess of fattyacid (sodium palmitate) in the refolding bu¡er.



did not di¡er signi¢cantly from the values obtainedby unfolding (not shown).

To test possible protein concentration e¡ects in thedetermined RS at intermediate GuHCl concentra-tions, the chromatographic separation at 1.3 and3.0 M GuHCl was repeated using three or more dif-ferent protein concentrations spanning the range0.05^1.0 mg/ml. The largest changes in RS were 5,2, and 10% for WT IFABP, W6F IFABP1ÿ131, andW6F IFABP1ÿ128, respectively. Although, this varia-tion does not introduce a signi¢cant error, all theexperiments were routinely performed in the lowerlimit of the protein concentration range, typicallyat 0.1 mg/ml or less.

The ¢rst conclusion drawn from the data in Fig. 6is that the two-state assumption is not adequate todescribe the unfolding: the optical changes only ac-company a fraction of the increase in size, a furtherexpansion take place at higher denaturant concentra-tions. It is unlikely that this discrepancy is the resultof a chromatographic artifact. The column utilized isthe reference for this kind of studies and has beenthoroughly tested with several model proteins in na-tive and non-native states [24,53]. It was reported toproduce nearly ideal size exclusion separations underdi¡erent experimental conditions, including thoseutilized in this work. In our hands, the procedureyielded accurate RS for other proteins in non-nativestates [8]. In addition, the extremes of the transitionshown in Fig. 6 yielded RS values close to thosecalculated for native and completely unfolded states(Table 1). Hence, the behavior of IFABP above 2 MGuHCl indicates the presence of a one or more hy-drodynamically distinct states, di¡erent from the na-tive and completely unfolded states. Partially-ex-panded states of IFABP seem to be remarkablystable, and it was needed 8 M GuHCl to approachthe plateau of maximal expansion (Fig. 6). Such highdenaturant concentration is at the limit of the instru-ment operability. The transitions observed by size arenot enough separated to ¢t the results con¢dently toa model with three or more states. Therefore, only aqualitative analysis of the SEC curves is reported.

As evidenced by SEC, WT IFABP and W6FIFABP1ÿ131 showed a ¢rst, partial expansion (60%)at denaturant concentration that approximately cor-responds to the transition observed by £uorescence.The remainder of the expansion occurred at higher

Fig. 6. GuHCl equilibrium unfolding of IFABP variants. Theprobe were £uorescence emission (circles) and RS (squares). Ex-citation was at 290 nm (4-nm band-pass) and emission was re-corded at 330 nm (8-nm band-pass). RS was measured by SECas described in Section 2. Fluorescence unfolding parametersare given in Table 2. Lines through SEC data points weredrawn solely to guide the eye.



GuHCl concentrations, exhibited very low coopera-tivity, and was silent by £uorescence. Complex ki-netic unfolding curves for IFABP have been reportedbefore, as well as persistent local structure aroundTrp-82 after the loss of native £uorescence signals[54]. However, to our best knowledge, this is the ¢rstreport of deviations from the two-state model ofbulk average properties for the unfolding of IFABPat equilibrium.

The unfolding pro¢le of W6F IFABP1ÿ128 asmonitored by RS indicated that this variant, below5 M GuHCl, increases in size almost continuouslywith small, but signi¢cant changes in the slope ofthe signal, suggesting the existence of residual coop-erativity. Perhaps, the more surprising feature ofW6F IFABP1ÿ128 is its behavior in the 0^0.5 MGuHCl range, where the £uorescence signal is almostnative despite the fact that up to 40% expansionoccurs. This behavior suggests sequential unfolding,with a compact nucleus involving Trp-82 that per-sists after other regions of the molecule have swelled.Above 2 M, the RS unfolding pro¢le of W6FIFABP1ÿ128 was similar to those from the othertwo variants.

