R E S EA RCH L E T T E R

Development of a single-tube loop-mediated isothermalamplification assay for detection of four pathogens of bacterial

meningitis

Nguyen Tien Huy1, Le Thi Thuy Hang1, Daniel Boamah1, Nguyen Thi Phuong Lan2,Phan Van Thanh2,3, Kiwao Watanabe4, Vu Thi Thu Huong4, Mihoko Kikuchi1,Koya Ariyoshi4, Kouichi Morita5,6 & Kenji Hirayama1,6

1Department of Immunogenetics, Institute of Tropical Medicine (NEKKEN), Nagasaki University, Sakamoto, Nagasaki, Japan; 2Laboratory of

Arbovirus, Pasteur Institute, Ho Chi Minh City, Vietnam; 3Faculty of Biology, Ho Chi Minh City University of Science, Ho Chi Minh City, Vietnam;4Department of Clinical Medicine, Institute of Tropical Medicine, Nagasaki University, Sakamoto, Nagasaki, Japan; 5Department of Virology,

Institute of Tropical Medicine, Nagasaki University, Nagasaki, Japan; and 6Global COE program, Nagasaki University, Nagasaki, Japan

Correspondence: Kenji Hirayama,

Department of Immunogenetics, Institute

of Tropical Medicine (NEKKEN), Nagasaki

University, 1-12-4 Sakamoto, Nagasaki

852-8523, Japan. Tel.: +81 95 819 7805;

fax: +81 95 819 7821; e-mail:

hiraken@nagasaki-u.ac.jp

Received 18 July 2012; revised 29 August

2012; accepted 30 August 2012.

DOI: 10.1111/1574-6968.12002

Editor: Andre Klier

Keywords

assay; bacteria; diagnosis; LAMP; meningitis;

simultaneous.

Abstract

Several loop-mediated isothermal amplification (LAMP) assays have been

developed to detect common causative pathogens of bacterial meningitis (BM).

However, no LAMP assay is reported to detect Streptococcus agalactiae and

Streptococcus suis, which are also among common pathogens of BM. Moreover,

it is laborious and expensive by performing multiple reactions for each sample

to detect bacterial pathogen. Thus, we aimed to design and develop a single-

tube LAMP assay capable of detecting multiple bacterial species, based on the

nucleotide sequences of the 16S rRNA genes of the bacteria. The nucleotide

sequences of the 16S rRNA genes of main pathogens involved in BM were

aligned to identify conserved regions, which were further used to design broad

range specific LAMP assay primers. We successfully designed a set of broad

range specific LAMP assay primers for simultaneous detection of four species

including Staphylococcus aureus, Streptococcus pneumoniae, S. suis and S. agalac-

tiae. The broad range LAMP assay was highly specific without cross-reactivity

with other bacteria including Haemophilus influenzae, Neisseria meningitidis

and Escherichia coli. The sensitivity of our LAMP assay was 100–1000 times

higher compared with the conventional PCR assay. The bacterial species could

be identified after digestion of the LAMP products with restriction endonucle-

ase DdeI and HaeIII.

Introduction

Rapid diagnosis of bacterial meningitis (BM) is essential

as successful disease outcome is dependent on immediate

antibiotic therapy (Saez-Llorens & McCracken, 2003;

Zimmerli, 2005). However, accurate and rapid identifica-

tion of BM is challenging for clinicians as its symptom

and laboratory test are often similar and overlapping with

those of aseptic meningitis. Conventional diagnosis of

BM relies on the detection of bacteria in cerebrospinal

fluid and/or blood by Gram staining, latex agglutination

and culturing. However, Gram staining and latex aggluti-

nation tests are low in sensitivity (Kennedy et al., 2007),

while culturing takes few days. Furthermore, antimicro-

bial therapy prior to lumbar puncture often reduces the

frequency of positive cultures from the CSF and blood

(Pandit et al., 2005).

