Does host adaptation of Tetranychus urticae populationsin clementine orchards with a Festuca arundinaceacover contribute to a better natural regulation of thispest mite?Ernestina Aguilar-Fenollosa*, Tatiana Pina, María A. Gómez-Martínez, Mónica A. Hurtado& Josep A. JacasDepartament de Ciencies Agraries i del Medi Natural, Universitat Jaume I, Unitat Associada d’Entomologia Agrıcola

Universitat Jaume I (UJI) – Institut Valencia d’Investigacions Agraries (IVIA), Campus del Riu Sec, E-12071, Castello de la

Plana, Spain

Accepted: 21March 2012

Key words: spider mite, host race formation, host-plant adaptation, reciprocal transplant, citrus,

Poaceae, Prostigmata, Tetranychidae, Rutaceae, Acari, microsatellite

Abstract Tetranychus urticaeKoch (Acari: Tetranychidae) is a key pest of clementinemandarins,Citrus clemen-

tinaTanaka (Rutaceae), in Spain. This mite is highly polyphagous and can be easily found in clemen-

tine orchards, both in the trees and in the associated flora. In a previous study we found that the use

of a cover of Festuca arundinacea Schreber (Poaceae) offered a better regulation of T. urticae popula-

tions than either bare soil or the traditional wild cover, which included a mix of weed species. We

hypothesized that the selection of two host races of T. urticae, specialized in F. arundinacea and C.

clementina, could partly explain the results obtained (bottom-up regulation). Reciprocal transplant

experiments show that sympatric deme 9 host combinations had higher mean fitness values than

the allopatric combinations in clementine, but not in F. arundinacea, for most of the fitness parame-

ters evaluated in our study. Because local adaptation implies mean deme fitness to be systematically

higher for the sympatric deme 9 habitat combinations than for the allopatric ones, these results can

be taken as indicative of occurrence of local adaptation in T. urticae. Molecular genetic analyses with

microsatellite markers support this conclusion and indicate that local adaptation of T. urticae found

in our systemmay indeed contribute to a better natural regulation of this mite.

Introduction

Habitat fragmentation in agricultural systems may be a

major determinant of the structure of plant-feeding

arthropod populations (Bailly et al., 2004). Differences in

resource availability as a result of natural or anthropogenic

processes can induce local adaptation and lead to genetic

differentiation between subpopulations if gene flow

between them is sufficiently small (Williams et al., 2003).

Moreover, in some cases, host spatial distribution and

habitat fragmentation are superimposed on plant-feeding

preferences of arthropods, promoting the differentiation

of subpopulations that are more or less connected by

migration (Jaenike, 1990; Berlocher & Feder, 2002). Tetra-

nychus urticae Koch (Acari: Tetranychidae) is a highly

polyphagous mite species (Bolland et al., 1998) that can

easily adapt to novel host plants (Gould, 1979; Fry, 1990;

Navajas, 1998; Agrawal, 2000;Magalhaes et al., 2007; Belli-

ure et al., 2010; Grbic et al., 2011). However, whether this

polyphagy is genuine or the result of coexistence of host-

adapted strains is not clear (Navajas, 1998; Magalhaes

et al., 2007; Belliure et al., 2010).

Host adaptation in the Acari is usually studied by means

of ecological studies using reciprocal transplant experi-

ments and genetic studies using molecular markers (Belli-

ure et al., 2010). In reciprocal transplant experiments the

performance of populations exploiting different hosts is

compared when they are challenged by changing the host.

However, local adaptation as detected in such studies

(Kawecki & Ebert, 2004) is necessary but not sufficient to

establish the occurrence of host races (Magalhaes et al.,*Correspondence: E-mail: aguilare@uji.es

© 2012 The Authors Entomologia Experimentalis et Applicata 144: 181–190, 2012

Entomologia Experimentalis et Applicata © 2012 The Netherlands Entomological Society 181

DOI: 10.1111/j.1570-7458.2012.01276.x

2007). Therefore, when possible, these studies need to be

accompanied by population genetic analyses. In the past

few years, microsatellites have become one of the most

popular molecular markers used for detecting population

differentiation (Balloux & Lugon-Moulin, 2002). Several

microsatellite loci have been isolated for T. urticae and

other related mite species (Navajas et al., 1998; Nishimura

et al., 2003; Uesugi & Osakabe, 2007; Abercrombie et al.,

2009; Hinomoto et al., 2010; Sabater-Munoz et al., 2012)

and they have been used for population genetic studies in

tetranychid mites (Bailly et al., 2004; Xie et al., 2006; Car-

bonelle et al., 2007; Li et al., 2009; Uesugi et al., 2009a,b).

Studies using these techniques in mites have been reviewed

byMagalhaes et al. (2007) and Belliure et al. (2010). These

authors concluded that host races are relatively frequent in

the Acari. Several studies have shown that adaptation can

occur after few generations of selection only (Fry, 1990;

Gotoh et al., 1993; Agrawal, 2000), and there may be no

costs associated with adapting to the newly acquired host

(Fry, 1990; Agrawal, 2000; Magalhaes et al., 2009).

In previous studies (Aguilar-Fenollosa et al., 2011a,b)

we reported the effects of cover crop management on the

dynamics of T. urticae populations in clementine manda-

rin [Citrus clementinaTanaka (Rutaceae)] orchards, where

this species is a key pest (Jacas & Urbaneja, 2010).We pro-

vided evidence that ground cover management could have

dramatic effects on the populations of tetranychid mites

on the trees. Both natural enemies (top-down effects) and

resources (bottom-up effects) played important regulatory

roles (Aguilar-Fenollosa et al., 2011a,b). In short, a mono-

specific cover of Festuca arundinacea Schreber (Poaceae)

led to better population regulation of T. urticae in the trees

than bare soil or the traditional wild cover, which included

a mix of weed species (Aguilar-Fenollosa et al., 2011c).

