Differentiation of Encapsulated Embryonic Stem CellsAfter Transplantation

Sophia K. Dean,1 Yulyana Yulyana,1 Georgia Williams,1 Kuldip S. Sidhu,1 and Bernard E. Tuch1,2

Background. Embryonic stem cells (ESC) when transplanted into recipients with different major histocompatibilityantigens may be rejected, especially as cells differentiate and expression of these antigens increases. One method toprevent rejection is to place the developing ESC in microcapsules. It is currently unknown what effect encapsulation hason the ability of ESC to differentiate.Methods. Human ESC (hESC; hES03 line) and mouse ESC (mESC; R1 line) were encapsulated in 2.2% barium alginateand transplanted intraperitoneally in SCID and BALB/c mice respectively. Cell morphology, viability, and gene char-acterization were assessed after retrieving the capsules up to four weeks from SCID mice and three months from BALB/cmice.Results. Encapsulation prevented hESC and mESC from forming teratomas up to four weeks and three months,respectively. mESC but not hESC formed aggregates within the capsules, which remained free of fibrosis. Some but notall the transplanted encapsulated hESC differentiated towards all three lineages, but more so towards an endodermallineage as shown by increased expression of alpha fetoprotein. This was similar to what occurred when encapsulatedand non-encapsulated hESC were cultured in vitro for two weeks. In contrast to the hESC, transplanted encapsulatedmESC differentiated mostly towards an ectodermal lineage as shown by increased expression of nestin and glialfibrillary acidic protein. In vitro, encapsulated and nonencapsulated mESC also began to differentiate, but not downany specific lineage.Conclusions. Encapsulated ESC do differentiate, although along multiple pathways, both when transplanted andmaintained in culture, just as nonencapsulated ESC do when removed from their feeder layer.

Keywords: Embryonic stem cells, Transplantation, Differentiation, Encapsulation, Alginate.

(Transplantation 2006;82: 1175–1184)

Embryonic stem cells (ESC) have unique features that in-clude unlimited growth capacity, expression of specific

markers, and an ability to differentiate. ESC of both human(hESC) and mouse (mESC) origin can be differentiated intovarious phenotypes including insulin-producing cells (1– 6),neural precursor cells (7–9), and cardiomyocytes (10, 11).The technical development in directing the differentiation ofESC has widened the potential use of these cells as an invalu-able source in cell replacement therapy.

From an immunological perspective, transplantationpresents a problem of immune rejection. As such, this mightalso be the case in the transplantation of cells derived fromESC for the purpose of cell replacement therapy. mESC in anundifferentiated state do not express major histocompatibil-ity complex (MHC) antigens, even after induction of differ-entiation in vitro (12). However, allotransplantation of thesecells leads to cellular infiltration and loss of the graft (13, 14).In contrast, in hESC, which have a low level of expression ofMHC class I antigens in an undifferentiated state, there is anenhancement of expression after differentiation of the cellsboth in vitro and in vivo (15). Therefore, it is anticipated thattransplantation of ESC and their derivatives may lead to im-munological rejection. A common approach to prevent rejec-

tion is by administering immunosuppressive drugs. How-ever, the use of immunosuppressive agents has serious sideeffects including increased susceptibility to infection and de-velopment of cancer. An alternative to these drugs is to en-capsulate transplantable cells within semi-permeable andbiocompatible membranes such as alginate. Since the initialsuccess in 1980 by Lim and Sun in obtaining prolonged sur-vival of islets by microencapsulation (16), others have usedthe technique with variable success. Best results are achievedwith purified types of alginate. Duvivier-Kali et al. encapsu-lated mouse islets with barium alginate and transplantedthese in diabetic BALB/c and NOD mice. They demonstratedthat microencapsulation conferred complete protection ofgraft from allorejection and found prolonged survival of thegraft for more than 350 days (17). Transplantation of porcineneonatal pancreatic cell clusters encapsulated with bariumalginate normalized blood glucose levels of diabetic immuno-competent mice for more than 20 weeks (18). Transplanta-tion of MIN6 (mouse insulinoma) cells encapsulated withalginate/poly-L-lysine normalized blood glucose levels instreptozotocin-induced diabetes rats without immunosup-pression (19). Similar to published reports, we have previ-ously reported on the immunological protection provided tocells inside microcapsules when allografted (20).

Transplantation of stem cells derived from differentiatedESC can also be contaminated with residual pluripotent celltypes leading to the formation of teratomas in the host (21–23).A teratoma, which is a tumor formed by the disorganized pro-liferation and differentiation of a mixture of cell phenotypes, isthe logical outcome of the growth of implanted ESC in the ab-sence of the signals that normally guide organogenesis. Terato-mas do appear spontaneously, for example, as benign tumors inwomen, arising from the parthenogenetic activation of oocytes,

1 Diabetes Transplant Unit, Prince of Wales Hospital, and The University ofNew South Wales, Sydney, Australia.

2 Address correspondence to: Bernard E. Tuch, MD, PhD, Diabetes Trans-plant Unit, Prince of Wales Hospital, High Street, Randwick, NSW 2031Australia.

