International Journal of Food Microbiology 153 (2012) 474–482

Contents lists available at SciVerse ScienceDirect

International Journal of Food Microbiology

j ourna l homepage: www.e lsev ie r .com/ locate / i j foodmicro

Short communication

Detection and characterization of pathogenic vibrios in shellfish by a LigationDetection Reaction-Universal Array approach

Alessia Cariani a,⁎,1, Annamaria Piano b,1, Clarissa Consolandi c, Marco Severgnini c, Bianca Castiglioni d,Giada Caredda c, Marco Candela e, Patrizia Serratore b, Gianluca De Bellis c, Fausto Tinti a

a Department of Experimental Evolutionary Biology, University of Bologna, Italyb Department of Veterinary Medical Sciences, University of Bologna, Italyc Institute of Biomedical Technologies, National Research Council, Milan, Italyd Institute of Agricultural Biology and Biotechnology, National Research Council, Italye Department of Pharmaceutical Sciences, University of Bologna, Italy

⁎ Corresponding author.E-mail address: alessia.cariani@unibo.it (A. Cariani).

1 These authors contributed equally to this work andauthors.

0168-1605/$ – see front matter © 2011 Elsevier B.V. Aldoi:10.1016/j.ijfoodmicro.2011.11.010

a b s t r a c t

a r t i c l e i n f o

Article history:Received 16 May 2011Received in revised form 23 September 2011Accepted 11 November 2011Available online 20 November 2011

Keywords:Food safetyVibrioShellfishVirulence markerMultiplex PCRMicroarray

Vibrios are a group of major foodborne pathogens widely distributed in marine environment. Vibrio cholerae,Vibrio parahaemolyticus, and Vibrio vulnificus are the pathogenic species of Vibrio that pose the greatest threatto human health. However, other vibrios, e.g. Vibrio alginolyticus, Vibrio mimicus and Grimontia hollisae,apparently less relevant in the group of foodborne pathogens, have been sporadically found in outbreaks.For seafood safety and economic purposes, a rapid and powerful method for the specific identification ofharmful Vibrio strains is needed.We developed a PCR-Ligase Detection Reaction-Universal Array (PCR-LDR-UA)assay for the simultaneous identification of pathogenic vibrios and detection of virulence coding genes. Theentire procedure was validated on a total of 31 reference strains and isolates from clinical and environmentalsamples, as well as on bivalve tissue homogenates infected with different strains of target Vibrio species.Twenty-three shellfish samples directed to human consumptionwere successfully screened, thus demonstratingthat the developedmicroarray-based platform could be a reliable and sensitive detection tool for the identificationof harmful Vibrio strains in seafood.

© 2011 Elsevier B.V. All rights reserved.

1. Introduction

Bacteria belonging to the family Vibrionaceae are normal inhabitantsin estuarine and marine environments (Hervio-Heath et al., 2002).Vibrio infections in humans mainly cause self-limiting gastroenteritisthrough the consumption of seafood, with special relevance for shellfish,as they concentratemicroorganisms from surroundingwaters during thefilter-feeding process and are often consumed whole and raw or onlylightly cooked. Although Vibrio parahaemolyticus, Vibrio choleraeand Vibrio vulnificus are the main species associated with seafood-borne infections, others, e.g. Vibrio alginolyticus, Vibrio mimicus andVibrio hollisae (now Grimontia hollisae), have been sporadicallyfound in human infections (Thompson et al., 2004a). Vibrio genomesare particularly dynamic with a relevant portion of genetic informationinserted or deleted from genomes by horizontal gene transfer(henceforth HGT), a common mechanism in marine habitats (Jiang andPaul, 1998). HGT often changes the ecological and pathogenic characterof bacterial species and promotesmicrobial diversification by introducing

should be considered co-first

l rights reserved.

novel physiological traits (Dutta and Pan, 2002). The occurrence ofinfection outbreaks due to environmental strains of vibrios routinelynot considered of clinical relevance has been correlated to the HGT ofvirulence factors between closely related species (González-Escalona etal., 2006). Due to these issues, a rapid and reliable monitoring of Vibriopathogenic strains and their virulence factors in seafood is of relevantinterest for human health and economic purposes. Culture-dependentstandard laboratory methods used to identify harmful vibrios aregenerally time-consuming, labor-intensive, do not target virulencefactors associated with human illness and they cannot detect micro-organisms in the viable but non culturable state (VBNC) (Vora et al.,2005). The need to adequately monitor biological threats for humanhealth has prompted the development of advanced technologicalresearch for the detection of pathogens. Molecular methods aresuitable i) for a culture-independent detection of microorganisms,ii) to accurately identify bacterial species and iii) to provide dataon the pathogenic potential of themicroorganisms. Among the severalmolecularmethods available for the identification of pathogenic bacteria,DNA-chip technologies are promising for accuracy, rapidity and efficiencyof detection (Wilson et al., 2002).

Our research deals with the development and the validation of aLigation Detection Reaction-Universal Array (LDR-UA) platform(Candela et al., 2010) for the direct identification and pathogenic

475A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

characterization of harmful strains of Vibrio in shellfish. The DNA-chip tool we developed was conceived for the simultaneous detec-tion of species-specific markers andmajor virulence factors associat-ed to vibrios.

The high specificity and the multiplexing potential achieved in theenzymatic reaction make the LDR-UA approach particularly suitableto target a relatively small number of species and marker genes(Cremonesi et al., 2008). The LDR technique uses a pair of probesfor each target: a) a Discriminating Oligonucleotide (DS) whose 3′-end insists on a position capable of discriminating the target sequencesfrom non-target ones; b) a Common Probe (CP), designed to be imme-diately 3′-downstream of the DS, which is used to complete the ligationprocess. The Universal Array format (Chen et al., 2000) is based on a setof artificial sequences, called ZipCodes, designed to be different fromany biological sequence, and it can be used to address specifically ligat-ed products to pre-determined positions of the array. This innovativetechnique has been recently applied to pathogen detection in foodsafety applications (Cremonesi et al., 2008; Lauri et al., 2010) andenvironmental screenings (Rantala et al., 2008; Sipari et al., 2010)successfully exhibiting high specificity and sensitivity.

The DNA-chip assay developed in the present study was validatedon multiple reference strains and environmental isolates. Additionallyretail shellfish samples were screened to assess the reliability of theplatform for routine monitoring studies.

2. Materials and methods

2.1. Bacterial strains and media

The complete list of the 31 strains used is displayed in Table 1. Ref-erence strains were purchased from the American Type Culture Col-lection (Manassas, VA, USA). Environmental strains were isolatedfrom seawater and shellfish from the Adriatic Sea. Bacterial strains

Table 1Bacterial strains used in this study.