We offered several hypotheses to explain this result. On

the one hand, the wild cover provided a year-round provi-

sion of alternative food, i.e., pollen that could have favored

omnivorous phytoseiid populations at the expense of T.

urticae-specialist phytoseiid populations (Aguilar-Fenol-

losa et al., 2011b; Pina et al., 2012). On the other hand,

the wild cover provided different hosts that were probably

exploited by T. urticae over the course of several genera-

tions within a single growing season, thereby deterring

host specialization. Instead the mono-specific cover could

have promoted host specialization. Provided that gene

flow of T. urticae populations between cover and clemen-

tine trees was limited, F. arundinacea could have induced

local host adaptation, resulting in selection of a host-spe-

cific strain of T. urticae unable to satisfactorily colonize

and/or exploit the trees.

In this study, we aim at testing whether or not the

replacement of a highly diverse seasonal wild cover by a

mono-specific perennial F. arundinacea exerted a strong

pressure on T. urticae populations in our agroecosystem

and induced the formation of a host strain. By means of

reciprocal transplant experiments combined with genetic

studies using microsatellite markers, we test whether or

not T. urticae demes collected from C. clementina and F.

arundinacea are locally adapted. If that were the case, this

phenomenon could at least partly explain why a better

control ofT. urticae in trees was achieved when F. arundin-

acea was used as a cover compared to other ground man-

agement strategies.

Materials and methods

Stock cultures

Young clementine (C. clementina cv. Clementina de Nules

grafted on citrange Carrizo rootstock) and F. arundinacea

(‘Cesped Todoterreno Formula Chalet’ of Fito Semillas,

Spain) plants were used in our assays. No insecticides or

acaricides were applied to these plants. They were main-

tained in a greenhouse at 25 ± 10 °C, 75 ± 30% r.h.,

under natural photoperiod at Universitat Jaume I, Castello

de la Plana, Spain (39°59′38″N, 0°03′59″W; 30 m

altitude).

Several hundred T. urticae specimens were originally

collected from naturally infested clementine trees in Les

Alqueries (Castello, Spain; 39°54′34″N, 0°06′55″W; 40 m

altitude) and F. arundinacea plants in Montcada (Valen-

cia, Spain; 39°35′20″N, 0°23′30″W; 37 m altitude), a suffi-

ciently small area to control for potential geographic

differentiation (Hurtado et al., 2008). These populations

were reared in a climatic chamber (25 °C, L12:D12 photo-period) on non-infested and fully expanded detached

leaves of their respective original hosts. Leaves were placed

upside down on top of sponges covered with cotton in

water-containing trays (14 9 14 9 7 cm) that served

both as a water source for leaves and mites and as a barrier

against mite dispersal. The two populations were reared

for about 6 months before the onset of the experiments.

As T. urticae generation time takes about 13 days (Aucejo-

Romero et al., 2004), both populations had been reared

for a minimum of 14 generations on these hosts under

controlled conditions prior to the beginning of the assays.

Reciprocal transplant experiments

The performance of both populations of T. urticae was

tested on clementine and on F. arundinacea leaves. Mites

were directly taken from the rearings, hence maternal

effects pertain to their respective host plant. All experi-

ments were performed on non-infested and fully expanded

detached leaves obtained from the same stock culture of

plants used for the rearing. Detached leaves were placed

182 Aguilar-Fenollosa et al.

upside down as previously described. In this case,

although, leaf margins were covered with insect glue (Tree

Tanglefoot®; Grand Rapids, MI, USA) as a barrier. Few

days prior to the start of the experiments, several hundred

ovipositing females were haphazardly taken from the rear-

ing units and transferred to detached leaves for 24 h.

Afterwards, females were removed. Leaves containing eggs

less than 24 h old were held separately in a climatic cham-

ber (25 °C, L12:D12 photoperiod). When attaining the

adult stage, immediately after the quiescent teleiochrysalis

stage, less than 24 h old presumably mated females were

selected and moved in groups of five onto a detached leaf

with a male obtained from the same cohort. These leaves

were checked 3 9 per week and eggs and juvenile speci-

mens were counted (when attaining the adult stage, speci-

mens were sexed and removed from the set-up) until the

original females died. The experiment was repeated 3 9

starting in September 2010 and finishing in December

2010. Six replicates (= detached leaves) per population,

host, and experiment were considered. Assuming the

exponential growth population model, we calculated the

instantaneous rate of increase (ri), as defined by Hall

(1964) and Walthall & Stark (1997). This rate measures

population increase (or decrease) after a short period of

observation and is calculated according to the following

equation:

ri ¼ lnðNf=N0Þ=Dt;where Nf is the final number of individuals (i.e., eggs, juve-

niles plus adults), No is the initial number of total individ-

uals, and Dt refers to the number of days the experiment is

run. The instantaneous rate of increase was calculated

5 days after females started oviposition because at this

moment we observed the population growth to be expo-

nential.

Statistical analysis

Peak oviposition rate, instantaneous rate of increase, sex

ratio, females per female ratio, and longevity of both T.

urticae demes on each host were compared with ANO-

VA (a = 0.05). Patterns of deme 9 host interaction for

all these parameters were taken as indicative of fitness

and were considered as diagnostic of local adaptation.

Two criteria, proposed by Kawecki & Ebert (2004), were

considered to establish the existence of local adaptation.

The first criterion was ‘local vs. foreign’, which empha-

sizes the comparison between demes within habitats: on

each host the local deme is expected to show higher fit-

ness (sympatric combination) than demes from other

hosts (allopatric combination). The ‘home vs. away’ cri-

terion emphasizes the comparison of demes’ fitness

across habitats: local adaptation occurs if each deme has

a higher fitness on its own host (at home) than on the

other host (away).

