lable at ScienceDirect

Biomaterials 30 (2009) 4986–4995

Contents lists avai

Biomaterials

journal homepage: www.elsevier .com/locate/biomater ia ls

Dual luciferase labelling for non-invasive bioluminescence imaging ofmesenchymal stromal cell chondrogenic differentiation indemineralized bone matrix scaffolds

Marta Vilalta a, Christian Jorgensen b,c, Irene R. Degano a, Yuti Chernajovsky d, David Gould d,Daniele Noel b,c, Jose A. Andrades e, Jose Becerra e, Nuria Rubio a, Jeronimo Blanco a,*

a Cardiovascular Research Center, CSIC-ICCC, CIBER-BBN, Barcelona 08025, Spainb INSERM U 844, Montpellier F-34091, Francec Universite MONTPELLIER1, UFR de Medecine, Montpellier F-34000, Franced Bone and Joint Research Unit, Barts and The London, Queen Mary’s School of Medicine and Dentistry, Charterhouse Square, London EC1M 6BQ, UKe Department of Cell Biology, Genetics and Physiology, Laboratory of Bioengineering and Tissue Regeneration, Faculty of Sciences,University of Malaga, CIBER-BBN, Malaga, Spain

a r t i c l e i n f o

Article history:Received 23 March 2009Accepted 21 May 2009Available online 17 June 2009

Keywords:Bioluminescence imaging (BLI)Collagen type II (COL2A1)Demineralized bone matrix (DBM)Human adipose tissue derivedmesenchymal stromal cells (hAMSCs)Murine cell line (CL1)

* Corresponding author. Cardiovascular Research CC/ Sant Atnoni MaClaret, 167, Barcelona 08025, Spaiþ34 93556555.

E-mail address: jblancof@csic-iccc.org (J. Blanco).

0142-9612/$ – see front matter � 2009 Elsevier Ltd.doi:10.1016/j.biomaterials.2009.05.056

a b s t r a c t

Non-invasive bioluminescence imaging (BLI) to monitor changes in gene expression of cells implanted inlive animals should facilitate the development of biomaterial scaffolds for tissue regeneration. We showthat, in vitro, induction of chondrogenic differentiation in mouse bone marrow stromal cell line (CL1) andhuman adipose tissue derived mesenchymal stromal cells (hAMSCs), permanently transduced witha procollagen II (COL2A1) promoter driving a firefly luciferase gene reporter (PLuc) (COL2A1p$PLuc),induces PLuc expression in correlation with increases in COL2A1 and Sox9 mRNA expression andacquisition of chondrocytic phenotype. To be able to simultaneously monitor in vivo cell differentiationand proliferation, COL2A1p$PLuc labelled cells were also genetically labelled with a renilla luciferase(RLuc) gene driven by a constitutively active cytomegalovirus promoter, and then seeded in deminer-alized bone matrix (DBM) subcutaneously implanted in SCID mice. Non-invasive BLI monitoring of theimplanted mice showed that the PLuc/RLuc ratio reports on gene expression changes indicative of celldifferentiation. Large (CL1) and moderated (hAMSCs) changes in the PLuc/RLuc ratio over a 6 weekperiod, revealed different patterns of in vivo chondrogenic differentiation for the CL1 cell line andprimary MSCs, in agreement with in vitro published data and our results from histological analysis ofDBM sections. This double bioluminescence labelling strategy together with BLI imaging to analyzebehaviour of cells implanted in live animals should facilitate the development of progenitor cell/scaffoldcombinations for tissue repair.

� 2009 Elsevier Ltd. All rights reserved.

1. Introduction

Non-invasive bioluminescent imaging (BLI) could provideadditional insight to that generated by more conventional in vitroapproaches, to understand cell proliferation and differentiationchanges taking place in live animals during normal tissue devel-opment or cell therapy. As previously described, the proliferationand distribution of cells labelled with bioluminescent reporters can

enter, CSIC-ICCC, CIBER-BBN,n. Tel.: þ34 935565905; fax:

All rights reserved.

be monitored by BLI, during extended time periods after beingdirectly seeded in scaffolds and implanted in live animals fortherapy [1–3]. Thus, during development of scaffolds for tissueregeneration, it would be particularly useful to non-invasivelymonitor, in real time, the behaviour of cell–scaffold combinationsimplanted in live animals.

Due to the capacity of light photons to transverse living tissues,BLI of photoprotein gene reporters introduced in cells can be usedto monitor biodistribution and gene expression in vivo. Thus, byusing tissue specific gene promoters to regulate bioluminescentreporters, changes in promoter activity induce changes in reporterexpression detectable as photon fluxes. Analysis of photon imagesprovides information on cell distribution and time related geneexpression changes associated to cell differentiation stages [4–6].

M. Vilalta et al. / Biomaterials 30 (2009) 4986–4995 4987

Self repair of damaged cartilage is limited due to the lack ofblood supply and undifferentiated cells [7]. It has been shown thatcartilage repair can be aided by tissue engineering approachescombining the use of stem cells, scaffolds and specific differentia-tion inducing factors [8,9]. Due to their chondrogenic capacity invitro and in vivo [10–12], ease of isolation, abundance and long termmaintenance in vitro [13,14], human adipose tissue mesenchymalstromal cells (hAMSCs) could potentially be more useful as autol-ogous candidates for cartilage repair than their bone marrowcounterparts [15–17].

Demineralized bone matrix (DBM) has been used, in variousforms, including surfaces, whole bones, chips or powders, toinduce osteogenesis in vivo [18–20]. DBM chambers, that allowinfiltration and attachment of the proliferating mesenchymethrough osteoconductive mechanisms, also supply osteoinductivegrowth factors that support osteogenesis [21]. When implanted inlive animals, this material has been shown to induce new boneformation in sequential stages analogous to those during humanbone healing [22], including chondroblast formation and carti-lage-specific matrix protein expression prior to further differen-tiation to hypertrophic chondrocytes [23,24]. Proteins from DBMhave been reported to have a regulatory function in the inductionof cartilage differentiation and bone formation from mesen-chymal stromal cells (MSCs) [25–30]. Thus, this material,although not new, provides a convenient testing ground forimaging procedures that should aid in the development of newmaterials.

In cartilage development, type II procollagen (COL2A1) geneexpression is a key event positively regulated by Sox9 and othertranscription factors such as L-Sox5 and Sox6, which have beendemonstrated to be enhancers and cofactors for cartilage matrixgene expression, in response to environmental clues including celladhesion, hypoxia, growth factors and cytokines [23,31,32]. Duringthe differentiation of condensed MSCs to hypertrophic chon-drocytes, a switch from COL2A1 to COL10A1 expression marks theterminal differentiation stage of the chondrogenic lineage and thebeginning of endochondral ossification [23,33]. Therefore, it hasbeen suggested that COL2A1 expression may be used as a marker ofchondrogenesis [34–36].

