Plasmid 66 (2011) 136–143

Contents lists available at SciVerse ScienceDirect

Plasmid

journal homepage: www.elsevier .com/ locate /yplas

Constructions of expression vectors of polyhydroxybutyrate-co-hydroxy-valerate (PHBV) and transient expression of transgenes in immature oilpalm embryos

Norazrin Ariffin ⇑, Ruslan Abdullah, Mohd. Rashdan Muad, Juanita Lourdes, Nurul Ain Emran,Mohd Razi Ismail, Ismanizan Ismail, Mohd Fazli Mohd Fadzil, Kong Lih Ling, Yasmeen Siddiqui,Anna Aryani Amir, Zulkarami Berahim, Mohd. Husni OmarLaboratory of Food Crops and Floriculture, Institute of Tropical Agriculture, Universiti Putra Malaysia, 43400 Serdang, Selangor, MalaysiaSime Darby R and D Centre, Plantation Research, 42700 Banting, Selangor, MalaysiaUniversiti Kebangsaan Malaysia, School of Bioscience and Biotechnology, Faculty Science and Technology, 43600 Bangi, Selangor, Malaysia

a r t i c l e i n f o

Article history:Received 14 April 2011Accepted 18 July 2011Available online 2 August 2011Communicated by Ananda Chakrabarty

Keywords:PHBVPlasmid constructionTransgenesAgrobacterium tumefaciensOil palmTransformation

0147-619X/$ - see front matter � 2011 Elsevier Incdoi:10.1016/j.plasmid.2011.07.002

⇑ Corresponding author at: Laboratory of Food CrInstitute of Tropical Agriculture, Universiti PutSerdang, Selangor, Malaysia. Fax: +60 3 89468968.

E-mail addresses: norazrin@putra.upm.eduyahoo.com (N. Ariffin).

a b s t r a c t

Polyhydroxybutyrate-co-hydroxyvalerate (PHBV) is a polyhydroxyalkanoate (PHA) bio-plastic group with thermoplastic properties is thus high in quality and can be degradable.PHBV can be produced by bacteria, but the process is not economically competitive withpolymers produced from petrochemicals. To overcome this problem, research on trans-genic plants has been carried out as one of the solutions to produce PHBV in economicallysound alternative manner. Four different genes encoded with the enzymes necessary tocatalyze PHBV are bktB, phaB, phaC and tdcB. All the genes came with modified CaMV35S promoters (except for the tdcB gene, which was promoted by the native CaMV 35S pro-moter), nos terminator sequences and plastid sequences in order to target the genes intothe plastids. Subcloning resulted in the generation of two different orientations of the tdcB,pLMIN (left) and pRMIN (right), both 17.557 and 19.967 kb in sizes. Both plasmids weretransformed in immature embryos (IE) of oil palm via Agrobacterium tumefaciens. Assaysof GUS were performed on one-week-old calli and 90% of the calli turned completely blue.This preliminary test showed positive results of integration. Six-months-old calli were har-vested and RNA of the calli were isolated. RT-PCR was used to confirm the transient expres-sion of PHBV transgenes in the calli. The bands were 258, 260, 315 and 200 bp in size forbktB, phaB, phaC and tdcB transgenes respectively. The data obtained showed that the bktB,phaB, phaC and tdcB genes were successfully integrated and expressed in the oil palmgenome.

� 2011 Elsevier Inc. All rights reserved.

1. Introduction one of its components. PHA is highly prized due to its high

Bioplastic is a natural biopolymer that can be degradedby microorganisms and polyhydroxyalkanoates (PHA) is

. All rights reserved.

ops and Floriculture,ra Malaysia, 43400

.my, azrinariffin@

value in commerce, industry and medicine. Some bacteriaunder restricted growth conditions can produce PHA as theirstorage material (Senior and Dawes, 1973). The first produc-tion of PHA polymer-accumulating bacterium Ralstoniaeutropha was done by Imperial Chemical Industry (ICI) as re-ported by Somerville et al. (1994). Polyhydroxybutyrate(PHB) is one of the PHA polymers and is commonly synthe-sized by bacteria as a storage material. Successful produc-tion of polyhydroxybutyrate-co-hydroxyvalerate (PHBV)

N. Ariffin et al. / Plasmid 66 (2011) 136–143 137

was achieved through pathway manipulation by supple-menting the fermentation medium with propionate.