4. Discussion

A number of conformational analyses were appliedto three IFABP variants, including a truncated form,W6F IFABP1ÿ128, which was designed as a potentialmodel for a partially folded state. These analyses,particularly the RS studies, unveiled a complex un-folding equilibrium, with intermediate states thatwere not previously apparent by optical measure-ments, such as £uorescence and CD ([54]; the datapresented herein). Optical probes failed to detect aprogressive swelling of the molecule at high denatur-ant concentration. Swollen states with greatly re-duced secondary and tertiary structure are particu-larly interesting. Rather than discrete structures, theymay be conformational ensembles, which ¢t neatly inthe new view of protein folding [1]. Swollen statessimilar to those reported here are not unprecedented.One of the best-characterized examples is staphylo-coccal L-lactamase, which exhibits a `partly folded'state (more expanded than the molten globule state)devoid of tertiary structure, with reduced secondary

structure, and 34% larger than the native state [53].What distinguishes IFABP swollen state is that it hasa greatly altered secondary structure, it is particularlywell separated from the native and other more com-pact states, and that it occurs at very high GuHClconcentrations.

The aim of this work was to populate a non-nativestate of IFABP by rational manipulation of the ami-no acid sequence. We wished to test if the remotionof a few IFABP speci¢c interactions, identi¢ed a pri-ori by inspection of the crystallographic model,would impede the formation of the native state.The results indicate that W6F IFABP1ÿ128 reachesnear native size and shape. However, all the spectro-scopic evidence suggests a signi¢cant disruption ofthe native state. The far UV CD trace indicates asigni¢cant loss of the original L-structure. UV CDshows loss of aromatic speci¢c tertiary interactions.UV absorption reveals that Phe and Tyr residues,which line all the native interior, are partially ex-posed to the solvent. Fluorescence and UV absorp-tion both indicate a non-native, solvent-shielded re-gion around Trp-82.

Although W6F IFABP1ÿ128 is compact, its highsusceptibility to proteolytic attack and the unfoldingequilibrium behavior clearly indicate that it is nottightly folded. The extremely low cooperativity ofthe size expansion at low denaturant concentrationis suggestive of conformational £uctuation and of theexistence of multiple intermediate states with partialsolvation. Interestingly, W6F IFABP1ÿ128 binds ANSwith a¤nity typical of molten globules. Althoughnative IFABP also binds ANS, it does so withmuch higher a¤nity. It is worth noting that CRAB-PI, an IFABP structural homolog, binds ANS beforethe formation of the net of hydrogen bonds thatcharacterize the L-clam fold [55].

The £uorescence properties of the single Trp-82in truncated IFABP are particularly interesting.Although con¢ned to a hydrophobic environment,this Trp produces a 4-nm broadened £uorescenceband, which indicates the coexistence of multipleconformations. This could be the result of a mixingdiscrete structures or could re£ect the £uctuation of asingle average structure. In any case, the conforma-tional heterogeneity perturbs signi¢cantly the opticalprobes without resulting in a noticeable increase inshape.



The signi¢cance of the non-native structure oftruncated IFABP in the folding pathway remainsto be established. Our data favor the hypothesisbased on 19F-NMR studies that a hydrophobic col-lapse around Trp-82 constitutes an early foldingevent [54]. However, the conformational features ofW6F IFABP1ÿ128 di¡er from those from previouslyfound kinetic and equilibrium intermediates ofIFABP. A kinetic intermediate with altered second-ary structure by stopped-£ow CD measurements andunfolded £uorescence spectrum has been described[56]. Likewise, the CD and £uorescence signals underthe conditions that populate the 19F-NMR detectableintermediate of IFABP correspond to unfolded mol-ecules by optical criteria [54]. Now, we found noevidence of an intermediate with the £uorescenceproperties of W6F IFABP1ÿ128 in the GuHCl-in-duced equilibrium unfolding of W6F IFABP1ÿ131

