Cribriform Adenocarcinoma of Minor Salivary GlandOrigin Principally Affecting the Tongue: Characterization

of New Entity

Alena Skalova, MD, PhD,* Radek Sima, PhD,w Jana Kaspirkova-Nemcova, Mgr,wRoderick H.W. Simpson, MD,z Goran Elmberger, MD,y Ilmo Leivo, MD, PhD,JSilvana Di Palma, MD,z Tomas Jirasek, MD, PhD,# Douglas R. Gnepp, MD, **

Ilan Weinreb, MD, w w Bayardo Perez-Ordonez, MD, w w Petr Mukensnabl, MD, PhD,*Boris Rychly, MD,zz Petr Hrabal, MD,yy and Michal Michal, MD*

Abstract:We present a series of 23 cases of a distinctive, hithertopoorly recognized low-grade adenocarcinoma, with several

histologic features reminiscent of papillary carcinoma of thethyroid, and which mostly but not exclusively occurs in thetongue. All the tumors were unencapsulated and were divided

into lobules that were composed mainly of cribriform and solidgrowth patterns. Therefore, we propose the name “cribriformadenocarcinoma of minor salivary gland origin (CAMSG).” Allthe patients were adults with a mean age at diagnosis of 55.8

years (range, 25 to 85 y). Fourteen of the 23 tumors werelocalized in the tongue, 3 in the soft palate, 2 in the retromolarbuccal mucosa, 3 in the lingual tonsils, and 1 in the upper lip.

Fifteen patients of 23 had synchronous metastases in the cervicallymph nodes at the time of diagnosis, bilateral in 3 cases. In 3patients, the nodal metastasis was the first evidence of disease,

later investigation revealing primary neoplasms in the base of

tongue and tonsil, respectively. In addition, 1 patient developed

a cervical lymph node metastasis 8 years after excision of aprimary tumor of the tongue. Data on treatment and follow-upwere available in 14 cases. The patients were treated by radicalexcision with clear margins (12 cases) or by simple excision (2

cases). Neck dissection was performed in 10 patients; 9 receivedradiotherapy, but none were treated by chemotherapy. Clinicalfollow-up ranged from 2 months to 13 years (mean, 6 y and

5mo). Twelve patients are alive with no evidence of recurrent ormetastatic disease after treatment, 1 patient died 2 years aftersurgery without evidence of tumor, and 1 patient is alive with

recurrent tumor of the palate.

Key Words: cribriform adenocarcinoma of minor salivary

glands, tongue, polymorphous low-grade adenocarcinoma,PLGA, myosecretory cells, hybrid secretory and myoepithelialcells

(Am J Surg Pathol 2011;35:1168–1176)

Polymorphous low-grade adenocarcinoma (PLGA) is amalignant neoplasm of minor salivary glands that was

originally described as lobular carcinoma11 and terminalduct carcinoma,1 the present term PLGA being intro-duced in 1984,9 and later adopted by the World HealthOrganization (WHO).7 It is generally a slow growingneoplasm of low metastatic potential that nearly alwaysarises in the minor salivary glands of the palate andbuccal mucosa.15 It is histologically characterized bybland uniform nuclear features and morphologic diver-sity, displaying a wide variety of growth patterns, such astrabecular, tubular, cribriform, fascicular, and solidstructures, often within the same individual neoplasm.A typical finding is the presence of concentric whorls,creating target-like (onion skin-like) patterns, reminiscentof lobular carcinoma of the breast. Invasion of theadjacent tissues and perineural spaces is typical. However,despite this, the overall prognosis of PLGA remains to befavorable.7,15 In a large series of 164 cases, more than97% of all patients treated with surgery alone were tumorCopyright r 2011 by Lippincott Williams & Wilkins

From the *Department of Pathology, Charles University Prague,Faculty of Medicine in Pilsen; wMolecular Pathology Laboratory,Department of Pathology, Medical Faculty Hospital, Pilsen;#Department of Pathology, Faculty Hospital Kralovske Vinohrady;yyDepartment of Pathology, Central Military Hospital, Prague,Czech Republic; zDepartment of Histopathology, Royal Devon andExeter Hospital, Exeter; zDepartment of Histopathology, theRSCH, Division of Clinical Medicine University of Surrey,Guildford, Surrey, England; yDepartment of Pathology and Cytology,Karolinska University Hospital, Solna and Danderyd, Stockholm,Sweden; JDepartment of Pathology, University of Turku, Turku,Finland; **Department of Pathology, Warren Alpert School ofMedicine at Brown University, Rhode Island Hospital, Providence,RI; wwDepartment of Pathology, University Health Network, Uni-versity of Toronto, Toronto, Ontario, Canada; and zzCytopathos,Bratislava, Slovakia.

Supported by: Grant Nr. 9725 of IGA MH CR (Internal Grant Agencyof Health Ministry, Czech Republic).

The preliminary results of the study were presented at the SYMPO-SIUM Updates in Head and Neck Pathology: at the XXVIIIthCongress of the International Academy of Pathology - Sao Paulo,Brazil, Oct 10th-15th 2010 (AS) and as a platform presentation atUSCAPMeeting 2011, San Antonio, Feb 26th-March 4th 2011 (AS).

Correspondence: Alena Skalova, MD, PhD, Sikl’s Department ofPathology, Medical Faculty of Charles University, Faculty Hospital,E. Benese 13, 305 99 Pilsen, Czech Republic (e-mail: skalova@fnplzen.cz).