Species Strain ID Source

Vibrio cholerae 70/28 Target Diagnostica CollectionV. cholerae 77/65 Sieroterapico Milano CollectionV. cholerae Isolate 344-17 Sea waterV. cholerae Isolate 795-1 Sea waterV. cholerae Isolate 178-19 ShellfishV. mimicus ATCC 33653 CollectionV. parahaemolyticus ATCC 17802 CollectionV. parahaemolyticus ATCC 43996 CollectionV. parahaemolyticus Isolate 344-1 Sea waterV. parahaemolyticus Isolate 298-1 Sea waterV. parahaemolyticus Isolate 178-1 ShellfishV. parahaemolyticus Isolate 178-14 ShellfishV. parahaemolyticus Isolate 826-19 Sea waterV. parahaemolyticus RIDM2210633 ClinicalV. parahaemolyticus F6729 ClinicalV. parahaemolyticus VPAQ3810 ClinicalV. parahaemolyticus AQ4644 ClinicalV. parahaemolyticus PM290 ClinicalV. vulnificus ATCC 27562 CollectionV. vulnificus Isolate 628-7 ShellfishGrimontia hollisae ATCC 33564 CollectionV. alginolyticus ATCC 17749 CollectionV. alginolyticus Isolate 178-23 ShellfishV. alginolyticus Isolate 822-4 Sea waterV. alginolyticus Isolate 468-5 ShellfishV. diabolicus Isolate706-5 Sea waterV. diabolicus Isolate 735-1 Sea waterV. diabolicus Isolate 460-16 ShellfishV. diabolicus Isolate 707-2 Sea waterV. harveyi Isolate 31712-11 ShellfishV. splendidus ATCC 33125T Collection

were cultured at 37 °C on Tryptone Soy Agar (TSA) supplementedwith 3% NaCl, for 24 h. DNA from clinical isolates of V. parahaemolyticuswas provided by Ronnie Gavilan Chavez, University of Santiago deCompostela, Spain. Bacterial strains were previously characterized bybiochemical tests, single-target PCR and direct sequencing of selectedgenes (Supplementary material Tables A, B, C).

2.2. Target selection and microarray design

Eleven genes were selected as potential target genes for PCR-LDR-UA (Table 2). The species identification of V. cholerae, V. vulnificus, V.parahaemolyticus, V. alginolyticus, V. mimicus and G. hollisaewas carriedout by targeting the ubiquitous gene recA (Thompson et al., 2004b) andspecies-specific markers. In order to increase the robustness of themolecular identification, V. cholerae, V. vulnificus, V. parahaemolyticusand V. alginolyticuswere considered correctly detected only if significanthybridization signals were simultaneously obtained for two specificmarkers (e.g. the recA and species-specific genes).

The assessment of the pathogenic potential of the strains wasachieved by targeting genes known to be required for virulence inVibrio species. Multiple probes were selected to target different vari-ants of V. parahaemolyticus tdh and trh genes and V. cholerae hemoly-sin gene hlyA. Moreover two distinct oligonucleotide pairs weresynthesized for the majority of pathogenic factors (ctxA, all tdh andtrh variants, vvhA) in order to increase the specificity of the detection.

2.3. Probe design

For each target gene, orthologous sequence datasets were gener-ated merging sequences retrieved from public database (NCBI) andsequences of obtained during this study (Supplementary material,Table C). For each probe, two datasets were built: a “Positive Set”with all available sequences of the target gene and species and a“Negative Set” including all other sequences in the database. Foreach positive set, a consensus sequence was calculated in Bioedit ver-sion 7.0.5.3 (Hall, 1999), setting the threshold frequency to 95%. LDRprobe pairs were designed using ORMA (Oligonucleotide Retrievingfor Molecular Application) (Severgnini et al., 2009) which runs inMatlab environment (Mathworks, Natick, MA), setting the annealingtemperature (Tm) to 68±1 °C and the probe length to 25–60 bp.More than 300 potential probe pairs were generated and tested forsequence similarity against the NCBI database by BLAST, to excludeany possible similarity with any known sequence that could occurin the samples analyzed. In case of sequences with high similarity,at least a mismatch at the 3′ end of the DS was required. Finally,probe pairs were selected according to specificity, Tm, number ofdegenerate bases and length. The DS probes were 5′-end labeledwith Cy3, whereas CPs were 5′-end phosphorylated and carried acZipCode at the 3′ end (Chen et al., 2000). All oligonucleotideswere synthesized by Thermo Fisher Scientific GmbH (Ulm, Germany).For synthesis purpose, any degenerated base in the probe pairs wassubstituted by inosine.

2.4. Genomic DNA extraction

Genomic DNA was extracted from pure culture colonies by boilingmethod. Individual colonies were resuspended in 100 μL of sterilewater, boiled for 15 min and incubated on ice for 3 min. After a centri-fugation step at 5000×g for 15 min, the supernatant was transferredin new tubes and used as PCR template.

Total DNA was extracted from homogenate of mollusc flesh andintervalvular liquid with InstaGene Matrix (Bio-Rad Laboratories,Hercules, CA, USA) according to the following procedure: 5 mL-aliquotswere centrifuged at 10,000×g for 10 min, and the cell pellet was resus-pended in 200 μL of InstaGene Matrix. Samples were then incubated at56 °C for 20 min, boiled for 10 min and centrifuged at 5000×g for 3 min

Table 2Species and marker genes selected for PCR-LDR-UA design. Information about the targeted strains is reported.

Target Detection of

Species Gene

V. cholerae/V. mimicus recA Recombinase V. cholerae (both clinical and environmental strains) and V. mimicusV. cholerae toxR Regulatory protein V. cholerae (both clinical and environmental strains)

hlyA Hemolysin V. cholerae (both biotypes)ctxA Cholera toxin, subunit A V. cholerae pathogenic strainstcpI Regulatory protein for tcp genes V. cholerae pathogenic strains

V. parahaemolyticus recA Recombinase V. parahaemolyticus (both clinical and environmental strains)toxR Regulatory protein V. parahaemolyticus (both clinical and environmental strains)tl Thermolabile hemolysin V. parahaemolyticus (both clinical and environmental strains)tdh-1 Thermostable direct hemolysin V. parahaemolyticus pathogenic strains tdh1+ varianttdh-234 Thermostable direct hemolysin V. parahaemolyticus pathogenic strains tdh2+, tdh3+, tdh4+ variantstrh1 TDH-related hemolysin V. parahaemolyticus pathogenic strains trh1+ varianttrh2 TDH-related hemolysin V. parahaemolyticus pathogenic strains trh2+ variantORF8 Open reading frame 8 V. parahaemolyticus pandemic strains

V. alginolyticus recA Recombinase V. alginolyticustl Thermolabile hemolysin V. alginolyticus

G. hollisae recA Recombinase G. hollisaetdh Thermostable direct hemolysin G. hollisae tdh+

V. vulnificus recA Recombinase V. vulnificusvvhA Cytolysin V. vulnificusviuB Vulnibactin utilization protein V. vulnificus clinical strains

476 A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

to collect total DNA. A 2 μL-aliquot of the supernatant was used astemplate in PCR amplification.