PCR assays have recently been developed to detect sev-

eral bacterial pathogens of BM. These assays have been

widely used in clinical practice and proved to have both

high sensitivity and specificity. However, the PCR method

requires expensive instrument, experienced technician and

few-hour performance. To overcome the limitations of

current PCR, the loop-mediated isothermal amplification

(LAMP) assay has been invented as an accurate, rapid

and cost-effective method, which amplifies the target

FEMS Microbiol Lett && (2012) 1–6 ª 2012 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

MIC

ROBI

OLO

GY

LET

TER

S

nucleic acid under isothermal conditions, usually

between 56 and 65 °C (Notomi et al., 2000). The

amplified product of LAMP assay can be detected in

< 1 h and identified by agarose gel electrophoresis, sim-

ple visual inspection, real-time monitoring of turbidity

or visual colour change using fluorescent dye. Impor-

tantly, the assay can be performed at bedside and in

rural areas using only a water bath (Tomita et al.,

2008). Several LAMP assays have been developed to

detect common causative pathogens of BM such as

Streptococcus pneumoniae, Haemophilus influenzae, Nei-

sseria meningitidis, Escherichia coli and Staphylococcus

aureus (Seki et al., 2005; Yamazaki et al., 2008; Hanaki

et al., 2011; Kim et al. 2011; McKenna et al. 2011).

However, no LAMP assay has been reported to detect

Streptococcus agalactiae and Streptococcus suis, which

are two of the most common pathogens of BM in some

countries (Mai et al., 2008; Chiba et al., 2009). More-

over, it is laborious and expensive by performing multi-

ple reactions for each sample to detect bacterial

pathogen. Thus, we aimed to design and develop a

LAMP assay capable of detecting multiple bacterial spe-

cies based on the nucleotide sequences of the 16S rRNA

genes of the bacteria.

Materials and methods

Design of LAMP assay primers for seven

common bacteria in BM

The broad range LAMP primers were designed to be spe-

cific for eubacterial 16S rRNA-specific gene. This gene

was chosen because of its highly conserved regions among

species and has been widely used as a target for broad

range PCR method (Gray et al., 1984; Lane et al., 1985).

The partial nucleotide sequences of the 16S rRNA genes

of S. aureus (GenBank FJ907240.1), S. pneumoniae

(Z22807), S. suis (Z22776.1), S. agalactiae (Z22808),

N. meningitidis (Z22806), H. influenzae (Z22809.1) and

E. coli (AY513502.1) were retrieved from the GenBank

database and were aligned to identify potential target

regions using MULTIALIN software (Corpet, 1988). Several

conserved regions were chosen for designing of LAMP

primer set using the LAMP primer design software Pri-

mer Explorer version 4 (Eiken Chemical Co., Ltd, Tokyo,

Japan). A set of four primers including two outer primers

(forward primer F3 and backward primer B3) and two

inner primers [forward inner primer (FIP) and backward

inner primer (BIP)] that identified six distinct regions on

the potential target sequence was designed. This study

was approved by the institutional ethical review com-

mittees of the Institute of Tropical Medicine, Nagasaki

University.

Bacterial strains and samples preparation

Serotypes 3 and 10 of S. pneumoniae were isolated from

upper respiratory tract in Vietnamese patients. Two

strains (8-01 and 8-02) of S. suis serotype 2, E. coli,

S. aureus and S. agalactiae were also isolated from Viet-

namese patients. In addition, H. influenzae and N. menin-

gitidis were isolated from Japanese patients. The

S. pneumoniae was cultured on rabbit blood Muller

Hinton agar, while other bacteria were grown on rabbit

blood brain heart infusion agar. Grown bacteria were

harvested and suspended in normal saline. The cells were

pelleted, suspended in TE buffer (10 mM Tris-HCl,

1 mM EDTA, pH 8.0) and serially diluted with TE

buffer ranging from 108 down to 100 colonies of

bacteria mL�1 (CFU mL�1). DNA was released from the

bacteria by boiling for 20 min followed by centrifugation

at 10 000 g for 10 min. The supernatant was used as

the DNA template.

Optimization of LAMP reaction

The LAMP reaction was carried out in a 25-lL reaction

mixture with a Loopamp DNA amplification kit (Eiken

Chemical Co., Ltd) as described in our previous work

(Kubo et al., 2010). The reaction mixture contained

40 pmol (1 lL) each of FIP and BIP, 5 pmol (1 lL) eachof F3 and B3 and 20 pmol (1 lL) each of Loop F and

Loop B. LAMP reaction was performed at several differ-

ent temperatures ranging from 55 to 68 °C in 90 min

using LA-320C Loopamp real-time turbidimeter (Tera-

mecs, Japan). The best condition for LAMP procedure

was at 63 °C and in 60 min. Therefore, all of mixtures

were incubated at 63 °C for 90 min, followed by heating

at 80 °C for 5 min to inactivate the reaction. Two micro-

litre of the extracted DNA was used as the template in

each reaction mixture. A negative control (a reaction

mixture with distilled water instead of DNA template)

and a positive control (a confirmed positive sample) were

included in each run. Precautions were taken to prevent

cross-contaminations.

