Food Chemistry 131 (2012) 1272–1278

Contents lists available at SciVerse ScienceDirect

Food Chemistry

journal homepage: www.elsevier .com/locate / foodchem

Effects of dietary broccoli fibre and corn oil on serum lipids, faecal bile acidexcretion and hepatic gene expression in rats

Tafadzwa Mandimika a,⇑, Gunaranjan Paturi b, Cloe Erika De Guzman c, Christine A. Butts c, Katia Nones c,John A. Monro c,d, Ruth C. Butler e, Nigel I. Joyce e, Suman Mishra c, Juliet Ansell c,d

a The New Zealand Institute for Plant and Food Limited, Private Bag 3230, Hamilton 3240, New Zealandb The New Zealand Institute for Plant and Food Research Limited, Private Bag 92169, Auckland 1142, New Zealandc The New Zealand Institute for Plant and Food Research Limited, Private Bag 11600, Palmerston North 4442, New Zealandd Riddet Institute, Massey University, Palmerston North 4442, New Zealande The New Zealand Institute for Plant and Food Research Limited, Private Bag 4704, Christchurch 8140, New Zealand

a r t i c l e i n f o

Article history:Received 17 September 2010Received in revised form 29 August 2011Accepted 27 September 2011Available online 4 October 2011

Keywords:Bile acidsBrassicaceaeCorn oilDietary fibreGene expressionLipid metabolism

0308-8146/$ - see front matter � 2011 Elsevier Ltd. Adoi:10.1016/j.foodchem.2011.09.117

⇑ Corresponding author. Tel.: +64 7 9594451; fax: +E-mail address: tafadzwa.mandimika@plantandfoo

a b s t r a c t

To determine the effects of broccoli fibre and corn oil on lipid metabolism, male Sprague–Dawley ratswere fed diets containing high (30%) or low (5%) corn oil, in combination with either 7.5% broccoli fibreor cellulose, for 4 months. High corn oil groups had significantly lower serum cholesterol and triglycer-ides than had low corn oil groups (p < 0.001). Broccoli fibre also lowered serum cholesterol and triglyc-eride levels compared to cellulose fibre. Faecal bile acid concentrations were higher in high corn oil-fedrats than in low corn oil-fed rats, with broccoli fibre inclusion in high corn oil diets resulting in higherfaecal bile acid concentrations. Regardless of corn oil level, broccoli fibre supplementation in the dietresulted in an increase (p = 0.018) in hepatic cytochrome P450, family 7A1 (CYP7A1) expression. Highcorn oil feeding resulted in reduced expression of fatty acid synthase (FAS) and increased expressionof carnitine palmitoyl transferase 1a (CPT1a) and 3-hydroxy-3-methyl-coenzyme A reductase (HMGCR)(p < 0.05). Our findings suggest that high dietary corn oil and broccoli fibre have beneficial effects on lipidmetabolism. Corn oil lipid-lowering effects may be due to alteration of hepatic expression of genesinvolved in lipid synthesis and increased rate of cholesterol catabolism to bile acids. Broccoli fibre mayalso act via its physical properties to reduce enterohepatic bile acid recycling and intestinal lipid absorp-tion, and increase luminal binding of bile acids, resulting in increased faecal bile acid excretion.

� 2011 Elsevier Ltd. All rights reserved.

1. Introduction

Western-style diets, low in dietary fibre and high in saturatedfatty acids, are associated with increased risk of cardiovascular dis-ease, diabetes and obesity (Hosomi, Fukunaga, Arai, Nishiyama, &Yoshida, 2009). Several studies have demonstrated the hypocho-lesterolemic and hypotriglyceridemic effects of polyunsaturatedfatty acids (PUFAs) (Howell, MacDougall, & Jones, 1998; Jump,2008; Russo, 2009) and soluble dietary fibre (Ramjiganesh et al.,2000; Rideout, Harding, Jones, & Fan, 2008). There are increasingefforts to identify functional foods or individual dietary compo-nents that may prevent or alleviate chronic diseases. As functionalfoods and individual dietary components are consumed as part of amixed diet, and not in isolation, it is necessary to understand thecombined effects of different food components, within diets, onhealth outcomes. This study investigated the dietary fibre and

ll rights reserved.

64 7 9594431.d.co.nz (T. Mandimika).

PUFA interactions and their potential beneficial hypolipidemic ef-fects in healthy rats.

Serum cholesterol and triglyceride-lowering effects of corn oilhave been observed in earlier studies (Howell et al., 1998; Wagner,Tomasch, & Elmadfa, 2001). Refined corn oil consists of 99% triacyl-glycerols with PUFAs constituting 59%, of which linoleic acid(C18:2n-6) is the major PUFA and linolenic acid (C18:3n-3) is aminor component (Dupont et al., 1990). A diet providing 2–5% ofits energy source from highly unsaturated 20- and 22-carbon ome-ga 6 or omega 3 fatty acids is associated with inhibition of hepaticlipogenesis, stimulation of fatty acid oxidation and consequentlowering of blood triglycerides (Clarke, 2004). The hypolipidemiceffects of PUFAs are mainly due to their regulation of the abun-dance or activity of key transcription factors, peroxisome prolifer-ator-activated receptor alpha (PPAR-a) and sterol regulatoryelement binding transcription factor-1c (SREBF-1c). PUFAs canactivate PPAR-a and suppress SREBF-1c, resulting in upregulationof genes encoded for enzymes involved in fatty acid oxidationand downregulation of genes encoded for enzymes of lipogenesisin the liver, respectively (Jump et al., 2005).