Data were further fitted to amixed-effect logistic growth

populationmodel (Pinheiro & Bates, 2000) defined as:

N ¼ K=f1þ exp½ðtk=2 � tÞ=r�g;where N is the total number of individuals (eggs, juveniles,

plus adults), t is the time since the start of the experiment

(days), K is the carrying capacity (i.e., the horizontal

asymptote as t ? ∞, representing the maximum average

population size that the environment can support; Speight

et al., 2008), tK/2 is the value of t for which the total num-

ber of individuals is K/2, and r is a growth rate, which cor-

responds with the slope of the line during the exponential

growth phase. The nonlinear least squares estimates of the

parameters (K, tK/2, and r) and their 95% confidence inter-

vals on the logistic model were estimated by means of a

Gauss-Newton algorithm. We considered time, t, as a ran-

dom effect and the parameters of the logistic model as

fixed effects.

The software ‘R’ version 2.9.2 (R Development Core

Team, 2009) and its package ‘nlme’ version 3.1–97 (Pin-

heiro et al., 2010) were used to fit the nonlinear mixed-

effect models. ANOVA tests were performed using IBM®

SPSS® statistics, version 19.0.0 (SPSS & IBM, 2010).

Microsatellite analysis

Seven microsatellite loci isolated by Uesugi & Osakabe

(2007) and Nishimura et al. (2003) labeled forward with

6-FAM fluorescent dye (Table 1) were used in a Multiplex

PCR (Henegariu et al., 1997) to determine the genetic

structure of the two demes (clementine and F. arundina-

cea) included in this study. Fifty individuals from each

deme were collected at four different times: (1) when stock

colonies were established from field-collected specimens

in March 2010; (2) 3 months later from the laboratory

stock colonies; (3) 1 year later from the same stock colo-

nies; and (4) in September 2011, when we looked for mites

in the same locations where they had been collected origi-

nally. Unfortunately, at this time T. urticae was found in

clementine, but not in F. arundinacea. For the first sam-

pling date, mites were extracted from leaf samples using

Berlese funnels, collected in absolute ethanol, and stored at

room temperature until processing. In subsequent analy-

ses, mites directly collected from the sample were individ-

ually introduced into a 1.5-ml microcentrifuge tube and

kept at �80 °C until processing. In all cases, genomic

DNA was prepared by crushing individual mites with a

plastic pestle in a 1.5-ml microcentrifuge tube using a salt-

ing-out protocol (Sunnucks & Hales, 1996). We used 1 llof this solution as the Multiplex PCR template. Each

PCR reaction was performed in a total volume of 20 ll

Local adaptation in Tetranychus urticae in citrus orchards 183

containing 2 ll PCR 109 buffer supplied by the manufac-

turer, 1 ll MgCl2 (50 mM), 2 ll dNTPs (2 mM), 0.075 llforward, 0.075 ll 6-FAM forward, and 0.15 ll reverse forprimers TuCT73 and TuCT04 (10 lM), 0.1 ll forward,0.1 ll 6-FAM forward, and 0.2 ll of reverse for primers

TuCA25 and TuCA12 (10 lM), 0.125 ll of forward,

0.125 ll of 6-FAM forward, and 0.25 ll of reverse for

primers TuCA83, TkMS015, and TuCT18 (10 lM),0.75 ll of Taq 1 U ll�1 (Biotools B&M Labs, Madrid,

Spain), and 8.35 ll ultrapure H2O. PCR amplifications

were performed using a PTC-200 thermal cycler (MJ

Research, Bio-Rad, Hercules, CA, USA). After an initial

denaturation step at 95 °C for 2 min, 35 cycles were car-

ried out consisting of 30 s denaturation at 95 °C, 1 min at

55 °C of annealing temperature, and 1 min 30 s extension

at 72 °C, followed by a last cycle at 60 °C for 30 min and a

hold step at 4 °C. Fragment sizes were analyzed in an ABI/

PE 3130 GeneAnalyzer (Applied Biosystems, Foster City,

CA, USA). Genotyping was performed using Peak Scan-

nerTM Software version 1.0 (Applied Biosystems, 2006).

Microsatellite data analysis

We inferred population structure by clustering with the

software STRUCTURE version 2.0 (Pritchard et al., 2000)

for multilocus analysis incorporating all seven loci scored.

Iteration parameters were set to a burn-in period of

100 000 iterations followed by 1 000 000 iterations and 10

independent simulation runs. This program performs a

Bayesian analysis to assign individuals to a predefined

number of clusters on the basis of probabilistic analysis of

the multilocus genotypes. The ad hoc statistic ΔK, basedon the rate of change in the log probability of data between

successive K-values, was evaluated to determine the

optimal K value (true number of genetic clusters) (Evanno

et al., 2005).

Results

Sex ratio was the only parameter indicative of fitness

included in this study that was the same irrespective of the

deme 9 host combination considered (P>0.05). Deme

and deme * host interaction were significant in all other

parameters considered (peak oviposition rate, instanta-

neous rate of increase, and females per female ratio). For

these parameters, the sympatric deme9 host combination

had higher mean fitness values than the allopatric combi-

nation in clementine, but showed no significant differ-

ences in F. arundinacea. Only in the case of longevity,

deme, host, and deme * host were significant (Figure 1,

Table 2). In this case the sympatric deme9 host combina-

tion had always higher mean fitness values than the

allopatric combination.

