Ecdysone agonist inducible transcription in transgenic tobacco plants

TECHNICAL ADVANCE

Ecdysone agonist inducible transcription in transgenictobacco plants

Alberto Martinez*, Caroline Sparks, Cliff A. Hart,

John Thompson and Ian Jepson

ZENECA Agrochemicals, Jealott's Hill Research Station,

Bracknell, Berkshire RG42 6ET, UK

Summary

A novel chemical-induced gene regulatory system for

plants consisting of two molecular components is

described. The ®rst, or regulatory, cassette comprises a

chimeric receptor composed of the hinge and ligand

binding domains of the Heliothis virescens ecdysone

receptor and the transactivation domain of the Herpes

simplex VP16 protein fused to the DNA binding domain

and transactivation of a mammalian glucocorticoid

receptor. The second component, a reporter cassette,

contains six copies of the glucocorticoid response

element (GRE) fused to the minimal 35SCaMV promoter

and b-glucuronidase. The system uses a commercially

available non-steroidal ecdysone agonist, RH5992

(tebufenozide), as an inducer. Activation of gene

expression is shown in both tobacco transient

protoplasts and transgenic plants. The response is

ligand dependent and is modulated by the change in

minimal promoter context. The system is capable of

inducing transgene activity up to 420-fold corresponding

to 150% of the activity observed with positive controls

(35SCaMV:GUS).

Introduction

Regulation of gene expression in a chemical dependent

manner can be achieved by fusion of a transcription factor

of interest to a steroid receptor ligand binding domain

(Aoyama et al., 1995; Lloyd et al., 1994; Simon et al., 1996).

This has been elegantly demonstrated in plants by fusing

factors that regulate trichome development (Lloyd et al.,

1994), leaf morphology (Aoyama et al., 1995) and ¯owering

time (Simon et al., 1996) with the ligand binding domain of

the glucocorticoid receptor (GR). Despite the success of

this approach, not all genes whose activity is to be studied

are transcription factors and, as a result, a more generic

system is required. In an attempt to achieve this objective,

Schena et al. (1991) used the entire GR to activate reporter

gene expression following treatment with dexametha-

sone. Although the GR was shown to activate reporter

gene activity in tobacco mesophyll protoplasts transient

assays (Schena et al., 1991), the same was not observed in

transgenic Arabidopsis plants (Lloyd et al., 1994). More

recently, Aoyama and Chua (1997) showed that a chimeric

receptor containing the Gal4 DNA binding domain fused to

the Herpes simplex VP16 transactivation domain, and that

the GR ligand binding domain induced luciferase activity

in both Arabidopsis and tobacco plants in a dexametha-

sone dependent manner. This system has been further

exempli®ed with the avrRpt2 gene which is involved in

hypersensitive cell death response in Arabidopsis (McNel-

lis et al., 1998). While a number of inducible systems are

available to activate transcription of target genes in plants,

including those containing the GR ligand binding domain

(Aoyama and Chua, 1997; Gatz et al., 1992; Mett et al., 1993;

Weinmann et al., 1994; Williams et al., 1992), none of these

systems are induced by compounds which are suitable for

agricultural use.

In order to develop an inducible system with the

potential for ®eld application, we have used components

of the ecdysone receptor (EcR) which belongs to the

steroid/retinoic acid/thyroid receptor superfamily (Koelle

et al., 1991). Members of the superfamily contain ®ve well-

de®ned domains of which the DNA and ligand binding

domains are best conserved. An advantage of the

ecdysone receptor is the availability of non-steroidal

ecdysone agonists (Heller et al., 1992; Wing et al., 1988;

Wing, 1988). In particular, RH5992 (tebufenozide) has been

shown to be an effective lepidopteran control agent which

lacks phytotoxicity and is currently used on a range of crop

species (Heller et al., 1992). We have isolated the ecdyster-

oid receptor (EcR) of the lepidopteran species Heliothis

virescens (tobacco bud worm) by cDNA library screening

and PCR based on degenerate primers to developmentally

regulated steroid/retinoic acid/thyroid receptor superfam-

ily members (Martinez et al., 1999). In contrast to GR,

which functions as a homodimer, activation of ecdysone

responsive genes is through a heterodimer of the EcR and

ultra-spiracle (USP) (Thomas et al., 1993; Yao et al., 1992;

Yao et al., 1993). In mammalian transient experiments, the

use of the Drosophila ecdysone ligand binding domain

fused to GR transactivation and DNA binding domain

Received 3 February 1999; revised 17 May 1999; accepted 18 May 1999.*For correspondence (fax +44 1344 414996;e-mail [email protected]).

The Plant Journal (1999) 19(1), 97±106

ã 1999 Blackwell Science Ltd 97

activated reporter gene activity in the presence of

muristeroneA (an ecdysone agonist) (Christopherson

et al., 1992). The utilisation of GR negates the need for

heterodimer mediated activation of ecdysone receptor

and provides the basis for regulating gene expression

via a simple chimeric receptor and ecdysone agonist

interaction.

In this paper, we demonstrate the RH5992 dependent

activation of reporter gene activity in transient tobacco leaf

protoplasts and stable tobacco plants transformed with a

chimeric receptor containing the Heliothis virescens ligand

binding domain.