(Fig. 6, middle panel).Because it is highly compact, W6F IFABP1ÿ128

non-native state seems to be more ordered thanany of the previously described folding intermediatesof IFABP. There are at least two possible generalmodels for the overall structure of partially foldedstates. It could be a structure with a native-like orga-nization of the backbone, with local distortions orunfolding, and loosened native tertiary contacts.This structure could have disordered ends as ob-served with truncated staphylococcal nuclease [8].On the other hand, the intermediate could have asigni¢cantly di¡erent organization with predomi-nance of non-native tertiary interactions. The distinc-tion between these two models is extremely impor-tant to understand the underlying mechanism ofprotein folding. However, our data do not allow dis-tinguishing between the two models: the spectro-scopic evidence is compatible with either expansionand local disorder or with new tertiary interactionsinvolving W82. Clearly, NMR studies are neededto settle this point. Unfortunately, so far, our at-tempts to study this structure using NMR were un-successful due to its low solubility in physiologicalbu¡ers, which impeded the preparation of suitablesamples.

It is tempting to speculate about the possible phys-ico-chemical basis of W6F IFABP1ÿ128 conforma-tional changes. However, we do not know yet if

the stability change provoked by the removal of spe-ci¢c interactions is the cause of W6F IFABP1ÿ128

conformational alterations; truncation could havea¡ected the folding mechanism, the transient struc-ture of a kinetic intermediate, or some more funda-mental aspect of the folding code. This will be ex-plored in future works.

An interesting aspect of our results bears upon thefolding code. This work adds to others in suggestingthat there must be two levels of information in theamino acid sequence. The lower level directs the ini-tial collapse of the molecule providing rough con-straints for more detailed interactions and may bebased on very simple rules, like the binary polar^non-polar patterns and statistical propensities forsecondary structure formation [57,58]. The higherlevel of the code, non-local by de¢nition, should di-rect the freezing of the structure in a single speci¢cconformation with rigid tertiary interactions betweenside chains. In comparison to amino acid substitu-tions in the middle of the sequence (especially thoseinvolving surface and polar residues) to which thefolded structure usually adapts itself [59], C-terminaltruncation seems to have a much more drastic e¡ect,dissociating the two levels of the folding code andyielding compact equilibrium non-native states. Thisis not the case for all deletions. A complete helix-turn-helix motif in IFABP can be eliminated (an in-ternal 17-residue deletion accompanied by a two-res-idue linker insertion) without signi¢cantly a¡ectingnative fold [60]. Thus, a scenario seems possiblewhere the folding code is not equally distributedalong the sequence, and there are highly information-al loci for which crucial structural function may beexpected. These loci may be randomly located, butsomething to bear in mind is that a C-terminalswitch for native folding would be a desirable featureto avoid stable misfolding during protein synthesis.We anticipate that, should these loci exist, theywould have high density of residues involved inlong-range interactions.

Finally, we wish to point out that controlled trun-cation may be an extremely useful approach to pop-ulate non-native states under physiological condi-tions. As such, these states may be of great help inexperimentally addressing fundamental problems inprotein folding.



Acknowledgements

This research has been supported by grants fromUniversidad Nacional de Quilmes, Fundacion An-torchas, the Third World Academy of Sciences, and(partially) by LNLS-National Synchrotron LightLaboratory, Brazil. M.R.E. and M.C. are CareerResearch Investigators from the Consejo Nacionalde Investigaciones Cient|¢cas y Tecnicas (CONI-CET), Argentina. E.M.C. is supported by a doctoralfellowship from Universidad Nacional de Quilmes.The IFABP cDNA was kindly provided by AlanKleinfeld. S.Y. Venyaminov and N. Gree¢eld kindlyprovided the programs used to estimate secondarystructure content. We thank I. Toriani and the sta¡at the LNLS (Campinas, Brazil) for guidance andassistance in the acquisition of SAXS data, A. Pala-dini for the use of the Jasco SLM-4800 instrumentand his assistance during £uorecence measurements,J. Lee and L. Lee (University of Texas MedicalBranch) for the acquisition of CD data. Commentsand suggestions by R.O. Fox and J.M. Del¢no aregratefully acknowledged.