When fitting our results to a nonlinear mixed-effect

model, we first used the entire data set. However, the vari-

ability of the residuals increased with fitted values (supple-

mentary online material). The wedge-shaped pattern

observed was due to the correlation among observations

in the same host and not to heteroscedastic error. We

obtained a better understanding of the problem by looking

at the plot of the residuals by host. Residuals were mostly

negative for the T. urticae population collected on F. arun-

dinaceawhen tested on F. arundinacea and mostly positive

for the T. urticae population collected on clementine

and tested on clementine. This finding highlighted the

strong effect of the host in the model. For this reason, we

decided to take into account this effect by fitting different

Table 1 Locus-specific primers and reaction conditions for microsatellites used in this study

Locus Motif Primer (5′–3′) Size (bp) No. alleles

TuCA12 CA GAT TTG TGG TCGTGG TTT TC 276 3

GATCAACTCAAAAGGATAACG TTG

TuCA25 TC AATGTGTTGGTTGTTTACGAAGTG 164 5

TTGGTCAAAGCCGGT TAC AG

TuCA83 GT CAGGGTGAAACT TAGATACC 205 4

CAA TTT TCCCTC TACATC TC

TuCT04 CT CGTCATCAT TGCCGTCAT TTT AC 149 2

GGAGCCGTT TCAAGAGAGTG

TuCT18 CT CTTGATGCTAGTGATACAACG 296 3

CAAGGTGATGAT TTGATT TAAAG

TuCT73 CA CGA TGTGGGTGGTAAGCA TG 111 2

ACGATGATA TTGATGATGAGCG

TkMS015 TC GATGGA TCAACA TTGAACAGATT 210–268 4

TCC TACACT TGACATAAAATCAA

Annealing temperature: 55 °C.

184 Aguilar-Fenollosa et al.

parameters for each host (Table 3), which resulted in dif-

ferent nonlinear models (Figure 2). As a consequence of

this change, the boxplots of the residuals by host no longer

indicated the host effect observed before (supplementary

online material). When comparing the fitted values of the

logistic models by comparing the overlap of the corre-

sponding 95% confidence intervals, the carrying capacity

(K) was the only parameter that did not overlap (Table 3).

On clementine it was 198.75 ± 7.77 (mean ± SE) for the

population collected on clementine, whereas it was

100.04 ± 5.83 for the population collected on F. arundina-

cea. Similarly, K on F. arundinaceawas lower for the popu-

lation collected on F. arundinacea than for the population

collected on clementine (73.72 ± 5.62 and 111.51 ± 5.74,

respectively).

Mites extracted using Berlese funnels in the first sam-

pling and kept in absolute ethanol failed to satisfactorily

amplify DNA and therefore could not be included in

our genetic analyses. The remaining samples, 216 indi-

viduals, could be successfully amplified and when results

were subjected to analysis of the seven microsatellite loci

considered, the optimal number of genetic clusters (i.e.,

the K-value) was two (Figure 3). These two clusters

corresponded to the two demes considered in this study.

Deme 1 included the two laboratory populations initially

collected in clementine trees plus the field population

collected more than 1 year later at the same location.

Deme 2 included the two laboratory populations origi-

nally collected in F. arundinacea.

Discussion

Reciprocal transplant experiments have some drawbacks

(Groot et al., 2005): (1) Effects of the acclimation period.

0

1

2

3

4

5

6

7

8

9

Pea

k ov

ipos

ition

rat

e

F. arundinaceaClementine F. arundinaceaClementine0.0

0.1

0.2

0.3

0.4

0.5

0.6

Inst

anta

neou

s ra

te o

f inc

reas

eF. arundinaceaClementine

0

5

10

15

20

25

No.

fem

ales

per

fem

ale

F. arundinaceaClementine0

5

10

15

20

25

30

Long

evity

A B

C D

Figure 1 (A)Mean (± SE) peak rate of oviposition (no. eggs per female per day), (B) instantaneous rate of increase (per day), (C) rate of

females per female, and (D) longevity (days) for Tetranychus urticae on clementine and Festuca arundinacea. Tetranychus urticae collected

from clementine (black dots) or F. arundinacea (white dots).

Table 2 Statistical significance of the vari-

ous parameters considered based on two-

way ANOVA

Peak

oviposition ri Sex ratio

Females per

female Longevity

Deme F 5.44 3.30 0.76 13.05 12.89

P 0.023 0.074 0.292 <0.001 <0.001Host F 3.08 1.02 1.13 0.12 17.17

P 0.084 0.317 0.388 0.729 <0.001Interaction F 4.17 4.40 7.23 15.15 6.04

P 0.045 0.040 0.092 <0.001 0.015

d.f. = 1,66 in all cases, except for longevity: d.f. = 1,238.

Local adaptation in Tetranychus urticae in citrus orchards 185

Transplanted mites can sometimes perform worse in a

new host because adjustment to a new host plant is costly

in terms of energy and time. This has been observed in T.

urticae (Agrawal et al., 2002). Had this been the case in

our experiment, we would have observed mite perfor-

mance on the novel host plant to go up after an initial

acclimation period (Groot et al., 2005). However, such a

response was not seen during the 20-day period that our

experiments lasted (Figure 2); (2) Effects of selection to

laboratory conditions. If laboratory growth conditions

had modeled the demes used in our assays, changes in

allele frequency over time should have been found. How-

ever, molecular analyses of the populations used in our

assays show that the allele frequency of the seven loci

included in our study did not change for any stock colony.

Interestingly, in the case of the clementine deme, these fre-

quencies were found again in the populations collected at

the original location where this deme had been collected

more than 1 year before. This is highly indicative of the

stability of the system; and (3) Maternal effects. To elimi-

nate differences in possible maternal effects in our experi-

ments, mites were taken directly from the corresponding

rearing. Hence, maternal effects pertained to their respec-

tive host plant.

Species with limited dispersal capabilities are affected

themost by the genetic and demographic impact of habitat

fragmentation (Bailly et al., 2004). The abilities of poly-

phagous pest species, such as T. urticae, to move around

and utilize different habitat patches in response to changes

in suitability enable them to exploit unstable cropping sys-

tems (Kennedy & Storer, 2000). Therefore, dispersal

behavior, even if it is not correlated with reproductive

traits, may increase mite fitness in temporally and spatially

fluctuating environments (Li & Margolies, 1994). Spider

mites display active dispersion behavior by crawling and

by taking off with the air currents. Usually, dispersal of

mites is restricted to relatively short distances, although

aerial long-distance dispersal can occur (Kennedy & Smit-

ley, 1985).Margolies (1995) provided evidence of selection

Clementine

0

50

100

150

200

250

0 5 10 15 20Time (days)

Time (days)

No.

indi

vidu

als

No.

indi

vidu

als

F. arundinacea

0

50

100

150

200

250

0 5 10 15 20

Figure 2 Mean (± SE) size ofTetranychus urticae populations(total number of all developmental stages) on clementine and

Festuca arundinacea, and their best fitting logistic growthmodels.