E-mail: b.tuch@unsw.edu.auReceived 8 June 2006. Revision requested 10 July 2006.Accepted 20 July 2006.Copyright © 2006 by Lippincott Williams & WilkinsISSN 0041-1337/06/8209-1175DOI: 10.1097/01.tp.0000239518.23354.64

Transplantation • Volume 82, Number 9, November 15, 2006 1175

which start developing in a disorganized mass of embryonic tis-sue (24). In essence, a teratoma arising from ESC does notmetastasize. However, its natural inclination to grow makes itpotentially unsafe when transplanted into an individual, whichmay impede its potential use in cell replacement therapy. It hasbeen suggested that differentiation of ESC in long-term culturesbefore transplantation according to specifically designed proto-cols may be instrumental in preventing teratoma formation(25). Bjorklund et al. have shown that teratoma formation couldbe prevented in a majority of cases when predifferentiated mESCwere implanted into the rat brain at a very low density (22).However, Asano and colleagues demonstrated that allogeneictransplantation of ESC into a nonhuman primate fetus in uteroformed a teratoma when developing in a natural cavity, but con-versely integrated normally in tissues when implanted in otherorgans (26).

Currently, there are no published reports examiningthe impact encapsulation has on ESC in vivo. Our study wasaimed to examine the effect of encapsulation on the viabilityof hESC and mESC and their capacity to differentiate whentransplanted into the peritoneal cavity of immunodeficientand immunocompetent hosts.

METHODS

Cell CultureThe hES03 cell line (a gift from ES Cell International)

was used in this study. Cells were maintained on �-irradiated(45 Gy) human fetal fibroblasts (hFF08) with subculturingperformed every seven days using 1 mg/ml collagenase(Sigma, St Louis, MO) at 37°C for 10 min to remove thehuman fetal fibroblasts. hES03 were grown each time in 4�6-well plates at passages 142–162 and harvested as previouslydescribed (27), with the hESC predominantly as single cells.Each well contained approximately 100 colonies with eachcolony producing 10 –15 small clumps (6,000 –9,000 clumpsor 2.5–2.8�106 single cells per 6-well plate). hESC weremaintained at 37°C, 5% CO2 in serum replacement mediumthat consisted of knock-out Dulbecco’s modified Eagle’s me-dium (KO-DMEM) with high glucose (Gibco, Melbourne,Victoria, Australia), 20% knock-out serum-replacement(Gibco), 2 mM L-glutamine, 0.1 mM nonessential aminoacids, 0.01 mM 2-mercaptoethanol, 1� insulin-transferrin-selenium, 25 U/ml penicillin, and 25 �g/ml streptomycin(Gibco). The hES03 cell line has been previously character-ized, showing the formation of teratomas when transplantedinto immunodeficient SCID mice (27).

The R1 mESC line, derived from 129/Sv mice (28), wasused in this study. Cells were maintained on feeder layer ofgamma-irradiated (35 Gy) mouse embryonic fibroblasts inKO-DMEM supplemented with 10% fetal bovine serum, peni-cillin/streptomycin, 2 mM L-glutamine, 100 mM nonessentialamino acids, 0.1 mM 2-mercaptoethanol and 1,000 U/ml leuke-mia inhibitory factor (LIF; Chemicon International Inc., Te-mecula, CA). Upon reaching 70–80% confluence, cells werepassaged, cryopreserved or harvested for encapsulation.

Encapsulation of hESC and mESCA total of 24,000 –36,000 hES03 clumps (or 10 –12�106

single cells) and 52�106 R1 mESC of passages 26 and 29 wereencapsulated with 2.2% purified alginate (Pronova UP MVG,

NovaMatrix, Oslo, Norway) containing a high glucuronicacid content (�60%). Alginate (viscosity: �200 mPa.s; endo-toxins: �100 EU/g) was used at a volume of 400 �L per 100�L packed cell volume. An air-driven droplet generator (Tor-sten Steinau Verfahrenstechnik, Berlin, Germany) was opti-mally set at an air pressure of 100 kPa and air flow rate of9L/min to produce capsule diameter size of around 300 �m.The droplets formed were immediately incubated in 20 mMBaCl2 for two min and the capsules were washed three timeswith 0.9% saline. Encapsulated hESC and mESC were incu-bated in their respective media at 37°C/5% CO2 until trans-plantation on the following day. Encapsulated hESC andmESC were also cultured for two and three weeks in theirrespective media at 37°C/5% CO2. Media was changed everythree days for encapsulated hESC and daily for encapsulatedmESC.