Broccoli stems

Washing

Grating

Blending

Pass through colloid mill

Washing

Dewatering

Drying

Milling

Water

Water

Water

Water Waste water

Waste water

Waste water

Dietary fibre

Waste water

Fig. 1. Schematic view of dietary fibre preparation from broccoli stems.

T. Mandimika et al. / Food Chemistry 131 (2012) 1272–1278 1273

Dietary fibre has well-established hypocholesterolemic effects;however the relationship between dietary fibre intake and serumcholesterol lowering is complex and depends on the type andphysicochemical properties of the dietary fibre. Generally, solubleviscous fibres, such as guar gum, are effective hypocholesterolemicagents (Rideout et al., 2008) because they reduce dietary fat, cho-lesterol and bile acid uptake, thereby increasing bile acid and cho-lesterol excretion, reducing cholesterol concentrations in the liver(Fernandez, 2001), and altering hepatic cholesterol homeostasis.

The dietary fibre used in this study consisted of mixed functioncell wall polysaccharides from broccoli stems, containing paren-chymatous cells rich in unextracted pectic polysaccharide, embed-ded with fibre cells, secondarily thickened by additionalhemicellulose and cellulose polysaccharides and lignin (Takahashiet al., 2009). The mixed fibre has large swelling and water holdingcapacities, properties known to elevate digesta viscosity in the ratby reducing free water content of the digesta (Takahashi et al.,2009). We have previously shown increased short-chain fatty acids(SCFAs) concentrations in rats fed broccoli fibre (Paturi et al.,2010). SCFAs, propionate and butyrate may decrease cholesterolbiosynthesis: propionate by inhibiting HMGCR in the liver (Alvaroet al., 2008), and butyrate by regulating intestinal function and sys-temic cholesterol metabolism (Marcil et al., 2002). In view of itscomposition, properties and fermentability in the large bowel, ahypocholesterolemic effect of broccoli fibre would seem probable.However, as dietary fibre affects lipid-bile acid interactions in thegut, and a number of intra luminal processes, the consequencesof corn oil and dietary fibre interaction for lipid homeostasis arenot clear.

In the present study, serum cholesterol and triglycerides, faecalbile acid concentrations and hepatic expression of genes involvedin cholesterol synthesis and catabolism were measured in ratsfed broccoli fibre in low (5%) and high (30%) corn oil diets, com-pared with control diets containing microcrystalline cellulose,which does not have the hydration capacity or susceptibility to fer-mentation as the broccoli fibre. We hypothesised that the charac-teristics of broccoli fibre would enable it to augment effects ofhigh corn oil diets on serum cholesterol and triglyceride concentra-tions and on faecal bile acid concentrations.

2. Materials and methods

2.1. Broccoli dietary fibre preparation

Broccoli (Brassica oleracea L. var. italica) stems were obtainedfrom growers in the Manawatu region (New Zealand), and storedat 4 �C prior to processing. Fig. 1 depicts the process of dietary fibrepreparation from broccoli stems. Broccoli fibre was prepared at theFood Technology Pilot Plant, Massey University (Palmerston North,New Zealand). Briefly, a cold water aqueous extraction method wasused as it has been shown to cause minimal loss of total non-starchpolysaccharide, including pectin from broccoli. The broccoli fibrewas freeze-dried and milled through 1 mm mesh fitted to a grind-ing mill and stored at room temperature until the experimentaldiets were prepared. The broccoli fibre preparation contained morethan 95% dietary fibre (dry weight after pepsin digestion and 80%ethanol precipitation).

2.2. Animals and experimental procedures

Nine week-old male Sprague–Dawley rats were housed in tem-perature-controlled rooms (22 + 1 �C), with humidity of 60 + 5%, airexchange of 12 times/h, and a 12 h light/dark cycle. The rats wererandomly allocated into experimental groups (n = 16): high cornoil diet with cellulose, low corn oil diet with cellulose, high corn

oil diet with broccoli fibre and low corn oil diet with broccoli fibre.The compositions of the experimental diets are shown in Table 1.Experimental procedures used in this study were approved bythe AgResearch Grasslands Animal Ethics Committee, PalmerstonNorth, New Zealand.

Rats were fed their respective diets for 17 weeks. Food andwater were provided ad libitum. The food intake and body weightof each rat were recorded every 7 days. One rat in the low cornoil cellulose group died during the rat trial. During week 17, totalfaecal samples were collected daily over a week. Faeces werefreeze-dried and stored at �80 �C for bile acid analysis. At theend of the 17 week feeding study, the rats were euthanised byCO2 asphyxiation. Blood was collected via cardiac puncture and leftto coagulate overnight at 4 �C. Serum was harvested following cen-trifugation at 2000�g for 10 min and stored at �80 �C until choles-terol and triglycerides were measured. Liver tissues from rats werecollected, snap-frozen in liquid nitrogen and then stored at �80 �Cfor gene expression analysis.

2.3. Serum lipids

Total cholesterol and triglycerides were measured by enzymatickits from Abbott Diagnostics (Wiesbaden, Germany) using theArchitect ci8200 analyser (Abbott Diagnostics).