Analysis of LAMP product

The LAMP product was analysed by three methods

including a real-time turbidimeter, agarose gel analysis

and naked eye visualization. The LA-320C Loopamp real-

time turbidimeter (Teramecs) was used to monitor the

LAMP reaction based on the turbidity of magnesium

pyrophosphate at 405 nm, a byproduct of the reaction.

The turbidity threshold value for a positive sample was

fixed at 0.1, and samples above this threshold value were

considered as positive. After amplification, 2 lL of the

ª 2012 Federation of European Microbiological Societies FEMS Microbiol Lett && (2012) 1–6Published by Blackwell Publishing Ltd. All rights reserved

2 N. T. Huy et al.

LAMP product was further separated by 2% agarose gel

electrophoresis, which was stained with ethidium bromide

and visualized under UV light. In addition, 1 lL of SYBR

Green I (Invitrogen) was added to the remained LAMP

product, a change from orange to fluorescent green col-

our was considered as positive. To further distinguish

bacterial species, 2 lL of the LAMP product was digested

with 10 U of DdeI or HaeIII at 37 °C for 90 min. The

digested LAMP product was analysed by 2% agarose gel

electrophoresis as described above.

Conventional PCR assay

A conventional PCR was also carried out with the univer-

sal primer set targeting 16S rRNA genes to compare the

sensitivity of the LAMP assay. The paired primers were

5′-CCAGCAGCCGCGGTAATACG-3′ and 5′-ATCGG(C/T)TACCTTGTTACGACTTC-3′ (Lu et al., 2000). Twenty-

five microlitre of PCR assay contained 2 lL of DNA tem-

plate, 1 lL of each primer, 2 mM MgCl2, 0.2 mM

dNTPs, 2.5 lL of 10 9 buffer and 1.25 U Taq HS DNA

polymerase (Takara Bio, Shiga, Japan). The reactions were

amplified as follows: initial activation of one cycle at tem-

perature 94 °C for 10 min and then followed by 35 cycles

at 94 °C for 30 s, 55 °C for 50 s and 72 °C for 2 min.

The final extension step was carried out at 72 °C for

10 min. Amplified products were then detected by ethidi-

um bromide staining after 2% agarose gel electrophoresis.

Results and discussion

Design of broad range LAMP assay primers

We aimed to develop a LAMP assay capable of detecting

many bacterial species (multispecies LAMP assay) for

diagnosis of BM. The bacterial species used in this study

were S. aureus, S. pneumoniae, S. suis, S. agalactiae,

N. meningitidis, H. influenzae and E. coli. The nucleotide

sequences of the 16S rRNA genes of these bacteria were

retrieved and aligned to design broad range specific

LAMP assay primers using EXPLORER VERSION 4 (Eiken

Chemical Co., Ltd). We could not design any broad range

specific LAMP assay primers for all the seven bacteria due

to high level of variation in the target 16S rRNA gene

among species (Fig. 1a). Next, we repeatedly aligned the

target gene and designed broad range specific LAMP assay

primers each time removing each species. However, no

broad range specific LAMP assay primers were found for

the detection of any set of more than four bacterial spe-

cies. Finally, we successfully designed a set of broad range

specific LAMP assay primers for the detection of four

species including S. aureus, S. pneumoniae, S. suis and

S. aureus

S. pneumoniae

Consensus

S. agalactiae

S. suis

S. pneumoniae

S. aureus

Consensus

S. agalactiae

S. suis

N.meningitidisH.influenzae

E. coli

S. aureus

S. pneumoniae

Consensus

S. agalactiae

S. suis

S. pneumoniae

S. aureus

Consensus

S. agalactiae

S. suis

N.meningitidisH.influenzae

E. coli

(a)

(b)

Fig. 1. Alignment of nucleotide sequences of the 16S rRNA genes of bacteria. The target gene of seven common bacteria of BM including

Neisseria meningitidis, Haemophilus influenzae, Streptococcus pneumoniae, Streptococcus agalactiae, Escherichia coli, Staphylococcus aureus and

Streptococcus suis (a) and four bacteria including S. pneumoniae, S. agalactiae, S. aureus and S. suis (b) were aligned to identify the highly

conserved regions, which were used for LAMP primers design. Consensus shown similar nucleotides in red colour was used to design a universal

set of LAMP primers for simultaneous detection of multiple bacteria.