Transplantation of Encapsulated hESC and mESCImmunodeficient male SCID mice (n�24) and immu-

nocompetent male BALB/c mice (n�18) (Institute of Medi-cal and Veterinary Science, Adelaide, Australia) were used inthis study. All procedures used were approved by the AnimalCare and Ethics Committee of our institution. Prior to trans-plantation, the capsules in media were washed twice with0.9% saline and the packed capsule volume measured. Micewere anesthetized with pentobarbitone (10 mg/ml) at a doseof 70 mg/kg body weight, and the capsules injected into theperitoneal cavity via a lateral abdominal skin incision using a14-G catheter. Each SCID mouse received about 6,700clumps (or 2.8�106 single cells) of encapsulated hESC andeach BALB/c mouse received approximately 8.5�106 of en-capsulated mESC. Immunocompetent mice were chosen forimplanting mESC but not the hESC because of previous stud-ies by us showing survival of allografted (20) but not xe-nografted encapsulated cells. As controls, 2�106 hESC and1.4�106 nonencapsulated mESC were transplanted underthe kidney capsule of SCID and BALB/c mice, respectively.Animals with hESC were killed at four weeks posttransplan-tation and those with mESC at two to four weeks; the graftwas subsequently removed.

Capsule Retrieval After TransplantationTransplanted SCID mice were killed with CO2 after

one, two, and four weeks and transplanted BALB/c mice werekilled with CO2 after one, two, and three months. The cap-sules were retrieved at each time point using saline lavages.The packed capsule volume of retrieved capsules was mea-sured and the capsules were assessed for fibrosis and break-age, and the cells for viability. Fibrosis and capsule breakagewere assessed by randomly choosing 40 –50 retrieved capsulesfrom each mouse and results were expressed as a percentageof the total.

Cell ViabilityViability of the capsules were assessed postencapsula-

tion and at retrieval/sampling time points using fluorescentdyes, 6-carboxyfluorescein diacetate (6-CFDA; Sigma) thatstained viable cells green, and propidium iodide (PI; Sigma)that stained nonviable cells red under the blue light. Approx-imately 40 capsules were obtained and washed with phos-phate buffered saline (PBS; Gibco BRL). Capsules were then

1176 Transplantation • Volume 82, Number 9, November 15, 2006

incubated in 6-CFDA solution for 30 min at 37°C followed byincubation in PI solution for 10 min at room temperaturewith washing in between incubation. Viability was assessed byestimating the proportion of green (viable cells) against red(nonviable cells) in each capsule and results were expressed asa percentage of the total.

Cell RetrievalTo extract RNA from encapsulated hESC and mESC,

the membrane of the capsules was dissolved by incubating thecapsules in a decapsulating solution consisting of 50 mMethylenediamine tetraacetic acid (EDTA) and 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) in

TABLE 1. Primer sequences used in the PCR amplification

Gene Primer sequence 5�- 3� PCR conditions Product size (bp)

Human primers

Oct-4 371

F attcagccaaacgaccatct 94°C for 2 min; 35 cycles of 94°C for 30s, 58°C for 30s, 72°Cfor 30s; 72°C for 5 minR agcagcctcaaaatcctct

Nanog 208

F cctatgcctgtgatttgtgg 94°C for 2 min; 35 cycles of 94°C for 30s, 58°C for 30s, 72°Cfor 30s; 72°C for 5 minR ctgggaccttgtcttccttt

AFP 450

F aaaagcccactccagcatc 94°C for 2 min; 35 cycles of 94°C for 30s, 58°C for 30s, 72°Cfor 30s; 72°C for 5 minR gcagacaatccagcacatctc

BMP4 785

F ggaggaggaggaagagcagat 94°C for 2 min; 35 cycles of 94°C for 30s, 58°C for 30s, 72°Cfor 30s; 72°C for 5 minR ggttggttgagttgaggtggt

Renin 150

F cgtctttgacactggttcgt 94°C for 2 min; 35 cycles of 94°C for 30s, 58°C for 30s, 72°Cfor 30s; 72°C for 5 minR gttgaatagcggagggtgag

Nestin (15) 388

F cagcgttggaacagaggttgg 94°C for 2 min; 35 cycles of 94°C for 30s, 58°C for 30s, 72°Cfor 30s; 72°C for 5 minR tggcacaggtgtctcaagggtag

�-actin 503

F acggcatcgtcaccaact 94°C for 2 min; 35 cycles of 94°C for 30s, 58°C for 30s, 72°Cfor 30s; 72°C for 5 minR aggaaggaaggctggaagag

Mouse primers

GAPDH 424

F acccagaagactgtggatgg 94°C for 2 min; 35 cycles of 94°C for 30s, 57°C for 30s, 72°Cfor 30s; 72°C for 5 minR ccaccctgttgctgtagcc

Oct-4 312

F ggcgttctctttggaaaggtgttc 94°C for 2 min; 35 cycles of 94°C for 30s, 60°C for 30s, 72°Cfor 30s; 72°C for 5 minR ctcgaaccacatccttctct

AFP 470

F acaggaggctatgcatcacc 94°C for 2 min; 35 cycles of 94°C for 30s, 54°C for 30s, 72°Cfor 30s; 72°C for 5 minR tggacatcttcaccatgtgg

Brachyury 588

F ccctgcacattacacaccac 94°C for 2 min; 35 cycles of 94°C for 30s, 62°C for 30s, 72°Cfor 30s; 72°C for 5 minR ggcaacaagggaggacatta

Nestin 593

F gaagaccagcaggcgtttag 94°C for 2 min; 35 cycles of 94°C for 30s, 62°C for 30s, 72°Cfor 30s; 72°C for 5 minR ttcgagagattcgagggaga

GFAP 400

F cacgaacgagtccctagagc 94°C for 2 min; 35 cycles of 94°C for 30s, 60°C for 30s, 72°Cfor 30s; 72°C for 5 minR tcacatcaccacgtccttgt

Tuj-1 587

F tgaggcctcctctcacaagt 94°C for 2 min; 35 cycles of 94°C for 30s, 60°C for 30s, 72°Cfor 30s; 72°C for 5 minR cattgagctgaccagggaat

© 2006 Lippincott Williams & Wilkins 1177Dean et al.