References

[1] K.A. Dill, H.S. Chan, Nat. Struct. Biol. 4 (1997) 10^19.[2] F.M. Hughson, R.L. Baldwin, Biochemistry 28 (1989) 4415^

4422.[3] F.M. Hughson, P.E. Wright, R.L. Baldwin, Science 249

(1990) 1544^1548.[4] P.A. Jennings, P.E. Wright, Science 262 (1993) 892^896.[5] Z. Peng, P.S. Kim, Biochemistry 33 (1994) 2136^2141.[6] D. Shortle, A.K. Meeker, Proteins Struct. Funct. Genet. 1

(1986) 81^89.[7] J.M. Flanagan, M. Kataoka, D. Shortle, D.M. Engelman,

Proc. Natl. Acad. Sci. USA 89 (1992) 748^752.[8] M.R. Ermacora, D.W. Ledman, R.O. Fox, Nat. Struct. Biol.

3 (1996) 59^66.[9] G. Prat Gay, J. Ruiz-Sanz, J.L. Neira, F.J. Corrales, D.

Otzen, A.G. Ladurner, A.R. Fersht, J. Mol. Biol. 254(1995) 968^979.

[10] S. Miller, J. Janin, A.M. Lesk, C. Chothia, J. Mol. Biol. 196(1987) 641^656.

[11] L. Banaszak, N. Whinter, Z. Xu, D.A. Bernlohr, S. Cowan,T.A. Jones, Adv. Protein Chem. 45 (1994) 89^151.

[12] G. Scapin, J.I. Gordon, J.C. Sacchettini, J. Biol. Chem. 267(1992) 4253^4269.

[13] N. Jiang, C. Frieden, Biochemistry 32 (1993) 11015^11021.[14] Y. Nozaki, Arch. Biochem. Biophys. 277 (1990) 324^333.

[15] S.C. Gill, P.H. Von Hippel, Anal. Biochem. 182 (1989) 319^326.

[16] M.M. Santoro, D.W. Bolen, Biochemistry 31 (1992) 4901^4907.

[17] D. Barrick, Rl. Baldwin, Biochemistry 32 (1993) 3790^3796.[18] T.E. Ferrin, C.C. Huang, L.E. Jarvis, R. Langridge, J. Mol.

Graphics 6 (1988) 13^27.[19] G.V. Richieri, R.T. Ogata, A.M. Kleinfeld, J. Biol. Chem.

267 (1992) 23495^23501.[20] R. Higuchi, in: H.A. Herlich (Ed.), PCR Technology. Prin-

ciples and Applications for DNA Ampli¢cation, StocktonPress, New York, 1989, pp. 61^70.

[21] E. Kurian, W.R. Kirk, F.G. Prendergast, Biochemistry 35(1996) 3865^3874.

[22] E. Daniel, G. Weber, Biochemistry 5 (1966) 1199^1893.[23] M.L. Johnson, S.G. Frasier, Methods Enzymol. 117 (1985)

117^342.[24] V.N. Uversky, Biochemistry 32 (1993) 13288^13298.[25] W.H. Press, S.A. Teukolsky, W.T. Vetterling, B.P. Flannery,

The Art of Scienti¢c Computing, Cambridge UniversityPress, New York, 1992.

[26] S.Y. Venyaminov, J.T. Yang, in: G.D. Fasman (Ed.), Cir-cular Dichroism and the Conformational Analysis of Bio-molecules, Plenum Press, New York, 1996, pp. 69^107.

[27] N.J. Green¢eld, Anal. Biochem. 235 (1996) 1^10.[28] W.R. Kirk, E. Kurian, F.G. Prendergast, Biophys. J. 70

(1996) 69^83.[29] L. Shi, D.R. Palleros, A.L. Fink, Biochemistry 33 (1994)

7536^7546.[30] A. Fontana, P. Polverino de Laureto, V. De Filippis, E.

Scaramella, M. Zambonin, Fold. Des. 2 (1997) R17^R26.[31] W.R. Woody, in: G.D. Fasman (Ed.), Circular Dichroism

and the Conformational Analysis of Biomolecules, PlenumPress, New York, 1996, pp. 25^67.