ORIGINAL ARTICLE

1168 | www.ajsp.com Am J Surg Pathol � Volume 35, Number 8, August 2011

free and either alive or dead from other causes within amean follow-up period of approximately 10 years.2

However, one series of 40 patients with moreprolonged follow-up of at least 10 years in each casenoted recurrences in 13 cases (32.5%) and regional lymphnode metastases in 6 cases (15%). Tumors with more thanfocal papillary growth had a higher incidence of nodalmetastases, but not of distant spread or death fromdisease.10 In contrast, another long-term study showed asuccessful outcome in all but 1 tumor that was completelyexcised at initial surgery.17 More aggressive behavior witha much higher metastatic rate was observed in 2 series,which specifically included tumors described as PLGA inthe tongue, tonsils, and retromolar triangle.19,22 The firststudy reported 17 cases of PLGA, among which 2 tumorswere located in the posterior tongue and 1 in the mucosaof retromolar region; all 3 patients (17%) presented withcervical lymph node metastases.19 The second studycomprised 24 patients with a diagnosis of PLGA,19 4 ofwhom (17%) had regional lymph node metastases atpresentation; in 3 of these 4 patients, the primary site wasthe tongue.22

In 1999, we published a series of a distinctive type ofadenocarcinoma occurring typically in the posteriortongue and retromolar region, which was characterizedby synchronous metastases in lateral neck lymph nodes,but no distant spread.16 These were designated ascribriform adenocarcinoma of the tongue (CAT).16 Thistumor was recognized by the latest issue of the WHOclassification as a possible variant of PLGA, but it wasnoted that it was not yet clear whether this represented agenuine separate entity.15 Therefore, over the subsequentyears, we have collected a new series of 23 cases of thesetumors, some of which arose in minor salivary glandsother than in the tongue. The purpose of this study was tobetter characterize this hitherto poorly recognized dis-tinctive tumor entity, for which we propose the name,cribriform adenocarcinoma of minor salivary gland origin(CAMSG).

MATERIALS AND METHODSThis study consists of a series of 23 cases of an

unusual distinctive low-grade adenocarcinoma that ismostly localized in the tongue and is characteristicallycomposed predominantly of cribriform and solid struc-tures. These tumors were mainly consultation cases in theauthors’ salivary gland tumor registry files (A.S., M.M.)that were identified among >5000 salivary gland tumors.Both tumor files were reviewed retrospectively (A.S.), andall tumors that were originally classified as PLGA ofminor salivary glands and cribriform adenocarcinomawere reevaluated by 1 of us (A.S.). In addition, all tumorsarising in the tongue, other than squamous cell carcino-ma, were also reviewed. The diagnostic criteria of PLGAincluded the WHO definition7 with additional descriptorsderived from other studies.2,9,10 Additional cases werecontributed from the files of other surgical pathologists.

Histochemical and ImmunohistochemicalStudies

For histologic and immunohistochemical studies,paraffin blocks and recuts were available in 12 cases ofCAMSG. For comparison, we also studied 5 cases of PLGAof the palate of conventional histologic type and 5 cases ofadenoid cystic carcinoma of the palate and buccal mucosa.

For conventional microscopy, the excised tissueswere fixed in formalin, routinely processed, embedded inparaffin, cut, and stained with hematoxylin and eosin.

For immunohistochemical study, 4-mm-thick sectionswere cut from paraffin blocks, mounted on slides coatedwith 3-aminopropyltriethoxy-silane (Sigma, St. Louis),deparaffinized in xylene, and rehydrated in descendinggrades (100% to 70%) of ethanol. The sections were thensubjected to heat-induced epitope retrieval by immersion ina 0.01M citrate buffer (pH 6.0) in a microwave ovenMicromed TTmega for 20 minutes. Endogenous peroxidasewas blocked by 5-minute treatment with 3% hydrogenperoxide in absolute methanol. The slides were then stainedby immunostainer BenchMark ULTRA (Roche). Theprimary antibodies used are summarized in Table 1. Thebound antibodies were visualized using the HistofineSimple Stain MAX PO (Multi) Universal Immuno-peroxidase Polymer, Anti-Mouse and Rabbit (NichireiBiosciences inc., Tokyo, Japan), and 3-30-diaminobenzidine(Sigma) as the chromogen. The slides were counterstainedwith Mayer hematoxylin. Appropriate positive and nega-tive controls were used.

UltrastructureSmall pieces of the formaldehyde-fixed wet tissue of

1 case and retrieved pieces of formaldehyde-fixed andparaffin-embedded tissue in 2 other cases were postfixedin glutaraldehyde and were routinely processed forelectron microscopy.

TABLE 1. Antibodies Used

Antibody Clone Source

SMA 1A4 Dako-YbuxAE1-3, pancytokeratin Pan-AE1/AE3, PCK26 VentanaCalponin EP798Y VentanaCAM 5,2 BD-BariaCD117 CD117, c-kit Dako-YbuxCK5/6 D5/16B4 Dako-YbuxCK7 OV-TL 12/30 Dako-YbuxCK8 35 betaH11 Dako-YbuxCK18 CD10 Dako-YbuxCK19 RCK 108 Dako-YbuxCyclin D1 SP4 VentanaEGFR H11 Dako-YbuxMIB1 Ki-67 Dako-YbuxP53 DO-7 Dako-YbuxP63 4A4 Dako-YbuxP16 protein INK4a CIN tec Dako-YbuxS-100 protein Polyclonal Dako-YbuxThyroglobulin 2H11+6E1 VentanaTTF1 8G7G3/1 Dako-Ybux

CK indicates cytokeratin; SMA, smooth muscle actin; TTF1, antithyroidtranscription factor.