Results and Discussion

The aim of this study was to produce an EcR-based gene

transcription regulation system induced by non-steroidal

ecdysteroid agonists. A chimeric receptor containing the

Heliothis virescens ecdysone receptor ligand binding

domain and GR transactivation and DNA binding domains

was used to study whether reporter gene activity was

altered in an ecdysteroid dependent manner. Tobacco

mesophyll protoplasts were transformed with a reporter

plasmid (p9GRE6, Figure 1a), containing six copies of the

glucocorticoid response element fused to ±60 35SCaMV

minimal promoter and uidA reporter gene (GUS), and the

chimeric receptor (pGRHEcR, Figure 1a) in the presence

and absence of muristeroneA (ecdysone agonist). Figure 2

shows a 5.6-fold elevation in reporter gene activity

following muristeroneA treatment, while the addition of

solvent (DMSO) or GR agonist dexamethasone resulted in

no elevation of reporter gene expression.

Although muristeroneA may have some utility in

research applications, its steroidal nature makes it un-

suitable for ®eld applications because of the structural

complexity for chemical synthesis and stability in the

Figure 1. Schematic representation ofregulator and reporter vectors.(a) Transient expression constructs. Theeffector construct contains theglucocorticoid receptor activation (GR Act)and DNA binding domains (DBD) fused tothe Heliothis ecdysone receptor ligandbinding domain (HEcR LBD). The reporterplasmid contains six copies of theglucocorticoid receptor response element(GRE) fused to the ±60 35SCaMV minimalpromoter (±60 MP) and the b-glucuronidasegene (uidA). Both pGRHEcR and p9GRE6contain the nos terminator sequences.(b) Plant transformation vectors containingthe effector and reporter components of thesystem within the multiple cloning site ofJRI and were assembled as described inExperimental procedures. pES-60 and pES-46 differ from each other in that pES-60contains the ±60 35SCaMV minimalpromoter (±60 MP) and pES-46 contains the±46 35SCaMV minimal promoter (±46 MP) inthe reporter gene portion of the construct.

98 Alberto Martinez et al.

ã Blackwell Science Ltd, The Plant Journal, (1999), 19, 97±106

environment. Non-steroidal commercial agrochemicals

with ecdysone agonist activity have been described

previously (Wing et al., 1988; Wing, 1988), and one

example is RH5992 which is currently used to control

insect pests on vine and horticulture (Heller et al., 1992).

Tobacco leaf protoplast transformations using pGRHEcR

and reporter gene construct in the presence of 10 mM

RH5992 resulted in a 10-fold increase in reporter gene

activity over the DMSO solvent treated control (Figure 3).

Comparable levels of expression are observed with 1 mM

RH5992 and 100 mM muristeroneA. The reporter gene

activity observed following muristeroneA and RH5992

treatment was 1/12 that of 35SCaMV:GUS positive control.

A comparison of the EcR fusion to GR reveals higher levels

of induced expression to those seen for the intact

glucocorticoid receptor (data not shown).

Although the GR receptor has been shown to induce

reporter gene expression in tobacco protoplasts (Schena

et al., 1991), stable transformants containing the intact GR

receptor failed to induce reporter gene activity in the

presence of dexamethasone (Lloyd et al., 1994). In an

attempt to elevate the levels of gene expression, a new

chimeric receptor was constructed by inserting the trans-

activation domain of the Herpes simplex VP16 protein

(amino acids 410±490) into the GR transactivation region.

Plant transformation vectors containing a regulator cas-

sette with the VP16 transactivation domain and the

reporter cassette comprising six copies of the GRE fused

to either ±46 or ±60 minimal CaMV 35S promoter (pES-46

and pES-60, respectively) were generated (Figure 1b).

Agrobacterium transformation of tobacco with pES-46

generated 60 primary transformants of which 38 were

found by PCR to contain both regulator and reporter

cassettes components. Progeny seed from 27 independent

transformants were assayed for inducible reporter expres-

sion in the presence of muristeroneA. ES-46 seed was

Figure 2. Induction of GUS activity by muristeroneA in transient assays.Tobacco protoplasts were transformed with pGRHEcR regulator constructand reporter plasmid (p9GRE6) in the presence or absence of 100 mM

muristeroneA (MurA) or 100 mM dexamethasone (Dex) and carrierdimethylsulphoxide (DMSO). Each data point is the result of threetransformations and the error bars depict standard error.

Figure 3. GUS activity is induced by RH5992 in transient assays.Tobacco leaf protoplasts were transformed with pGRHEcR and reporterplasmid (p9GRE6) in the presence or absence of 10 mM and 1 mM RH5992.Each data point is the result of three transformations and the error barsdepict standard error.

Figure 4. Reporter gene expression is inducible with muristeroneA.(a) ES-46 transgenic seedlings are inducible with muristeroneA. Seedfrom self-pollinated primary transformant transgenic plants wasgerminated and incubated in the presence or absence of 0.4 mM

muristeroneA for 2 days post-germination.(b) ES-60 tobacco seedlings are inducible with muristeroneA. Self-pollinated seed from primary transformants was germinated andincubated in the presence or absence of 0.4 mM muristeroneA for 2 dayspost-germination. Data points refer to three replicates of 10 seedlingseach. The error bars represent standard error.