2.5. Gene amplification

Single-target gene amplificationswere carried out in 25 μL-reactionscontaining Buffer 1×, 2 mM MgCl2, 0.2 mM each dNTP, 0.4 μM eachprimer, 1 U Taq polymerase and 1 μL of DNA template. Single PCRconditions were: denaturation for 4 min at 94 °C, 30 cycles of 1 min at94 °C, 1 min at annealing temperature (Ta) (i.e. 60 °C for all V. choleraeandV. vulnificusmarkers; 58 °C for all V. parahaemolyticus,V. alginolyticusand G. hollisae markers and recA gene), 1 min at 72 °C; a final ex-tension step of 7 min at 72 °C. All PCR primer sequences are reportedin Table 3. Primer pairs were designed using Primer3 (www.primer3.sourceforge.net/webif.php) and PrimerExpress (Applied

Table 3Primer pairs used for PCR amplification in single-target and multiplex reactions. Amplicon sPCR reactions of V. cholerae and V. vulnificus markers; Mplx2: multiplex PCR reactions of V.

Target species Gene Primer sequences 5′–3′

Vibrio spp. recA F: TGARAARCARTTYGGTAAAGR: TCRCCNTTRTAGCTRTACC

V. cholerae toxR F: GATTAGGCAGCAACGAAAGR: CCAAGTTTGGAGCCGATTTA

V. cholerae hlyA F: GGCAAACAGCGAAACAAATR: CTCAGCGGGCTAATACGGT

V. cholerae ctxA F: GCAGATTCTAGACCTCCTGR: CGATGATCTTGGAGCATTCC

V. cholerae tcpI F: CGCGATAAAGCAGTCGAAGR: AAACATCCCACTGCCGTTAG

V. vulnificus vvhA F:AACTATGACGTTTTGTACGAR: CCACACTGTTCGACTGTGA

V. vulnificus viuB F: AATGGTTCGCACATCAAAGR: GGATGAACAAGATCGTGGA

V. parahaemolyticus/V. alginolyticus tl F: AAAGCGGATTATGCAGAAGR: GCTACTTTCTAGCATTTTCTC

V. parahaemolyticus toxR F: GTCTTCTGACGCAATCGTTGR: ATACGAGTGGTTGCTGTCAT

V. parahaemolyticus/G. hollisae tdh F: CCCCGGTTCTGATGAGATATR: TGGAATAGAACCTTCATCTT

V. parahaemolyticus trh F: ACTAYTGGACAAACCGAAMR: CCAGAAAGAGCWGCCATYG

V. parahaemolyticus ORF8 F: AGGACGCAGTTACGCTTGAR: CTAACGCATTGTCCCTTTGT

Biosystem, Foster City, CA, USA). Two different multiplex PCR reac-tions were set up: all V. cholerae and V. vulnificus markers were si-multaneously amplified in a single reaction (Mplx1), as well as V.parahaemolyticus, V. alginolyticus and G. hollisae marker genes wereamplified all together (Mplx2). Multiplex PCR were performed in50 μL-reactions containing Buffer 1×, 2 mM MgCl2, 0.4 mM eachdNTP, 1 μM each primer, 5 U Taq polymerase and 2 μL of DNA template.Multiplex PCR conditions were: denaturation for 4 min at 94 °C; 30 cy-cles of 1 min at 94 °C, 1 min at Ta (i.e. 60 °C for Mplx1; 58 °C for Mplx2and recA), 1 min at 72 °C; a final extension of 7 min at 72 °C. All PCR re-agents were purchased from Invitrogen (Carlsbad, CA, USA). The PCRproducts were purified with QIAquick PCR Purification Kit (Qiagen)according to the manufacturer's protocols and quantified by the BioA-nalyzer 2100 (AgilentTechnologies, Palo Alto, CA, USA) using the DNA7500 kit.

ize and references are reported. F: forward primer, R: reverse primer. Mplx1: multiplexparahaemolyticus, V. alginolyticus and G. hollisae marker genes.

Amplicon size (bp) Reference

G 837 Thompson et al., 2005

C 402 Present study Mplx1

ACC 738/727 Rivera et al., 2001TTA

564 Fields et al., 1992CACA 333 Present study

AG 437 Present study

413 Present studyTA

CACTG 450 Bej et al., 1999 Mplx2TGC

368 Kim et al., 1999GT 337 Present studyCACC Bej et al., 1999CA 148 Present study

TG 369 Myers et al., 2003AG

477A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

2.6. Detection of seeded strains in shellfish homogenates

Twenty-five g of Tapes philippinarum homogenate was added to225 mL of Alkaline Peptone Water (APW) with 3% NaCl, pH 8.6.Four aliquots were seeded with approximately 108 CFU of each target:Inaba 70/28 and Ogawa El Tor 77/65 for V. cholerae, ATCC 17802 andATCC 43996 for V. parahaemolyticus, ATCC 27562 for V. vulnificus, andATCC 33564 for G. hollisae. An unseeded aliquot of mollusc homogenatewas included as negative control. The homogenates were enriched at37 °C and 5 mL-aliquots were collected 24 h after inoculation. Eachsample was used for direct DNA extraction, PCR amplification andLDR-UA experiments.

2.7. Screening of retail shellfish samples

The detection of vibrios in retail shellfishwas carried out on 23mol-lusc samples obtained from monitoring surveys in the Adriatic Seaand identified as Crassostrea gigas (9), Mytilus galloprovincialis (7),T. philippinarum (6), Callista chione (1). These samples were screenedfor the presence of Vibrio by streaking shellfish homogenates on ahighly selective media, thiosulfate citrate bile salts sucrose (TCBS)agar, and incubating at 37 °C for 24 h. A statistically significant numberof suspected colonieswere selected and screened on the basis of a set ofbiochemical tests for the identification of Vibrio spp. (Noguerola andBlanch, 2008; Serratore et al., 1999).