Am J Surg Pathol � Volume 35, Number 8, August 2011 Cribriform Adenocarcinoma of Minor Salivary Glands

r 2011 Lippincott Williams & Wilkins www.ajsp.com | 1169

Molecular Genetic StudyFor molecular genetic analysis, 18 samples from 10

patients with CAMSG were available. In addition, 5 casesof PLGA of minor salivary glands and 5 cases of adenoidcystic carcinoma were also evaluated for comparison.

DNA for molecular genetic investigation wasextracted from formalin-fixed, paraffin-embedded tissuesby the NucleoSpin Tissue Kit (MACHEREY-NAGELGmbH & Co. KG, Duren, Germany) according to themanufacturer’s protocol. Moreover, special precautionswere taken to prevent human papilloma virus (HPV)nonamplifiable microcontamination.

Mutational AnalysisAnalysis of activating mutation V600E of the BRAF

gene and activating mutations of the KRAS gene wasconducted using StripAssay PGX KRAS BRAF Kit(ViennaLab, Vienna, Austria) according to the manufac-turer’s protocol.

Mutational analysis of exons 9, 11, 13, and 17 of thec-kit gene and exons 12, 14, and 18 of the PDGFRa genewas conducted using polymerase chain reaction (PCR)and direct sequencing. The reaction conditions were asfollows: 12.5 mL of FastStart PCR Master (RocheApplied Science, Indianapolis), 10 pmol of each primer(Table 2), 100 ng of template DNA, and distilled water upto 25 mL. The amplification program consisted ofdenaturation at 951C for 10 minutes and then 40 cyclesof denaturation at 951C for 1 minute, annealing at 551C

for 1 minute, and extension at 721C for 1 minute. Theprogram was finished by incubation at 721C for 7minutes.

Detection of HPVHPV DNA detection was performed using a set of

several PCRs with different primers to cover a widedetection range of predominantly high-risk/low-risk HPVtypes. The following primer systems were used: SPF(according to the manufacturer’s protocol of a commercialproduct INNO-LiPA HPV Genotyping kit Extra, Innoge-netic NV, Belgium), CPSGB26 with some modifications inchemistry,13 and GP5+/GP6+.27 Positive PCR sampleswere sequenced or reversely hybridized to reveal theparticular HPV type. To avoid false-negative findings(because of loss of L1 or E1 region due process of HPVintegration into host genome), PCR targeting of HPVoncogenes E6 and E7 of 5 most prevalent high-risk HPVtypes, namely type 16, 18, 31, 33, and 35 was performed.12

RESULTS

Clinical and Follow-up DataThe main clinical data and gross features of 23

patients with CAMSG are summarized in Table 3. Theage of the patients at diagnosis ranged from 25 to 85 years(mean, 55.8 y). Fourteen tumors occurred in the tongue, 3in the soft palate, 2 in the retromolar buccal mucosa, 3 inthe lingual tonsils, and 1 in the upper lip. Original

TABLE 2. PCR Primers Used in Molecular Genetic Study

Gene Exon Primer Sequence 50-30

c-kit 9 ATGCCACATCCCAAGTGTTTCCCCTTAAATTGGATTAAAAAGAAAT

11 TGTTCTCTCTCCAGAGTGCTCTAAACCCAAAAAGGTGACATGGA

13 ATGCGCTTGACATCAGTTTGCAATAAAAGGCAGCTTGGACA

17 ATGGTTTTCTTTTCTCCTCCTACATTATGAAAGTCACAGG

PDGFRa 12 TCCAGTCACTGTGCTGCTTCGGAGGTTACCCCATGGAACT

14 TCACAGGATTAGTCATATTCTTGGTTTGAAAATCCTCACTCCAGGTC

18 GCTACAGATGGCTTGATCCTGGACCAGTGAGGGAAGTGAGG

HPV Type 16 TCA AAA GCC ACT GTG TCC TGACGT GTT CTT GAT GAT CTG CAA

Type 18 CCG AGC ACG ACA GGA ACG ACTTCG TTT TCT TCC TCT GAG TCG CTT

Type 31 CTA CAG TAA GCA TTG TGC TAT GCACG TAA TGG AGA GGT TGC AAT AAC CC

Type 33 AAC GCC ATG AGA GGA CAC AAGACA CAT AAA CGA ACT GTG GTG

Type 35 CCC GAG GCA ACT GAC CTA TAGGG GCA CAC TAT TCC AAA TG

CPSGB ATATGTCTGAG CCTCCWAARTTATGTTAATWSAGCCWCCAAAATTTTA TCA WAT GCC CAY TGT ACC AT

GP5+ TTTGTTACTGTGGTAGATACTACGAAAAATAAACTGTAAATCATATTC

TABLE 3. Clinical Features and Follow-up Data of 23 Patients

SexFemale 9Male 10NA 4

AgeMean 55.8 yRange 25-85 y

Location of primary tumorTongue 14Palate 3Retromolar mucosa 2Tonsils 3Upper lip 1

Lymph node statusPositive LN: total number 16Positive at presentation 15Positive as recurrent disease 1Positive LN as first manifestation of disease 3Bilateral positive LN 3Cervical lymph nodes negative: total number 3NA 4

Status at last follow-upAlive NED 12DOC NED 1Alive with recurrent disease 1Lost from follow-up 9

Duration of follow-upMean 6 y 5moRange 2mo-13 y

DOC indicates dead of other causes; LN, lymph node; NA, not available;NED, no evidence of disease.