[32] K. Kim, R. Ramanathan, C. Frieden, Protein Sci. 6 (1997)364^372.

[33] P.O. Freskga®rd, L.G. Ma®rtensson, P. Jonasson, B.H. Jons-son, U. Carlsson, Biochemistry 33 (1994) 14281^14288.

[34] P.L. Clark, B.F. Weston, L.M. Gierasch, Fold. Des. 3 (1998)401^412.

[35] A. Perczel, K. Park, G.D. Fasman, Anal. Biochem. 203(1992) 83^93.

[36] N. Green¢eld, G.D. Fasman, Biochemistry 8 (1969) 4108^4116.

[37] C.T. Chang, C.S. Wu, J.T. Yang, Anal. Biochem. 91 (1978)13^31.

[38] S.W. Provencher, J. Glo«ckner, Biochemistry 20 (1981) 33^37.

[39] P. Manavalan, W.C.J. Johnson, Anal. Biochem. 167 (1987)76^85.

[40] N. Sreerama, R.W. Woody, J. Mol. Biol. 242 (1994) 497^507.

[41] M.A. Andrade, P. ChacUê n, J.J. Merelo, F. Morn, ProteinEng. 6 (1993) 383^390.

[42] G. Bo«hm, R. Muhr, R. Jaenicke, Protein Eng. 5 (1992) 191^195.



[43] Y. Goto, L.J. Calciano, A.L. Fink, Proc. Natl. Acad. Sci.USA 87 (1990) 573^577.

[44] Y.V. Griko, A. Gittis, E.E. Lattman, P.L. Privalov, J. Mol.Biol. 243 (1994) 93^99.

[45] C.N. Arighi, J.P.F.C. Rossi, J.M. Del¢no, Biochemistry 37(1998) 16802^16814.

[46] E. Padros, A. Morros, J. Manosa, M.A. Dunach, Eur.J. Biochem. 127 (1982) 117^122.

[47] T.A. Bewley, C.H. Li, Arch. Biochem. Biophys. 233 (1984)219^227.

[48] H.A. Havel, R.S. Chao, R.J. Haskell, T.J. Thamann, Anal.Biochem. 61 (1989) 642^650.

[49] H. Mach, J.A. Thomsom, C.R. Middaugh, R.V. Lewis,Arch. Biochem. Biophys. 287 (1991) 33^40.

[50] H. Mach, C.R. Middaugh, Anal. Biochem. 222 (1994) 323^331.

[51] E.H. Strickland, J. Horwitz, E. Kay, L.M. Shannon, Wil-chek, C. Billups, Biochemistry 10 (1971) 2631^2638.

[52] I.J. Ropson, J.I. Gordon, C. Frieden, Biochemistry 29 (1990)9591^9599.

[53] V.N. Uversky, O. Ptitsyn, Biochemistry 33 (1994) 2782^2791.

[54] I.J. Ropson, C. Frieden, Proc. Natl. Acad. Sci. USA 89(1992) 7222^7226.

[55] P.L. Clark, Z.P. Liu, J. Rizo, L.M. Gierasch, Nat. Struct.Biol. 4 (1997) 883^886.

[56] I.J. Ropson, P.M. Dalessio, Biochemistry 36 (1997) 8594^8601.

[57] S. Kamtekar, J.M. Schi¡er, H. Xiong, J.M. Babik, M.H.Hecht, Science 262 (1993) 1680^1685.

[58] S. Roy, K.J. Helmer, M.H. Hecht, Fold. Des. 2 (1997) 89^92.

[59] D.P. Goldenberg, in: T.E. Creighton (Ed.), Protein Folding,W.H. Freeman, New York, 1992, pp. 353^404.

[60] D.P. Cistola, K. Kim, H. Rogl, C. Frieden, Biochemistry 35(1996) 7559^7565.



Engineering a compact non-native state of intestinal fatty acid-binding protein

Documents

Transcript of Engineering a compact non-native state of intestinal fatty acid-binding protein