2.4. Faecal bile acids

Bile acids in rat faeces were measured by liquid chromatogra-phy-mass spectrometry (LCMS). The LCMS system consisted of aThermo Electron Corporation (San Jose, CA, USA) Finnigan SurveyorMS pump, Finnigan MicroAS auto-sampler, and a ThermaSphere TS-130 column heater (Phenomenex, Torrance, CA, USA). Freeze driedfaeces samples were weighed (<500 mg) into 15 ml polypropylene

Table 1Compositions of experimental diets (g/kg).

Ingredients High corn oil diet with cellulose High corn oil diet with broccoli Low corn oil diet with cellulose Low corn oil diet with broccoli

Lactic casein 120 120 120 120Vitamin mixa 50 50 50 50Mineral mixb 50 50 50 50Sucrose 40 40 40 40Starch 365 365 615 615Corn oil 300 300 50 50Cellulose 75 0 75 0Broccoli fibre 0 75 0 75Energy (kcal/kg) 4734.5 4734.5 3545.75 3545.75

a Mixture contains the following components: (mg/kg diet) – Retinol acetate 5.0, DL-a-tocopheryl acetate 100.0, menadione 3.0, thiamin hydrochloride 5.0, riboflavin 7.0,pyridoxine hydrochloride 8.0, D-pantothenic acid 20.0, folic acid 2.0, nicotinic acid 20.0, D-biotin 1.0, myo-inositol 200.0, choline chloride 1500.0; (lg/kg diet) – ergocalciferol25.0, cyanocobalamin 50.0.

b Mixture contains the following components: (g/kg diet) – Ca 6.29, Cl 7.79, Mg 1.06, P 4.86, K 5.24, Na 1.97; (mg/kg diet) – Cr 1.97, Cu 10.7, Fe 424.0, Mn 78.0, Zn 48.2;(lg/kg diet) – Co 29.0, I 151.0, Mo 152.0, Se 151.0.

1274 T. Mandimika et al. / Food Chemistry 131 (2012) 1272–1278

centrifuge tubes and extracted with 5 ml of methanol by vortex, fol-lowed by end-over-end mixing on a vertical carousel for 30 min.The supernatant was recovered after centrifuging and filtered intoamber glass 1.5 ml auto sampler vials via a 0.22 lm nylon syringefilter.

2.5. Quantitative real-time polymerase chain reaction (qPCR) analysis

Total RNA from liver tissues was isolated, using a Qiagen RNeasyMini Kit (Qiagen, Melbourne, Australia), in combination with theRNase-free DNase kit (Qiagen). The RNA concentration and puritywere determined using a NanoDrop ND-1000 spectrophotometer(NanoDrop Technologies Inc., Wilmington, DE, USA). Samples withan OD 260/280 ratio >1.8 and 230/260 > 2 were considered accept-able for further analysis. RNA integrity was determined by gelelectrophoresis.

Complementary DNA (cDNA) was synthesised from 1 lg of totalRNA for each sample, using the Transcriptor First Strand cDNA Syn-thesis Kit, following manufacturer’s instructions (Roche Diagnos-tics, Mannheim, Germany). Primers for selected genes weredesigned using Primer-Blast from the National Center for Biotech-nology Information (NCBI), which are shown in Table 2. After pri-mer design, all primers were run through the NCBI Blast databaseto check for specificity. PCR amplification and detection were per-formed with the iQ SYBR Green Supermix (BioRad Laboratories,Hercules, CA, USA) and the LightCycler 480 PCR system (RocheDiagnostics). The PCR conditions were 95 �C for 5 min, then 45 cy-cles at 95 �C for 10 s, 65 �C for 10 s and 72 �C for 10 s. A dissociationcurve was run with each PCR reaction to verify the absence of pri-mer-dimers. Each rat sample was evaluated for the eight targetgenes, and two reference genes 18s rRNA and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). For each gene, thresholdcycle (Ct) values were obtained according to the manufacturer’sprotocol for 10 ll reactions. PCR efficiencies, for all runs and primersets, were calculated using Light-Cycler 480 software v. 1.5.0 SP3.

Table 2Primers used for quantitative real-time PCR analysis.

Gene name Gene symbol Sequenc

Apolipoprotein B ApoB NM_019Carnitine palmitoyl transferase 1a CPT1a NM_031Cytochrome P450, family 7A1 CYP7A1 NM_012Fatty acid synthase FAS NM_0173-Hydroxy-3-methyl-coenzyme A reductase HMGCR NM_013Low density lipoprotein receptor LDLR NM_175Peroxisome proliferator-activated receptor alpha PPAR-a NM_013Sterol regulatory element binding transcription factor 2 SREBF2 NM_001Glyceraldehyde-3-phosphate dehydrogenase GAPDH NM_01718s rRNA 18s rRNA M11188

A standard curve for all genes, including reference genes, wasgenerated using serial dilutions (1/10–1/1000) of pooled cDNAsamples and was included in each run. Negative controls (no tem-plate) were included in reverse transcription reactions and RT-qPCR runs and these did not produce amplicons. Samples from ratswere included in duplicate on a plate. Due to the numbers of sam-ples, three plates (runs) were required for each gene. Using thesame layout across plates for each gene, samples were randomizedto plates, with either five or six rats per treatment group includedon a plate, to give an approximately equal distribution of treat-ments across the three plates.