Skalova et al Am J Surg Pathol � Volume 35, Number 8, August 2011

1170 | www.ajsp.com r 2011 Lippincott Williams & Wilkins

diagnoses of referring pathologists included PLGA inmost instances, but 1 patient each was diagnosed withmucoepidermoid, adenoid cystic carcinoma, cystadeno-carcinoma, low-grade myoepithelial carcinoma, and low-grade carcinoma not otherwise specified.

Overall, 16 patients presented with metastases in thecervical lymph nodes: 15 at approximately the same timeas the diagnosis of the primary (bilateral in 3 cases), and 1after an interval of 8 years. The primary sites in the 16lymph node-positive cases were posterior tongue andretromolar mucosa (13 cases), tonsils (2 cases), and thepalate (1 case). In 3 patients, a cervical lymph nodemetastasis appeared before the primary tumor wasidentified (base of the tongue and tonsil). The diagnosisof the referring pathologist in these cases was metastaticpapillary carcinoma of the thyroid gland.

Treatment and Follow-up PeriodData on treatment were available in 14 cases. The

patients were treated by radical excision and/or partialresection of the tongue with clear margins (12 cases) and bysimple excision (2 cases). Neck dissection was performed in10 patients and 9 received radiotherapy, but no patient wastreated by chemotherapy. Clinical follow-up was availablein 14 cases and ranged from 2 months to 13 years (mean,6 y and 5mo); 9 patients were lost to follow-up. Twelvepatients are alive with no evidence of recurrent or furthermetastatic disease after treatment, 1 patient died 2 yearsafter surgery without evidence of tumor, and 1 patient isalive with recurrent tumor of the palate.

Histopathologic and ImmunohistochemicalFindings

Grossly, all the tumors were unencapsulated, white-tan to gray in color, and hard in consistency with no areasof hemorrhage or necrosis.

Histologically, the tumors were covered by intactsquamous epithelium devoid of ulceration, although

varying degrees of pseudoepitheliomatous hyperplasiawere frequently seen (Fig. 1A). Each tumor had invasivemargins, in most cases with infiltration of the muscularlayer of the tongue, and/or adjacent tissues (Fig. 1B).Lymphovascular invasion was observed in 8 of 23 cases(Fig. 1B). There were often deposits of hemosiderin infocally hyalinized interstitial stroma close to the invasiveborder of the lesions. The tumors themselves werecomposed predominantly of cribriform and solid structuresin variable proportions (Fig. 2A). In most instances, thetumor architecture consisted mainly of a generally solidmass, often divided by fibrous septa into irregularly shapedand sized nodules composed of solid, cribriform, andmicrocystic structures (Fig. 2B). In the solid areas, thetumor nests were detached from the surrounding fibrousstroma by (presumably artifactual) clefts, giving a glomer-uloid appearance (Fig. 2C). The peripheral layer of suchsolid tumor nests often displayed hyperchromatic nuclei ina somewhat palisaded pattern (Fig. 2D). Typically, thetumors also included intermingled tubular, solid, andcribriform growth patterns. The tubules were approxi-mately all of the same size and they consisted of 1 cell layer.

The most prominent feature of the tumors, however,was the appearance of the nuclei. These often overlappedone another, and were pale, optically clear, and vesicularwith a ground-glass appearance, so that the tumorscytologically strongly resembled papillary carcinoma ofthe thyroid gland (Fig. 3A). Cellular atypia was mild, andmitotic figures were rare in most cases. Generally, therewere 1 to 3 small inconspicuous nucleoli. The cytoplasmwas clear to eosinophilic and often abundant. Cytologi-cally, all the tumors were composed of 1 cell type. Theoverall morphology of the tumor, particularly with focalpapillary growth and with overlapping clear “OrphanAnnie eye-like nuclei,” was remarkably similar to the solidvariants of papillary thyroid carcinoma. The cervical lymphnode metastases had identical appearances to the primarytumors (Fig. 3B).

FIGURE 1. A, The tumors were covered by intact mucosa (hematoxylin and eosin). B, There are invasive margins, in most caseswith infiltration of the muscular layer of the tongue, and/or adjacent tissues (hematoxylin and eosin). Lymphovascular invasion isseen (inset) (immunohistochemical staining D2-40).

Am J Surg Pathol � Volume 35, Number 8, August 2011 Cribriform Adenocarcinoma of Minor Salivary Glands

r 2011 Lippincott Williams & Wilkins www.ajsp.com | 1171

FIGURE 2. A, The tumors are composed predominantly of solid and cribriform growth structures in variable proportions(hematoxylin and eosin). B, They are divided by fibrous septa into irregular nodules composed of solid, cribriform, and microcysticstructures (hematoxylin and eosin). C, In the solid areas, the tumor nests are detached from the adjacent fibrous stroma byartificial clefting (hematoxylin and eosin). D, The peripheral layer of such solid tumors nests display hyperchromatic nuclei in avaguely palisading pattern (hematoxylin and eosin).