PBS for 20 min at 37°C. Cells were then collected by centrif-ugation at 3,000 rpm for 10 min.

RNA ExtractionRNA was extracted using TRIzol reagent (Invitrogen,

Carisbad, CA) according to the manufacturer’s instructions.Extracted RNA was then treated with DNase using Deoxyri-bonuclease I Kit Amplification Grade (Invitrogen) accordingto the manufacturer’s instructions.

Gene Characterization using RT-PCR and PCRcDNA was synthesized from 1 �g of total RNA in 22 �L

reaction mixture using Superscript III RT First Strand Syn-thesis System (Invitrogen) according to manufacturer’s in-structions. Polymerase chain reaction (PCR) amplificationwas carried out using the Platinum Taq DNA Polymerase(Invitrogen). Primers and PCR conditions used are listed inTable 1. The PCR cycle number for each primer was 35 givinga valid comparison between the groups. There were a total of24 (8 samples per time point) and 18 samples (6 samples pertime point) obtained from SCID and BALB/c mice, respec-tively. For the in vitro study, there were a total of 18 samples

(6 samples per time point) and 24 samples (6 samples pertime point) for the cultured encapsulated hESC and mESC,respectively. Each sample was assessed three times via PCR.Amplified products were analyzed on 1% agarose gel (Ultra-pure agarose; Invitrogen) with ethidium bromide (Sigma)staining.

Statistical AnalysisAll data are presented as means�standard error

(mean�SE). Comparison between two groups was per-formed using two-sample Student’s t test as well an analysis ofvariance (ANOVA) with P�0.05 being statistically signifi-cant. Statistical analyses were performed with NumberCruncher Statistical System (NCSS) 2004 (Kaysville, UT).

RESULTS

Morphology of Encapsulated hESC and mESC

Prior to Transplantation/In Vitro CulturePassages 142–162 of hES03 cells and Passages 26 and

29 of R1 mESC were harvested and encapsulated in 2.2%barium-alginate. Figure 1A shows the typical appearance of

FIGURE 1. Light microscopic viewof encapsulated hESC retrieved fromthe peritoneal cavity of SCID mice.hESC were encapsulated as a mixtureof single cells and small clumps at day0 (A). Capsules retrieved at one week(B), two weeks (C), and four weeks (D)remain as single cells or as smallclumps. Capsules maintained in cul-ture for two weeks are similar (E).

1178 Transplantation • Volume 82, Number 9, November 15, 2006

hESC after encapsulation, with the hESC predominantly insingle cell formation. The capsule diameter was 269�16 �mwith capsule size range of 100 –548 �m. Cell viability prior totransplantation was 89�10%. Figure 2A show the typical ap-pearance of mESC in single-cell formation after encapsula-tion. The capsule diameter was 333�6 �m with capsule size145–570 �m. Cell viability was 89�1%.

After TransplantationTo determine the ability of ESC to differentiate in vivo,

encapsulated hESC were transplanted into the peritoneal cav-ity of SCID mice (n�24) and capsules were retrieved afterone, two, and four weeks for assessment and cell character-ization. Figure 1B–D illustrates the encapsulated hESC re-trieved at various time points. Capsules at one, two, and fourweeks posttransplantation exhibited a combination of single

cells and small clumps with no obvious cell aggregation. At alltime points, the surface of the retrieved capsules was free offibrotic overgrowth. The number of intact capsules was�98% with a retrieval efficiency also of �98% (370 �Lpacked capsule volume at day 0) at all time points. Viability ofhESC inside the capsules pretransplantation was 89�10%.Posttransplantation, all hESC stained green with 6-CFDA,but there were fewer cells than before transplantation.

Encapsulated mESC were transplanted into the perito-neal cavity of BALB/c mice (n�18) and capsules retrievedafter one, two, and three months for assessment and cell char-acterization. The packed capsule volume transplanted was400 �L and the capsule retrieval efficiency was 97%, 90%, and87% at one, two, and three months, respectively. Figure 2B–Dillustrates the capsules retrieved at various time points. Byone month, the earliest time point examined after transplan-

FIGURE 2. Encapsulated mESC retrieved from the peritoneal cavity of BALB/c mice. mESC were encapsulated as singlecells on day 0 (A). Capsules retrieved at one month (B), two months (C), and three months (D) have formed aggregates incontrast to being single cells prior to transplantation. The same occurred during culture in vitro after one week (E).Retrieved capsules were also assessed for viability using fluorescent microscopy. Viable cells stain green (6-CFDA) anddying cells red (PI) prior to transplantation (F) and two months posttransplantation (G).