2.6. Statistical analysis

All data were analysed with analysis of variance, which in-cluded contrasts to assess the main effects of corn oil level, fibretype and corn oil level � fibre type interaction. All analyses werecarried out using GenStat 12th edition release (VSN International,Hemel Hempstead, UK). Faecal bile acid data included undeter-mined measurements (‘ND’ – not detectable). For all bile acidsother than glycochenodeoxycholic acid, treating these undeter-mined values as missing data, did not substantially affect the con-clusions; thus the results presented are from analysis of variancewith these data.

For the qPCR data, Ct values were first converted into DNA rel-ative concentrations by the Light-Cycler software. The average ofthe duplicate values was obtained for each gene for each animal.The ratios of these amounts for the gene of interest and the refer-ence genes were calculated, and these ratios were then analysed.The ratios were log10 transformed before analysis to stabilize thevariance. Because three plates per gene were required, data wereinitially explored with a mixed model analysis fitted with REML(Residual Maximum Likelihood) (GenStat 12th edition release,VSN International) to assess whether there were substantial differ-ences relating to the three plates: no substantial differences were

e ID Forward primer (50–30) Reverse primer (50–30)

287.2 GCAAAGGGAGGGAAAAGGTT TTAGGTAGGGGCTCACATTATTGG559.1 ATGACGGCTATGGTGTCTCC GTGAGGCCAAACAAGGTGAT942.1 CACCATTCCTGCAACCTTTT GTACCGGCAGGTCATTCAGT332.1 TCGAGACACATCGTTTGAGC TCAAAAAGTGCATCCAGCAG134.2 TGTGGGAACGGTGACACTTA CTTCAAATTTTGGGCACTCA762.2 GGGCTGGCGGTAGACTGGATC CAATCTGTCCAGTACATGAAGC196.1 TCACACAATGCAATCCGTTT GGCCTTGACCTTGTTCATGT033694.1 TGAAGCTAAGAGCAGTGCGA TGGTGGGATTTTCTCCTCTG008.3 GCATGGCCTTCCGTGTTCC GGGTGGTCCAGGGTTTCTTACTC.1 CCATCCAATCGGTAGTAGCG GTAACCCGTTGAACCCCATT

T. Mandimika et al. / Food Chemistry 131 (2012) 1272–1278 1275

observed. Therefore, data were analysed as for the other measure-ments, using analysis of variance.

3. Results

3.1. Weight gain and food intake

There were no significant differences in baseline and final bodyweights among the experimental diet groups (data not shown). After17 weeks on the experimental diets, the rats fed high corn oil dietshad a mean body weight gain of 40 g more than those fed the lowcorn oil diets (p = 0.001, Table 3). Those rats fed the low corn oil diettended to eat more (Table 3) than those on high corn oil diet(p < 0.001). Despite this, there was no significant difference in en-ergy intake between the low and high corn oil fed rats (p = 0.45).There was no significant difference in body weight gain (p = 0.909)or food intake (p = 0.984) between the animals fed broccoli fibreand those fed cellulose diets. (p = 0.909 and p = 0.984, respectively).

3.2. Serum lipids

Cholesterol and triglyceride levels were on average 0.88 and1.81 lmol/l lower in the high corn oil fed rats than in the low cornoil fed rats (p < 0.001, Table 4). Broccoli fibre inclusion also resultedin lower cholesterol and triglyceride levels, with cholesterol(p = 0.047) and triglyceride (p = 0.110) levels, on average, 0.35lmol/l lower with broccoli than with cellulose.

3.3. Faecal bile acids

Generally, there were higher faecal total (primary and second-ary) bile acid concentrations in rats fed high corn oil than in thosefed low corn oil diets (Table 5). The most dominant bile acid groupin faeces was secondary bile acids, which accounted for about 90%of the total bile acids present. For the total primary bile acids, fibretype had no significant effect (p = 0.94). However, an increase infaecal primary bile acid concentrations was observed with ratsfed high corn oil diets (p = 0.001). No significant corn oil � fibreinteractions were observed for secondary or total bile acid faecalconcentrations (p = 0.08, 0.15, respectively), despite the large dif-ferences in concentrations between broccoli and cellulose for highcorn oil-fed rats and the negligible difference for low corn oil-fedrats. This was due to the high levels of variation between ratsand the large numbers of non-detectable values.

There were significant interactions between corn oil levels andfibre types for the faecal biliary concentrations of taurocholic(p = 0.003), taurochenodeoxycholic (p = 0.008), deoxycholic(p = 0.031), and lithocholic (p = 0.037) acids, indicating that theeffects of a low versus a high corn oil diet on the faecal concentra-

Table 3Effects of experimental diets on body weight, and food and energy intake.

High corn oil diet with cellulose High corn oil diet with bro

Body weight gain (g) 224.8 210.3Food intake (g/week) 110.0 110.7Energy (kcal) 520.9 524.2

a Least significant difference (LSD) between two means at the 5% level. Degrees of fre

Table 4Effect of experimental diets on serum lipids (lmol/l).

High corn oil diet with cellulose High corn oil diet with broccoli

Cholesterol 2.64 2.48Triglycerides 1.35 1.27

a Least significant difference (LSD) between two means at the 5% level. Degrees of fre

tions of the bile acids differed between broccoli and cellulose.Regardless of broccoli or cellulose supplementation, animals fedlow corn oil diets had similar levels of the bile acids, with the excep-tion of lithocholic acid. However, consumption of high corn oil re-sulted in increased faecal concentrations of the bile acids withgreater concentrations observed with the broccoli fibre than withcellulose fibre supplementation (Table 5).