FIGURE 3. A, The nuclei, which often overlap one with another, were pale, optically clear, and vesicular with a ground-glassappearance, so that the tumors cytologically strongly resemble papillary carcinoma of the thyroid gland. B, The cervical lymphnode metastases has identical appearances to the primary tumors.

Skalova et al Am J Surg Pathol � Volume 35, Number 8, August 2011

1172 | www.ajsp.com r 2011 Lippincott Williams & Wilkins

Immunohistochemically, 12 cases of CAMSG werestudied and all the tumors were identical. In each case,virtually every cell reacted strongly with antibodies to AE1-3, CAM5.2, cytokeratin 7 (CK7), cytokeratin (CK8),cytokeratin (CK18), S-100 protein, and vimentin. Inaddition, there was significant positivity for c-kit (CD117)in 5 of 12 cases with range of positive cells between 10%and 80% with strong cytoplasmic and membranousexpression (Fig. 4A). The immunostaining for p16 proteinwas strong in both cytoplasm and nuclei typically with apatchy pattern in most cases with variable proportions ofpositive cells (range, 5% to 60%). In 1 case, it was diffuse inall cells of the entire tumor (Fig. 4B). Neither the normalepithelial or stromal components of the salivary glandtissue adjacent to the tumor nor the epithelium of thelingual mucosa demonstrated any p16 positivity. Immu-nostaining for cyclin D1 and p53 protein demonstratedvariable percentages of positive nuclei ranging between 0%

to 35% (mean, 10%) and 0% to 10% (mean, 2.2%),respectively.

Basal and myoepithelial cell markers, such as p63,calponin, CK14, smooth muscle actin (Fig. 4C), andCK5/6 were positive in all tumors with variable propor-tions up to 60%. Often the palisade cells surrounding theglomeruloid structures were positive for these markers.Expression of CK19 was variable with mild-to-moderatestaining of membranes and cytoplasm in 9 of 12 cases(range, 3% to 5% of cells; mean, 3%) (Fig. 4D). Threecases were completely devoid of staining, but no casewas diffusely positive. Proliferative activity was generallylow. Epithelial membrane antigen, epidermal growthfactor receptor, and HER-2/neu were negative in allcases. More importantly, all the tumors were completelydevoid of any staining for thyroid transcription factor 1and thyroglobulinFboth stains were repeated in mostcases.

FIGURE 4. A, Positivity for c-kit (range of positive cells 20% to 80%) with strong cytoplasmic and membranous expression(immunohistochemical staining CD117). B, The immunostaining for p16 protein has a typical patchy pattern with variableamount of positive cells (range, 50% to 100%). The staining for p16 protein was strong cytoplasmic/nuclear and diffuse in thewhole tumor in 3 cases (inset). C, Peripheral layer of solid and cribriform tumor nests often displayed myoepithelial differentiation(immunohistochemical staining smooth muscle actin). D, Expression of CK19 was variable with mild-to-moderate staining ofmembranes and cytoplasm in up to 5% of cells (immunohistochemical staining CK19).

Am J Surg Pathol � Volume 35, Number 8, August 2011 Cribriform Adenocarcinoma of Minor Salivary Glands

r 2011 Lippincott Williams & Wilkins www.ajsp.com | 1173

Ultrastructural FindingsUltrastructurally, all the cells of the tumor were

uniform and were thus of 1 type. They had irregularlyclefted nuclei with nucleoli. The light microscopy nuclearclear morphology may be explained perhaps by thepronounced nuclear folding seen ultrastructurally. Interest-ingly, at the ultrastructural level, even the areas with solidappearance at light microscopical level revealed a micro-cribriform arrangement. The secretory spaces were com-posed of well-formed microvilli on the apical borders of thecells. A further unusual feature was that many of thesecretory cells displaying the apical microvilli also containedgroups of microfilaments in the cytoplasm (Fig. 5). Thesecells thus had features of hybrid myoepithelial-secretorycells, and consequently had all the aspects of “secretorymyoepithelia.” Many cells, especially those in areas thatshowed spindling of neoplastic cells, were found to containnumerous bundles of cytoplasmic tonofilaments.

Molecular Genetic FindingsEighteen tumor samples of CAMSG from 10 cases

were available for molecular genetic testing. Results aresummarized in Table 4. No mutations of BRAF, KRAS,c-kit, and PDGFRa genes were found in any of theanalyzable cases. In 1 case, DNA quality was unsatisfac-tory for molecular analysis. Furthermore, detection ofDNA of wide spectrum of high-risk/low-risk HPV typeswas performed. All but 1 case were negative. In 1 case,high-risk HPV type 33 was detected (this case also showedweak positivity of HPV type 18).

DISCUSSIONCAMSG is rare. Since the original publication in

1999, only a few reports20 and commentaries aboutCAMSG have been published in the literature.14

We originally described 8 cases of what we calledCAT.16 Since then, we have identified 23 additional casesof cribriform adenocarcinoma among >5000 cases of

salivary gland tumors in our registries. These 23 new casesadded several invaluable pieces of information furthercharacterizing this tumor entity:

1. Although most examples of CAMSG are located onthe tongue, this is not always the case. Nine of our 23cases originated at other sites, including the tonsil,3

palate,3 retromolar mucosa,2 and upper lip.1 Thisfinding practically excludes the possibility of origin ofCAMSG from the remnants of the thyroglossal duct(which is a residue of the descent of the fetal thyroidgland), as suggested in our original report.16 Onaccount of the extralingual location of a third of thecases in our series, it is apparent that these tumors arisefrom minor salivary glands located throughout themucosa of the oral cavity and lips. Thus, the name usedin our previous study “cribriform adenocarcinoma oftongue”16 is no longer sufficiently descriptive. We nowpropose that this tumor entity be termed “cribriformadenocarcinoma of minor salivary gland origin”mostly affecting the tongue.