Inducible transcription in tobacco plants 99


germinated in the presence of 0.4 mM muristeroneA and

collected 2 days post-cotyledon emergence. A range of

GUS expression levels following chemical treatment was

observed. Figure 4(a) shows results from independent

transformants of ES-46 population, where ES-46-20 and

ES-46-40 have consistently been induced by ®vefold and

sevenfold with 0.4 mM muristeroneA. The levels of in-

duced GUS expression were up to 1/12 that of a high

expressing tobacco transgenic plants containing a

35SCaMV:GUS construct. Although levels of induced

expression are small relative to the positive control, the

background levels are comparable to wild-type tobacco

negative controls.

A plant population of 70 ES-60 transgenic tobacco plants

was generated using Agrobacterium transformation and

was screened by PCR for the presence of regulator and

reporter cassettes. Seedlings from 40 ES-60 independent

primary transformants were screened for inducible repor-

ter gene expression following treatment with murister-

oneA. Figure 4(b) shows a representative sample of

induction levels observed for the ES-60 plant population.

The levels of induction seen after the addition of inducer

ranged from two- to 420-fold. The induced levels of

reporter gene activity detected varied from 20 to 150% of

the activity observed in a high expressing homozygous

tobacco line containing 35SCaMV:GUS (selected from an

equivalent size transgenic population).

Independent transformants from both plant populations

show variability in reporter gene expression which may be

attributed to position effect of the inserted T-DNA in the

genome. This phenomena is observed with both constitu-

tively expressed genes and inducible systems in plants

(Salter et al., 1998) and mammals (Furth et al., 1994; No

et al., 1996; Shockett et al., 1995; Wang et al., 1997).

Although line to line variability is expected, the variability

in induced samples within a line is comparable to what has

been observed with other plant inducible systems

(Aoyama and Chua, 1997; Gatz et al., 1992; Mett et al.,

1993; Salter et al., 1998; Weinmann et al., 1994).

Induced levels in ES-60 plants were up to 20-fold higher

than in ES-46 plants, although the uninduced levels of

expression in independent transgenic lines varied between

1 and 5% of the activity of 35SCaMV:GUS plants and up to

10 times higher than that exhibited by wild-type tobacco.

The minimal promoter region of the reporter appears to

play an important role in the level of induction observed

following the addition of inducer chemical. The stringent

activity of the ±46 35SCaMV minimal promoter may be due

to a change in the distance between the TATA box and the

GRE sequences or to the deletion of a CCAAT-like box

present in the ±60 35SCaMV promoter (Ow et al., 1987).

The latter suggests interactions between the chimeric

receptor and transacting factors binding to the ±60

35SCaMV minimal promoter but not the ±46 35SCaMV

minimal promoter. For applications where low levels of

expression from low background are desired, manipula-

tion of the minimal promoter may be a useful approach to

modulate levels of expression. The uninduced levels of

expression in ES-60 plants may be addressed by studying

the behaviour of different minimal promoters.

Induction of ES-60 and ES-46 plants with muristeroneA

demonstrates that the ecdysone receptor inducible system

is active in plants. Three single locus insert ES-60 lines

were used to study the effect of the non-steroidal

compound RH5992 on reporter gene activity. ES-60 seed

was imbibed in 1/2MS media containing 50 mM RH5992 and

seedlings were collected 2 days post-cotyledon emer-

gence. The three lines show different induction levels

consistent with those observed in Figure 4(b) for the same

lines (Figure 5). However, the amount of chemical used to

Figure 5. ES-60 seedlings respond to RH5992 and muristeroneA.ES-60-44, ES-60-37 and ES-60-64 transgenic self-pollinated seed fromprimary transformants was germinated and incubated in the presence orabsence of 0.4 mM muristeroneA or 0.1 mM RH5992 for 2 days post-germination. 35SCaMV:GUS and wild-type (wt) seedlings were collectedat the same developmental stage and assessed for GUS activity. Datapoints refer to three replicates of 10 seedlings each. The error barsrepresent standard error.

Figure 6. A dose response for the non-steroidal inducer of the ecdysonereceptor switch.Homozygous seed from ES-60-44 plant was grown for 2 days in thepresence of different amounts of RH5992. The concentration of thecompound ranged from 75 mM to 250 nM. Data points refer to threereplicates of 10 seedlings each. The error bars represent standard error.



elicit comparable levels of induction is two orders of

magnitude lower when using RH5992. Equivalent results

showing that RH5992 was more potent were observed

during the evaluation of the system in transient expression

experiments (Figures 2 and 3). ES-60-02 transgenic seed-

lings treated in the same manner as described above were

used to assess the saturation of GUS activity with

increasing amounts of the inducer. Figure 6 shows that

Figure 7. Histochemical staining of GUS activity from ES-60 seedlings induced with RH5992.ES-60-02 transgenic was germinated and incubated in the presence of (a) DMSO and (b) RH5992 (50 mM). The 35SCaMV:GUS (c) seedling shows similarstaining distribution to that seen in induced ES-60-02. Detailed images of cotyledons under bright ®eld lighting (d and e), dark ®eld lighting showing tipsof the cotyledons (f and g), cross section through a minor vein of cotyledons (h and i), hypocotyl (bright ®eld, j, k and dark ®eld n, o) and radicle (in bright®eld l, m and in dark ®eld p, q) show similar patterns of expression between ES-60-02 seedlings induced with 50 mM RH5992 (d, f, h, k, m and o) and35SCaMV:GUS seedlings (e, g, i, l, n and p).



maximal activation of the reporter gene is achieved with

12.5 mM RH5992. The system is activated by 0.05 mM

RH5992 which compares favourably to the concentration

range reported for the glucocorticoid receptor based

transcription induction system (Aoyama and Chua, 1997).