Aliquots of 25 g of mollusc homogenate were enriched in APW at37 °C. After 24 h, 5 mL-aliquots were used for DNA extraction, multiplexPCR amplification of all target genes and LDR-UA experiments.

2.8. LDR/Universal Array experiments and data analysis

Chemical treatment of glass slides and spotting of probes on thearray were carried out following Candela et al. (2010). The LDR andhybridization experiments were performed according to Candela etal. (2010) with the probe annealing temperature set at 63 °C. TheLDRs were performed in 20 μL-reactions with specific amounts ofpurified PCR product in different types of experiments. Specificitytests were performed using 50 fmol of initial PCR product (in themultiplex PCR, this amount was calibrated on the least abundantamplified marker). In the sensitivity tests, the PCR product concen-tration was decreased with serial dilutions down to 0.7 fmol. Thescreening of shellfish samples was performed adjusting the overalltemplate to 50 fmol. Each experiment was replicated twice andwhenever the result of the two replicates was discordant, the samplewas reprocessed. Data analysis was performed as described in detailin Candela et al. (2010). Briefly, to identify significant specific hy-bridization signals, a t-test for each target-associated ZipCode wasperformed, comparing the distribution of the hybridization values(n=4 for each probe, n=8 for the hybridization positive control)with the one of the negative controls (empty spots, n=6), the lattercorrected by adding two times the standard deviation. Where theratio between the standard deviation and the mean of the distributionexceeded 100%, the most extreme value from the test population wasremoved. The significance threshold was set at Pb0.01. All statisticalanalyses were performed in Matlab environment.

3. Results

The PCR-LDR-UA platform here developed addressed two principles:the identification of six Vibrio species of great interest for human healththrough multiple species-specific markers and the characterization oftheir harmful potential by the detection of primary virulence factors.

For the detection of five species- specific variants of the housekeep-ing gene recA, the species-specific marker genes toxR, hlyA, tl, vvhAand virulence genes ctxA, tcpI, tdh, trh, ORF8 and viuB, a total of 28probe pairs (DS+CP oligonucleotides) were selected (Table 4). The

mean Tm of probe pairs was 68.1±0.6 °C, with probe length rangingfrom 30 to 60 nucleotides. Only one out of 56 probes had four degen-erated bases, whereas 32 out of 56 were highly specific with nodegenerated positions.

In vitro specificity of the selected probe pairs was evaluated byPCR-LDR-UA experiments on reference strains, clinical and environ-mental isolates. Multiple marker genes were evaluated for most ofthe 31 strains tested, through single target and multiplex PCR-LDR-UA, for a total of more than 80 assays performed. All the referencestrains and environmental isolates were correctly identified (Fig. 1),proving an optimal specificity of the PCR-LDR-UAplatform.Hybridizationresults were consistent with the strains molecular characterizationpreviously obtained through single target PCR and gene sequencing(Supplementary material, Table B and C): all expected markerswere detected and different gene variants were correctly identified(i.e. tdh, trh and hlyA). No cross-hybridization signal was observedon non-target strains such as Vibrio harveyi and Vibrio splendidus.However, unexpectedly, a positive VA-tl signal was obtained withVibrio diabolicus tl amplicons. This finding was further investigatedby direct sequencing of the tl amplicons from strains of V. diabolicusand V. alginolyticus (Supplementary material, Table C) revealing thatthe two species share the same tl haplotype. At the same time, nocross-ligation was observed on recA gene between the two species.

The lower sensitivity limit of the PCR-LDR-UA was estimated at6 fmol of PCR product in the ligation reaction step by the detection ofa significant hybridization signal (Fig. 3), an amount that can be pro-duced from a strain culture of at least 104 CFU/mL.

The array applied on experimentally infected shellfish samples(Fig. 2, samples A–E) allowed the correct identification of the inoculatedstrains by the simultaneous detection of all species-specific genes andvirulence factors, in agreement with the molecular characterizationachieved previously (Supplementary material, Table B).

In order to evaluate the array performance on retail shellfish, 23shellfish samples were analyzed by PCR-LDR-UA. The summary resultson these samples are shown in Fig. 2 (samples 1–23). All sampleswere negative for the presence of target Vibrio species on the basisof the TCBS isolation and biochemical screening. In contrast to the re-sults obtained by biochemical screening, based on the results of thePCR-LDR-UA only ten samples were negative for the presence of targetVibrio species (samples 4, 5, 7, 12, 14–16, 19, 21 and 23). Otherwise,thirteen samples showed significant PCR-LDR-UA hybridization signalssuggesting the presence of target Vibrio strains. Samples 3, 9, 11, 17 and18 showed positive signals for VP-recA, VP-toxR and VP-tl probes, indi-cating the presence of V. parahaemolyticus strains. The detection oftwo out of three species-specific markers (VP-toxR and VP-tl probes)suggested the presence of V. parahaemolyticus strains also in sample 1.Samples 1, 3, 6, 11, 17 and 18 gave significant hybridization signals toV. alginolyticus specific probes (VA-recA and VA-tl). Among these posi-tive samples, five showed the simultaneous occurrence of V. parahae-molyticus and V. alginolyticus (1, 3, 11, 17 and 18). Both samples 1and 9 gave significant hybridization signals for trh (variant 2) probes.In samples 2, 20 and 22, hybridization signal from probe VA-tl wasdetected without the corresponding signal from the related VA-recAprobe. In three samples, the signal from only one specific probe wasdetected (VC-toxR in sample 8 and 10 and VP-recA in sample 13). Sincewe adopted a double-probe identification system, the identification ofV. cholerae and V. parahaemolyticus strains in these three samples wasnot supported.

4. Discussion

A DNA microarray platform was implemented for a reliable iden-tification of harmful Vibrio strains in seafood, without prior microbio-logical isolation of colonies. Through the simultaneous detection ofspecies-specific markers and primary virulence factors, the PCR-

Table 4Selected probe pairs (Discriminating Oligos and Common Probes) and associated ZipCode selected for the PCR-LDR-UA platform. VC: Vibrio cholerae, VV: V. vulnificus, VP: V. parahaemolyticus, VA: V. alginolyticus, VM: V. mimicus,GH: Grimontia hollisae. ZipCode numbers are as in Chen et al. (2000).

Target ZipCodeno.