FIGURE 5. Secretory myoepithelias. The secretory cells bear-ing microvilli on the apical border also contain groups ofmicrofilaments (arrowheads).

TABLE 4. Molecular Genetic Findings in CAMSG and ControlCases (AdCC and PLGA)

CAMSG

Case C-kit PDGFRa BRAF KRAS HPV

1 WT WT WT WT negWT WT WT WT neg

2 WT* WT WT WT negWT WT WT WT neg

3 WT* WT WT NA negWT WT WT WT negWT WT WT WT neg

4 WTw WT WT WT negWT WT WT WT negWT WT WT WT neg

5 NA NA WT WT NANA NA WT WT NA

6 WT WT WT WT negWT WT WT WT neg

7 WT WT WT WT neg8 NA NA NA NA neg9 WT WT WT WT HPV 33,

weak18 (HR)

10 WT WT WT WT negPLGAC1 WT WT NA NA negC2 WT WT WT NA negC3 WT WT WT WT negC4 WT WT WT WT negC5 NA NA WT WT negAdCCC6 WT WT WT WT negC7 WT WT WT WT negC8 WT WT WT WT negC9 WT WT WT WT negC10 WT WT WT WT neg

*Exon 17 cannot be amplified.wExons 11, 17 cannot be amplified.AdCC indicates adenoid cystic carcinoma; HR, high risk; NA, nonamplifiable;

neg, negative; WT, wild type.

Skalova et al Am J Surg Pathol � Volume 35, Number 8, August 2011

1174 | www.ajsp.com r 2011 Lippincott Williams & Wilkins

2. CAMSG arising at any location can developmetastases as occurred in 6 of 9 extralingual cases (2of retromolar mucosa and 2 of tonsils). Moreover, 2 of3 patients with CAMSG of the palate also experiencedcervical lymph node disease; one 3 years after excisionof the original tumor and the other at the time ofprimary diagnosis. In the original series, all 8 patientswith CAMSG had metastases in the neck already at thetime of presentation. In our new series, 4 of 23 patients(17%) did not develop lymph node metastases withinfollow-up periods between 2 and 8 years, which meansthat metastatic disease is not necessarily a feature ofCAMSG in all cases. Primary sites in these lymphnode-negative cases were the tongue,2 soft palate,1 andupper lip.1 In additional 4 patients (of 23), data onnodal status were not available.

3. Although the additional cases of the present expandedseries confirmed the high incidence of metastaticspread in CAMSG, the prognosis remains very good,as in our original report in which all 8 patients weresurvivors.16 In this study, all the patients were alivewithout evidence of disease (other than 1 of 23 whodied of other causes) within the follow-up period up to13 years (mean, 6 y and 5mo).

A particularly interesting feature of CAMSG is thehybrid nature of the tumor cells. Dual secretory andmyoepithelial characteristics were demonstrated at theimmunohistochemical level with smooth muscle actin,cytokeratins, and S-100 protein all positive in the sametumor cells. The myosecretory phenotypic immunoprofilecorrelated at the ultrastructural level with the presence ofactin microfilaments and microvilli located in the same cells.Similar cells have been described recently in the breast by DelVecchio et al,6 who reported a cell type with hybrid secretoryand myoepithelial differentiation in 3 cases of lobularcarcinoma, 2 of which had an infiltrating component. Thesecells displayed not only typical lobular cytomorphology, butalso myoepithelial differentiation as shown by severalmyoepithelial markers. In addition, there are reports ofadditional mammary adenocarcinomas exhibiting similarhybrid secretory and myoepithelial differentiation.23–25 Thesecells were termed myosecretory cells6; however, in thecontext of salivary gland tumors, we propose the name“secretory myoepithelium” for this cell type. These secretorymyoepithelial cells, which are practically always present inCAMSG, are another distinguishing feature from othersalivary gland neoplasms, particularly PLGA.

According to the current issue of the WHOClassification of Tumours of the Head and Neck, theposition of CAMSG is provisional without a clearstatement as to whether it represents a genuine entity oris merely a variant of PLGA.15 We are now convinced,however, that CAMSG is a distinct neoplasm, and thatthere are several reasons why it should be consideredseparate from PLGA.