For the remaining bile acids, there was an increased faecal bili-ary concentrations of glycochenodeoxycholic, chenodeoxycholicand cholic acids with the high corn oil diet compared with a lowcorn oil diet (p < 0.007), and lower output of hyodeoxycholic acid(p = 0.011). Neither broccoli fibre nor cellulose had a significant ef-fect on the faecal concentrations of these bile acids (p > 0.05 for thefibre effect and the interactions between fibre and corn oil level).Only ursodeoxycholic acid showed a significant effect of fibre type(p = 0.036); broccoli supplementation resulted in greater faecalconcentration of this bile acid than did cellulose diets. In addition,concentrations of ursodeoxycholic acid tended to be higher in highcorn oil-fed rats than those on low corn oil diets, but the effect wasnot significant (p = 0.21, and p = 0.846 for the corn oil � fibreinteraction).

3.4. Hepatic expression of genes encoding proteins involved in lipidmetabolism

Analyses were done using two reference genes, 18s rRNA andGAPDH, to confirm the reproducibility of gene expression data.The results from analyses using the two references genes werecomparable, so only the results for ratios to 18s rRNA are pre-sented. There was increased expression of CPT1a and HMGCRgenes and decreased expression of FAS in rats fed high corn oildiets compared with the low corn oil diet groups (p < 0.001 forCPT1a and HMGCR genes and p = 0.019 for FAS) (Fig. 2). In contrast,there was no significant effect of fibre supplementation or cornoil � fibre interaction on the expression of these genes (p = 0.25,p > 0.05, respectively). However, broccoli fibre supplementationin the diet, regardless of corn oil level, resulted in a significant in-crease in the expression of CYP7A1 (p = 0.018). A minor effect ofcorn oil level was observed for CYP7A1 (p = 0.085), with ratios ofthe high corn oil diets being 0.68 times greater than those forlow corn oil diets. No significant effect on differential expressionwas observed for PPAR-a, SREBF2, low density lipoprotein receptor(LDLR) or apolipoprotein B (APOB) (p = 0.39 or larger for alleffects).

4. Discussion

In this study we determined the effects of corn oil and broccolifibre on lipid metabolism. Overall, our main findings were that

ccoli Low corn oil diet with cellulose Low corn oil diet with broccoli LSDa

171.1 183.4 32.5151.2 150.7 11.1536.3 534.4 47.4

edom (d.f.) are 59.

Low corn oil diet with cellulose Low corn oil diet with broccoli LSDa

3.71 3.17 0.493.43 2.82 0.60

edom (d.f.) are 59.

Table 5Faecal bile acid excretion in rats fed experimental diets (nmol/g).

High corn oil dietwith cellulose

High corn oil diet withbroccoli

Low corn oil diet withcellulose

Low corn oil diet withbroccoli

LSDa d.f.b

Primary bile acidsCholic 45.8 59.0 28.6 15.5 13.3 58Chenodeoxycholic 14.8 20.9 6.8 3.2 4.9 56Glycochenodeoxycholic 1.1 1.2 0.8 0.4 0.3 39Taurocholic 3.8 6.3 0.9 0.7 0.6 58Taurochenodeoxycholic 0.8 1.5 0.2 0.4 0.2 59Secondary bile acidsDeoxycholic 922 1247 512 470 117 59Lithocholic 193 355 135 197 33.3 59Hyodeoxycholic 554 626 774 859 121 56Tertiary bile acidsUrsodeoxycholic 20.5 28.7 14.3 24.2 6.0 50

Total primary bile acids 50.5 66.8 31.4 16.5 13.5 57Total secondary bile acids 1623 2228 1521 1450 266 38Total bile acids 1687 2274 1599 1588 285 33

a Least significant difference (LSD) between two means at the 5% level.b Degrees of freedom (d.f.).The means for the total primary and secondary bile acids and total bile acids do not equal the total of the means for the constituent acids because

it is not possible to calculate a total for any rat with not detectable for any of the acids making up that total. The detection limit was 1.5 nmol/g.

FAS

High-corn oil Low-corn oil0.0

0.2

0.4

0.6

0.8ApoB

High-corn oil Low-corn oil

Targ

et g

ene/

18s

rRN

A ra

tio

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4CPT1a

High-corn oil Low-corn oil0.0

0.2

0.4

0.6

0.8

1.0CYP7A1

High-corn oil Low-corn oil0.0

0.2

0.4

0.6

0.8

1.0

SREBF2

High-corn oil Low-corn oil0.0

0.2

0.4

0.6

0.8

1.0PPAR-α

High-corn oil Low-corn oil0.0

0.2

0.4

0.6

0.8

1.0

1.2LDLR

High-corn oil Low-corn oil0.0

0.2

0.4

0.6

0.8

1.0HMGCR

High-corn oil Low-corn oil

Targ

et g

ene/

18s

rRN

A ra

tio

0.0

0.2

0.4

0.6

0.8

1.0

Fig. 2. Effects of experimental diets on hepatic lipid metabolism gene expression. Ratios are the concentrations of a target gene/concentration of the reference gene(18s rRNA). Broccoli d, Cellulose w. Bars are 95% confidence limits for the means.