Discriminating Oligo 5′–3′ Common Probe 5′–3′

Species Gene

VC/VM recA 2 GAYAGCCACATGGGTCTNCAAGCGCGTATGTTGTCG CAAGCRATGCGTAAACTGACGGGTAACCTVAAGCAATCCAACTGTATVC toxR 7 GTCAATGAATACGCAGARTCAAGCAGTGTGCCTTCATCAG CCACTGTAGTGAACACACCGCAGCCAGCCAATGT

hlyA 31 GCGACACCGGATGCCAAAATTGTGCGTATCAGCC TAGATGATGACAGCACGGGAGCCGGCTGATCAACTChlyA 32 TAGATGATGACAGCACVGGAGCMGGCATTCATCTGAA TGATCAACTCGGTTATCGTCAGTTTGGAGCCAGTTATACGACctxA 21B GATGGTTATGGATTGGCAGGTTTCCCTCCGGAGCAT AGAGCTTGGAGGGAAGAGCCGTGGATTCATCATGCActxA 21 GAGCATAGAGCTTGGAGGGAAGAGCCGTGGATTC ATCATGCACCGCCGGGTTGTGGGAATGCTCCAAtcpI 27 CACAGCTTTTGATATCGATAAAACAACTGGGCAACACGTTCTCACTATTG CCACCCCTGTTTATGTAGGCAACGACATTGTCGGCA

VP recA 4 GGTYTVCAAGCTCGTATGCTTTCTCAAGCAATGCGTAAGCTT ACAGGTAACCTGAAACAGTCTAACTGTATGTGTATCTTCATCAACCAAATCCtoxR 8 GCAGTGCATTGAACGCTACGTTAAGCACCATGCAGAAGAC TCSTTACCAGTGGAAGTRATTGCCACTGGCGGACAAAATAtl 10 ACATCACGTTGTTTGATACTCACGCCTTGTTCGAGACGC TAACTTCTGCGCCMGAAGAGCACGGTTTCGTGAACGtdh1 12 CCCGGTTCTGATGAGATATTGTTTGTTGTTCGAGATACAACTTTTAATACCCAAGCT CCGGTCAATGTAAAGGTCTCTGACTTTTGGACAAACCGTAATGTAAAAAGAAAACCtdh1 14 GTCAATGTAAAGGTCTCTGACTTTTGGACAAACCGTAATGTAAAAAGAAAACCGTACG AAGATGTTTATGGTCAATCAGTATTCACAACGTCAGGTACTAAATGGTTGACATCCTACAtdh234 17 CCCCGGTTCTGATGAGATATTGTTTGTTGTTCGAGATRCAACTTTTAAWACCAAT GCACCGGTSAATGTARASGTCTCTGACTTTTGGACAAACCGTAATGTAAAAtdh234 18 AAAACCGTACAAAKATGTTTATSSTCAATCAGTATTCACAACGTCAGGTACTAAATGGC TGACATCCTACATGACTGTGAACATTAATGATAAAGACTATACAATGGCAGCGGTtrh1 19 TGGACAAACCSAAACRTAAAACGAAAACCATATAAAAGCGTTCACGGTCAATCTA TTTTCACGACTTCAGGCTCAAAATGGTTAAGCGCCTATAKRACGGTAAAtrh1 20 CCSAAACRTAAAACGAAAACCATATAAAAGCGTTCACGGTCAATCTATTTTCACG ACTTCAGGCTCAAAATGGTTAAGCGCCTATAKRACGGTAAAYATKAATGGAAATAtrh2 23B ACAAAGRTGTATACGGTCAATCGGTTTTCACAACWGCRGGTTCAAAG TGGTTAAGCGCCTATATGACAGTMAACATCAATGGTCAYAACTATACRATGGCtrh2 25B TTGGACAAACCGAAMCATAAAAAGAAAACCAWACAAAGRTGTATACGGTCAATCG GTTTTCACAACWGCRGGTTCAAAGTGGTTAAGCGCCTATATGACAGTorf8 28 AGCTGAGGCTTACGGGCTCACTCCTGCTGTACT TTTAGCTCGGTTAGCTGGCGGTTCTACAATTGAACAAGCATTAGGTATT

VA recA 3 CTGTATACGCGAAGAAACTTGGCGTWGATATCGATGCATTGCTA GTTTCTCAGCCAGACACAGGTGAGCAAGCGCTAGtl 9 GCATCTGGCGCAGATAAGTTYGTGTTCTGGGATGTGACT CACCCAACCACAGCMACGCATCGTTATGTKGCAGAGAAAA

GH recA 6 CGCTGGATCCTATCTACGCGCGCAAGCTGA ACGTTGATATCGATAACCTGTTGGTATCCCAGCCAGATACCtdh 15 CCCTGGTTCTGATGAGATATTGTTTGTTGTTCGAGATACAACTTTTAATACCAAAGA GCCGGTCAATGTAAAGGTCTCTGACTTTTGGACAAACCGTAATGTAAAAAGAAAACtdh 16 GACAAACCGTAATGTAAAAAGAAAACCGTACAAAGATGTTCATGGTCAATCAGTATTCAT AACGTCAGGTACTAAATGGTTGACATCCTACATGACTGTGAGCATTAATAATAAAGACTA

VV recA 5 GTTATTGTTGTCGACTCTGTKGCMGCATTGACRCCAAAG GCAGAAATCGAAGGTGAGATGGGCGAYTCGCACvvhA 22 TTATGGTGAGAACGGTGACAAAACGGTTGCGGGTGG TTCGGTTAACGGCTGGAGCTGTCACGGCAGTTGvvhA 23 AAAACGGTTGCGGGTGGTTCGGTTAACGGCTGG AGCTGTCACGGCAGTTGGAACCAAGTTTGGGGCviuB 29 CGGTGCGAGAAGGGGACAACGTCATTTGGCCT GAACACAAACCCGTTCCGAGAGCTTACTCGGTCAGACAATAT

478A.Carianiet

al./InternationalJournalofFood

Microbiology

153(2012)

474–482

recA

toxR

hlyA

hlyA

ctxA

ctxA

tcpI

recA

toxR tl

tdh1

tdh1

tdh2

34

tdh2

34

trh1

trh1

trh2

trh2

OR

F8

recA tl

recA tdh

tdh

recA

vvhA

vvhA

viuB

VC

/VM

GH

VV

VC

VP

VA

Fig. 1. Summary of the results of the specificity tests on selected probe pairs. The results of the PCR-LDR-UA assay are shown in terms of unadjusted P-value of the one sided t-test: whitecells represent significant signals (Pb0.01). The strain and the amplicon tested are displayed in the left column. PCR: single-target amplification,Mplx: multiplex amplification, VC: Vibriocholerae, VV: V. vulnificus, VP: V. parahaemolyticus, VA: V. alginolyticus, VM: V. mimicus, GH: Grimontia hollisae. Probe pairs and corresponding ZipCodes are provided on the bottom,grouped according to target species. ZipCode 66 is the hybridization control, “Blank” is the mean of negative controls (empty spots), “Other” represents the mean of all the remainingZipCodes in the Universal Array not associated to any probe pair.