First, CAMSG is not a polymorphous tumor, but acytologically monomorphous neoplasm that is composedof 1 cell type displaying a relatively limited range ofgrowth patterns. In contrast, PLGA typically has a wide

range of architectural appearances, including tubule andfascicle formation, and also solid, cribriform, and some-times small papillary structures. A particularly character-istic feature of PLGA is the finding of streaming columnsof single file or narrow trabeculae of cells formingconcentric whorls, thereby creating a target-like appear-ance.15 Perineural invasion is often seen, but does notindicate more aggressive behavior. At the cellular level,PLGA quite often contains clear cells and less frequently,mucous cells. In 3% to 5% of cases of PLGA, crystalsresembling the tyrosine-rich crystals of some pleomorphicadenomas can be found.3,21 None of these features wereseen in CAMSG. Second and perhaps most importantly,the most striking feature of CAMSG is the great nuclearsimilarity to papillary carcinoma of the thyroid, and thisis not seen to any great extent in PLGA. Third, PLGAonly rarely metastasizes, and it is our view that asignificant proportion of the putative examples ofmetastasizing PLGA could perhaps in reality representCAMSG, which had been lumped together in somepublished series of PLGA. As a consequence therefore,we strongly suspect that if cases of CAMSG wereexcluded from the series of PLGA, then the metastaticrate of true PLGA would be even lower than nowconsidered. In contrast, CAMSG had lymph nodemetastases in 15 of 23 cases already at the time of thepresentation of the primary tumor in our series, whichmakes CAMSG unique among all low-grade salivarygland tumors.

It has been suggested that the tongue is unique in theupper aerodigestive tract because of its rich lymphaticsupply and consequently, even a tumor with a lowmetastatic potential such as PLGA arising here will stillmetastasize frequently. As a result, we earlier considered thepossibility that the neoplasm we originally reported as CATwas just a variant of PLGA, and its high metastatic rate inthe tongue merely reflected its site of origin. In view of thefindings in this study, we are now firmly of the opinion thatthis contention is not valid. We are not aware of any PLGAof the tongue with a conventional morphology (ie, differentfrom CAMSG), which metastasized to lymph nodes.Interestingly, in a series of PLGAs with metastatic disease,we believe that the illustration of the metastatic tumorclearly shows the typical histomorphologic picture ofCAMSG.4 In a separate recently published series of 24cases of PLGA, 4 metastasized to the cervical lymph nodes,3 of which arose in the tongue.22 In addition, in our files, wehave several cases of PLGA with morphology differentfrom CAMSG located in the tongue and none of these“genuine” PLGAs metastasized (unpublished observation).

There are 2 further cases in the literature of probableCAMSG located on the tongue named as tubular adeno-carcinoma28 and papillary adenocarcinoma.5 Both metas-tasized to the neck lymph nodes, and in the second casecytologic similarity to papillary carcinoma of the thyroidwas noted,5 a typical feature of CAMSG in our experience.

The most significant differential diagnosis of CAMSGis from metastatic papillary carcinoma of the thyroid,particularly if nodal disease is the first presentation. Colloid

Am J Surg Pathol � Volume 35, Number 8, August 2011 Cribriform Adenocarcinoma of Minor Salivary Glands

r 2011 Lippincott Williams & Wilkins www.ajsp.com | 1175

is absent and most importantly, CAMSG is alwaysthyroglobulin and thyroid transcription factor 1 negative.In contrast, all cases of CATS stain strongly for S-100protein and p16 protein. Moreover, there is immunohis-tochemical and ultrastructural evidence of focal myoe-pithelial differentiation with calponin and actinpositivities. Staining for CK19 is always very strong anddiffuse in thyroid cancers, whereas CAMSG demon-strated only mild and patchy staining in up to 5% of cells.

Finally, the mechanism of p16 protein overexpres-sion in salivary gland tumors has not been clearly defined.There are only a few studies that have looked at this andthey produced conflicting results.8,18 P16 is a tumor-suppressor protein that inhibits cyclin-dependent kinase4A. In tumors with biologically active HPV, the HPV E7protein leads to inactivation of retinoblastoma protein(Rb). As Rb normally suppresses p16 transcription, lackof Rb protein leads to p16 overexpression. A strong anddiffuse immunostaining pattern for p16 is thereforeconsidered as a highly sensitive surrogate marker ofHPV-associated tumors. It is, however, not always so, asother pathways may also lead to p16 overexpression. Inour series, we demonstrated overexpression of p16 proteinimmunohistochemically in all studied CATS (range, 5%to 100% positive cells). All the cases but 1, however, werenegative for detection of high-risk HPV by PCR. In this 1case (100% positive cells for p16), high-risk HPV type 33was detected, and this case also showed weak positivity ofHPV type 18.

In short, we believe this study shows that CAMSG isa distinct tumor entity that differs from PLGA by location(ie, most often arising on the tongue), cytology, histologicarchitecture, and behavior, with frequent metastases at thetime of presentation of the primary tumor.

ACKNOWLEDGMENTSThe authors acknowledge the following pathologists

for submitting cases for consultation: Dr Brigid Maguire,Ashford, England; Dr John Bridger, Torquay, England; DrTimothy Bracey, Truro, England; Dr Veres, Bratislava,Slovakia; Dr Zamecnık, Trencın, Slovakia; Dr Berouskova,Kladno, Czech Republic; Dr Curık, Plzen, Czech Republic;and Dr Pavlovsky, Most, Czech Republic.

REFERENCES1. Batsakis JG, Pinkston GR, Luna MA, et al. Adenocarcinomas of

the oral cavity: a clinicopathologic study of terminal ductcarcinomas. J Laryngol Otol. 1983;97:825–835.

2. Castle JT, Thompson LD, Frommelt RA, et al. Polymorphous lowgrade adenocarcinoma: a clinicopathologic study of 164 cases.Cancer. 1999;86:207–219.

3. Cleveland DB, Cosgrove MM, Martin SE. Tyrosine-rich crystalloidsin a fine needle aspirate of a polymorphous low grade adenocarci-noma of a minor salivary gland. Acta Cytol. 1994;38:247–251.