Tetranychus urticae originated from clementine (black triangles,

drawn line) or F. arundinacea (white squares, dashed line).

Table 3 Estimated values and 95% confidence intervals (CI) for the logistic model parameters (K, tk/2, and r) of Tetranychus urticae on

clementine and Festuca arundinacea

On clementine On F. arundinacea

Original host Estimated 95%CI t1 P Estimated 95%CI t1 P

K (no. T. urticae individuals)

Clementine 198.75 183.50–213.99 25.60 <0.001 111.51 100.24–122.79 19.42 <0.001F. arundinacea 100.04 88.59–111.49 17.15 <0.001 73.72 62.72–84.72 13.16 <0.001

tk/2 (days)

Clementine 7.01 6.26–7.77 18.25 <0.001 5.13 4.33–5.93 12.60 <0.001F. arundinacea 5.29 4.24–6.33 9.98 <0.001 4.96 3.69–6.24 7.65 <0.001

r (day�1)

Clementine 2.12 1.48–2.75 6.50 <0.001 1.29 0.56–2.01 3.49 0.015

F. arundinacea 1.51 0.63–2.38 3.38 <0.001 1.39 0.28–2.48 2.46 0.013

1Student’s t-test value.

186 Aguilar-Fenollosa et al.

on spider mite dispersal rates in relation to habitat persis-

tence in agroecosystems with intra-specific genetic varia-

tion in this trait being maintained by heterogeneous

environments in time and space (Roff, 1975).

Evergreen citrus orchards cannot be considered an

unstable habitat, especially when in association with a per-

manent mono-specific cover crop such as F. arundinacea.

The main cause of instability in commercial citrus orch-

ards is probably pesticide application. After a treatment,

selection should favor resistant specimens staying in the

treated patch – where intraspecific competition initially

will be low –, thus avoiding the risks associated with dis-

persal to a new habitat. The use of economic thresholds

(ET) in commercial orchards should also favor stability.

As crowding increases habitat degradation, population

build-up to damaging levels in orchards could contribute

to increased dispersal behavior in mites (Margolies & Ken-

nedy, 1985). However, the use of ET does not allow mites

to reach high populations in commercial citrus orchards.

In the case of clementines, the economic threshold is espe-

cially low (7% of a random sample of the outer leaves

occupied by at least one adult mite; Martınez-Ferrer et al.,

2006), as commonly found in pests of cosmetic impor-

tance (Hare, 1994). As a result, one would expect mites in

our citrus system not to be selected for increased dispersal

capacities and therefore to preferentially mate with neigh-

bors. Indeed, field studies carried out in Greece demon-

strated that T. urticae populations from lemon trees

collected in orchards in various locations were genetically

closer than those collected on 11 additional hosts at the

same locations only 150 m apart from each other (Tsag-

karakou et al., 1998). This limited dispersion characteristic

of T. urticae in combination with pesticide treatments may

explain the results found in our study.

Clementine trees and F. arundinacea in citrus orchards

are often infested by T. urticae (Aguilar-Fenollosa et al.,

2011a). According to Fry (1996), adaptation to one host

results in relatively poor performance on alternative hosts

due to the antagonistic pleiotropic action of one or more

genes. As a consequence, no genotype has maximal fitness

on different hosts and natural selection will promote host

specialization (Fry, 1996; Agrawal, 2000). For most of the

fitness parameters used in our study, the sympatric

deme 9 host combinations had higher mean fitness val-

ues than the allopatric combinations in clementine and

showed no differences in F. arundinacea. Therefore, our

system complied with the ‘home vs. away’ criterion in all

cases. The ‘local vs. foreign’ criterion (Kawecki & Ebert,

2004) was fully complied with longevity. However, the

other parameters studied did not satisfy this criterion as

both demes performed equally on F. arundinacea. In gen-

eral statistical terms, local adaptation implies mean deme

fitness to be systematically higher for the sympatric

deme 9 habitat combinations than for the allopatric

ones, therefore these results can be taken as indicative but

not conclusive of the occurrence of local adaptation in T.

urticae. Our genetic analysis with molecular markers

performed on the various populations supports this

conclusion.

Opposite to the results of Fry (1990), Agrawal (2000),

and Magalhaes et al. (2009), we found adaptation to be

costly in T. urticae. The clementine deme clearly showed

loss of fitness when reared on F. arundinacea. However,

the F. arundinacea deme only proved to lose fitness (i.e.,

lived shorter) when reared on clementine (Figure 1D,

Table 2). The differences observed in the carrying capacity

of clementine and F. arundinacea, which were significant

for host and deme (Table 3), point at the different inher-

ent profitability of these plants and also at the different

ability of themite demes to exploit them.

Based on our results it could be predicted that after

selection of a F. arundinacea-specialist race in the ground

cover, co-existence of both clementine and F. arundinacea

demes in the same orchard will be difficult. After all, the

clementine deme is expected to eventually outcompete the

F. arundinacea deme, because the former performs better

on clementine, whereas the two demes perform equally

well on F. arundinacea. Still, when F. arundinacea is used

as a cover, high populations of T. urticae in the cover do

not result in heavy infestations in the tree (Aguilar-Fenol-

losa et al., 2011a). This suggests that there are additional

factors at play that are key to maintaining the F. arundina-

cea population in the cover under natural conditions in

the citrus agroecosystem. Firstly, even if dispersal rates are

low in our system, the occurrence of different migration

rates up and down the trees could explain our results. In

an ongoing study where we are monitoring mite dynamics

in clementine trees associated with a F. arundinacea cover

0

1000

2000

3000

4000

5000

6000

7000

1 2 3 4 5 6 7K

*

K

Figure 3 Graphical method described by Evanno et al. (2005)

allowing the detection of the true number of groups K. The

modal value of this distribution is the true K (*) or theuppermost level of structure, here two clusters.