© 2006 Lippincott Williams & Wilkins 1179Dean et al.

tation, the cells had aggregated into clusters (Fig. 2B). Theextent of cell aggregation was more prominent in capsulesretrieved after two and three months posttransplantation(Fig. 2C and D). At all time points, the surface of the majorityof retrieved capsules was free of fibrotic overgrowth. How-ever, a minority of the capsules retrieved from the peritonealcavity of mice had ruptured. The number of intact capsuleswas 87%, 86%, and 76% at one, two, and three months, re-spectively. In some cases, cells were observed growing outsideof the broken capsules.

From Figure 2F, most of the mESC inside the capsulespretransplantation were viable (88�1%). Posttransplanta-tion, viability of mESC decreased, with 63�1% of cells viableat one month, 55�2% at two months (Fig. 2G) and 49�1% atthree months. The loss of viability may have been because ofischemia due to competition of the expanding cell populationfor limited nutrients.

Control mice transplanted with nonencapsulated hESCand mESC developed teratomas. This was seen as early as twoweeks posttransplantation in mice grafted with mESC (Fig.3A), with further growth and invasion of surrounding tissuesthereafter (Fig. 3B). Histological analysis of the teratomasshowed the presence of ectodermal, mesodermal, andendodermal tissues (data not shown).

Gene Characterization of RetrievedEncapsulated hESC and mESC

To determine the level of differentiation that occurredin transplanted encapsulated ESC, RNA from the capsuleswas extracted and gene characterization for pluripotent andlineage markers was performed. As expected, the pluripotentmarkers, Oct-4 (29) and nanog (30) were expressed in encap-sulated hESC at day 0/pretransplantation, indicating thepresence of undifferentiated pluripotent cells. After oneweek, Oct-4 and nanog were still expressed and remained sofor four weeks (Fig. 4A), which indicates the presence of atleast some undifferentiated hESC. In mESC, expression ofOct-4 was lost by one month posttransplantation (Fig. 5A),indicating that all encapsulated mESC were differentiating.

To determine whether the differentiated cells had ac-quired markers of other lineages, the expression of markersrepresenting derivatives of ectoderm, mesoderm, andendoderm were also examined. In encapsulated hESC at day0, nestin (ectodermal marker) and bone morphogenetic pro-tein 4 (BMP4) were present, whereas renin (mesodermalmarker) and alpha fetoprotein (AFP) (endodermal marker)

were not expressed (Fig. 4A). The expression of BMP4 inhESC has been shown to support self-renewal of ESC (31),thus maintaining pluripotency. AFP was expressed from oneweek, although levels did fluctuate. There was no change inthe expression of nestin and BMP4 after four weeks post-transplantation. Slight expression of renin, which was notpresent at day 0, was observed four weeks posttransplanta-tion. From the RT-PCR results, it can be seen that the direc-tion of differentiation of the encapsulated hESC aftertransplantation was mostly endodermal.

In encapsulated mESC, nestin, brachyury (mesodermalmarker), and AFP were present at day 0, showing that at leastsome of the cells had begun differentiating prior to transplan-tation (Fig. 5A). There was enhanced expression of the genesfor all three lineages at one month but a diminution thereafterfor brachyury and AFP. Thus, the direction of differentiationof the encapsulated mESC after one month was mostly ecto-dermal. To investigate expression of other ectodermal geneticmarkers, both glial fibrillary acidic protein (GFAP), an astro-cyte marker, and Tuj-1, a neuronal marker, were screened. Asseen from Figure 5A, expression of GFAP occurred aftertransplantation, while Tuj-1 expression, which was presentbefore transplantation, was unchanged thereafter.

In Vitro Culture of Encapsulated hESC and mESCTo determine if encapsulated hESC could differentiate

in vitro, the capsules were maintained in KO-DMEM serum-replacement media to allow differentiation to occur. hESCremained as single cells or appeared as small clumps posten-capsulation (Fig. 1E). Viability of encapsulated hESC atday 0 was 97�1% and significantly decreased to 61�9%(P�0.0159) and 57�5% (P�0.001) after one and two weeksin culture respectively. In contrast, mESC maintained inmESC media without LIF for three weeks, formed large cel-lular aggregates (Fig. 2E). Viability of mESC immediatelypostencapsulation was 87�1% and 75�1%, 84�1% and95�1% after one, two, and three weeks culture, respectively.

In order to determine what level of differentiation levelhad occurred in cultured encapsulated hESC, RNA was ex-tracted to enable gene characterization. Oct-4 and nanogwere still expressed even after two weeks (Fig. 4B), indicatingthat there was still a proportion of undifferentiated hESCpresent. Nestin and BMP4 were present at day 0 and the ex-pression of these genes was unchanged during culture. AFPand renin, absent at day 0, were expressed from one week andtwo weeks, respectively. There were similarities between cul-

FIGURE 3. Formation of teratoma(arrowed) after non-encapsulated mESCwere transplanted under the renal cap-sule of BALB/c mice. The teratoma canbe seen in the kidney at two weeks (A),but by four weeks it has expanded tobe outside the kidney (B).