The tissue specificity of COL2A1 promoter (COL2A1p) enhancerregion construct has already been demonstrated. In vitro experi-ments have shown transient COL2A1p driven reporter expressiononly in COL2A1 positive cells, such as chondroprogenitors cells andchondrocytes, where this gene is expressed at high levels [37].

The aim of the current work has been to develop advances inimaging procedures to aid in the development of scaffolds for tissueregeneration. We demonstrate that the use of the tissue-specificCOL2A1p to regulate the expression of a luciferase reporter, incombination with non-invasive BLI to analyze changes in geneexpression allows monitoring cell differentiation in a live animalmodel of cartilage and bone formation. For such purpose, progen-itor cells were transduced to express both, the Photinus pyralisluciferase (PLuc) under the control of the COL2A1p, as a reporter ofchanges in gene expression, and the Renilla reniformis luciferase(RLuc) under the control of a constitutively active promoter asa reporter of cell proliferation. DBM scaffolds for chondro-osteo-genic induction were seeded with the light producing cells,implanted in live animals and regularly imaged to monitor changesin the activity of the collagen gene.

We show that this is a convenient and sensitive method to non-invasively monitor changes in tissue specific gene expressionduring chondrogenic differentiation in vitro and chondro-osteo-genic differentiation in vivo. These new refinements of non-invasiveimaging procedures should be useful in the field of scaffolddevelopment.

2. Materials and methods

2.1. Vector construction

The lentiviral vector PLox–COL2A1p$PLuc containing the human COL2A1psequence and the PLuc gene (Promega Corporation, Madison, WI) was cloned in twosteps. Part of COL2A1p including an intronic insert from the vector pGL2–0.387kbE715(þ)US (provided by Dr. P. Galera, Caen, France) [37] was cloned in thepSP–lucþ vector (Promega) between the AvrII and HindIII cloning sites. The fragmentCOL2A1p$PLuc was excised and cloned in the cassette between the polylinkerrestriction sites SpeI and SmaI replacing the XhoI and KpnI fragment from the len-tiviral transfer vector Plox/Twgfp (provided by Dr. D. Trono, Switzerland). The hrl–mrfp–ttk lentiviral vector containing a chimeric construct of the RLuc reporter gene,the monomeric red fluorescent protein (mRFP1) and a truncated version of the herpessimplex virus thymidine kinase gene sr39tk in a PHR lentiviral vector was constructedas described [38,39], and kindly provided by Dr. S.S Gambhir (Stanford, US).

2.2. CL1 cell culture, transduction and differentiation

A bipotent cell line (CL1), was kindly provided by Dr. Hidemoto Kitamura (Fuji-Gotemba research laboratories, Shizouka, Japan) [40]. CL1 cells were grown inMinimum Essential Medium Eagle alpha modification (a-MEM, Sigma, Steinheim,Germany) supplemented with 10% FBS, 2 mM L-glutamine and 50 U/ml penicillin/streptomycin. Medium was changed three times per week.

For viral transduction, cells were plated at 5 � 103 cells/cm2 in a 6 well cellculture cluster and infected with concentrated lentivirus particles PLox-COL2A1p$PLuc stock (2 � 106 transduction units/ml, MOI ¼ 21), produced aspreviously described [3], in medium containing 10 mg/ml polybrene (Sigma) for 48 h,to obtain the COL2A1p$PLuc–CL1 cells.

For chondrogenic differentiation cells were plated at 5�103 cells/cm2 in a 6 wellcell culture cluster. At confluence, 5 ng/ml of TGF-b1 (Peprotech, Rocky Hill, NJ, US)was added to the culture medium three times per week. Equal volume of PBS 1�wasadded to the control wells. Alcian Blue and Oil Red O staining was performed afterthe differentiation period, as described [40].

For in vivo studies a COL2A1p$PLuc–CL1 clone (F12) was transduced with hrl–mrfp–ttk concentrated lentiviral stock (2 � 106 transduction units/ml, MOI ¼ 21) for48 h at the end of which the highest 6% mRFP expressing cells were selected byfluorescence activated cell sorting (FACS).

2.3. hAMSCs transduction and differentiation

hAMSCs were isolated and cultured as previously described [3]. For trans-duction, passage three cells, at a density of 5 � 103 cells/cm2 were plated in a 6 wellcell culture cluster and infected with concentrated lentiviral PLox–COL2A1p$PLucstock (2 � 106 transduction units/ml, MOI ¼ 21) for 48 h to obtain COL2A1p$PLuc–hAMSC cells.

For chondrogenic differentiation cells were grown with the growth mediumsupplemented with 10 ng/ml of TGF-b1 (Peprotech), 100 nM dexamethasone(Sigma), 6.25 mg/ml insulin (Sigma), 50 nM ascorbate-2-phosphate (Sigma) and110 mg/l sodium pyruvate (Sigma) as previously described [10].

To perform in vivo assays hAMSCs were transduced with hrl–mrfp–ttkconcentrated lentiviral stock (2 � 106 transduction units/ml, MOI ¼ 21) for 48 h andthe highest 11% mRFP expressing cells were selected by (FACS). Sorted cells werethen transduced with PLox–COL2A1p$PLuc lentiviral stock as described.

2.4. Cell DNA extraction

Genomic DNA from cells was obtained by adding DNAzol reagent (Invitrogen,Oregon, US) to cell culture wells to lyse the cells. The precipitate formed from thelysate was pelleted and washed with 100% and 75% of EtOH, respectively, dissolvedin 8 mM NaOH and kept at 4 �C. PCR was performed using recombinant Taq DNApolymerase (Fermentas, Maryland, US) and 3% of DMSO. PCR products were elec-trophoresed on a 1% agarose gels, containing ethidium bromide (0.5 mg/ml) andvisualized under UV light.

2.5. In vitro luminometric determination of luciferase activity

Differentiated and control cells were scraped from the 6 well plates in 200 ml of 1�reporter lysis buffer (RLB 1�) (Promega) for each well. Following, 20 ml of the lysatewas added to 100 ml of luciferin reagent (Promega) and light production was quan-tified using a bench top luminometer (Sirius, Berthold Detection Systems, Pforzheim,Germany). DNA in each 20 ml sample was determined using the Quant-it DNA Br assaykit (Invitrogen) and a bench top plate reader (Wallac victor 2 multi-label counter).Luciferase activity from cell lysates was always expressed per ng of total DNA.