1276 T. Mandimika et al. / Food Chemistry 131 (2012) 1272–1278

serum cholesterol and triglyceride levels were significantly lowerin high corn oil diets than in low corn oil diets, whether supple-mented with broccoli fibre or cellulose, and that cholesterol andtriglyceride levels were lower in the broccoli-supplemented groupthan in the cellulose-supplemented group. Broccoli fibre did notappear to augment the effect of high corn oil intakes on lipidmetabolism, although it was more effective in the low corn oil diet.It seems probable that the capacity of the physicochemical proper-ties of broccoli fibre in the diet to alter lipid digestion was over-whelmed in the high corn oil diets, which contained 30% lipidagainst a background of 7.5% dietary fibre, compared with thelow corn oil diets in which the ratio was 5% lipid to 7.5% dietary fi-bre. The efficacy of the broccoli fibre in the low corn oil diet may be

due to its physical properties, reducing small intestinal lipidabsorption and/or bile acid recycling through the terminal ileum.On the other hand, the lipid-lowering effects of corn oil may bedue to its alteration of hepatic expression of lipid metabolism-related genes, affecting lipid synthesis and increased rate of choles-terol catabolism to bile acids. This study is in agreement with pre-vious studies that have observed a hypolipidemic effect of corn oiland soluble fibres (Rideout et al., 2008; Wagner et al., 2001).

Serum triglycerides were lower in rats fed high corn oil dietsthan in low corn oil-fed rats. Similarly, inclusion of broccoli fibrein the diets tended to reduce serum triglyceride levels. In compar-ison to cellulose diets, the addition of broccoli fibre to high corn oildiet showed an approximately 6% decrease in cholesterol and

T. Mandimika et al. / Food Chemistry 131 (2012) 1272–1278 1277

triglycerides levels whereas, in low corn oil diets, broccoli fibrelowered cholesterol and triglyceride levels by approximately 15%and 18%, respectively. Triglyceride levels can be lowered by eithera decrease in the absorption of lipids from the small intestine or bystimulation of fatty acid oxidation in the liver (Hosomi et al., 2009).For the rats fed high corn oil diets, we observed an induction inexpression of CPT1a in the liver; however, broccoli fibre supple-mentation had no significant effect. CPT1a is the rate limiting genein fatty acids b-oxidation; it encodes a protein that stimulates syn-thesis of carnitine, directing fatty acids towards b-oxidation in-stead of promoting fatty acid synthesis. A decrease in CPT1aactivity can lead to increased hepatic cholesterol and triglyceridesin vivo (Bergstrom, Wong, Edwards, & Edmond, 1984; Fungwe, Ca-gen, Cook, Wilcox, & Heimberg, 1993). The increased expression ofCPT1a in high corn oil-fed rats may explain the decrease in serumcholesterol and triglyceride levels observed. However, no signifi-cant induction of PPAR-a, a transcription factor that upregulatesgenes involved in fatty acid and lipid catabolism, was observed.It is probable that the decrease in triglyceride levels in animalsfed high corn oil diets may be due in part to the stimulation of fattyacid b-oxidation. On the other hand, the observed decrease in tri-glyceride levels, due to broccoli fibre supplementation, may be aresult of interference of the fibre with intestinal lipid absorption,due to its viscosity or binding properties (Moundras, Behr, Remesy,& Demigne, 1997). More studies are required to conclusively iden-tify the exact mechanism(s) of triglyceride lowering by broccolifibre.

Significant lowering of serum cholesterol was observed withboth high corn oil diets and broccoli fibre supplementation andthe investigation of the expression of various genes encoding pro-teins involved in cholesterol metabolism helped elucidate the pos-sible mechanism(s). High corn oil diets significantly increasedHMGCR expression (the rate limiting gene in cholesterol synthesis)and decreased FAS expression. Increased expression of HMGCRsuggests that the lowering of serum cholesterol levels in the ratsfed high corn oil diets was sufficient to induce hepatic cholesterolbiosynthesis. It is known that induction of this gene is via a positivefeedback mechanism, following appearance of low serum choles-terol levels (Goldstein & Brown, 1990). Howell et al. (1998) specu-lated that corn oil, through its phytosterol content, reducescholesterol absorption from the gut, which consequently lowersbody pools and enhances hepatic synthesis of cholesterol throughinduction of cellular HMGCR activity. In addition, this inductionmay indicate the loss of cholesterol from the body pool into faecalsteroid excretion (Moundras et al., 1997). Reinforcing this was theincrease in faecal bile acid concentrations observed in animals fedhigh corn oil diets rather than low corn oil diets. Broccoli fibre sup-plementation had no effect on HMGCR or FAS genes but inducedthe expression of CYP7A1. CYP7A1 encodes a key enzyme in thesynthesis of bile acids from cholesterol; excess hepatic cholesterolis usually eliminated via bile acids synthesis (Horton, Cuthbert, &Spady, 1994). A more pronounced increase in faecal bile acid con-centrations was observed with rats fed a high corn oil diet supple-mented with broccoli fibre. Increase in faecal loss of bile acids mayhave resulted in an increase in the demand for cholesterol for denovo synthesis of bile acids, thus resulting in lowering of serumcholesterol.