1180 Transplantation • Volume 82, Number 9, November 15, 2006

tured mESC and hESC, with Oct-4 still expressed in mESCcultured for three weeks (Fig. 5B). Unlike the hESC, all threelineage markers were present in mESC at day 0, indicatingthat some of the cells had differentiated. After one week, therewas increased expression of brachyury and nestin, and aftertwo weeks AFP.

DISCUSSIONESC have an enormous potential for use in cell replace-

ment therapy owing to their capability to differentiate intoany type of cell from the three germ lineages under optimalconditions. However, transplantation of stem cells derivedfrom differentiated ESC can also be contaminated with resid-

FIGURE 4. Gene expression analysis of encapsulated hESC. Transplanted encapsulated hESC (n�24, 8 samples per timepoint) (A) and encapsulated hESC maintained in vitro for two weeks (n�18; 6 samples per time point) (B) were screened forpluripotent (Oct-4 and nanog), endoderm (AFP), mesoderm (renin) and ectoderm (nestin) markers. �-actin was used as thehousekeeping gene. Each sample was analyzed by PCR three times. All samples showed the same PCR result and this figureis representative of what was obtained in this study.

© 2006 Lippincott Williams & Wilkins 1181Dean et al.

ual pluripotent cell types leading to the formation of terato-mas in the host (21–23). Results from our study show thatencapsulation prevents formation of teratomas, perhaps bylimiting the amount of space available for the cells to grow.No hESC capsules were broken and no teratoma formationwas observed after four weeks transplantation in immunode-ficient SCID mice. Similar results were obtained with encap-sulated mESC transplanted into immunocompetent BALB/cmice after three months. By contrast, in our control experi-ment with nonencapsulated hESC and mESC, teratomasformed. The formation of teratomas in the immunocompe-tent mice grafted with non-encapsulated mESC was unex-pected. It was anticipated that transplantation of these mESC,with major histocompatibility antigens (H-2b) different fromthose of the recipient BALB/c mice (H-2d), would result inimmune rejection. This was based on the reported presence ofMHC class I antigens, admittedly at low levels, on the surfaceof hESC and enhancement of their expression upon differen-tiation (15, 32). The development of a teratoma may suggest

that mESC did not express MHC antigens on their surfaceand hence would not be rejected. The absence of MHC anti-gens on the surface of undifferentiated mESC has indeed beenpreviously shown by Tian et al. (12). However, allotransplan-tation of 1�106 mESC led to formation of teratoma after fourweeks but the graft was lost after eight weeks (14). MHC classI is expressed in transplanted mESC and cellular infiltrationof grafted cells does occur (13). It is possible that rejection ofthe nonencapsulated mESC we grafted into BALB/c micemight have occurred if the animals had been observed forgreater than four weeks.

Our results also demonstrate that encapsulation didnot prevent hESC from differentiating, as indicated by theup-regulation of the lineage markers, even though the pluri-potent markers Oct-4 and nanog were still present, both invivo and in vitro. It has been suggested that hESC have anadaptive capacity similar to embryonal carcinoma (EC) cells.Draper et al. demonstrated that a subline from H7-s6 hESCline retained a pluripotent phenotype even when cultured for

FIGURE 5. Gene expression analysis of encapsulated mESC. Transplanted encapsulated mESC (n�18; 6 samples pertime point) (A) and encapsulated mESC maintained in vitro for three weeks (n�24; 6 samples per time point) (B) werescreened for pluripotent (Oct-4), endoderm (AFP), mesoderm (brachyury) and ectoderm (nestin) markers. Expression ofan astrocyte marker (GFAP) and neuronal marker (Tuj-1), which are markers of differentiating ectoderm, were furtherscreened. GAPDH was used as the housekeeping gene. Each sample was analyzed by PCR 3 times. All samples showed thesame PCR result and this figure is representative of what was obtained in this study.