2.6. BLI determination of luciferase activity from in vitro cultures

BLI of cultured COL2A1p$PLuc–CL1 cells was performed at the start, whenreaching cell confluence, and at the end of the differentiation process. For BLI,

M. Vilalta et al. / Biomaterials 30 (2009) 4986–49954988

medium was removed from the plates, cells were rinsed twice with PBS 1� and300 ml or 1 ml of luciferin reagent stock (Promega) was added to each well or to each10 cm2 plate, respectively, and imaged immediately. For imaging, a plate was placedin the detection chamber of a high-efficiency ORCA-2BT Imaging System (Hama-matsu Photonics, Hamamatsu City, Japan) provided with a C4742-98-LWG-MODcamera fitted with 512 � 512 pixel charge couple device (CCD) cooled at �80 �C.Images were acquired during 1 min using 1�1 arrays (binning 1�1) and in order toregister the position of the light signal, an additional image was obtained usinga white light from a lamp in the detection chamber. Light measurements werecalculated using the Wasabi image analysis software and expressed as photoncounts (PHCs) after discounting background using this formula: PHCs ¼ (totalnumber of PHCs in the area of interest) � [(number of pixels in the area ofinterest) � (background average PHCs/pixel)].

Pseudo color images were generated using the same arbitrary color displaysettings for all images in the same experiment. Arbitrary color bars representstandard light intensity levels for PLuc (blue ¼ lowest; red ¼ highest) and for RLuc(black ¼ lowest; blue ¼ highest).

2.7. RNA extraction, real-time PCR and RT-PCR

Total RNA was extracted from the samples using the RNAeasy mini kit(Qiagen, Dusseldorf, Germany). One microgram of total RNA was reverse

Fig. 1. COL2A1p$PLuc–CL1 cells spontaneously differentiating to the chondrocytic lineagecontaining the COL2A1 promoter and the luciferase reporter gene from Photinus pyralis (PLuCL1 confluent culture plate and corresponding bioluminescence image (BLI). Colour spots shplate seeded at limiting dilution with COL2A1p$PLuc–CL1 cells (left) and 6 well plates (right)white circles D7, F6, C10 and D3; positive clones, C2, F12, F1 and G11. Colour bar representsamplified genomic DNA from PLuc positives and negatives clones (C), top row. PCR primer coladder high range. Second and third rows show 2% agarose gel of RT-PCR products amplifie

transcribed using the Revertaid First Strand cDNA Synthesis Kit (Fermentas) andproduct cDNA was then real-time PCR amplified using the ABI PRISM 7000�

(Applied Biosystems, Foster City, CA) and the corresponding TaqMan geneexpression assay (Applied Biosystems) for each amplified gene. The Glyceral-dehyde-3-phosphate dehydrogenase (GADPH) gene was used as internalcontrol.

RT-PCR of the cDNA from the total mRNA was performed using specific oligo-nucleotide primers for the human COL2A1 and mouse COL2A1 genes (BonsaiTechnologies Group, Alcobendas, Spain). b-Actin gene was used to normalise results(hCOL2A1 forward: ttcagctatggagatgacaatc; hCOL2A1 reverse: agagtccta-gagtgactgag; mCOL2A1 forward: acacaatccattgcgacc; mCOL2A1 reverse:agatagttcctgtctccgcc).

2.8. Cell implantation in DBM chambers

Six-week-old SCID mice were purchased from Charles-River (Wilmington, MA,US) and maintained in a specific pathogen-free environment throughout theexperiment. All animal-related procedures were performed with the approval of theAnimal Care Committee of the Cardiovascular Research Center and the Governmentof Catalonia. Mice were anesthetized by an intraperitoneal injection of a mixturecontaining 100 mg/kg ketamine (Merial, Duluth, GA) and 3.3 mg/kg xilacine (HenrySchein, Melville, NY).

express PLuc and COL2A1 mRNA. (A) PLox–COL2A1p$PLuc lentiviral vector constructc) within the long terminals repeats (LTR). (B) Microphotograph from a COL2A1p$PLuc–ow colonies of cells spontaneously emitting light. (C) BLI image of a 96 well cell cultureseeded in duplicate with cells from clones selected for further culture; negative clones,

PLuc light intensity levels from low (�): blue to high (þ): red. (D) 1% agarose gel of PCRrresponded to the PLuc gene, molecular weight of 1700 bp. Right lane, MassRuler DNAd from cell mRNA using primers for COL2 and b-Actin genes, respectively.

M. Vilalta et al. / Biomaterials 30 (2009) 4986–4995 4989

For each cell type, six DBM chambers, prepared as described [41] and having theends of the chamber sealed with Millipore filters (Millipore Ltd., London, UK), wereimplanted subcutaneously (SC), in the backs of three SCID mice, one week previousto seeding with cells. Cells were trypsinized and 1�106 cells suspended in 15 ml of a-MEM were injected through the mouse skin and the sealed end into each DBM usingan insulin syringe.

2.9. Non-invasive BLI of luciferase activity from implanted DBMs

In vivo BLI of SCID mice bearing DBM seeded with luciferase expressingcells were intravenously injected with 150 ml of luciferin (PLuc substrate)(16.7 mg/ml in physiological serum) (Braun, Melsungen, Germany) or with25 ml of benzyl coelenterazine (hCTZ) (RLuc substrate) (1 mg/ml in 50/50propileneglycol/ethanol) (Nanolight Technology, Pinetop, AZ, USA, http://www.nanolight.com) diluted in 125 ml of water, through tail vein of theanesthetized mice. Imaging of PLuc and RLuc activities was performed inconsecutive days. Images were acquired during 5 min. An additional image ofthe animal was obtained using a white light source inside the detectionchamber, to register the position of the luminescence signal in the animal. Toincrease detection sensitivity the readout noise of the recorded signal wasreduced by adding the light events recorded by arrays of 8 � 8 adjacent pixels

Fig. 2. Chondrogenic differentiation of COL2A1p$PLuc–CL1cells is accompanied by an increaa 6 well cell culture plate seeded with the F12 clone and imaged after reaching cell confluencto induce chondrogenic differentiation (lower row). The right panel shows photomicrograpAlcian Blue. Colour bars represent light intensity levels from PLuc ranging from low (�): bluedifferentiated wells (n ¼ 18). (C) Histogram showing luciferase activity RLU/ng of cell DNA (ndifferentiated cultures, obtained by quantitative PCR (n ¼ 18). (E) Histogram showing averaquantitative PCR (n ¼ 18). A.U. ¼ arbitrary units, RLU ¼ relative light units (*p < 0.05 vs. co

(binning 8 � 8) in the camera CCD. Mice were monitored during a six weekperiod at the indicated times. Quantification and analysis of photons recordedin images was done using the Wasabi image analysis software (HamamatsuPhotonics).