Through genetic engineering, plants could be the an-swer for large-scale PHA production. Transgenic plantssuch as Arabidopsis (Poirier et al., 1992; Nawrath et al.,1994; Bohmert et al., 2000), tobacco (Arai et al., 2001;Bohmert et al., 2002), and rape (Houmiel et al., 1999) areable to produce PHB. The abundance of acetyl-coA inplastids has been an advantage as it is the first precursorthat can undergo the sequential series of enzymatic reac-tions for the production of PHB.

The biosynthesis of PHBV requires four different genes,including the three genes that can be found in the biosyn-thesis of PHB pathway, phbA, phbB and phbC, which encodefor 3-kethothiolase, acetoacetyl-coA reductase and phbsynthase, respectively. The fourth gene responsible forthe production of PHBV is tdcB or ilvA encoding for threo-nine deaminase. These enzymes convert threonine to2-kethobutyrate. In the 1980s, Imperial Chemical Indus-tries (ICI) started the production of PHBV by bacterialfermentation of Ralstonia eutropha (Anderson and Dawes,1990). Although the production could be done by bacteria,the cost is still high (RM 0.25–0.5 kg�1) due to the use ofpropionate as the starting material and this made it unfea-sible to be commercialized (Proirier, 2002).

Oil crops such as oil palm were chosen as a potentialtarget for the production of PHBV due to its high flux ofacetyl-coA (Reddy et al., 2003). Omidvar et al. (2008) re-ported the expression of PHB genes regulated by oil palmmesocarp-specific promoter by transient assay. Parveezet al. (2008) reported successful transformation events ofPHB and PHBV genes driven by maize ubiquitin promoterin the oil palm embryogenic calli. A number of successfulexperiments involving foreign genes in oil palm tissues inthe production of PHBV promise a good future for the pro-duction of PHBV in oil palm plants.

In this study, two PHBV expression vectors were con-structed for the transgene expression in the embryogeniccalli of oil palm. Each vector carrying the four different

Fig. 1. Schematic diagram of (a) pJLPHB3 plasmid construct consisting three caplasmid. Both plasmids which have the same restriction site of HindIII were dig

transgene cassettes of phbA, phbB, phbC and tdcB and weredriven by the modified and native CaMV 35S promoters.Consequently, the PHBV genes biosynthetic pathways weretransiently evaluated in the embryogenic calli of oil palm.

2. Materials and methods

2.1. Expression vector and bacterial strains

The experiment was conducted in the MolecularBiology Laboratory, Faculty of Science and Technology,National University of Malaysia.

The plasmids used in this experiment were as follows:pMR 109 plasmid (4.8 Kb, constructed by Rashdan) con-sisting of a tdcB transgene cassette driven by the nativeCaMV35S promoter and pJLPHB3 carrying three transgenecassettes (bktB, phaB and phaC) driven by a modifiedpromoter of CaMV35S, GUS and hygromicin sites (Juanita).All transgene cassettes consisted of a promoter, flanked bya plastid targeting sequence and a NOS terminator. Bothplasmids (Fig. 1) were digested and ligated at the sameHindIII site.

The resulting plasmids, pRMIN (19.967 kb) and pLMIN(17.557 kb) consists of all four PHBV transgene cassettes.The difference in both plasmids is the orientation of thetdcB transgene cassette (Fig. 2). Isolation of plasmids wasperformed by alkaline lysis (Birnboim and Doly, 1979).Both plasmids were transformed into Escherichia coli strainDH5a competent cells (prepared using the rubidiumchloride method) prior to transformation into the Agrobac-terium tumefaciens competent cells (prepared by calciumchloride).

2.2. Establishment of immature embryos of oil palm andtransformation by A. tumefaciens

Elaieiss guineensis oil palm fruit samples at 12 weeksafter anthesis were obtained from Malaysian Palm Oil

ssettes of phaB, phaC and bktB transgenes (b) tdcB transgenes in pMR109ested and ligated.

Fig. 2. pRMIN and pLMIN plasmids showing different orientations of tdcBtransgenes cassette.

Table 1Primers for detection of PHBV genes.