In order to examine the spatial regulation of GUS

expression following RH5992 treatment of ES-60 lines, a

histochemical staining approach was adopted. No visible

staining was observed when seedlings were grown in the

absence of inducer (Figure 7a). ES-60 seedlings grown in

the presence of RH5992 show signi®cant staining in the

cotyledons and radicle comparable to that observed with

35SCaMV:GUS material (Figure 7b,c). Detailed analysis of

both 35SCaMV:GUS positive control and ES-60-02 treated

seedlings shows that in both sets of seedlings GUS

staining is observed throughout the cotyledons with

accumulation of stain in the vascular bundles (Figure

7d,f,h compared to Figure 7e,g,i). A cross-section of a

minor vein of the cotyledons shows that the epidermis cell

layer and vascular cells are preferentially stained in both

35SCaMV:GUS and ES-60-02 treated seedlings (Figure 7f,h

compared to Figure 7g,i). In the hypocotyl (Figure 7j,n

compared to Figure 7k,o), radicle and root hairs (Figure

7l,p compared to Figure 7m,q), a similar distribution of

stain is observed for both 35SCaMV:GUS and ES-60-02

treated seedlings (Figure 7). This observation may be

explained by the fact that the effector cassette of the

inducible system uses 35SCaMV promoter.

Seedlings grown in the presence of RH5992 for a period

of 20 days show maximal activation by day 5 after seed

imbibition (260-fold) but signi®cant levels of GUS expres-

sion still remain after day 20 (23-fold) (Figure 8a). A higher

resolution investigation of the levels of reporter gene

induction after seed imbibition was carried out using

35S:GUS transgenic seed (as positive control), wild-type

seed (as negative control) grown in the presence of DMSO,

and ES-60-02 transgenic seed grown in DMSO and

RH5992. Samples of seedlings were collected at the same

developmental stages and GUS reporter gene activity was

analysed. 35SCaMV promoter activity in the ®rst 24 h after

Figure 8. Time course of ecdysone induciblegene system activation in tobacco seedlings.(a) ES-60-02 seedlings were grown in thepresence of 50 mM RH5992 and solvent alonefor a period of 20 days after seed imbibition.(b) High resolution time course on wild-type(wt) 35SCaMV:GUS and ES-60-02 seedlings.ES-60-02 seedlings were grown in mediasupplemented with DMSO alone (solvent)or 50 mM RH5992 while wild-type and35SCaMV:GUS seedlings were grown inDMSO. Samples were collected at differenttime points and GUS activity assessed. Forboth (a) and (b) the data points refer to threereplicates of 10 seedlings each. The errorbars represent standard error.



seed imbibition, as monitored by the 35S:GUS transgenic

seedlings, is below 50 units (nmoles 4-MU h±1 mg±1

protein) (Figure 8b). Similarly, induction of the reporter

gene expression in the ES-60-02 seedlings resembles that

of the 35SCaMV. It is only when signi®cant levels of

35SCaMV promoter activity (73 h onwards) are observed

that the inducibility of the system is signi®cant. Therefore,

the activity of the promoter driving the effector molecule of

the inducible system plays an important role in the

behaviour of the induced gene and hence the temporal,

developmental and activity levels of the promoter should

be carefully examined. This hypothesis could be tested by

replacing the 35SCaMV promoter with an alternative

promoter which drives high expression levels earlier in

germination. The inducibility of the system may also be

affected by the uptake of the inducer and the lag observed

in activation of reporter gene activity may be a result of the

time required to have adequate levels of activator protein

and inducer chemical in the cell. Experiments are being

carried out to determine whether the kinetics of the GUS

induction is a result of chemical uptake, metabolism of

inducer, regulator protein promoter activity, desensitisa-

tion of the regulator or a combination of different factors.

The evidence shown in this paper suggests that the

induction kinetics of the system is a result of complex

chemical and regulator protein interactions.

Finally, Figure 8(b) shows that wild-type seedling gene

activity is similar to that of the DMSO treated ES-60-02

seedlings. This shows, therefore, that within a population

of transgenic plants containing the ES-60 version of the

inducible gene expression system, a plant can be selected

which has low background activity (Figure 8b) and is

highly inducible (Figures 4b and 7).

In this paper we describe a novel chemically regulated

transcription system based on the Heliothis virescens

ecdysone receptor which exhibits high levels of induced

gene expression. The system is induced by both steroid

and commercial ecdysteroid agonists which show no

detrimental effects on plant growth in our studies.

RH5992 activates reporter gene expression throughout

the seedling and the response is dose dependent. The

inducible system is ¯exible, in that a strong activator (i.e.

VP16) has been successfully used to enhance performance

while different minimal promoters were shown to have

signi®cant effects on levels of basal and induced reporter

gene expression. The system described has potential for

both research and commercial applications.