2.10. Histological analysis

At the end of the monitoring period the DBM chambers were retrieved from theanimals and fixed in formalin solution 10% (Sigma) for 24 h. The chambers were thendecalcified and dehydrated before embedding in paraffin. Sections of 7 mm werestained with Toluidine blue (TB) and Alcian blue (AB) as described [42,43]. Immu-nohistochemistry was performed using a primary anti-Collagen type II antibody(Calbiochem, IL, USA) followed by a secondary cyanine(Cy)-3-conjugated goat anti-rabbit IgG antibody (Jackson Immunoresearch, PA, USA). Of the six chambersimplanted in three mice, one was retrieved and analyzed each week.

2.11. Statistical analysis

Statistical analysis was performed using the two-way ANOVA test (StatViewversion 5.0.1 software; SAS Institute Inc., NC, US). Values of p< 0.05 were consideredsignificant.

se in light production as well as COL2A1 and Sox9 mRNA expression. (A) BLI images ofe (left) and 14 days after treatment (middle) with either PBS 1� (upper row) or TGF-b1,hs (�200) of the cell cultures unstained (left) and stained (right) with Oil Red O andto high (þ): red. (B) Histogram showing photon counts (PHCs) from control and TGF-b1¼ 18). (D) Histogram showing average levels of COL2A1 mRNA from control and TGF-b1ge values of Sox9 mRNA expression from control and TGF-b1 treated cells, obtained by

ntrol cells).

M. Vilalta et al. / Biomaterials 30 (2009) 4986–49954990

3. Results

3.1. Regulated expression of COL2A1p$PLuc in CL1 cells

To demonstrate that the COL2A1p regulates tissue specificexpression of the PLuc reporter gene in live cells, we transformedCL1 cells, a mouse MSC cell line capable of spontaneous differen-tiation to the adipogenic and chondrogenic lineages, with a lenti-viral vector for genomic integration of PLuc under the control of theCOL2A1p (COL2A1p$PLuc–CL1) (Fig. 1A). After a two week culti-vation period, BLI images from confluent cell cultures showed thepresence of PLuc expressing colonies on a uniform lawn of mostlynon-expressing cells, indicative of spontaneous induction ofcollagen and COL2A1p regulated PLuc expression in some of thecells (Fig. 1B).

Limited dilution and single cell cloning, in 96 well plates, oftransduced cells resulted in light producing and non-lightproducing clones from single cells (Fig. 1C). PCR amplification ofgenomic DNA and mRNA from PLuc positive and negative clonesusing primers for the PLuc and COL2A1 genes, respectively,showed the presence of genome integrated COL2A1p$PLucconstruct as well as COL2A1 mRNA expression in all the PLucpositive clones. However, of the no light producing clones, some(D7) contained no integrated COL2A1p$PLuc construct butexpressed elevated levels of COL2A1 mRNA, while others (C10, F6and D3) showed integrated COL2A1p$PLuc construct but very low(C10) or non-detectable levels of COL2A1 mRNA expression (F6)(Fig. 1D).

More importantly, one clone (D3) initially not expressing PLuc,spontaneously initiated light production accompanied by COL2A1mRNA expression after several passages. Thus, PLuc expression wasnot constitutive in the reporter transduced cells but was induced incorrelation with the spontaneous induction of COL2A1 geneexpression.

Fig. 3. Chondrogenic differentiation of COL2A1p$PLuc–hAMSC cells is accompanied by incmicrograph showing chondrogenic morphology of COL2A1p$PLuc–hAMSCs cultures grownmedium (left) (�200). (B) Histogram showing luciferase activity/ng cell DNA from lysates ofamplified COL2A1 mRNA relative to the b-actin from control and differentiated cells. Histogrby real-time PCR amplification of cell mRNA (*p < 0.001) (n ¼ 18). (D) Histogram shows Samplification of cellular mRNA (*p < 0.05) (n ¼ 18).

3.2. COL2A1 driven expression of PLuc in differentiating CL1 cells

To monitor by BLI changes in light production associated withchondrocyte differentiation, the light producing clone, COL2A1p$-PLuc–CL1 (F12), was induced to differentiate to the chondrogeniclineage by addition of TGF-b1 (Fig. 2).

Following 14 days in culture, BLI data indicated that induced cellsproduced 2 times more photons (absolute value) (P ¼ 0.0338) thancontrol non-induced cells (Fig. 2B). Measurement of light produc-tion relative to DNA content in cell lysates revealed even largerdifferences, and induced cells produced 4.6 times more photons/ngof DNA than non-induced control cells (P < 0.0001) (Fig. 2C).Moreover, increases in light production by induced cells correlatedwith significant increases in the levels of mRNA expression for bothCOL2A1 (5.7 fold) and Sox9 (2 fold), a transcription factor requiredfor COL2A1 activation, as measured by real-time PCR (P ¼ 0.0006and P ¼ 0.0421, respectively) (Fig. 2D and E).

Differences in light production and mRNA expression were alsoaccompanied by clear phenotypic differences, and by the end of theinduction period, TGF-b1 treated cells showed a chondrogenicphenotype, by Alcian Blue staining of glycosaminoglycans, whilecontrol untreated cells showed a preferentially adipogenic pheno-type, by accumulation of Oil Red O stained lipid deposits (Fig. 2A).

3.3. COL2A1 driven expression of PLuc in differentiating hAMSCs

Human lipoaspirate and bone marrow stromal cells (hBMSCs)are known to respond to chondrogenic differentiation by increasingthe levels of COL2A1 gene expression. We used this gene to analyzethe relationship between COL2A1 expression and COL2A1promoter driven light production in these cells. HAMSCs weretransduced for expression of COL2A1p$PLuc and then induced todifferentiate to the chondrocyte lineage by cultivation in monolayerwith inductive medium.

reases in light production as well as COL2A1 and Sox9 mRNA expression. (A) Photo-during 6 weeks in differentiation medium (right) vs control cultures grown in growthcontrol and differentiated cells (*p < 0.05) (n ¼ 18). (C) 1.5% agarose gel of the RT-PCRam shows COL2A1 mRNA expression levels in control and differentiated cells obtainedox9 mRNA levels from control and differentiated cultures, obtained by real-time PCR

M. Vilalta et al. / Biomaterials 30 (2009) 4986–4995 4991

Differentiated and undifferentiated COL2A1p$PLuc–AMSCsshowed evident morphological differences in monolayer assays, bythe end of the six week induction period (Fig. 3A). Cell lysates ofdifferentiated COL2A1p$PLuc–AMSCs showed a 6 fold increase in theamount of light produced per ng DNA in comparison with that ofcontrol undifferentiated cells (P ¼ 0.028) (Fig. 3B). This increase inlight production by differentiated cells was also accompanied by anincrease in COL2A1 mRNA, detectable after RT-PCR of total mRNA notobservable in amplified mRNA from undifferentiated cells (Fig. 3C).

Further analysis by real-time PCR quantification showed thatCOL2A1 and transcription factor Sox9 gene expression levels were,respectively, 4.1 and 5.9 fold higher in differentiated compared toundifferentiated COL2A1p$PLuc–AMSCs (P¼ 0.0006 and P¼ 0.044,respectively) (Fig. 3C and D).