Local adaptation in Tetranychus urticae in citrus orchards 187

using sticky bands on tree trunks, we have actually

observed rates of T. urticae migration from the cover into

the trees to be much higher than those of mites moving

from the canopy to the cover. This differential migration

rate might be related to the nature of the host plant (herba-

ceous vs. woody) and a similar phenomenon has earlier

been observed in apple orchards (Hardman et al., 2011).

However, the existence of alternative dispersal mecha-

nisms, such as aerial or gravity-driven drop, could com-

pensate the differential ambulatory migration rates

observed.

Another factor that could explain our results is related

to prey choice by omnivorous predators like phytoseiids,

the most abundant entomophagous group in our system

(Abad-Moyano et al., 2009; Aguilar-Fenollosa et al.,

2011b). Because all phytophagous arthropods derive their

nutrition from plants, entomophagous arthropods feeding

on them indirectly obtain their nutrition from plants

(Bottrell et al., 1998). In fact, plant-feeding omnivores

consume more herbivores on host plants of low quality

than on high-quality plants (Agrawal et al., 1999; Agrawal

& Klein, 2000). Most Phytoseiidae present in citrus agro-

ecosystem are omnivores (McMurtry & Croft, 1997), and

F. arundinacea is clearly a poorer host than clementine for

T. urticae (Table 3).Therefore, a higher predation exerted

by phytoseiid mites living in the F. arundinacea cover

against the clementine-fed deme relative to F. arundina-

cea-fed deme may also explain our results. A better under-

standing of the plant/pest/natural enemy complex is

necessary to ascertain whether this factor could contribute

to the coexistence of both populations in citrus orchards

and additional research is needed.

Finally, it should not be forgotten that T. urticae pop-

ulations occurring in the tree canopy in commercial

orchards are subjected to pesticide treatments, which if

properly applied, should only marginally affect mites

inhabiting the cover. These differential mortality rates in

the canopy and in the cover could contribute to the

results observed.

To sum up, the patterns of local adaptation detected in

our study may contribute to the successful biological con-

trol of T. urticae observed when using F. arundinacea as a

cover crop in citrus. This adaptation could be the key for

bottom-up mechanisms preventing successful settlement

of cover inhabitingmites in the tree canopy.

Acknowledgements

We are grateful to M. Montserrat (CSIC, Malaga, Spain)

and A. Urbaneja (IVIA, Valencia, Spain) for their helpful

comments on an earlier version of this manuscript, and to

M.V Ibanez-Gual (UJI) for her statistical advice. E.A.F.

was recipient of a predoctoral grant from Universitat

Jaume I. This work was partly funded by the Spanish

Ministerio de Ciencia e Innovacion (AGL2008-05287-

C04/AGR and AGL2011-30538-C03-01).

References

Abad-Moyano R, Pina T, Dembilio O, Ferragut F & Urbaneja A

(2009) Survey of natural enemies of spider mites (Acari: Tetra-

nychidae) in citrus orchards in eastern Spain. Experimental

and Applied Acarology 47: 49–61.Abercrombie LG, Anderson CM, Baldwin BG, Bang IC, Beldade

R et al. (2009) Permanent genetic resources added to molecu-

lar ecology resources database 1 January 2009–30 April 2009.

Molecular Ecology Resources 9: 1375–1429.Agrawal AA (2000) Host-range evolution: adaptation and trade-

offs in fitness of mites on alternative hosts. Ecology 81: 500–508.

Agrawal AA & Klein CN (2000) What omnivores eat: direct

effects of induced plant resistance to herbivores and indirect

consequences for diet selection by omnivores. Journal of Ani-

mal Ecology 69: 525–535.Agrawal AA, Kobayashi C & Thaler JS (1999) Influence of prey

availability and induced plant resistance on omnivory by wes-

tern flower thrips. Ecology 80: 518–523.Agrawal AA, Vala F & SabelisMW(2002) Induction of preference

and performance after acclimation to novel hosts in a phyto-

phagous spider mite: adaptive plasticity? American Naturalist

159: 553–565.Aguilar-Fenollosa E, Ibanez-Gual MV, Pascual-Ruiz S, Hurtado

M & Jacas JA (2011a) Effect of ground-cover management on

spider mites and their phytoseiid natural enemies in clemen-

tine mandarin orchards (I): bottom-up regulation mecha-

nisms. Biological Control 59: 158–170.Aguilar-Fenollosa E, Ibanez-Gual MV, Pascual-Ruiz S, Hurtado

M & Jacas JA (2011b) Effect of ground-cover management on

spider mites and their phytoseiid natural enemies in clemen-

tine mandarin orchards (II): top-down regulation mecha-

nisms. Biological Control 59: 171–179.Aguilar-Fenollosa E, Pascual-Ruiz S, Hurtado-Ruiz M & Jacas JA

(2011c) Efficacy and economics of ground cover management

as a conservation biological control strategy against Tetrany-

chus urticae in clementine mandarin orchards. Crop Protection

30: 1328–1333.Applied Biosystems (2006) Peak Scannere Software v1.0. Lin-

coln Centre, Drive Foster City, CA, USA. https://products.ap-

pliedbiosystems.com. Accessed 05October 2011.

Aucejo-Romero S, Gomez-Cadenas A & Jacas-Miret JA (2004)

Effects of NaCl-stressed citrus plants on life-history parameters

of Tetranychus urticae (Acari: Tetranychidae). Experimental

and Applied Acarology 33: 55–68.Bailly X, Migeon A & Navajas M (2004) Analysis of microsatellite

variation in the spider mite pest Tetranychus turkestani (Acari:

Tetranychidae) reveals population genetic structure and raises

questions about ecological factors. Biological Journal of the

Linnean Society 82: 69–78.