1182 Transplantation • Volume 82, Number 9, November 15, 2006

a long period without feeders, or conditioned medium, buton Matrigel (32). One of these sublines was also adapted togrow without feeders and in the absence of fibroblast growthfactor (FGF), a growth factor generally thought to be requiredby hESC. Nevertheless, these hESC retained their pluripo-tency, expressing typical markers of hESC and produced ter-atomas when transplanted into immunosuppressed mice(32). Likewise, we have shown previously both the continuedexpression of both Oct-4 and nanog in the hES03 line cul-tured for three weeks as nonencapsulated embryoid bodies inthe absence of FGF (32). In the current study with encapsu-lated ESC, both Oct-4 and nanog were still expressed evenafter four weeks in vivo, with AFP and renin being expressedafter one and four weeks, respectively. Similar results werealso obtained when encapsulated hESC were maintained inculture without feeders and basic FGF, with AFP and reninbeing expressed after one and two weeks, respectively. Thesein vitro results are similar to those we have reported previ-ously with nonencapsulated embryoid bodies from the hES03line. In that study, AFP was expressed within the first week ofculture and the mesoderm marker in the second week (32)With the encapsulated mESC cultured in vitro, results similarto those obtained with the encapsulated hESC were obtained.Oct-4 was still present after three weeks of culture, eventhough upregulation of lineage markers was observed. This issimilar to what we have reported previously for nonencapsu-lated mESC (3). The supportive role of BMP4 in maintainingpluripotency in hESC was also indicated by its coexpressionwith Oct-4 and nanog throughout all time points in thisstudy. BMP4 has been shown to support self-renewal of hESCby inhibiting mitogen-activated protein kinase pathways(31). It is plausible that the pluripotent markers may disap-pear with BMP4 if a longer time frame was examined as wehave seen with encapsulated mESC transplanted for threemonths. Nevertheless, the pathway in which cells differenti-ate depends on a balance between intracellular and extracel-lular cues. In our study, encapsulated hESC were directedmainly towards an endodermal lineage both in vivo and invitro, while retaining pluripotency.

Encapsulation technology has been used for many yearsin cell transplantation studies. Studies involving transplanta-tion of microencapsulated islet cells in allogeneic and xeno-geneic settings have proven to be successful with completeprotection and prolonged survival and functioning of thegraft (17, 18). As such, it is reasonable to assume thatencapsulation can be utilized to confer protection from im-munological rejection for ESC when transplanted across his-tocompatibility barriers. The data from the present studyseem to confirm this assumption since mESC of R1 origin andBALB/c mice possess different MHC antigens. Temperingthis interpretation is the fact that undifferentiated mESC arereported not to express MHC antigens (12), although theseantigens are expressed as the cells differentiate in vivo (13).

Encapsulated hESC were statically cultured for twoweeks without the presence of feeder layers and basic FGFwith the medium changed every two to three days. After oneweek, cell viability has significantly decreased to 61% andcontinued to decrease to 57% after two weeks. It is possiblethat the static incubation of encapsulated hESC may beinstrumental in the decrease in cell viability in that the subse-quent media changes may not have been adequate to trans-

port essential nutrients into the center of the capsule. UnlikemESC, encapsulated hESC did not form cellular aggregatesand remained in their current formation of single cells and/orin small clumps, which may have impeded their survivalgiven the lack of cell-to-cell interactions. This was in contrastto the results obtained by Dang et al. (33) who found thatencapsulated hESC and mESC in agarose allow controlledagglomeration and that this procedure permits the mainte-nance of phenotype and increased cell numbers.

In conclusion, our results demonstrate that encapsu-lated hESC and mESC do not form teratomas after four weeksand three months when respectively transplanted in immu-nodeficient and immunocompetent hosts. At the same time,encapsulation allows hESC and mESC to differentiate in amanner similar to what occurs when non-encapsulated hESCand mESC are maintained in culture. Because of the multi-lineage nature of the differentiating ESC in the microcap-sules, however, it would seem appropriate to differentiateESC prior to encapsulation and subsequent transplantation.

ACKNOWLEDGMENTSWe are grateful to the Australian Stem Cell Centre, Syd-

ney Foundation of Medical Research and the Rebecca CooperFoundation for funding this work. We would like to thankMathiyalagan Appavoo and Jayne Foster for technical advice inmolecular biology and encapsulation, respectively, and JustinLees for designing the in-house primers used in this study.

REFERENCES1. Bai L, Meredith G, Tuch BE. Glucagon-like peptide-1 enhances pro-

duction of insulin in insulin-producing cells derived from mouse em-bryonic stem cells. J Endocrinol 2005; 186: 343.

2. Leon-Quinto T, Jones J, Skoudy A, et al. In vitro directed differentia-tion of mouse embryonic stem cells into insulin-producing cells. Dia-betologia 2004; 47: 1442.

3. Lumelsky N, Blondel O, Laeng P, et al. Differentiation of embryonicstem cells to insulin-secreting structures similar to pancreatic islets.Science 2001; 292: 1389.

4. Segev H, Fishman B, Ziskind A, et al. Differentiation of human embry-onic stem cells into insulin-producing cells. Stem Cells 2004; 22: 265.

5. Soria B, Roche E, Berna G, et al. Insulin-secreting cells derived fromembryonic stem cells normalize glycemia in streptozotocin-induceddiabetic mice. Diabetes 2000; 49: 157.

6. Vaca P, Martin F, Vegara-Meseguer J, et al. Induction of differentiationof embryonic stem cells into insulin secreting cells by fetal soluble fac-tors. Stem Cells 2006; 24: 258.

7. Itsykson P, Ilouz N, Turetsky T, et al. Derivation of neural precursorsfrom human embryonic stem cells in the presence of noggin. Mol CellNeurosci 2005; 30: 24.

8. Muotri AR, Nakashima K, Toni N, et al. Development of functionalhuman embryonic stem cell-derived neurons in mouse brain. Proc NatlAcad Sci U S A 2005; 102: 18644.