FEMS Microbiol Lett && (2012) 1–6 ª 2012 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

Single-tube LAMP assay of bacterial meningitis 3

S. agalactiae (Fig. 1b). The name, positions and nucleo-

tide sequences of all four primers are shown in Fig. 1b

and Table 1. The DNA sequence alignment of 16S rRNA

gene of these four species indicated a low variation

among these species.

Sensitivity and specificity of LAMP assay

The sensitivities of the broad range LAMP assay were per-

formed by running 10-fold serial dilutions of target bacte-

ria (from 107 to 100 CFU mL�1). The detection limit was

100 CFU mL�1 of S. pneumoniae by both real-time turbi-

dimeter and electrophoresis of LAMP products, and

10 000 CFU mL�1 by conventional PCR method (Fig. 2).

Similarly, the broad range LAMP assay detected S. suis,

S. agalactiae and S. aureus at 100 CFU mL�1, while con-

ventional PCR assay only detected these bacteria with

more than 104 CFU mL�1 (Table 2). The results of all

the positive samples detected by the LAMP assay were

achieved within 60 min.

The specificity of the LAMP assay was evaluated by

cross-reactivity test using DNA extracted from N. menin-

gitidis, H. influenzae and E. coli. There were ladder-like

products amplified from S. pneumoniae, S. suis, S. agalac-

tiae and S. aureus but not from N. meningitidis, H. influ-

enzae and E. coli cultures (Fig. 3), suggesting that the

broad LAMP assay was specific for S. pneumoniae, S. suis,

S. agalactiae and S. aureus.

Visual detection of the LAMP products

LAMP products were further explored by visual inspec-

tion based on the intercalation of fluorescent dye SYBR

Green I into amplified DNA. As shown in Fig. 4, the

product of positive reaction became visible under ultravi-

olet lamp and was green colour under naked eye, while

the negative product was not seen under ultraviolet lamp

and remained orange colour under day light.

Table 1. LAMP primer sequences for simultaneous detection of

Streptococcus pneumoniae, Streptococcus agalactiae, Staphylococcus

aureus and Streptococcus suis

Primers Sequence 5′–3′

FIP CGCTTTCG(C/A)(A/G)C(A/C)TCAGCGTCATGGAGGAA

CACC(A/G)GTGGC

BIP CACGC(C/T)GTAAACGATGAGTGCTAGGC

GGAGTGCTTAATGC

F3 CATGTGTAGCGGTGAAATGC

B3 TCAACCTTGCGGTCGTACT

–0.1

0

0.1

0.2

0.3

0.4

0.5

0.6

15 20 25 30 35 40 45 50 55 60

Time (min)

107 CFU mL–1

106 CFU mL–1

105 CFU mL–1

104 CFU mL–1

103 CFU mL–1

102 CFU mL–1

Turb

idity

(a)

(b)

Fig. 2. Sensitivity of broad range LAMP assay for the detection of

Streptococcus pneumoniae. LAMP reactions detected by real-time

turbidity (a) and electrophoresis of LAMP products and conventional

PCR products (b). The assay was performed in 10-fold serial dilutions

(from 107 to 100 CFU mL�1). Streptococcus pneumoniae with more

than 100 CFU mL�1 was detected by both real-time turbidimeter and

electrophoresis. The conventional PCR only detected S. pneumoniae

with more than 104 CFU mL�1.

Table 2. Sensitivities of LAMP and conventional PCR assays

Bacteria

The limit of detection (CFU mL�1)

LAMP assay PCR assay

S. pneumoniae 102 104

S. suis 102 104

S. agalactiae 102 105

S. aureus 102 104

2 3 876M 1 4 5 9 P N

Fig. 3. Specificity of broad range LAMP assay. Two microlitre of

the DNA template (105 CFU mL�1) extracted from Staphylococcus

aureus (lane 1), Streptococcus pneumoniae serotype 3 (lane 2),

S. pneumoniae serotype 10 (lane 3), Streptococcus suis serotype 2-8-

01 (lane 4), S. suis serotype 2-8-02 (lane 5), Streptococcus agalactiae

(lane 6), Haemophilus influenzae (lane 7), Escherichia coli (lane 8) and

Neisseria meningitidis (lane 9). Lane P, Positive control; lane N,

Negative control; and lane M, DNA size markers.