188 Aguilar-Fenollosa et al.

Balloux F & Lugon-Moulin N (2002) The estimation of popula-

tion differentiation with microsatellite markers. Molecular

Ecology 11: 155–165.Belliure B, Montserrat M & Magalhaes S (2010) Mites as models

for experimental evolution studies. Acarologia 50: 513–529.Berlocher SH & Feder JL (2002) Sympatric speciation in phy-

tophagous insects: moving beyond controversy. Annual

Review of Entomology 47: 773–815.BollandHR, Gutierrez J & FlechtmannCHW (1998)World Cata-

logue of the Spider Mite Family (Acari: Tetranychidae). Brill,

Leiden, The Netherlands.

Bottrell GD, Barbosa P & Gould F (1998) Manipulating natural

enemies by plant variety selection and modification: a realistic

strategy? Annual Review of Entomology 43: 347–367.Carbonelle S, Hance T, Migeon A, Baret P, Cros-Arteil S & Nava-

jas M (2007) Microsatellite markers reveal spatial and genetic

structure of Tetranychus urticae (Acari: Tetranychidae) popu-

lations along a latitudinal gradient in Europe. Experimental

and Applied Acarology 41: 225–241.Evanno G, Regnaut S & Goudet J (2005) Detecting the number of

clusters of individuals using the software STRUCTURE: a sim-

ulation study.Molecular Ecology 14: 2611–2620.Fry JD (1990) Trade-offs in fitness on different hosts – Evidence

from a selection experiment with a phytophagousmite. Ameri-

can Naturalist 136: 569–580.Fry JD (1996) The evolution of host specialization: are trade-offs

overrated? American Naturalist 158: 84–107.Gotoh T, Bruin J, Sabelis MW & Menken SBJ (1993) Host

race formation in Tetranychus urticae: genetic differentiation,

host plant preference, and mate choice in a tomato and a

cucumber strain. Entomologia Experimentalis et Applicata 68:

171–178.Gould F (1979) Rapid host range evolution in a population of the

phytophagous mite Tetranychus urticae Koch. Evolution 33:

791–802.Grbic M, van Leeuwen T, Clark RM, Rombauts S, Rouze P et al.

(2011) The genome of Tetranychus urticae reveals herbivorous

pest adaptations. Nature 479: 487–492.Groot TVM, Janssen A, Pallini A & Breeuwer JAJ (2005) Adapta-

tion in the asexual false spider mite Brevipalpus phoenicis: evi-

dence for frozen niche variation. Experimental and Applied

Acarology 36: 165–176.Hall DJ (1964) An experimental approach to the dynamics of a

natural population of Daphnia galeata mendotae. Ecology 45:

94–112.Hardman JM, Franklin JL, Bostanian NJ & Thistlewood HMA

(2011) Effect of the width of the herbicide strip on mite

dynamics in apple orchards. Experimental and Applied Acarol-

ogy 53: 215–234.Hare JD (1994) Sampling arthropod pests in citrus. Handbook of

Sampling Methods for Arthropods in Agriculture (ed. by LP

Pedigo & GD Buntin), pp. 417–431. CRC Press, Boca Raton,

FL, USA.

Henegariu O, Heerema NA, Dlouhy SR, Vance GH & Vogt PH

(1997) Multiplex PCR: Critical parameters and step-by-step

protocol. BioTechniques 23: 504–511.

Hinomoto N, Todokoro Y & Higaki T (2010) Population struc-

ture of the predatory mite Neoseiulus womersleyi in a tea field

based on an analysis of microsatellite DNA markers. Experi-

mental and Applied Acarology 53: 1–15.Hurtado MA, Ansaloni T, Cros-Arteil S, Jacas JA & Navajas

M (2008) Sequence analysis of the ribosomal internal tran-

scribed spacers region in spider mites (Prostigmata: Tetrany-

chidae) occurring in citrus orchards in Eastern Spain: use

for species discrimination. Annals of Applied Biology 153:

167–174.Jacas JA & Urbaneja A (2010) Biological control in citrus in

Spain: from classical to conservation biological control. Inte-

grated Management of Arthropod Pests and Insect Borne Dis-

eases 5 (ed. by A Ciancio & KG Mukerji), pp. 57–68. Springer,Dordrecht, The Netherlands.

Jaenike J (1990) Host specialization in phytophagous insects.

Annual Review of Ecology and Systematics 21: 243–273.Kawecki T & Ebert D (2004) Conceptual issues on local adapta-

tion. Ecology Letters 7: 1225–1241.Kennedy GG & Smitley DR (1985) Dispersal. Spider Mites: Their

Biology, Natural Enemies, and Control. World Crop Pests vol.

1A (ed. by W Helle & MW Sabelis), pp. 233–242. Elsevier,Amsterdam, TheNetherlands.

Kennedy GG & Storer NP (2000) Life systems of polyphagous

arthropod pests in temporally unstable cropping systems.

Annual Review of Entomology 45: 467–493.Li J & Margolies DC (1994) Responses to direct and indirect

selection on aerial dispersal behaviour in Tetranychus urticae.

Heredity 72: 10–22.Li T, Chen X-L & Hong XY (2009) Population genetic structure

ofTetranychus urticae and its sibling species Tetranychus cinna-

baribus (Acari: Tetranychidae) in China as inferred from mi-

crosatellite data. Annals of the Entomological Society of

America 102: 674–683.Magalhaes S, Blanchet E, Egas M & Olivieri I (2009) Are adapta-

tion costs necessary to built up a local adaptation pattern?

BMC Evolutionary Biology 9: 182–194.Magalhaes S, Forbes MR, Skoracka A, Osakabe M, Chevillon C &

McCoy KD (2007) Host race formation in the Acari. Experi-

mental and Applied Acarology 42: 225–238.Margolies DC (1995) Evidence of selection on spider mite dis-

persal rates in relation to habitat persistence in agroecosystems.