3.4. Non-invasive BLI monitoring of CL1 cell chondrogenicdifferentiation in DBM scaffolds

It was apparent, from previous experiments, that promoter-controlled induction of PLuc expression is best measured relative toDNA content, in order to take into consideration, changes in lightproduction resulting from cell proliferation. However, due to thedifficulty of measuring the DNA contents of cells in vivo, weresorted to the use of a constitutively expressed luciferase reporter,as an internal control, to monitor cell proliferation.

To do this, clone COL2A1p$PLuc–CL1 (F12) cells were alsotransduced with a lentiviral vector construct, hrl–mrfp–ttk, forexpression of a chimeric reporter with ‘‘RLuc–fluorescent protein–

Fig. 4. Non-invasive imaging of PLuc and RLuc expressing CL1 cells seeded in DBM scaffolderation. Diagram illustrating DBM implantation sites (white areas) within the BLI imaged fielPLuc (upper) and RLuc (lower) activity from dually labelled CL1 cells (Clone F12) seeded in Dimages of recipient mice (n ¼ 6). Colour bars illustrating relative light intensities from PLuQuantification of image data from (A). The graphs show individual (symbols) and averageCMV$RLuc. (C) Histogram showing the dynamic range for COL2A1 expression as the ratio P

truncated thymidine kinase’’ activities, controlled by the constitu-tively active cytomegalovirus (CMV) promoter. Transduced cells,now expressing COL2A1 driven PLuc and CMV driven RLuc, wereselected by FACS (COL2A1p$PLuc–RLuc–F12), and inoculated in sixDBM chambers that had been previously implanted SC in SCIDmice. Implanted mice were regularly inoculated with luciferin orcoelenterazine and monitored by BLI to quantify PLuc and RLucactivities as reporters of COL2A1 and cell proliferation activities,respectively.

BLI images showed a continuous increase in PLuc activity, duringthe six week observation period, indicative of COL2A1 induction,accompanied by steady state RLuc activity, indicative of low or noproliferation of the implanted cells (Fig. 4A and B). Thus, the ratio ofPLuc to RLuc expression increased progressively, reaching a value,by the end of the experiment 256 times higher than that at thebeginning of the testing period (Dynamic Range of PLuc expression)(Fig. 4C).

To monitor histological changes in the implants, following the2nd week one DBM was removed weekly, fixed and seriallysectioned for analysis.

TB stained sections from 3rd and 6th week chambers demon-strated the presence of osteoid matrix (blue) and allowed thedetection of cartilage (stained purple due to the metachromaticeffect of the dye) (Fig. 5E and L). Presence of chondrocytes wasfurther confirmed by AB staining of glycosaminoglycan matrixessurrounding the denser blue stained cell bodies of mature chon-drocytes (Fig. 5B, C, I, and J), also corresponding to the areas ofmetachromatic TB staining.

sc implanted in SCID mice shows increase in COL2A1 expression without cell prolif-d (dotted square), dorsal view. (A) Representative BLI images (2 DBMs out of 6) showingBM matrixes and SC implanted in SCID mice, superimposed on black and white dorsal

c (upper) and RLuc (lower); low: blue and black; high: red and blue, respectively. (B)(lines) values for photon counts (PHCs) recorded in images; (>) COL2A1p$PLuc; (*)Luc/RLuc (photon counts). A.U. ¼ arbitrary units.

M. Vilalta et al. / Biomaterials 30 (2009) 4986–49954992

AB staining evidenced morphological differences taking placebetween the 3rd and the 6th week post inoculation (PI). While inthe 3rd week DBM sections contained mature chondrocytes (denseblue spots), by the 6th week, pale blue and less compact spotsdenoted the presence of hypertrophic chondrocytes embedded inthe glycosaminoglycan matrix (Fig. 5C and J). Col2A1 expressionwas also corroborated by immunohistochemistry within the areaspositively labelled with AB and TB staining (Fig. 5D and K).

Additionally, confocal microscopy demonstrated the presence ofred fluorescent cells with chondrocytic phenotype in the lightproducing areas from 3rd and 6th week DMBs (Fig. 5F, G, M and N).

3.5. Non-invasive BLI monitoring of hAMSC chondrogenicdifferentiation in DBM scaffolds

HAMSCs were also used to monitor COL2A1 driven PLucexpression during chondrocyte differentiation in vivo.

COL2A1p$PLuc–hAMSCs were transduced, as in the previouscase, with the CMV promoter driven ‘‘RLuc–red-fluorescentprotein–truncated thymidine kinase’’ construct to produceCOL2A1p$PLuc–RLuc–hAMSCs constitutively expressing the RLucreporter of cell proliferation. Positively transduced cells, selected byFACS, were used to seed six DBM chambers that had been previ-ously SC implanted in SCID mice.

Non-invasive BLI imaging of the implanted mice during a sixweek period showed that COL2A1 driven PLuc expression increasedmoderately up to the third week post implantation after which nofurther increase could be detected. During the same period,constitutive CMV driven RLuc expression showed a pattern ofdecreasing activity, indicative of non-proliferating cells (Fig. 6A andB). Changes in the ratio of PLuc to RLuc activity indicateda maximum 3.24 Dynamic Range for COL2A1 driven PLuc expres-sion by the 3rd week PI (Fig. 6C).

Histological analysis of serial sections from the 3rd and 6thweek DBMs showed different staining patterns (Fig. 7). AB and TB

Fig. 5. Histological analysis of serial sections from DBM chambers inoculated with CL1 cells aF12) seeded in DBM chambers after the 3rd week (upper row) or 6th week (lower row) postained DBM section from A and H, respectively (magnification �6). (C, J) Higher magn(magnification �20 and �40, respectively). (D, K) Immunohistochemistry of tissue sections aL) TB staining of bone (blue) and cartilage (magenta) from sections contiguous in depthmicroscopy images showing implanted red fluorescent cells from areas positively stained b(bars ¼ 10 mm). (*) Indicates the same area corresponding to different images. Dotted lines

staining of a 3rd week DBM (Fig. 7, upper row), showed the pres-ence of cartilage (blue staining of glycosaminoglycans and purplemetachromatic staining, respectively) (Fig. 7B, C and E), also coin-cident with positive binding of anti-COL2A1 antibody (Fig. 7D).

Conversely, in sections from the 6th week DBM chamber (Fig. 7,bottom row), TB staining revealed the presence of strong blue areas(Fig. 7J), indicative of new bone formation, within light blue stainedareas of old bone (DBM walls) and no purple metachromatic areasof cartilage. Absence of cartilage was further supported by no ABstaining of glycosaminoglycans (Fig. 7I and J) and negative imu-nohistochemistry of Col2A1 (Fig. 7K).