Experimental procedures

Vector construction

Glucocorticoid receptor transactivation and DNA binding

domains. Ampli®cation of the N-terminal end and DNA binding

domain of the glucocorticoid receptor (amino acids 1±500 of thehuman glucocorticoid receptor) was performed by PCR. The 5¢end PCR primer contained an EcoRI site and the Kozak consensussequence (Kozak, 1989) for translation initiation (sense oligonu-cleotide GREcoRI 5¢attgaattccaccatggactccaagaatcattaactc 3¢). The3¢ end primer contained an XhoI site in frame with the readingframe at amino acid 500 of hGR (antisense oligonucleotideGRXhoI 5¢ gagactcctgtagtggcctcgagcattccttttatttttttc 3¢). PCR wascarried out under hot start conditions followed by 15 cycles ofdenaturing (94°C for 1 min), annealing (66°C for 1 min) andsynthesis (72°C for 3 min) using 107 Pfu of a human ®brosarcomacDNA library (Clontech) as a template and Vent polymerase(Biolabs). The PCR products were digested and ligated intopBluescript SK (pSK) EcoRI/XhoI. The resulting plasmid pSKGRNwas sequenced and found to lack mutations when compared tothe published sequence (Hollenberg et al., 1985).

Construction of the Glucocorticoid/Heliothis ecdysone

chimeric receptor tobacco transient expression plasmid

(pGRHEcR). The production of the Heliothis virescens ecdysonereceptor (Martinez et al., 1999; EMBL accession number Y09009)portion involved the introduction of an SalI recognition site at theDNA binding/hinge domain junction (amino acid 229). The SalIsite (sense oligonucleotide Hecrsal 5¢attgtcgacaaaggcccgagtgc-gtggtgccggag 3¢) was introduced via PCR mutagenesis using theunique AccI site 107 bp upstream of the junction point (antisenseoligonucleotide hecracc 5¢ tcacattgcatgatgggaggcatg 3¢). The PCRreaction was carried out using Taq polymerase (2.5 U) in themanufacturer's reaction buffer containing 100 ng of template DNA(pSK19R), 100 ng of Hecrsal and 50 mM dNTPs with the sameconditions as described above. The DNA was digested andsubcloned into pSK SalI/SacI with the 1.2kb AccI/SacI 3¢ end HEcRfragment to yield pSKHEcRDEF. To construct the tobaccotransient expression plasmid containing the glucocorticoid/Heliothis ecdysone chimeric receptor, a ligation of pMFt EcoRI/SacI with the 1.5 kb EcoRI/XhoI fragment of GR and the 1.3 kb SalI/SacI fragment of pSK HEcRDEF to yield pMFtGRHEcR (pGRHEcR).The vector pMFt is an intronless derivative of pMF6 (Goff et al.,1990).

Construction of the tobacco expression construct contain-

ing VP16 transactivation sequences (GRVHEcR) The con-struction of this chimeric receptor is based upon replacing thesequences encoding for the GR transactivating domain (aminoacid 153±405) with those belonging to the VP16 protein of Herpessimplex (amino acid 411±490) (Dalrymple et al., 1985). A 2.2 kbEcoRV/NotI GRVP16HEcR fragment was introduced into apcDNA3 EcoRV/NotI vector (InVitrogen) resulting in pcDNA3GRV-P16HEcR. A 2.2 kb BamHI DNA fragment was isolated frompcDNA3GRVP16HEcR and ligated into the pMFt BamHI vector toproduce pMFtGRVP16HEcR (pGRVHEcR).

Construction of reporter plasmid. The reporter plasmids weremade by inserting into the pBI221.9 and pBI221.10 BamHI/HindIIIvectors two pairs of oligonucleotides containing six copies of theglucocorticoid response element (GRE). pBI221.9 contains the ±60CaMV minimal promoter fused to the b-glucuronidase gene andthe nos terminator in pUC18. In pBI221.10 the ±60 CaMV minimalpromoter has been replaced by the ±46 CaMV minimal promoter.The ®rst oligonucleotide pair GRE1 A/B when annealed resulted ina dsDNA fragment ¯anked with an HindIII site at the 5¢ end and anSalI site at the 3¢ end (sense oligonucleotide GRE1 A 5¢agcttcgactgtacaggatgttctagctactcgagtagctagaacatcctgtacagtcgag-



tagctagaacatcctgtacag 3¢, antisense oligonucleotide GRE1B 5¢tcgactgtacaggatgttctagctactcgactgtacaggatgttctagctactcgagtcgcta-gaacatcctgtacagtcga 3¢). The second pair of oligonucleotides is¯anked by an SalI site at the 5¢ end and a BamHI site at the 3¢ end(sense oligonucleotide GRE2 A 5¢ tcgactagctagaacatcctgtacagtcg-agtagctagaacatcctgtacagtcgagtagctagaacatcctgtacag 3¢, antisenseoligonucleotide GRE2B 5¢ gatcctgtacaggatgttctagc tactcgactgt-acaggatgttctagctactcgactgtacaggatgttctagctag 3¢). The resultingplasmids were named p9GRE6 and p10GRE6 (Figure 1).