9. Zhang SC, Wernig M, Duncan ID, et al. In vitro differentiation oftransplantable neural precursors from human embryonic stem cells.Nat Biotechnol 2001; 19: 1129.

10. McDevitt TC, Laflamme MA, Murry CE. Proliferation of cardiomyo-cytes derived from human embryonic stem cells is mediated via theIGF/PI 3-kinase/Akt signaling pathway. J Mol Cell Cardiol 2005; 39:865.

11. Wei H, Juhasz O, Li J, et al. Embryonic stem cells and cardiomyocytedifferentiation: phenotypic and molecular analyses. J Cell Mol Med2005; 9: 804.

12. Tian L, Catt JW, O’Neill C, King NJ. Expression of immunoglobulinsuperfamily cell adhesion molecules on murine embryonic stem cells.Biol Reprod 1997; 57: 561.

13. Kofidis T, DeBruin JL, Tanaka M, et al. They are not stealthy in theheart: embryonic stem cells trigger cell infiltration, humoral and T-

© 2006 Lippincott Williams & Wilkins 1183Dean et al.

lymphocyte-based host immune response. Eur J Cardiothorac Surg2005; 28: 461.

14. Swijnenburg RJ, Tanaka M, Vogel H, et al. Embryonic stem cell immu-nogenicity increases upon differentiation after transplantation intoischemic myocardium. Circulation 2005; 112: I166.

15. Drukker M, Katz G, Urbach A, et al. Characterization of the expres-sion of MHC proteins in human embryonic stem cells. Proc Natl AcadSci U S A 2002; 99: 9864.

16. Lim F, Sun AM. Microencapsulated islets as bioartificial endocrinepancreas. Science 1980; 210: 908.

17. Duvivier-Kali VF, Omer A, Parent RJ, et al. Complete protection ofislets against allorejection and autoimmunity by a simple barium-alginate membrane. Diabetes 2001; 50: 1698.

18. Omer A, Duvivier-Kali VF, Trivedi N, et al. Survival and maturation ofmicroencapsulated porcine neonatal pancreatic cell clusters trans-planted into immunocompetent diabetic mice. Diabetes 2003; 52: 69.

19. Aoki T, Hui H, Umehara Y, et al. Intrasplenic transplantation of en-capsulated genetically engineered mouse insulinoma cells reversesstreptozotocin-induced diabetes in rats. Cell Transplant 2005; 14: 411.

20. Foster JL, Keogh G, Roberts S, et al. Evidence of allograft function indiabetic pig recipients in the absence of anti-rejection drugs. IPITA2005; 10: 110.

21. Barberi T, Klivenyi P, Calingasan NY, et al. Neural subtype specifica-tion of fertilization and nuclear transfer embryonic stem cells and ap-plication in parkinsonian mice. Nat Biotechnol 2003; 21: 1200.

22. Bjorklund LM, Sanchez-Pernaute R, Chung S, et al. Embryonic stemcells develop into functional dopaminergic neurons after transplanta-tion in a Parkinson rat model. Proc Natl Acad Sci U S A 2002; 99: 2344.

23. Erdo F, Buhrle C, Blunk J, et al. Host-dependent tumorigenesis of em-

bryonic stem cell transplantation in experimental stroke. J Cereb BloodFlow Metab 2003; 23: 780.

24. Mitjavila-Garcia MT, Simonin C, Peschanski M. Embryonic stem cells:meeting the needs for cell therapy. Adv Drug Deliv Rev 2005; 57: 1935.

25. Kim JH, Auerbach JM, Rodriguez-Gomez JA, et al. Dopamine neuronsderived from embryonic stem cells function in an animal model ofParkinson’s disease. Nature 2002; 418: 50.

26. Asano T, Ageyama N, Takeuchi K, et al. Engraftment and tumor for-mation after allogeneic in utero transplantation of primate embryonicstem cells. Transplant 2003; 76: 1061.

27. Sidhu KS, Tuch BE. Derivation of three clones from human embryonicstem cell line by FACS sorting and their characterization. Stem Cells Dev2006; 15: 61.

28. Nagy A, Rossant J, Nagy R, et al. Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc Natl AcadSci U S A 1993; 90: 8424.

29. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4defines differentiation, dedifferentiation or self-renewal of ES cells. NatGenet 2000; 24: 372.

30. Mitsui K, Tokuzawa Y, Itoh H, et al. The homeoprotein Nanog is re-quired for maintenance of pluripotency in mouse epiblast and ES cells.Cell 2003; 113: 631.

31. Qi X, Li TG, Hao J, et al. BMP4 supports self-renewal of embryonicstem cells by inhibiting mitogen-activated protein kinase pathways.Proc Natl Acad Sci U S A 2004; 101: 6027.

32. Draper JS, Moore HD, Ruban LN, et al. Culture and characterization ofhuman embryonic stem cells. Stem Cells Dev 2004; 13: 325.

33. Dang SM, Gerecht-Nir S, Chen J, et al. Controlled, scalable embryonicstem cell differentiation culture. Stem Cells 2004; 22: 275.

1184 Transplantation • Volume 82, Number 9, November 15, 2006