The SREBF2 gene, the master regulator of cholesterol biosyn-thesis, was not differentially expressed by any of the experimen-tal diets. However, it is known that SREBF2 activity is also posttranslationally regulated and, in our current studies, we did notdetermine the nuclear levels of this protein. Therefore, our studydoes not rule out the possibility of either broccoli fibre or highcorn oil regulating SREBF2 activity. Surprisingly, expression ofthe LDLR gene was not significantly affected by our experimentaldiets; LDLR encodes low-density lipoprotein (LDL) receptors that

are associated with increased faecal excretion of bile acids andcholesterol. LDL receptor expression is controlled by feedbackinhibition of intracellular cholesterol; a decrease in hepaticcholesterol accumulation stimulates production of more highaffinity LDL receptors, which results in increased clearance ofcholesterol from the circulation by LDL receptor and thus lowersblood cholesterol (Horton et al., 1994; Spady, Turley, & Dietschy,1985).

It is likely that broccoli fibre and corn oil are lowering serumcholesterol levels via different mechanisms. The hypocholestero-lemic effects of broccoli supplementation in the diet may bemainly due to a reduction of the reabsorption of bile acids at theterminal ileum for enterohepatic recycling and an increase incatabolism of cholesterol to bile acids and not by the suppressionof the rate of cholesterol synthesis (Ramjiganesh et al., 2000). Stud-ies have shown that soluble fibres reduce serum cholesterol byaltering the composition of enterohepatic bile acid pools and byincreasing the faecal loss of total bile acids (Jones, Begley, Hill, Ga-han, & Marchesi, 2008; Rideout et al., 2008; Ridlon, Kang, & Hylem-on, 2006). Broccoli fibre may also have a physical effect, resultingin reducing intestinal lipid absorption and/or increasing luminalbinding of bile acids (Matheson, Colon, & Story, 1995), while thehypocholesterolemic effects of corn oil may be due to both its sup-pression of cholesterol/lipid synthesis and its effect on increasingthe catabolism rate of cholesterol to bile acids.

In a previous study (Paturi et al., 2010), we found differences incaecum microbiota composition between rats fed high and lowcorn oil diets supplemented with broccoli. A significant increasein Bifidobacterium spp. was observed in animals fed high corn oildiets. In addition, an increase in Bifidobacterium spp. was also ob-served with broccoli supplementation, regardless of corn oil level,though not significant. We also observed an increase in the Clos-tridium perfringens in animals fed a high corn oil diet and an in-crease of Lactobacillus spp. in animals fed a diet supplementedwith broccoli. These results may be correlated with the currentstudy where we observed increased faecal bile acid concentrationsin animals fed high corn oil diets and broccoli fibre. These bacteriamay be aiding in the deconjugation (via their bile salt hydrolaseactivity) and modification (for example, 7-a/b dehydroxylation)of conjugated bile acids to generate free bile acids, which are read-ily excreted in faeces (Begley, Hill, & Gahan, 2006; Jones et al.,2008; Ridlon et al., 2006).

In summary, our study shows that broccoli fibre and high die-tary corn oil levels result in lower serum cholesterol and triglycer-ides, which is likely to be a result of an increase in faecal bile acidexcretion and regulation of various genes involved in lipid metab-olism. Despite differences in cholesterol metabolism between hu-mans and rats, the rat has proved to be a useful model ofcholesterol lowering by dietary fibre due to its sensitivity to bileacid depletion and SCFA production (Hara, Haga, Aoyama, & Kiriy-ama, 1999; Roldan-Marin et al., 2010). Further, our study did notdelineate whether the observed lowering of serum cholesteroltranslates into lowering of LDL, which is associated with increasedrisk of coronary disease. Therefore, further work, investigating theinfluence of dietary interactions between PUFAs and dietary broc-coli fibre on different lipoproteins and their impact on health out-comes, is warranted. This will contribute to the development/identification of effective cholesterol/triglyceride-lowering func-tional foods.

Acknowledgements

We would like to acknowledge Sheridan Martell, Janice Rhodesand Hannah Smith for their technical assistance during the animaltrial. This study was funded by a Plant and Food Research GutActivity Strategic Science Investment.

1278 T. Mandimika et al. / Food Chemistry 131 (2012) 1272–1278

References

Alvaro, A., Sola, R., Rosales, R., Ribalta, J., Anguera, A., Masana, L., et al. (2008). Geneexpression analysis of a human enterocyte cell line reveals downregulation ofcholesterol biosynthesis in response to short-chain fatty acids. IUBMB Life, 60,757–764.

Begley, M., Hill, C., & Gahan, C. G. M. (2006). Bile salt hydrolase activity in probiotics.Applied and Environmental Microbiology, 72, 1729–1738.

Bergstrom, J. D., Wong, G. A., Edwards, P. A., & Edmond, J. (1984). The regulation ofacetoacetyl-CoA synthetase activity by modulators of cholesterol synthesisin vivo and the utilization of acetoacetate for cholesterogenesis. Journal ofBiological Chemistry, 259, 14548–14553.

Clarke, S. D. (2004). The multi-dimensional regulation of gene expression by fattyacids: Polyunsaturated fats as nutrient sensors. Current Opinion in Lipidology, 15,13–18.

Dupont, J., White, P., Carpenter, M., Schaefer, E., Meydani, S., Elson, C., et al. (1990).Food uses and health effects of corn oil. Journal of the American College ofNutrition, 9, 438–470.

Fernandez, M.-L. (2001). Soluble fiber and nondigestible carbohydrate effects onplasma lipids and cardiovascular risk. Current Opinion in Lipidology, 12, 35–40.