Entomologia Experimentalis et Applicata 76: 105–108.Margolies DC & Kennedy GG (1985) Movement of the twospot-

ted spider mite, Tetranychus urticae, among hosts in a

corn-peanut agroecosystem. Entomologia Experimentalis et

Applicata 37: 55–61.Martınez-Ferrer MT, Jacas JA, Ripolles-Moles JL & Aucejo-Ro-

mero S (2006) Approaches for sampling the two spotted spider

mite (Acari: Tetranychidae) on clementines in Spain. Journal

of Economic Entomology 99: 1490–1499.McMurtry JA & Croft BA (1997) Life-styles of phytoseiid mites

and their role in biological control. Annual Review of Ento-

mology 42: 291–321.Navajas M (1998) Host plant associations in the spider mite

Tetranychus urticae (Acari: Tetranychidae): insights from

Local adaptation in Tetranychus urticae in citrus orchards 189

molecular phylogeography. Experimental and Applied Acarol-

ogy 22: 201–214.Navajas MJ, Thistlewood HMA, Lagnel J & Hughes C (1998) Mi-

crosatellite sequences are under-represented in two mite ge-

nomes. InsectMolecular Biology 7: 249–256.Nishimura S, Hinomoto N&Takafuji A (2003) Isolation, charac-

terization, inheritance and linkage of microsatellite markers in

Tetranychus kanzawai (Acari: Tetranychidae). Experimental

and Applied Acarology 31: 93–103.Pina T, Argolo P Sa, Urbaneja A & Jacas JA (2012) Effect of pollen

quality on the efficacy of two different life-style predatorymites

against Tetranychus urticae in citrus. Biological Control 61:

176–183.Pinheiro JC & Bates D (2000) Fitting nonlinear mixed-effects

models. Mixed-Effects Models in S and S-Plus (ed. by JC

Pinheiro & D Bates), pp. 337–414. Springer, New York, NY,

USA.

Pinheiro JC, Bates D, DebRoy S & Sarkar D & R Development

Core team (2010) Package nlme version 3.1-97. Linear and

Nonlinear Mixed Effects Models. http://cran.r-project.org/

web/packages/nlme/index.html. Accessed 04 January 2011.

Pritchard JK, Stephens M & Donnelly P (2000) Inference of pop-

ulation structure using multilocus genotype data. Genetics

155: 945–959.R Development Core Team (2009) R: A language and environ-

ment for statistical computing. R Foundation for Statistical

Computing, Vienna, Austria. http://www.R-project.org. Acce-

ssed 05October 2009.

Roff DA (1975) Population stability and the evolution of dis-

persal in a heterogeneous environment. Oecologia 19: 217–237.

Sabater-Munoz B, Pascual-Ruiz S, Gomez-Martınez MA, Jacas

JA & Hurtado MA (2012) Isolation and characterization of

polymorphic microsatellite markers in Tetranychus urticae and

cross amplification in other Tetranychidae and Phytoseiidae

species of economic importance. Experimental and Applied

Acarology 57: 37–51.Speight RM, Hunter DM &Watt DA (2008) Ecology of Insects –Concepts and Applications.Wiley-Blackwell, Oxford, UK.

SPSS & IBM (2010) IBM® SPSS® Statistics for Windows®,

version 19.0.0. IBM, Armonk, NY, USA.

Sunnucks P & Hales DF (1996) Numerous transposed sequences

of mitochondrial cytochrome oxidase I-II in aphids of the

genus Sitobion (Hemiptera: Aphididae). Molecular Biology

and Evolution 13: 510–524.Tsagkarakou A, Navajas M, Papaioannou-Souliotis P & Pasteur

N (1998) Gene flow among Tetranychus urticae (Acari:

Tetranychidae) populations in Greece. Molecular Ecology 6:

305–314.

Uesugi R & Osakabe M (2007) Isolation and characterization of

microsatellite loci in the two-spotted spider mite, Tetranychus

urticae (Acari: Tetranychidae). Molecular Ecology Notes 7:

290–292.Uesugi R, Kunimoto Y & Osakabe M (2009a) The fine-scale

genetic structure of the two-spotted spider mite in a commer-

cial greenhouse. Experimental and Applied Acarology 47: 99–109.

Uesugi R, Sasawaki T & Osakabe M (2009b) Evidence of a high

level of gene flow among apple trees in Tetranychus urticae.

Experimental and Applied Acarology 49: 281–290.Walthall WK & Stark JD (1997) Comparison of two population

level ecotoxicological endpoints: the intrinsic (rm) and instan-

taneous (ri) rates of increase. Environmental Toxicology and

Chemistry 16: 1068–1073.Williams B, Brawn JD& Paige KN (2003) Landscape scale genetic

effects of habitat fragmentation on a high gene flow species:

Speyeria idalia (Nymphalidae). Molecular Ecology 12: 11–20.Xie L, Hong XY & Xue XF (2006) Population genetic structure of

the two-spotted spider mite (Acari: Tetranychidae) from

China. Annals of the Entomological Society of America 99: 959

–965.

Supporting Information

Additional Supporting Information may be found in the

online version of this article:

Figure S1. (A) Residuals vs. fitted values of the nonlin-

ear mixed-effect model when considering the entire data

set. (B) Boxplots of residuals by population-host of the

logistic growth population model fitted when considering

the entire data set. And (C) idem when considering sepa-

rate data sets (FF is Tetranychus urticae collected from

Festuca arundinacea tested on F. arundinacea, FC is

T. urticae collected from F. arundinacea tested on clemen-

tine, CF is T. urticae collected from clementine tested on

F. arundinacea, and CC is T. urticae collected from clem-

entine tested on clementine).

Please note: Wiley-Blackwell are not responsible for the

content or functionality of any supporting materials sup-

plied by the authors. Any queries (other than missing

material) should be directed to the corresponding author

for the article.

190 Aguilar-Fenollosa et al.