Also, confocal microscopy demonstrated the presence of redfluorescent cells that while having chondrocytic morphology in theDBM from the 3rd week (Fig. 7F and G), changed morphology andwere associated to bone structures by the 6th week (Fig. 7M and N).

Thus it appears that initial chondrocyte differentiation hadprogressed to hypertrophic chondrocytes and bone formation.

4. Discussion

We sought to develop a non-invasive imaging system usinga COL2A1 promoter driven luciferase (PLuc) reporter to monitor invivo changes in gene expression leading to chondro-osteogenic celldifferentiation of mesenchymal stromal cells seeded in scaffold forconnective tissue repair.

The human COL2A1 gene is a 30 kb sequence [44], flanked by 50

regulatory sequence with binding sites for a variety of transcriptionfactors such as Sox9, L-Sox5 and Sox6, known to regulate geneexpression [45]. Transient transfection studies using several maturecell types have demonstrated tissues-specific expression ofreporter genes driven by the COL2A1 promoter in vitro [37].

Induction of cell differentiation to the chondrogenic lineage ofboth murine and human stromal progenitor cells permanentlytransduced with the COL2A1p$PLuc reporter results in significantincreases in light production that correlate well with changes in cell

nd SC implanted in SCID mice Photomicrographs of serial sections from CL1 cells (Clonest implantation. (A, H) BLI images showing the location of implanted DBMs. (B, I) AB

ification of B and I, respectively, showing AB staining of glycosaminoglycans (blue)djacent to C and J, respectively, using an anti-COL2A1 antibody (magnification �40). (E,to C and J, respectively (magnification �20 and �40, respectively). (F, M) Confocal

y AB and TB, and the corresponding superimposed black and white images (G and N)indicate the position of subcutaneously implanted DBMs in live mice.

M. Vilalta et al. / Biomaterials 30 (2009) 4986–4995 4993

morphology and gene expression, indicative of entry into thechondrogenic lineage, showing that the COL2A1p$PLuc constructcould be used as a reporter of COL2A1 activity when integrated inthe cell genome.

Since we were particularly interested in monitoring the capacityof biomaterials to induce proper cell differentiation in vivo, we alsoused the COL2A1p$PLuc reporter to non-invasively monitor chon-drogenic differentiation of the CL1 and hAMSC cells seeded in DBMsimplanted in SCID mice. For these in vivo studies, it was necessary todistinguish changes in light production resulting from induction ofgene expression, from unrelated changes in light production due tothe proliferation of light producing cells. To do this, COL2A1p$PLucexpressing cells were also transduced with a second, non-cross-reactive chimeric reporter comprising a luciferase gene, RLuc,driven by a constitutively active CMV promoter. Although the mainfunction of this second reporter was to provide a quantitativeestimate of cell numbers at all times, we used a chimeric reporteralso comprising an RFP for histological analysis and a truncatedthymidine kinase for positron emission tomography in largeanimals [38]. With this new strategy, changes in collagen geneexpression level could be evaluated independently of cell replica-tion and represented graphically as changes in the ratio betweenregulated and constitutive luciferase activities in the implants.

We used this strategy to analyze the capacity of a well charac-terized DBM scaffold to induce chondro-osteogenic differentiationof hAMSC primary cells and CL1 cell line, in independent experi-ments. To do this, COL2A1p$PLuc–hAMSC and COL2A1p$PLuc–CL1

Fig. 6. Non-invasive imaging of PLuc and RLuc expressing hAMSCs seeded in DBM scaffold sproliferation. Diagram illustrating DBM implantation sites (white areas) within the BLI imagshowing PLuc (upper) and RLuc (lower) activity from dually labelled hAMSCs seeded in DBimages of recipient mice (n ¼ 6). Colour bars illustrating relative light intensities of PLucQuantification of image data from (A). The graphs show individual (symbols) and averageCMV$RLuc. (C) Histogram showing the Dynamic Range for Col2A1 expression as the ratio P

cells were transduced with the constitutively expressed RLucreporter and then seeded in DBM chambers SC implanted inimmuno deficient mice.

In both experiments, the light producing regions within theDBM scaffolds also corresponded with the regions that in histo-logical sections stained positively for cartilage, glycosaminoglycans,specifically bound to anti-COL2A1 antibody and contained redfluorescent cells, observed by confocal microscopy.

In the CL1 implants, PLuc activity increased rapidly with timepost implantation, while RLuc activity remained relatively stable, asexpected of differentiating but non-proliferating cells. This wasparticularly noticeable on the 6th week when the PLuc/RLucactivity ratio reached a level 256 fold higher than that at the time ofimplantation, indicating a continuous increase in COL2A1 expres-sion per cell. This was supported by results from the histologicalanalysis of serial sections of DBMs from the 3rd week PI, showingthat light producing areas bound anti-COL2A1 antibody andshowed positive TB staining for cartilage. AB staining also revealedthat these areas contained glycosaminoglycan matrixes embeddedwith dense blue bodies indicative of mature chondrocytes. Insections from the 6th week, cartilage was still detectable, however,glycosaminoglycan matrixes were now found embedded with lightblue stained cell bodies of what appear to be hypertrophic chon-drocytes. Moreover, confocal microscopy analysis of the putativechondrocyte containing regions in the DBM sections, showed thepresence of red fluorescent cells with chondrocytic morphology atthe 3rd and 6th weeks PI.

c implanted in SCID mice shows transient increase in COL2A1 expression relative to celled field (dotted square), dorsal view. (A) Representative BLI images (2 DBMs out of 6)M matrixes and SC implanted in SCID mice, superimposed on black and white dorsal(upper) and RLuc (lower); low: blue and black; high: red and blue, respectively. (B)(lines) values for photon counts (PHCs) recorded in images; (>) COL2A1p$PLuc; (*)Luc/RLuc photon counts. A.U. ¼ arbitrary units.

Fig. 7. Histological analysis of serial sections from DBM chambers inoculated with hAMSCs cells and SC implanted in SCID mice Photomicrographs of serial sections from seededDBM chambers after the 3rd week (upper row) or 6th week (lower row) post implantation. (A, H) BLI images showing the location of implanted DBMs. (B, I) AB stained DBM sectionfrom A and H, respectively (magnification �6). (C, J) Higher magnification of B and I respectively, showing AB staining of glycosaminoglycans (blue) (magnification �20 and �12,respectively). (D, K) Immunohistochemistry of tissue sections adjacent to C and J, respectively, using an anti-COL2A1 antibody (magnification �40 and �20, respectively). (E, L) TBstaining of bone (blue) and cartilage (magenta) from sections contiguous in depth to of C and J, respectively(magnification �20 and �12, respectively); (F, M) Confocal microscopyimages showing implanted red fluorescent cells in areas positively stained by AB and TB, and the corresponding superimposed black and white images (G and N) (bars ¼ 10 mm). (*)Indicates the same area corresponding to different images. Dotted lines indicate the position of subcutaneously implanted DBMs in live mice.