ª 2012 Federation of European Microbiological Societies FEMS Microbiol Lett && (2012) 1–6Published by Blackwell Publishing Ltd. All rights reserved

4 N. T. Huy et al.

Identification of bacterial species

To identify bacterial species, the LAMP product was

digested with specific restriction enzyme and analysed by

gel electrophoresis. After digested with DdeI, all LAMP

products were digested into several fragments. Staphylo-

coccus aureus gave five bands at 55, 150, 197, 230 and

263 bp (Fig. 5a, lane 1). Streptococcus pneumoniae pro-

duced three bands at 55, 150 and 200 bp (Fig. 5a, lane

3). Streptococcus agalactiae (lane 2) and S. suis (lane 4)

gave similar pattern. Thus, the LAMP products of S. aga-

lactiae and S. suis were further digested with HaeIII. The

result showed that S. agalactiae was digested into four

bands at 70, 216, 254 va 292 bp (Fig. 5b, lane 6), while

S. suis was not digested by HaeIII (Fig. 5b, lane 5).

To our knowledge, this is the first study that developed

a broad range LAMP assay for simultaneous detection of

more than four different bacterial species. The sensitivity

of our LAMP assay was 100–1000 times higher compared

with the conventional PCR assay. The bacterial species

could be distinguished among S. pneumoniae, S. suis,

S. agalactiae and S. aureus based on the digested pattern

of the LAMP products with restriction enzymes of DdeI

and HaeIII. In addition, our method has several advanta-

ges over the current diagnostic methods. Firstly, the

method is rapid (c. 1 h) as compared with the real-time

PCR method which requires 6 h to run (Nadkarni et al.,

2002). Secondly, the LAMP method does not require

expensive fluorimeter and fluorogenic primers and

probes. Thirdly, the assay is simple and does not require

highly experienced technician. More importantly, the

assay can be performed in a water bath at bedside or in

rural areas. These advantages suggested that our broad

range LAMP assay would improve the early diagnosis and

treatment of BM, helping to reduce morbidity and mor-

tality. Furthermore, the assay could detect bacterial spe-

cies, helping to select an appropriate antibiotic therapy.

One limitation of our LAMP assay was that only four

species could be detected. A single-tube LAMP assay for

the detection of more than four species is under develop-

ment using a mixture current broad range LAMP primers

and specific LAMP primers of other bacteria species.

Additional clinical studies are also required to validate

this new assay.

Conclusions

Four common pathogen of BM including S. pneumoniae,

S. suis, S. agalactiae and S. aureus could be simulta-

neously detected using a broad range LAMP assay in sin-

gle tube in < 1 h. The assay is highly sensitive, rapid and

simple and can be performed at bedside in healthcare

facilities.

Acknowledgements

We thank Dr Toru Kubo, from Department of Virology,

Institute of Tropical Medicine, Nagasaki University,

Nagasaki, Japan, for his technical advice. The authors

declare no competing interests of the manuscript due to

commercial or other affiliations. This study was sup-

ported in part by Japan Initiative for Global Research

Network on Infectious Diseases (J-GRID) for K.H.

Authors’ contributions

N.T.H and L.T.T.H. contributed equally to this work.

PNPN

Fig. 4. Visual detection of LAMP products. Representative visual

inspection of Streptococcus pneumoniae by fluorescence under

ultraviolet lamp (left Streptococcus) and day light (right). (N), negative

control without DNA template; (P), positive reaction in the presence

of S. pneumoniae DNA template.

2M 41 63 5MM

(a) (b)

Fig. 5. The digested pattern of the LAMP products with restriction

enzymes using 2% agarose electrophoresis. (a) DdeI digestion

patterns of the LAMP products from Staphylococcus aureus (lane 1),

Streptococcus agalactiae (lane 2), Streptococcus pneumoniae (lane 3)

and Streptococcus suis (lane 4). (b) HaeIII digestion patterns of the of

the LAMP products from S. suis (lane 5) and S. agalactiae (lane 6).

Lane M is 100-bp ladder size markers.