Plant transformation constructs

This method involves three steps. pBluescript SK HindIII/EcoRIvector was ligated to either GRE6-4635SCaMV:GUSNOS HindIII/EcoRI from pBI221.10GRE6 or GRE6-6035SCaMV:GUSNOS Hin-dIII/EcoRI from pBI221.9GRE6 resulting in plasmid pSK-46 andpSK-60. The second step comprised of the insertion ofthe chimeric receptor (35SCaMV:GRVP16HEcRNOS) into the XbaIof pSK-60 or pSK-46 to produce pSKES-60 (pSKGRE6±6035SCaMV:GUSNOS-35SCaMV:GRVP16HEcRNOS) and pSKES-46 (pSKGRE6±4635SCaMV:GUSNOS-35SCaMV:GRVP16HEcR-NOS) (Figure 1). The third step involved the transfer frompBluescript based vectors to binary vectors and comprises of afurther ®ve steps. The digestion of ES-60 and ES-46 with ApaI andNotI was followed by BamHI methylation, according to manufac-turer's instructions (Biolabs). An ApaI/NotI linker with an internalBamHI site was ligated to the protected fragment (senseApaBNot1 5¢cgattcctaggttac 3¢ and antisense ApaBNot25¢ggccgctaaggatccaatgggcc 3¢). The protected and linkered frag-ment was digested with BamHI. The protected DNA fragment(5.5 kb) was ligated into a pJRI BamHI vector to produce pES-60 orpES-46. The DNA of the recombinant was characterised byrestriction mapping and the sequence of the junctions deter-mined.

Tobacco protoplast transformation

Tobacco shoot cultures cv. Samsun maintained on solidi®ed MSmedium containing 3% sucrose in a controlled environment (16 hday/8 h night at 25°C, 55% relative humidity) were used as thesource material for protoplasts. Leaves were sliced parallel to themid-rib (discarding large veins) and the slices were placed inCPW13 M (13% mannitol, pH 5.6, 860 mmol kg±1) for 1 h to pre-plasmolyse the cells. This solution was replaced with enzymemixture (0.2% cellulase R10, 0.05% macerozyme R10 in CPW9 M

(CPW13 M but 9% mannitol), pH 5.6, 600 mmol kg±1) and incubatedin the dark at 25°C overnight (16 h). The enzyme mixture waspassed through a 75 mm sieve and the ®ltrate was centrifuged at600 rpm for 3.5 min, discarding the supernatant. The pellet wasresuspended in 0.6 M sucrose solution and centrifuged at 1000 gfor 10 min. The protoplasts were removed and diluted withCPW9 M (pH 5.6, 560 mmol kg±1) and pelleted by centrifuging at1000 g for 3.5 min. The protoplasts were resuspended in CPW9 M,counted, diluted to 2 3 106 ml±1 in MaMg medium (Negrutiu et al.,1987), and aliquotted at 4 3 105 protoplasts per treatment.Twenty mg each of pMFtGRHEcRS and p9GRE6 DNA (1 mg ml±1)were added, followed by 200 ml of PEG solution (Negrutui et al.,1987). The protoplasts were incubated at room temperature for10 min before the addition of 5 ml MSP19 M medium (MSmedium, 3% sucrose, 9% mannitol, 2 mg l±1 NAA, 0.5 mg l±1 BAP,pH 5.6, 700 mmol kg±1) in the presence or absence of ligand. Theprotoplasts were cultured in their tubes lying horizontally at 25°C.The protoplasts were harvested for the GUS assay after 24 h.

Tobacco plant transformation

The plant transformation construct pES-60 and pES-46, contain-ing a chimeric ecdysone receptor and a reporter gene cassette,were transformed into Agrobacteriun tumefaciens LBA4404 usingthe freeze/thaw method described by Holsters et al. (1978).Tobacco (Nicotiana tabacum cv Samsun) transformants wereproduced by the leaf disc method (Horsch et al., 1988). Shootswere regenerated on medium containing 100 mg l±1 kananmycin.After rooting, plantlets were transferred to the glasshouse andgrown under 16 h light/8 h dark conditions.

PCR analysis

Analysis of transgenic tobacco plants by PCR was carried outusing leaf samples extracted in 300 ml of extraction buffer. TheDNA was precipitated with isopropanol at 4°C for 10 min and thencentrifuged. Pellet was dried and resuspended in 100 ml of TE(10 mM Tris HCl pH 8.0, 1 mM EDTA). 2.5 ml were placed in a 500 mlEppendorf tube and a master mix containing buffer, dNTPs andoligonucleotides was added. The Taq polymerase (Gibco-BRL)was added after samples were denatured for 3 min.

Chemical treatments

MuristeroneA (Sigma) and RH5992 were dissolved in DMSO(Sigma) and the stock maintained at ±20°C. The RH5992 stock was2 mg ml±1 or 5.4 3 10±4

M while muristeroneA was 1.5 3 10±3M. The

compounds were diluted in growth media used to germinateseedlings. Uninduced seedlings were treated with an equivalentamount of DMSO. Seeds were germinated in MS mediasupplemented with 0.8% (w/v) agar. Seedlings were collectedfor analysis 2 days after chemical treatment.

GUS assays

Transient transformed tobacco protoplasts were harvested bycentrifugation at 2000 g The supernatant was discarded and theprotoplasts resuspended in GUS extraction buffer (Jeffersonet al., 1987) for the preparation of b-glucuronidase extracts. Thetubes were vortexed for 1 min and then spun at 12 000 g for 2 min.The supernatant was collected and placed in a fresh Eppendorftube. Twenty ml of the extract were used in the GUS assays.Fluorometric assays for GUS activity were performed with thesubstrate 4-methylumbelliferyl-D-glucuronide (Sigma) using aPerkin-Elmer LS-35 ¯uorometer (Jefferson et al., 1987). Proteinconcentration of tissue homogenates were determined by theBio-Rad protein assay (Bradford, 1976). In seedling inductionexperiments, 10 2-day-old seedlings were collected and ¯ashfrozen in liquid nitrogen. The seedlings were homogenised in300 ml of GUS extraction buffer and centrifuged for 5 min at12 000 g. The supernatant was used for both GUS and Bio-Radprotein assays.