M. Vilalta et al. / Biomaterials 30 (2009) 4986–49954994

In the hAMSC implants, PLuc and RLuc expression changedmoderately over time and the ratio of PLuc/RLuc expressionreached by the 3rd week a maximum 3.24 fold higher than that atthe time of implantation, followed by a decline thereafter. Inagreement with this, histological analysis of DBM sections indi-cated the presence of cartilage, including positive staining with theanti-COL2A1 antibody, by the 3rd week. However, from weeks 4–6,while new bone formation was detectable, neither cartilage, norchondrocytes were observed and no reaction to anti-COL2A1 wasdetectable. Fluorescence confocal microscope analysis of thecartilage staining regions revealed the presence of red fluorescentcells with chondrocytic morphology in the 3rd week DBM but noton those from the 6th week, when red fluorescent cells hada different morphology.

In summary, these results are consistent with a strong differ-entiation of CL1 cells, within DBM chambers, to collagen producingchondrocytes that later mature to hypertrophic chondrocytes butare unable to enter normal osteogenic differentiation, in agreementwith in vitro observations for these cells [40]. On the other hand,primary hAMSCs implanted in DBMs appear to follow a differentdifferentiation pathway, more closely related to that of normalbone formation, and after differentiating to collagen producingchondrocytes, progress rapidly to osteogenic differentiation.

5. Conclusions

We show that a luciferase reporter driven by the tissue specificCOL2A1p can be used to monitor COL2A1 expression in perma-nently transduced COL2A1p–PLuc mesenchymal stem cells. More-over, by labelling the COL2A1p–PLuc cells with a second,constitutively expressed, luciferase reporter (CMVp–RLuc) it ispossible to simultaneously and non-invasively monitor changesexclusively related to gene expression and cell proliferation. Thisstrategy was used to monitor, in live animals and in real time,chondrogenic differentiation of stem cells seeded in a biomaterial,and should facilitate the development of scaffolds for tissue repair.

Acknowledgments

The authors would like to thank Javier F. Alcudia for his essentialhelp with real-time PCR methodology and results interpretationand to Silvia Claros for his essential help in histological procedures.We would also like to acknowledge Dr. P. Galera and Dr. S.S.Gambhir for the gift of plasmids pGL2-0.387kbE715(þ) and hrl–mrfp–ttk, respectively. This study was funded in part by grantsfrom: EU-FP7 Integrated Project Angioscaff (CP-IP 214402-2), EU-FP6 Integrated Project GENOSTEM (LSHB-CT-503161), ArthritisResearch Campaign (UK), Fundacio Marato TV3 (Ref # 050210),Fondo de Investigacion Sanitaria (FIS, PI 060208 and PI 061855),Ministerio de Educacion y Ciencia (SAF 2007-62472 and BIO 2006-03599); Ministerio de Salud (P07-CVI-2781) and Red Tematica deInvestigacion Cooperativa TERCEL.

References

[1] Roman I, Vilalta M, Rodriguez J, Matthies AM, Srouji S, Livne E, et al. Analysis ofprogenitor cell-scaffold combinations by in vivo non-invasive photonicimaging. Biomaterials 2007;28:2718–28.

[2] Degano IR, Vilalta M, Bago JR, Matthies AM, Hubbell JA, Dimitriou H, et al.Bioluminescence imaging of calvarial bone repair using bone marrow andadipose tissue-derived mesenchymal stem cells. Biomaterials 2008;29:427–37.

[3] Vilalta M, Degano IR, Bago J, Gould D, Santos M, Garcia-Arranz M, et al. Bio-distribution, long-term survival, and safety of human adipose tissue-derivedmesenchymal stem cells transplanted in nude mice by high sensitivity non-invasive bioluminescence imaging. Stem Cells Dev 2008;17:993–1003.

[4] Iyer M, Wu L, Carey M, Wang Y, Smallwood A, Gambhir SS. Two-step tran-scriptional amplification as a method for imaging reporter gene expressionusing weak promoters. Proc Natl Acad Sci USA 2001;98:14595–600.

[5] Rome C, Couillaud F, Moonen CT. Gene expression and gene therapy imaging.Eur Radiol 2007;17:305–19.

[6] Contag CH, Spilman SD, Contag PR, Oshiro M, Eames B, Dennery P, et al.Visualizing gene expression in living mammals using a bioluminescentreporter. Photochem Photobiol 1997;66:523–31.

[7] Naujoks C, Meyer U, Wiesmann HP, Jasche-Meyer J, Hohoff A, Depprich R, et al.Principles of cartilage tissue engineering in TMJ reconstruction. Head FaceMed 2008;4:3.

M. Vilalta et al. / Biomaterials 30 (2009) 4986–4995 4995

[8] Steinert AF, Ghivizzani SC, Rethwilm A, Tuan RS, Evans CH, Noth U. Majorbiological obstacles for persistent cell-based regeneration of articular carti-lage. Arthritis Res Ther 2007;9:213.

[9] Xian CJ, Foster BK. Repair of injured articular and growth plate cartilage usingmesenchymal stem cells and chondrogenic gene therapy. Curr Stem Cell ResTher 2006;1:213–29.

[10] Lin Y, Luo E, Chen X, Liu L, Qiao J, Yan Z, et al. Molecular and cellular char-acterization during chondrogenic differentiation of adipose tissue-derivedstromal cells in vitro and cartilage formation in vivo. J Cell Mol Med 2005 Oct–Dec;9(4):929–39.

[11] Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, et al. Multilineage cellsfrom human adipose tissue: implications for cell-based therapies. Tissue Eng2001;7:211–28.

[12] Estes BT, Wu AW, Guilak F. Potent induction of chondrocytic differentiation ofhuman adipose-derived adult stem cells by bone morphogenetic protein 6.Arthritis Rheum 2006;54:1222–32.

[13] Kern S, Eichler H, Stoeve J, Kluter H, Bieback K. Comparative analysis ofmesenchymal stem cells from bone marrow, umbilical cord blood, or adiposetissue. Stem Cell 2006;24:1294–301.

[14] Kucerova L, Altanerova V, Matuskova M, Tyciakova S, Altaner C. Adiposetissue-derived human mesenchymal stem cells mediated prodrug cancer genetherapy. Cancer Res 2007;67:6304–13.

[15] Zuk PA, Zhu M, Ashjian P, De Ugarte DA, Huang JI, Mizuno H, et al. Humanadipose tissue is a source of multipotent stem cells. Mol Biol Cell2002;13:4279–95.