479A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

recA

toxR

hlyA

hlyA

ctxA

ctxA

tcpI

recA

toxR tl

tdh1

tdh1

tdh2

34

tdh2

34

trh1

trh1

trh2

trh2

OR

F8

recA tl

recA tdh

tdh

recA

vvhA

vvhA

viuB

VC

/VM

GH

VV

VC

VP

VA

Fig. 2. Summary of the results on experimentally infected and retail shellfish samples. The results of the PCR-LDR-UA assay are shown in terms of unadjusted P-value of the onesided t-test: white cells represent significant signals (Pb0.01). A–E: experimentally infected samples; 1–23: retail shellfish samples. Probe pairs and corresponding ZipCodes areprovided on the bottom, grouped according to target species. ZipCode 66 is the hybridization control, “Blank” is the mean of negative controls (empty spots), “Other” representsthe mean of all the remaining ZipCodes in the Universal Array not associated to any probe pair.

480 A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

LDR-UA assay we developed allows the rapid and high-resolutionidentification of the most harmful Vibrio species for human health.In addition, it potentially achieves the successful detection of strainsusually not relevant to human concern, which could, however, haveacquired clinical significance by HGT of virulence factors.

The array prototype exhibited high specificity in the detection ofthe target genes on reference strains and environmental isolates.However, a cross-reaction of V. diabolicus strains towards V. alginolyticustl amplicon was observed, but with no corresponding signal for the recAgene. The double-probe identification system of the array, thus, allowsthe differentiation of this two species, thanks to the different hybridiza-tion patterns observed: a signal from the VA-tl probe without the corre-sponding signal from the VA-recA probe suggests the presence of V.diabolicus strains, while a positive signal from both probes indicatesthe presence of V. alginolyticus. Little is known about V. diabolicus, arecently discovered, non pathogenic species, phylogenetically closely re-lated to V. parahaemolyticus. On the basis of our findings, this species pos-sesses a tl gene, sharing the same haplotype with V. alginolyticus, causingpossible interference in the molecular identification of V. alginolyticusstrains. However these species could be efficiently distinguished byrecA gene sequences, allowing researchers to be confident in the speciesidentification also on non-previously characterized samples.

The performance of the PCR-LDR-UA in the environmental andseafood monitoring studies was rated by the detection of Vibriostrains in retail shellfish samples. The presence of target vibrios wasassessed in 57% of the analyzed mollusc samples. Among these positivesamples, half were infected by V. parahaemolyticus and V. alginolyticus,two of themost common vibrios reported in the Adriatic Sea (Masini etal., 2007; Vezzulli et al., 2009). The multi-probe positive signal corrob-orates the robustness of the results. The detection of trh2+ strains of V.parahaemolyticus in two samples is consistent with the previous find-ing of only few potentially pathogenic trh+ strains of this species inthe Adriatic Sea (Caburlotto et al., 2009; Fabbro et al., 2010; Ottavianiet al., 2010). The hybridization pattern showing a positive signal ofthe VA-tl probe coupled to a negative VA-recA signal could indicatethe presence of V. diabolicus strains in three shellfish samples.

TCBS isolation, followed by biochemical screening of isolates,failed in the detection of target Vibrio species in 13 out of 23 retailshellfish samples screened, demonstrating the higher sensitivity ofPCR-LDR-UA with respect to conventional microbiological approach.Possible explanations for these results are consistent with some con-siderations: the isolation method does not include an enrichmentstep and provides the analysis of a statistically significant number ofthe isolated colonies, but not all of them. This approach is inherently

Fig. 3. Sensitivity assessment results. P-value plots derived from the dilution tests performedon three Vibrio parahaemolyticus strains: tl amplicon on isolate 178-1 (solid blackline), toxR amplicon on ATCC 17802 (light gray line) and isolate 178-14 (dashedblack line). Y-axis reports the one-sided t-test P-value, in logarithmic scale. X-axisis the concentration of PCR product (fmol). The horizontal line represents P-valuethreshold for significance (i.e.: 0.01), whereas vertical lines represent the boundaryof the detection limit, between 6 and 3 fmol.

481A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

less sensitive and accurate than molecular methods, able to identifyeven small amounts of cells, living, dead or in the VBNC state (Voraet al., 2005).

The detection assay of Vibrio species in shellfish based on the PCR-LDR-UA platform has the advantage of combining high efficiency andrapidity. Because microbiological isolation of colonies is unnecessary,the procedure provides reliable results in 8 h after the enrichment step.In contrast, current microbiological methods have a longer duration ofmultiple days.

The addition of the enzymatic-mediated LigationDetection Reactionafter the amplification step has at least two main advantages over con-ventional PCRmethods: a) the sensitivity limit to 6 fmol of PCR productis far below any detectable limit on conventional detectionmethods forPCR products (e.g.: agarose gel); b) more noteworthy, the LDR stepallows a robust identification of the PCR products which could nothave been possible simply evaluating the size of the PCR products.The multiple-probe strategy gave an unequivocal distinction betweenV. cholerae (based on hlyA variants) and V. parahaemolyticus (based ontdh and trh genes) strains. Current Real-Time PCR detection methodsprovide rapid, high sensitive and exact quantification of the targets(Tebbs et al., 2011). However, the PCR-LDR-UA method has the advan-tages over Real-Time PCR to be more cost-effective when many loci(>10) have to be investigated simultaneously (Lauri et al., 2011;Wang et al., 2008).

Several microarray-based platforms for the detection of pathogenicVibrio spp. have been developed in the last years (Call, 2005; Chen etal., 2011; Gonzalez et al., 2004; Kim et al., 2010; Panicker et al., 2004;Vora et al., 2005). Panicker et al. (2004) focused to the three mainhuman-pathogen speciesV. cholerae,V. parahaemolyticus andV. vulnificus.Vora et al. (2005) carried out an exhaustive characterization of pathogen-ic Vibrio spp. using a RNA-based procedure on Vibrio isolates, whichhowever, seems to be less suitable for the direct Vibrio detection incomplex matrices such as shellfish. Otherwise, the developed PCR-LDR-UA platform has been successfully applied for Vibrio identificationin mollusc samples and has the advantage to be particularly flexible,because probe pairs can be eliminated, added or replaced at the costof oligonucleotide synthesis. Since all the ZipCodes have the sameTm, the Universal Array format can be used regardless of the targetspecies or genes, thus sensibly reducing the costs and setup time.