Fungwe, T. V., Cagen, L. M., Cook, G. A., Wilcox, H. G., & Heimberg, M. (1993). Dietarycholesterol stimulates hepatic biosynthesis of triglyceride and reducesoxidation of fatty acids in the rat. Journal of Lipid Research, 34, 933–941.

Goldstein, J. L., & Brown, M. S. (1990). Regulation of the mevalonate pathway.Nature, 343, 425–430.

Hara, H., Haga, S., Aoyama, Y., & Kiriyama, S. (1999). Short-chain fatty acids suppresscholesterol synthesis in rat liver and intestine. Journal of Nutrition, 129, 942–948.

Horton, J. D., Cuthbert, J. A., & Spady, D. K. (1994). Regulation of hepatic 7alpha-hydroxylase expression by dietary psyllium in the hamster. Journal of ClinicalInvestigation, 93, 2084–2092.

Hosomi, R., Fukunaga, K., Arai, H., Nishiyama, T., & Yoshida, M. (2009). Effects ofdietary fish protein on serum and liver lipid concentrations in rats and theexpression of hepatic genes involved in lipid metabolism. Journal of Agriculturaland Food Chemistry, 57, 9256–9262.

Howell, T. J., MacDougall, D. E., & Jones, P. J. H. (1998). Phytosterols partially explaindifferences in cholesterol metabolism caused by corn or olive oil feeding.Journal of Lipid Research, 39, 892–900.

Jones, B. V., Begley, M., Hill, C., Gahan, C. G. M., & Marchesi, J. R. (2008). Functionaland comparative metagenomic analysis of bile salt hydrolase activity in thehuman gut microbiome. Proceedings of the National Academy of Sciences of theUnited States of America, 105, 13580–13585.

Jump, D. B. (2008). N-3 polyunsaturated fatty acid regulation of hepatic genetranscription. Current Opinion in Lipidology, 19, 242–247.

Jump, D. B., Botolin, D., Wang, Y., Xu, J., Christian, B., & Demeure, O. (2005). Fattyacid regulation of hepatic gene transcription. Journal of Nutrition, 135,2503–2506.

Marcil, V., Delvin, E., Seidman, E., Poitras, L., Zoltowska, M., Garofalo, C., et al. (2002).Modulation of lipid synthesis, apolipoprotein biogenesis, and lipoproteinassembly by butyrate. American Journal of Physiology. Gastrointestinal and LiverPhysiology, 283, G340–346.

Matheson, H. B., Colon, I. S., & Story, J. A. (1995). Cholesterol 7{alpha}-hydroxylaseactivity is increased by dietary modification with psyllium hydrocolloid, pectin,cholesterol and cholestyramine in rats. Journal of Nutrition, 125, 454–458.

Moundras, C., Behr, S. R., Remesy, C., & Demigne, C. (1997). Fecal losses of sterolsand bile acids induced by feeding rats guar gum are due to greater pool size andliver bile acid secretion. Journal of Nutrition, 127, 1068–1076.

Paturi, G., Butts, C., Monro, J., Nones, K., Martell, S., Butler, R., et al. (2010). Cecal andcolonic responses in rats fed 5 or 30% corn oil diets containing either 7.5%broccoli dietary fiber or microcrystalline cellulose. Journal of Agricultural andFood Chemistry, 58, 6510–6515.

Ramjiganesh, T., Roy, S., Nicolosi, R. J., Young, T. L., McIntyre, J. C., & Fernandez, M. L.(2000). Corn husk oil lowers plasma LDL cholesterol concentrations bydecreasing cholesterol absorption and altering hepatic cholesterol metabolismin guinea pigs. Journal of Nutritional Biochemistry, 11, 358–366.

Rideout, T., Harding, S., Jones, P., & Fan, M. (2008). Guar gum and similar solublefibers in the regulation of cholesterol metabolism: Current understandings andfuture research priorities. Vascular Health and Risk Management, 4, 1023–1033.

Ridlon, J. M., Kang, D.-J., & Hylemon, P. B. (2006). Bile salt biotransformations byhuman intestinal bacteria. Journal of Lipid Research, 47, 241–259.

Roldan-Marin, E., Jensen, R. I., Krath, B. N., Kristensen, M., Poulsen, M., Cano, M. P.,et al. (2010). An onion byproduct affects plasma lipids in healthy rats. Journal ofAgricultural and Food Chemistry, 58, 5308–5314.

Russo, G. L. (2009). Dietary n-6 and n-3 polyunsaturated fatty acids: Frombiochemistry to clinical implications in cardiovascular prevention. BiochemicalPharmacology, 77, 937–946.

Spady, D. K., Turley, S. D., & Dietschy, J. M. (1985). Rates of low density lipoproteinuptake and cholesterol synthesis are regulated independently in the liver.Journal of Lipid Research, 26, 465–472.

Takahashi, T., Furuichi, Y., Mizuno, T., Kato, M., Tabara, A., Kawada, Y., et al. (2009).Water-holding capacity of insoluble fibre decreases free water and elevatesdigesta viscosity in the rat. Journal of the Science of Food and Agriculture, 89,245–250.

Wagner, K. H., Tomasch, R., & Elmadfa, I. (2001). Impact of diets containing corn oilor olive/sunflower oil mixture on the human plasma and lipoprotein lipidmetabolism. European Journal of Nutrition, 40, 161–167.