4. Colmenero CM, Patron M, Burgueno M, et al. Polymorphous low-grade adenocarcinoma of the oral cavity: a report of 14 cases. J OralMaxillofac Surg. 1982;50:595–600.

5. Crocker TP, Kreutner A, Othersen HB, et al. Papillary adenocarci-noma of minor salivary gland origin in a child. Arch Otolaryngol.1983;109:827–831.

6. Del Vecchio M, Foschini MP, Peterse JL, et al. Lobular carcinoma ofthe breast with hybrid myoepithelial and secretory (“myosecretory”)cell differentiation. Am J Surg Pathol. 2005;29:1530–1536.

7. Ellis GL, Auclair PL. Polymorphous low-grade adenocarcinoma. In:Ellis GL, Anclair PL, eds. AFIP Atlas of Tumor Pathology, FourthSeries, Fascicle 9. Tumors of Salivary Glands. Silver Spring,Maryland: ARP Press; 2008:246–259.

8. Etges A, Nunes FD, Ribeiro KC, et al. Immunohistochemicalexpression of retinoblastoma pathway proteins in normalsalivary glands and in salivary gland tumours. Oral Oncol. 2004;40:326–331.

9. Evans HL, Batsakis JG. Polymorphous low-grade adenocarcinomaof minor salivary glands: a study of 14 cases of a distinctiveneoplasm. Cancer. 1984;53:935–942.

10. Evans HL, Luna MA. Polymorphous low-grade adenocarcinoma: astudy of 40 cases with long-term follow up and an evaluation of theimportance of papillary areas. Am J Surg Pathol. 2000;24:1319–1328.

11. Freedman PD, Lumerman HG. Lobular carcinoma of intraoralminor salivary gland origin: report of twelve cases. Oral Surg OralMed Oral Pathol. 1983;56:157–166.

12. Karlsen F, Kalantari M, Jenkins A, et al. Use of multiple PCRprimer sets for optimal detection of human papillomavirus. J ClinMicrobiol. 1996;34:2095–2100.

13. Kazakov DV, Nemcova J, Mikyskova I, et al. Human papilloma-virus in lesions of anogenital mammary-like glands. Int J GynecolPathol. 2007;26:475–480.

14. Luna MA. Controversial salivary gland lesions. Pathologica. 2005;97:61–64.

15. Luna MA, Wenig BM. Polymorphous low-grade adenocarcinoma.In: Barnes EL, Eveson JW, Reichart P, et al, eds. World HealthOrganization Classification of Tumours. Pathology and Genetics ofHead and Neck Tumours. Lyon: IARC Press; 2005:223–224.

16. Michal M, Skalova A, Simpson RHW, et al. Cribriform adeno-carcinoma of the tongue: a hitherto unrecognized type ofadenocarcinoma characteristically occurring in the tongue. Histo-pathology. 1999;35:495–501.

17. Parrett TJ, Prasad AR, Raslan WF, et al. Long term and life-longfollow-up in polymorphous low grade adenocarcinoma. ModPathol. 2002;15:223A. (Abstract).

18. Patel RS, Rose B, Bawdon H, et al. Cyclin D1 and p16 expression inpleomorphic adenoma and carcinoma ex pleomorphic adenoma ofthe parotid gland. Histopathology. 2007;51:691–696.

19. Perez-Ordonez B, Linkov I, Huvos AG. Polymorphous low-gradeadenocarcinoma of minor salivary glands: a study of 17 cases withemphasis on cell differentiation. Histopathology. 1998;32:521–529.

20. Prasad KC, Kaniyur V, Pai RR, et al. Pedunculated cribriformadenocarcinoma of the base of the tongue. Ear Nose Throat J.2004;83:62–64.

21. Raubenheimer EJ, Van Heerden WFP, Thein T. Tyrosine-richcrystalloids in a polymorphous low-grade adenocarcinoma. OralSurg Oral Med Oral Pathol. 1990;70:480–482.

22. Seethala RR, Johnson JT, Barnes EL, et al. Polymorphous low-grade adenocarcinoma: the University of Pittsburgh Experience.Arch Otolaryngol Head Neck Surg. 2010;136:385–392.

23. Shousha S, Knee G. In-situ lobular/myoepithelial neoplasia of thebreast. Histopathology. 2004;45:93–95.

24. Soares J, Tomasic G, Buciarelli E, et al. Intralobular growth ofmyoepithelial cell carcinoma of the breast. Virchows Arch. 1994;425:205–210.

25. Tamai M. Intraductal growth of malignant mammary myoepithe-lioma. Am J Surg Pathol. 1992;16:1116–1125.

26. Tieben LM, ter Schegget J, Minnaar RP, et al. Detection ofcutaneous and genital HPV types in clinical samples by PCR usingconsensus primers. J Virol Methods. 1993;42:265–279.

27. van den Brule AJ, Pol R, Fransen-Daalmeijer N, et al. GP5+/6+PCR followed by reverse line blot analysis enables rapid and high-throughput identification of human papillomavirus genotypes.J Clin Microbiol. 2002;40:779–787.

28. Yajima M, Yamazaki T, Minemura T, et al. Tubular adenocarci-noma of the apex of the tongue. J Oral Maxillofac Surg.1989;47:86–88.

Skalova et al Am J Surg Pathol � Volume 35, Number 8, August 2011

1176 | www.ajsp.com r 2011 Lippincott Williams & Wilkins