GUS staining

GUS staining was carried out on 2-day induced seedlings. Theseedlings were placed in 1 ml of histochemical stain (0.1 M

NaPO4 pH 7.0, 0.5 mM potassium ferricyanide, 0.5 mM potas-sium ferrocyanide, 1 mM X-glucuronide (Sigma) and 0.1%Triton X-100 (Sigma) and vacuum in®ltrated for 10 min. Theseedlings were incubated at 37°C for 16 h followed by de-



staining with several changes of absolute ethanol for at least4 h at 4°C. Tissues were observed under a dissection micro-scope and photographed.

Histology

Following GUS staining, uncleared whole seedlings were ®xedovernight in 0.1 M phosphate buffered 4% para-formaldehyde+1% glutaraldehyde with 2.5% sucrose at pH 7.4. The tissue wasthen passed through a graded series of 0.3 M and 0.75 M sucroseto 1.5 M sucrose as a cryoprotectant. Seedlings were attached inMiles OCT/4583 Tissue-Tek compound to pieces of ®lter paperbefore freezing in liquid nitrogen. The frozen tissue was mountedonto a pre-cooled aluminium stub before 12±18 mm sections werecut at ±22°C in a Bright's OTF/5030 Cryostat microtome. Sectionswere collected onto cooled microscope slides before bringing upto room temperature and mounting in 1.5 M sucrose undercoverslips. Unfrozen whole seedlings were also similarly pre-pared for light microscopy. Uncleared and non-dehydratedmaterial was used to try to preserve the cellular structure asmuch as possible.

Bright and dark ®eld digital micrographs were recorded usingLeica LIDA and QWin software operated with a Leica DMRXE lightmicroscope ®tted with 32.5, 35 and 340 objective lenses and aJVC KY-F55B video camera.

Acknowledgements

We thank M. Bevan for his kind gift of pBI221.9 vector plasmid.We thank Pam Morgan for the maintenance of plants in theglasshouse and Paul Thompson for technical assistance with GUSstaining.

References

Aoyama, T. and Chua, N.-M. (1997) A glucocorticoid-mediatedtranscriptional induction system in transgenic plants. Plant J.

11, 605±612.Aoyama, T., Dong, C.-H., Wu, Y., Carabelli, M., Sessa, G., Ruberti,

I., Morelli, G. and Chua, N.-H. (1995) Ectopic expression of the

Arabidopsis transcriptional activator Athb-1 alters leaf cell fatein tobacco. Plant Cell, 7, 1773±1785.

Bradford, M.M. (1976) A rapid and sensitive method for thequanti®cation of microgram quantities of protein utilising the

principle of protein-dye binding. Anal. Biochem. 72, 248±254.Christopherson, K.S., Melanie, M.R., Bajaj, V. and Godowski, P.J.

(1992) Ecdysteroid-dependant regulation of genes in

mammalian cells by a Drosophila ecdysone receptor andchimeric transactivators. Proc. Natl Acad. Sci. USA, 89, 6314±

6318.Dalrymple, M.A., McGeoch, D.J., Davison, A.J. and Preston, C.M.

(1985) DNA sequence of the herpes simplex virus type I genewhose product is responsible for transcriptional activation of

immediate early promoters. Nucl. Acids Res. 13, 7865±7879.Furth, P.A., Onge, L. St., Boeger, H., Gruss, P., Gossen, M.,

Kistner, A., Bujard, H. and Henninghausen, L. (1994) Temporal

control of gene expression in transgenic mice by a tetracycline-responsive promoter. Proc. Natl Acad. Sci. USA, 91, 9302±9306.

Gatz, C., Frohberg, C. and Wendenburg, R. (1992) Stringent

repression and homogeneous de-repression by tetracycline ofa modi®ed CaMV 35S promoter in intact transgenic tobacco

plants. Plant J. 2, 397±404.

Goff, S.A., Klein, T.M., Roth, B.A., Fromm, M.E., Cone, K.C.,Radicella, J.P. and Chandler, V.L. (1990) Transactivation ofanthocyanin biosynthetic genes following transfer of Bregulatory genes into maize tissues. EMBO J. 9, 2517±2522.

Heller, J.J., Mattioda, H., Klein, E. and Sagenmuller, A. (1992)Field evaluation of RH5992 on Lepidopterous pests in Europe.Proceedings of the 1992 Brighton Crop Protection Conference-Pest and Diseases, pp. 59±65.

Hollenberg, S.M., Weinberger, C., Ong, E.S., Cerelli, G., Oro, A.,Lebo, R., Thompson, E.B., Rosenfeld, M.G. and Evans, R.M.(1985) Primary structure and expression of a functional humanglucocorticoid receptor cDNA. Nature, 318, 635±641.

Holsters, M., De Waele, D., Depicker, A., Messens, E., VanMontagu, M. and Schell, J. (1978) Transfection andtransformation of Agrobacterium tumefaciens. Mol. Gen.Genet. 163, 182±187.

Horsch, R., Fry, J., Hoffmann, N., Neidermeyer, J., Rogers, S.,Fraley, R. (1988) Leaf Dish Transformation, in Plant MolecularBiology Manual, A5 (Gelvin, S. and Schilperoort, R., eds)Dordecht: Kluwer Academic, pp. 1±23.