Primers Genes Nucleotide sequence (50–30) PCRproduct(bp)

Set IRphaB phaB GACTCCTCCGACGACAACCAG 260FphaB ACCAACTACTCCACCGCCAAG

Set 2RphaC phaC CACCGTATGTCCCTGCTCCACFphaC ATGTCGCCCGCCAACTTCC 315

Set 3RBktB bktB CACAGGCGGTTCACGGTCAG 258FBktB AAGTGGTAGTGGTAAGCGGTGTC

Set 4RTdcB tdcB CGGGCGGGAGACATCACAAC 200FTdcB TGGAGGTTTAATTGCTGGTATTGC

Set 5NAD5R1 nad5 ATCACCGAACCTGCACTCAGGAA 832NAD5F1 TAGCCCGACCGTAGTGATGTTAA

138 N. Ariffin et al. / Plasmid 66 (2011) 136–143

Board (MPOB). The fruit was immersed in water anddropped with Tween� 20. The sample was sterilized in100% (v/v) ethanol and dried in laminar flow. The isolatedembryo was cultured into N6OPS for callus formation. Onemilliliter of A. tumefaciens culture containing recombinantplasmids pRMIN and pLMIN was inoculated into 60 mlLB-G before incubation at 28 �C for 4 h. The culture wasdissolved in N66 solution. The immature embryos (IEs)were transferred into the bacteria culture to induce infec-tion. The mixture was cultured onto N6OPS agar againfor 3 days and subcultured onto new agar with an additionof cefotaxime (25 lg/ml) for callus formation.

2.3. GUS assays and transformation frequency

Putative transformants were stained in the GUS assaybuffer (0.062 M Na2HPO4.2H2O, 0.038 MNaHPO2.H12O2,0.001 M K3[Fe(CN6)], 0.001 M K4[Fe(CN6)], 0.01 EDTA,0.1% Triton X-100, 20% (v/v) methanol, 100 mg X-Gluc) at37 �C for 16 h.

2.4. RNA preparation and RT-PCR analysis of PHBV transgenes

Total RNA, intact and with high integrity is necessaryfor the next portion of transgene expression analysis (re-verse transcriptase-polymerase chain reaction). Total RNAwas prepared using RNeasy Plant Minikit (Qiagen,Germany). Isolated RNA was within range of 1.78–1.95 atwavelengths of A260/280 in a spectrophotometer. TheRNAs were then converted to cDNAs using Quantitect�

Reverse Transcription (Qiagen, Germany).The expressions of PHBV transgenes in the genome was

verified by RT-PCR performed by Master Cycler

(Eppendorf). Total reactions of 25 ll comprised of DNA(�200 ng), 1� PCR buffer (Takara, Japan), 1.0 lM of eachprimer (as listed in Table 1), 0.2 mM of DNTPs (Takara,Japan), 1.5 mM MgCl2 (Biotools), 0.2 U Taq DNA Polymer-ase (1 U/lL) (Takara, Japan) and sterilized water. The PCRwas programed for: 95 �C for 5 min for denaturation ofthe DNA template, 25–30 cycles of 30 s of denaturation,1 min of an annealing at 58 �C (for the amplification of tdcBgene) and 60 �C (for amplification of phaB, phaC and bktBgenes), and the extension step for 1 min at 72 �C forpolymerization. The DNA fragments were observed onthe electrophoresis gel.

3. Results

3.1. Large DNA size cloning strategy, transformation andputative transformants bacteria confirmation

Four genes (bktB, phaB, phaC and tdcB) in one vectorwere required to produce PHBV. The subcloning processresulted in the generation of two different orientations ofthe tdcB, which was left, (named pLMIN) 17.557 kb in sizewhereas the right (pRMIN) was 19.967 kb in size. Both se-lected clones were screened with HindIII and reconfirmedby SpeI to check for the expected size of inserts (Fig. 3).

Modifications on both plasmids were done by eliminat-ing the antibiotic ampicillin site through digestion with anAvrII restriction enzyme. Two DNA fragments sized 20.44and 2.4 kb (Fig. 4) respectively were obtained. The priorDNA fragment consisting of four genes (bktB, phaB, phaCand tdcB) for PHBV production were isolated and purifiedprior to ligation.