FEMS Microbiol Lett && (2012) 1–6 ª 2012 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

Single-tube LAMP assay of bacterial meningitis 5

References

Chiba N, Murayama SY, Morozumi M, Nakayama E, Okada T,

Iwata S, Sunakawa K & Ubukata K (2009) Rapid detection

of eight causative pathogens for the diagnosis of bacterial

meningitis by real-time PCR. J Infect Chemother 15: 92–98.Corpet F (1988) Multiple sequence alignment with hierarchical

clustering. Nucleic Acids Res 16: 10881–10890.Gray MW, Sankoff D & Cedergren RJ (1984) On the

evolutionary descent of organisms and organelles: a global

phylogeny based on a highly conserved structural core in

small subunit ribosomal RNA. Nucleic Acids Res 12:

5837–5852.Hanaki K, Sekiguchi J, Shimada K, Sato A, Watari H, Kojima

T, Miyoshi-Akiyama T & Kirikae T (2011) Loop-mediated

isothermal amplification assays for identification of

antiseptic- and methicillin-resistant Staphylococcus aureus. J

Microbiol Methods 84: 251–254.Kennedy WA, Chang SJ, Purdy K et al. (2007) Incidence of

bacterial meningitis in Asia using enhanced CSF testing:

polymerase chain reaction, latex agglutination and culture.

Epidemiol Infect 135: 1217–1226.Kim DW, Kilgore PE, Kim EJ, Kim SA, Anh DD & Seki M

(2011) Loop-mediated isothermal amplification assay for

detection of Haemophilus influenzae type b in cerebrospinal

fluid. J Clin Microbiol 49: 3621–3626.Kubo T, Agoh M, Mai le Q et al. (2010) Development of a

reverse transcription-loop-mediated isothermal amplification

assay for detection of pandemic (H1N1) 2009 virus as a

novel molecular method for diagnosis of pandemic

influenza in resource-limited settings. J Clin Microbiol 48:

728–735.Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML & Pace NR

(1985) Rapid determination of 16S ribosomal RNA

sequences for phylogenetic analyses. P Natl Acad Sci USA

82: 6955–6959.Lu JJ, Perng CL, Lee SY & Wan CC (2000) Use of PCR with

universal primers and restriction endonuclease digestions for

detection and identification of common bacterial pathogens

in cerebrospinal fluid. J Clin Microbiol 38: 2076–2080.

Mai NT, Hoa NT, Nga TV et al. (2008) Streptococcus suis

meningitis in adults in Vietnam. Clin Infect Dis 46:

659–667.McKenna JP, Fairley DJ, Shields MD, Cosby SL, Wyatt DE,

McCaughey C & Coyle PV (2011) Development and clinical

validation of a loop-mediated isothermal amplification

method for the rapid detection of Neisseria meningitidis.

Diagn Microbiol Infect Dis 69: 137–144.Nadkarni MA, Martin FE, Jacques NA & Hunter N (2002)

Determination of bacterial load by real-time PCR using a

broad-range (universal) probe and primers set. Microbiology

148: 257–266.Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe

K, Amino N & Hase T (2000) Loop-mediated isothermal

amplification of DNA. Nucleic Acids Res 28: E63.

Pandit L, Kumar S, Karunasagar I & Karunasagar I (2005)

Diagnosis of partially treated culture-negative bacterial

meningitis using 16S rRNA universal primers and

restriction endonuclease digestion. J Med Microbiol 54:

539–542.Saez-Llorens X & McCracken GH Jr (2003) Bacterial

meningitis in children. Lancet 361: 2139–2148.Seki M, Yamashita Y, Torigoe H, Tsuda H, Sato S & Maeno

M (2005) Loop-mediated isothermal amplification method

targeting the lytA gene for detection of Streptococcus

pneumoniae. J Clin Microbiol 43: 1581–1586.Tomita N, Mori Y, Kanda H & Notomi T (2008) Loop-

mediated isothermal amplification (LAMP) of gene

sequences and simple visual detection of products. Nat

Protoc 3: 877–882.Yamazaki W, Taguchi M, Ishibashi M, Kitazato M, Nukina M,

Misawa N & Inoue K (2008) Development and evaluation

of a loop-mediated isothermal amplification assay for rapid

and simple detection of Campylobacter jejuni and

Campylobacter coli. J Med Microbiol 57: 444–451.Zimmerli W (2005) How to differentiate bacterial from viral

meningitis. Intensive Care Med 31: 1608–1610.

ª 2012 Federation of European Microbiological Societies FEMS Microbiol Lett && (2012) 1–6Published by Blackwell Publishing Ltd. All rights reserved

6 N. T. Huy et al.