Furthermore, problems related to secondary structure of the targetDNAs or steric hindrance of differently sized targets (Peplies et al.,2003) are avoided or minimized by the enzymatic ligation and bythe relatively high hybridization Tm (i.e.: 65 °C).

The implementation of simple and flexible microarray tools is arelevant need in the diagnostic research field, as highlighted by recentliterature in which an array based genotyping platform developed forhuman clinical application (as it was for the LDR-UA technique) wasapplied for pathogens detection (Chen et al., 2011). The identificationof multiple pathogenic strains through the detection of specificvirulence-factor genes is an innovative approach that is currentlyreplacing the genotyping of species-specific polymorphisms of universalmarkers, as 16S rRNA gene. Moreover, the increasing genomic in-formation available in public database enables the identification ofspecies-specific target sequences and advanced molecular techniques,like multiplex PCR, allow the simultaneous amplification of tens ofmarkers (Kim et al., 2010). The strength of the developed PCR-LDR-UA platform relies on the coupling of information from multiplespecies-specific marker genes with that of the primary Vibrio virulencefactors. This multilocus typing approach confers reliability and specific-ity to the strains detection, through the accurate identification at specieslevel (achieved with a double markers system) and the characterizationof their harmful potential.

In order to protect consumer health and avoid financial losses inthe shellfish industry, the microbiological safety of seafood productsis a matter of fundamental importance. The PCR-LDR-UA assay heredescribed can be used as a screening tool for pathogen detection inretail shellfish: positive samples can be further investigated throughadditional methods; for those resulting negative, on the other hand,laborious, time- and cost-expensive techniques can be avoided.

The array here developed represents a first application of this sensi-tive, specific, and rapid detection system for pathogenicVibrio in shellfishdestined to human consumption and could complement current molec-ular methods in the screening of species potentially harmful for humanhealth.

Supplementary materials related to this article can be found onlineat doi: 10.1016/j.ijfoodmicro.2011.11.010.

Acknowledgments

This work was supported by a grant from University of Bolognafrom Strategic Research Project 2005 MICRO(BI)ARRAY coordinatedby Fausto Tinti. We also acknowledge partial financial support fromMIUR (FIRB “MICRAM”, RBNE01ZB7A; FIRB2003, RBLA03ER38_004).We are grateful to Ronnie Gavilan Chavez, University of Santiago deCompostela, Spain for providing clinical strains of V. parahaemolyticus.

References

Bej, A.K., Patterson, D.P., Brasher, C.W., Vickery, M.C., Jones, D.D., Kaysner, C.A., 1999.Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfishusing multiplex PCR amplification of tl, tdh and trh. Journal of MicrobiologicalMethods 36, 215–225.

Caburlotto, G., Gennai, M., Ghidini, V., Tafi, M., Lleo, M.M., 2009. Presence of T3SS2 andother virulence-related genes in tdh-negative Vibrio parahaemolyticus environmentalstrains isolated from marine samples in the area of the Venetian Lagoon, Italy. FEMSMicrobiology Letters 70, 506–514.

Call, D.R., 2005. Challenges and opportunities for pathogen detection using DNA micro-arrays. Critical Reviews in Microbiology 31, 91–99.

Candela, M., Consolandi, C., Severgnini, M., Biagi, E., Castiglioni, B., Vitali, B., De Bellis,G., Brigidi, P., 2010. High taxonomic level fingerprint of the human intestinalmicrobiota by Ligase Detection Reaction — Universal Array approach. BMC Micro-biology 10, 116.

Chen, J., Iannone, M.A., Li, M.S., Taylor, J.D., Rivers, P., Nelsen, A.J., Slentz-Kesler, K.A.,Roses, A., Weiner, M.P., 2000. A microsphere-based assay for multiplexed singlenucleotide polymorphism analysis using single base chain extension. GenomeResearch10, 549–557.

Chen, W., Yu, S., Zhang, C., Zhang, J., Shi, C., Hu, Y., Suo, B., Cao, H., Shi, X., 2011. Develop-ment of a single base extension-tag microarray for the detection of pathogenic Vibriospecies in seafood. Applied Microbiology and Biotechnology 89, 1979–1990.

482 A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

Cremonesi, P., Pisoni, G., Severgnini,M., Consolandi, C.,Moroni, P., Raschetti,M., Castiglioni, B.,2008. Pathogen detection in milk samples by ligation detection reaction-mediateduniversal array method. Journal of Dairy Science 92, 3027–3039.

Dutta, C., Pan, A., 2002. Horizontal gene transfer and bacterial diversity. Journal of Bioscience27, 27–33.

Fabbro, C., Cataletto, B., Del Negro, P., 2010. Detection of pathogenic Vibrio parahaemolyti-cus through biochemical andmolecular-basedmethodologies in coastal waters of theGulf of Trieste (North Adriatic Sea). FEMS Microbiology Letters 307, 158–164.

Fields, P.I., Popovic, T., Wachsmuth, K., Olsvik, O., 1992. Use of polymerase chain reactionfor detection of toxigenic Vibrio cholerae O1 strains from the Latin American choleraepidemic. Journal of Clinical Microbiology 30, 2118–2121.

Gonzalez, S.F., Krug, M.J., Nielsen, M.E., Santos, Y., Call, D.R., 2004. Simultaneous detectionof marine fish pathogens by using multiplex PCR and a DNA microarray. Journal ofClinical Microbiology 42, 1414–1419.

González-Escalona, N., Blackstone, G.M., DePaola, A., 2006. Characterization of a Vibrioalginolyticus strain, isolated from Alaskan oysters, carrying a hemolysin gene similarto the thermostable direct hemolysin-related hemolysin gene (trh) of Vibrio parahae-molyticus. Applied and Environmental Microbiology 72, 7925–7929.

Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysisprogram for Windows 95/98/NT. Nucleic Acids Symposium Series 41, 95–98.

Hervio-Heath, D., Colwell, R.R., Derrien, A., Robert-Pillot, A., Fournier, J.M., Pommepuy,M., 2002. Occurrence of pathogenic vibrios in coastal areas of France. Journal of AppliedMicrobiology 92, 1123–1135.