The orientations of both plasmids were identified usingEcoRI restriction enzyme. Three DNA fragments sized11.387, 6.99 and 1.597 kb for pRMIN and three DNA frag-ments sized 11.387, 4.58 and 1.597 kb for pLMIN wereobtained after digestion.

Fig. 3. Selected clones screened with restriction endonuclease analysis (a) HindIII, (b) SpeI. Lane 1: k HindIII marker, Lane 10 & 11: 1 kb ladder. The sizes ofthe generated fragments were as predicted.

N. Ariffin et al. / Plasmid 66 (2011) 136–143 139

3.2. Transient analysis of GUS assays

Transient analysis of GUS histochemical assays wasdone about a week after the transformation event toconfirm the integration of PHBV genes. Prior to the trans-formation event, precultures of immature embryos wereperformed for 3–7 days on N6OPS. Even though the effec-tiveness of pre-culture on the transformation efficiency isstill uncertain, a high percentage of plant regeneration byprior pre-culture to Agrobacterium infection was reportedby Abdullah (2005). Apparently, oil palm tissues upon pre-treatments with 2,4-D can be made susceptible to Agrobac-terium infection (Abdullah, 2005). Gus assay on freshlyco-cultivated IEs showed uniform and well-spread Gusactivity as shown in (Fig. 5). An average of 90.9% and91.2% transformation frequencies (Table 2) were observedin this experiment. This provides initial information onsuccessfully transformed tissue. The ability of the abovetissues to express Gus activities after more than 4 months

of co-cultivation with both pLMIN and pRMIN plasmidsfurther indicates that the transgene has been integratedinto the genome of the putative transformants of oil palm.

3.3. Detection of PHBV transgene expressions via RT-PCRanalysis

RT-PCR analysis verified the expression of PHBV trans-genes. Purification of isolated RNA is determined usingRT-PCR with a pair of primers NAD5R1/NAD5F1 to nad5gene as the internal control (Fig. 6). The success of nad5amplification shows that the RNA isolated is purified andis qualified for the next RT-PCR for detection of PHBVtransgenes (Fig. 7) exhibits that the engineering of thePHBV pathway in immature embryos of oil palm has re-sulted in the successful expression of bktB, phaB, phaCand tdcB. The anticipated sizes of bktB, phaB, phaC and tdcBtransgenes amplified by the specific primers were 258,260, 315 and 200 bp (Fig. 8) respectively. No expression

Fig. 4. Modification on recombinant plasmids by digestion with AvrII restriction endonuclease. The 20.44 kb fragments were isolated and religated.

Fig. 5. GUS expression patterns after a week of the transformation events. (a) pRMIN transformed IE, (b) pLMIN transformed IE and (c) nontransformed IE.

140 N. Ariffin et al. / Plasmid 66 (2011) 136–143

of PHBV transgenes from the negative control of non-transformed oil palm tissues can be observed. This showedthat no endogenous genes were expressed and no faultexpression of the transgenes occurred.

4. Discussion

4.1. GUS expression analysis

This study was conducted to construct expression vec-tors of PHBV transgenes and to see the feasibility of its

expressions in the oil palm tissues. pRMIN (17.557 kb)and pLMIN (19.967 kb) were successfully cloned in Agro-bacterium LBA4404 and were later transformed into theoil palm immature embryos. Before the transformationevents took place, the immature embryos were culturedonto the N6OPS medium that contain a special formulationof nutrients and growth hormone, 2,4-D for 7–14 weeks.According to Abdullah (2005), a high percentage of plantregenerations could be gained through transformationusing pre-cultured oil palm embryos.

2,4-D acts as growth regulator for the immature em-bryos to divide more actively while the charcoal functions

Table 2Frequencies of transient transformation in both pLMIN and pRMINtransformed IEs of oil palm.

Experiment IE AssayedIE

PositiveGUS assay

Transienttransformationfrequencies

pLMIN (1) 310 31 28 90.3pLMIN (2) 300 30 29 96.7pLMIN (3) 280 28 24 85.7

Average = 90.9pRMIN (1) 290 29 26 89.6pRMIN (2) 320 32 30 93.7pRMIN (3) 310 31 28 90.3

Average = 91.2

N. Ariffin et al. / Plasmid 66 (2011) 136–143 141

to neutralize the phenolic compounds that arise from thewounded tissues of oil palm. Immature embryos start tobud after 7 days of the pre-culture events. Those embryoswere used for the transformation process, to ease thegeneration of the oil palm callus.