[16] Nakagami H, Morishita R, Maeda K, Kikuchi Y, Ogihara T, Kaneda Y. Adiposetissue-derived stromal cells as a novel option for regenerative cell therapy.J Atheroscler Thromb 2006;13:77–81.

[17] De Ugarte DA, Morizono K, Elbarbary A, Alfonso Z, Zuk PA, Zhu M, et al.Comparison of multi-lineage cells from human adipose tissue and bonemarrow. Cell Tissues Organs 2003;174:101–9.

[18] Harakas NK. Demineralized bone-matrix-induced osteogenesis. Clin OrthopRelat Res 1984;188:239–51.

[19] Becerra J, Andrades JA, Ertl DC, Sorgente N, Nimni ME. Demineralized bonematrix mediates differentiation of bone marrow stromal cells in vitro: effect ofage of cell donor. J Bone Miner Res 1996;11:1703–14.

[20] Pacaccio DJ, Stern SF. Demineralized bone matrix: basic science and clinicalapplications. Clin Podiatr Med Surg 2005;22:599–606.

[21] Sandhu HS, Khan SN, Suh DY, Boden SD. Demineralized bone matrix, bonemorphogenetic proteins, and animal models of spine fusion: an overview. EurSpine J 2001;10:S122–31.

[22] Chakkalakal DA, Strates BS, Garvin KL, Novak JR, Fritz ED, Mollner TJ, et al.Demineralized bone matrix as a biological scaffold for bone repair. Tissue Eng2001;7:161–77.

[23] Okazaki K, Sandell LJ. Extracellular matrix gene regulation. Clin Orthop RelatRes 2004;427(Suppl):S123–8.

[24] de Crombrugghe B, Lefebvre V, Behringer RR, Bi W, Murakami S, Huang W.Transcriptional mechanisms of chondrocyte differentiation. Matrix Biol2000;19:389–94.

[25] Andrades JA, Santamaria JA, Nimni ME, Becerra J. Selection and amplificationof a bone marrow cell population and its induction to the chondro-osteogeniclineage by rhOP-1: an in vitro and in vivo study. Int J Dev Biol 2001;45:689–93.

[26] Lecanda F, Avioli LV, Cheng SL. Regulation of bone matrix protein expressionand induction of differentiation of human osteoblasts and human bonemarrow stromal cells by bone morphogenetic protein-2. J Cell Biochem1997;67:386–96.

[27] Kasten P, Luginbuhl R, van Griensven M, Barkhausen T, Krettek C, Bohner M,et al. Comparison of human bone marrow stromal cells seeded on calcium-

deficient hydroxyapatite, beta-tricalcium phosphate and demineralized bonematrix. Biomaterials 2003;24:2593–603.

[28] Chen B, Lin H, Wang J, Zhao Y, Wang B, Zhao W, et al. Homogeneous osteo-genesis and bone regeneration by demineralized bone matrix loading withcollagen-targeting bone morphogenetic protein-2. Biomaterials 2007;28:1027–35.

[29] Lin H, Zhao Y, Sun W, Chen B, Zhang J, Zhao W, et al. The effect of crosslinkingheparin to demineralized bone matrix on mechanical strength and specificbinding to human bone morphogenetic protein-2. Biomaterials 2008;29:1189–97.

[30] Jansen EJ, Sladek RE, Bahar H, Yaffe A, Gijbels MJ, Kuijer R, et al. Hydropho-bicity as a design criterion for polymer scaffolds in bone tissue engineering.Biomaterials 2005;26:4423–31.

[31] Lefebvre V, Huang W, Harley VR, Goodfellow PN, de Crombrugghe B. SOX9 isa potent activator of the chondrocyte-specific enhancer of the pro alpha1(II)collagen gene. Mol Cell Biol 1997;17:2336–46.

[32] Zhao Q, Eberspaecher H, Lefebvre V, De Crombrugghe B. Parallel expression ofSox9 and Col2a1 in cells undergoing chondrogenesis. Dev Dyn 1997;209:377–86.

[33] Barry F, Boynton RE, Liu B, Murphy JM. Chondrogenic differentiation ofmesenchymal stem cells from bone marrow: differentiation-dependent geneexpression of matrix components. Exp Cell Res 2001;268:189–200.

[34] Thorogood P, Bee J, von der Mark K. Transient expression of collagen type II atepitheliomesenchymal interfaces during morphogenesis of the cartilaginousneurocranium. Dev Biol 1986;116:497–509.

[35] Chen Q, Johnson DM, Haudenschild DR, Goetinck PF. Progression andrecapitulation of the chondrocyte differentiation program: cartilagematrix protein is a marker for cartilage maturation. Dev Biol 1995;172:293–306.

[36] Ornitz DM, Marie PJ. FGF signaling pathways in endochondral and intra-membranous bone development and human genetic disease. Genes Dev2002;16:1446–65.

[37] Ghayor C, Herrouin JF, Chadjichristos C, Ala-Kokko L, Takigawa M, Pujol JP,et al. Regulation of human COL2A1 gene expression in chondrocytes. Identi-fication of C-Krox-responsive elements and modulation by phenotype alter-ation. J Biol Chem 2000;275:27421–38.

[38] Cao F, Lin S, Xie X, Ray P, Patel M, Zhang X, et al. In vivo visualization ofembryonic stem cell survival, proliferation, and migration after cardiacdelivery. Circulation 2006;113:1005–14.

[39] Ray P, De A, Min JJ, Tsien RY, Gambhir SS. Imaging tri-fusion multi-modality reporter gene expression in living subjects. Cancer Res 2004;64:1323–30.

[40] Kitamura H. Establishment of a bipotent cell line CL-1 which differentiatesinto chondrocytes and adipocytes from adult mouse. Osteoarthritis Cartilage2004;12:25–37.

[41] Nimni ME, Bernick S, Ertl D, Nishimoto SK, Paule W, Strates BS, et al. Ectopicbone formation is enhanced in senescent animals implanted with embryoniccells. Clin Orthop Relat Res 1988;234:255–66.

[42] Montes GS, Junqueira LCU. Histochemical localization of collagen andproteoglycans in tissues. In: Nimni ME, editor. Collagen, 2. Boca Raton: CRCPress; 1988. p. 41–72.

[43] Becerra J, Guerado E, Claros S, Alonso M, Bertrand ML, Gonzalez C, et al.Autologous human-derived bone marrow cells exposed to a novel TGF-beta1fusion protein for the treatment of critically sized tibial defect. Regen Med2006;1:267–78.

[44] Cheah KS, Stoker NG, Griffin JR, Grosveld FG, Solomon E. Identification andcharacterization of the human type II collagen gene (COL2A1). Proc Natl AcadSci USA 1985;82:2555–9.

[45] Bi W, Deng JM, Zhang Z, Behringer RR, de Crombrugghe B. Sox9 is required forcartilage formation. Nat Genet 1999;22:85–9.