Jiang, S.C., Paul, J.H., 1998. Gene transfer by transduction in the marine environment.Applied and Environmental Microbiology 64, 2780–2787.

Kim, Y.B., Okuda, J., Matsumoto, C., Takahashi, N., Hashimoto, S., Nishibuchi, M., 1999.Identification of Vibrio parahaemolyticus strains at the species level by PCR targetedto the toxR gene. Journal of Clinical Microbiology 37, 1173–1177.

Kim, D.H., Lee, B.K., Kim, Y.D., Rhee, S.K., Kim, Y.C., 2010. Detection of representativeenteropathogenic bacteria, Vibrio spp., pathogenic Escherichia coli, Salmonellaspp., Shigella spp., and Yersinia enterocolitica, using a virulence factor gene-basedoligonucleotide microarray. Journal of Microbiology 48, 682–688.

Lauri, A., Castiglioni, B., Severgnini, M., Gorni, C., Mariani, P., 2010. A method based onthe Ligation Detection Reaction-Universal Array (LDR-UA) for the detection andcharacterization of Listeria and Campylobacter strains. European Food Researchand Technology 231, 985–998.

Lauri, A., Castiglioni, B., Morabito, S., Tozzoli, R., Consolandi, C., Mariani, P., 2011. A toolbased on Ligation Detection Reaction-Universal Array (LDR-UA) for the character-ization of VTEC by identification of virulence-associated and serogroup-specificgenes. Molecular and Cellular Probes 25, 35–43.

Masini, L., De Grandis, G., Principi, F., Mengarelli, C., Ottaviani, D., 2007. Research andcharacterization of pathogenic vibrios from bathing water along the Conero Riviera(Central Italy). Water Research 41, 4031–4040.

Myers, M.L., Panicker, G., Bej, A.K., 2003. PCR detection of a newly emerged pandemicVibrio parahaemolyticus O3:K6 pathogen in pure cultures and seeded watersfrom the Gulf of Mexico. Applied and Environmental Microbiology 69, 2194–2200.

Noguerola, I., Blanch, A., 2008. Identification of Vibrio spp. with a set of dichotomouskeys. Journal of Applied Microbiology 105, 175–185.

Ottaviani, D., Leoni, F., Rocchegiani, E., Canonico, C., Potenziani, S., Santarelli, S., Masini,L., Scuota, S., Carraturo, A., 2010. Vibrio parahaemolyticus-associated gastroenteritis

in Italy: persistent occurrence of O3:K6 pandemic clone and emergence of O1:KUTserotype. Diagnostic Microbiology and Infectious Disease 66, 452–455.

Panicker, G., Call, D.R., Krug, M.J., Bej, A.K., 2004. Detection of pathogenic Vibrio spp. inshellfish by using multiplex PCR and DNA microarrays. Applied and EnvironmentalMicrobiology 70, 7436–7444.

Peplies, J., Glöckner, F.O., Amann, R., 2003. Optimization strategies for DNA microarray-based detection of bacteria with 16S rRNA-targeting oligonucleotide probes. Appliedand Environmental Microbiology 69, 1397–1407.

Rantala, A., Rizzi, E., Castiglioni, B., De Bellis, G., Sivonen, K., 2008. Identification ofhepatotoxin-producing cyanobacteria by DNA-chip. Environmental Microbiology10, 653–664.

Rivera, I.N.G., Chun, J., Huq, A., Sack, R.B., Colwell, R.R., 2001. Genotypes associated withvirulence in environmental isolates of Vibrio cholerae. Applied and EnvironmentalMicrobiology 67, 2421–2429.

Serratore, P., Turtura, G.C., Rinaldini, E., Milandri, S., Presepi, D., 1999. Phenotypic char-acterization of some bacterial populations belonging to the genus Vibrio. Annali diMicrobiologia ed Enzimologia 49, 79–88.

Severgnini, M., Cremonesi, P., Consolandi, C., Caredda, G., De Bellis, G., Castiglioni, B.,2009. ORMA: a tool for identification of species-specific variations in 16S rRNAgene and oligonucleotides design. Nucleic Acids Research 37, e109.

Sipari, H., Rantala-Ylinen, A., Jokela, J., Oksanen, I., Sivonen, K., 2010. Development of a chipassay and quantitative PCR for detecting microcystin synthetase E gene expression.Applied and Environmental Microbiology 76, 3797–3805.

Tebbs, R.S., Brzoska, P.M., Furtado, M.R., Petrauskene, O.V., 2011. Design and validationof a novel multiplex Real-Time PCR assay for Vibrio pathogen detection. Journal ofFood Protection 74, 939–948.

Thompson, F.L., Iida, T., Swings, J., 2004a. Biodiversity of vibrios. Microbiology and Mo-lecular Biology Reviews 68, 403–431.

Thompson, C.C., Thompson, F.L., Vandemeulebroecke, K., Hoste, B., Dawyndt, P.,Swings, J., 2004b. Use of recA as an alternative phylogenetic marker in the familyVibrionaceae. International Journal of Systematic and Evolutionary Microbiology54, 919–924.

Thompson, F.L., Gevers, D., Thompson, C.C., Dawyndt, P., Naser, S., Hoste, B., Munn, C.B.,Swings, J., 2005. Phylogeny and molecular identification of vibrios on the basisof multilocus sequence analysis. Applied and Environmental Microbiology 71,5107–5115.

Vezzulli, L., Pezzati, E., Moreno, M., Fabiano, M., Pane, L., Pruzzo, C., 2009. Benthic ecologyof Vibrio spp. and pathogenic Vibrio species in a coastal Mediterranean environment(La Spezia Gulf, Italy). Microbial Ecology 58, 808–818.

Vora, G.J., Meador, C.E., Bird, M.M., Bopp, C.A., Andreadis, J.D., Stenger, D.A., 2005.Microarray-based detection of genetic heterogeneity, antimicrobial resistance, andthe viable but nonculturable state in human pathogenic Vibrio spp. Proceedings ofthe National Academy of Sciences 102, 19109–19114.

Wang, X.L., Xie, S.G., Zhang, L., Yang, W.X., Wang, X., Jin, H.Z., 2008. Comparison ofligase detection reaction and real-time PCR for detection of low abundant YMDDmu-tants in patients with chronic hepatitis B. World Journal of Gastroenterology 14,120–124.

Wilson, W.J., Strout, C.L., DeSantis, T.Z., Stilwell, J.L., Carrano, A.V., Andersen, G.L., 2002.Sequence-specific identification of 18 pathogenic microorganisms using microarraytechnology. Molecular and Cellular Probes 16, 119–127.