Jefferson, R.A., Kavanagh, T.A. and Bevan, M.W. (1987) GUSFusions: b-glucuronidase as a sensitive and versatile genefusion marker in higher plants. EMBO J. 6, 3901±3907.

Koelle, M.R., Talbot, W.S., Segraves, W.A., Bender, M.T., Cherbas,P. and Hogness, D.S. (1991) The Drosophila EcR gene encodesan ecdysone receptor, a new member of the steroid receptorsuperfamily. Cell, 67, 59±77.

Kozak, M. (1989) The scanning model for translation: an update. J.Cell. Biol. 108, 229±241.

Lloyd, A.M., Schena, M., Walbot, V. and Davis, R.W. (1994)Epidermal cell fate determination in Arabidopsis: patternsde®ned by a steroid inducible regulator. Science, 266, 436±439.

Martinez, A., Scanlon, D., Gross, B., Perara, S.C., Palli, S.R.,Greenland, A., Windass, J., Pongs, O., Broad. P. and Jepson, I.(1999) Transcriptional activation of the cloned Heliothisvirescens (Lepidoptera) ecdysteroid receptor (HvEcR) bymuristeroneA. Insect Biochem. Mol. Biol. in press.

McNellis, T.W., Mudgett, M.B., Li, K., Aoyama, T., Horvath, D.,Chua, N.-H. and Staskawicz, B.J. (1998) Glucocorticoidinducible expression of a bacterial avirulence gene intransgenic Arabidopsis induces hypersensitive cell death.Plant J. 14, 247±257.

Mett, V.L., Lockhead, L.P. and Reynolds, P.H.S. (1993) Copper-controllable gene expression system for whole plants. Proc.Natl Acad. Sci. USA, 90, 4567±4571.

Negrutiu, I., Shillito, R., Potrykus, I., Biasini, G. and Sala, F. (1987)Hybrid genes in the analysis of transformation conditions. PlantMol Biology, 8, 363±373.

No, D., Yao, T.-P. and Evans, R.M. (1996) Ecdysone-inducible geneexpression in mammalian cells and transgenic mice. Proc. NatlAcad. Sci. USA, 93, 3346±3351.

Ow, D.W., Jacobs, J.D. and Howell, S.H. (1987) Functional regionsof the cauli¯ower mosaic virus 35S RNA promoter determineby use of the ®re¯y luciferase gene as a reporter of promoter ofactivity. Proc. Natl Acad. Sci. USA, 84, 4870±4874.

Salter, M.G., Paine, J.A., Riddell, K.V., Jepson, I., Greenland, A.J.,Caddick, M.X. and Tomsett, A.B. (1998) Characterisation of theethanol-inducible alc gene expression system for transgenicplants. Plant J. 16, 127±132.

Schena, M., Lloyd, A.M. and Davis, R.W. (1991) A steroid-inducible gene expression system for plant cells. Proc. NatlAcad. Sci. USA, 88, 10421±10425.

Shockett, P., Di®llipantino, F., Hellman, H. and Schatz, D.G. (1995)A modi®ed tetracycline-regulated system provides



autoregulatory, inducible gene expression in cultured cells andtransgenic mice. PNAS, 92, 6522±6566.

Simon, R., Igeno, I.-M. and Coupland, G. (1996) Activation of ¯oralmeristem identity genes in Arabidopsis. Nature, 384, 59±62.

Thomas, H.E., Stunnenberg, H.G. and Steward, A.F. (1993)Heterodimerisation of the Drosophila ecdysone receptor withretinoid X receptor and ultraspiracle. Nature, 362, 471±475.

Wang, Y., DeMayo, F.J., Tsai, S.Y. and O'Malley, B.W. (1997)Ligand-inducible and liver-speci®c target gene expression intransgenic mice. Nature Biotech. 15, 239±243.

Weinmann, P., Gossen, M., Hillen, W., Bujard, H. and Gatz, C.(1994) A chimeric transactivator allows tetracycline-responsivegene expression in whole plants. Plant J. 5, 559±569.

Williams, S., Friedrich, L., Dincher, S., Carozzi, N., Kessmann, H.,Ward, E. and Ryals, J. (1992) Chemical regulation of Bacillus

thuringiensis d-endotoxin expression in transgenic plants.

Biotechnology, 10, 540±543.Wing, K.D. (1988) RH5948, a non steroidal ecdysone agonist:

effects on a Drosophila cell line. Science, 241, 467±469.Wing, K.D., Slawecki, R.A. and Carlson, G.R. (1988) RH5849, a

nonsteroidal ecdysone agonist: effects on larval lepidoptera.

Science, 241, 470±472.Yao, T.-P., Forman, B.M., Jiang, Z., Cherbas, L., Chen, J.D.,

McKeown, M., Cherbas, P. and Evans, R.M. (1993) Functional

ecdysone receptor is the product of EcR and Ultraspiracle

genes. Nature, 366, 476±479.Yao, T.-P., Segraves, W.A., Oro, A.E., McKeown, M. and Evans,

R.M. (1992) Drosophila ultraspiracle modulates ecdysone

receptor function via heterodimer formation. Cell, 71, 63±72.

EMBL accession number Y09009.



Ecdysone agonist inducible transcription in transgenic tobacco plants

Documents

Transcript of Ecdysone agonist inducible transcription in transgenic tobacco plants