After a month of transformations, a transient analysis ofGUS was performed to validate the genes transfer and thusto see the transformation frequency. GUS assays on pRMINand pLMIN from freshly co-cultivated immature embryosshowed uniform and well-spread blue immature embryos.The negative control exhibited no sign of GUS activity, asanticipated. 90.9% and 91.2% transformation frequencywere recorded for pLMIN and pRMIN co-cultivated tissuesof immature oil palm embryos. These percentages showedalmost no difference between the transformation fre-quency between pRMIN and pLMIN co-cultivated oil palmtissues. This suggests that there are no differences in theexpressions of PHBV although both plasmids were in dif-ferent positions in tdcB’s cassettes gene.

4.2. Analysis of PHBV transgene expressions through RT-PCR

rRNA represents 85% of total RNA and maintains theintegrity of certain RNA populations. However, mRNA,

Fig. 6. NAD Internal control of nad5 by RT-PCR analysis. Lane 1–3: pLMIN tr

which is a single-stranded molecule, is unstable and highlysusceptible to the degradation process. Thus, mRNA needsto be converted into a more stable, double-stranded mole-cule called cDNA prior to PCR analysis when a specificprimer is applied. The combination of both processes iscalled reverse transcription (reverse transcription-polymerasechain reaction). This method can detect low levels ofmRNA expression down to 1 pg, and is thus suitable foruse in detection of PBHV transgene expressions.

Before reverse transcription is performed, RNA is ap-plied with optimum DNAseI enzyme to eliminate the pres-ence of any possible genomic DNA. RT is performed usingRevertAid™ First Strand cDNA Synthesis (Fermentas).Oligo-dT primer is used because it can synthesize completea cDNA sequence from poly-A end if compared to inflexibleflanking performed by specific primers.

The amplification of cDNA by RT-PCR from putativetransformed callus RNA showed that transgenes bktB, phaB,phaC and tdcB have fragment sizes of 258, 260, 315 and200 pb respectively. The positive results of all transgenesshowed that modified regions of CAMV 35S have fewer re-peated sequences and can avoid deletion of transgenes inimmature transformed oil palm embryos. The negative re-sults of expression analysis from untransformed IEs sampleindicates the expression of PHBV transgenes and IEs oilpalm were the result of engineering PHBV transgenes.

Even though research on the presence and expression ofPHBV transgenes is transient, it is possible to test the effec-tiveness of vectors and promoters (Schenk et al., 1998).One of the most important elements is the selection of asuitable promoter. Examples of promoters usually used intransgenes expression are constitutive, tissue-specific,synthetic and induced (Roa-Rodriguez and Nottenburg,2003). CAMV 35S is already in use in expression vectorengineering, specifically to enhance PHB thermoplasticvalues in Linus usitassimum stem tissue transgenic plants(Bohmert et al., 2000; Wrobel et al., 2004, 2007). However,the modified CAMV 35S was used in this experiment

ansformed IEs, lane 4–6: pRMIN transformed IEs, lane 7: 1 Kb ladder.

Fig. 7. RT-PCR analysis of PHBV genes in nontransformed and transformed immature embryo of oil palm (a) bktB transgene (b) phaB transgene (c) phaCtransgene, lane 1: 1 Kb ladder, lanes 2–3: negative control and positive control from PJLPHB3 plasmid respectively, lanes 4–5: RT-PCR for pLMINtransformed IEs, lanes 6–7: RT-PCR for pRMIN transformed IEs.

Fig. 8. RT-PCR analysis of tdcB genes in nontransformed and transformed immature embryo of oil palm lane 1: negative control, lane 2: 1 Kb ladder, lanes3–4: positive control from pMR 109 plasmid, lanes 5–6: pLMIN transformed IEs, lanes 6–7: pRMIN transformed IEs.

142 N. Ariffin et al. / Plasmid 66 (2011) 136–143

needed much more energy to generate products compara-ble to tissue-specific promoters (Halfon et al., 1997).

Other factors that contribute to stable expressions ofPHBV transgenes in oil palm also need to be considered.The use of matrix attachment in tobacco (RB-MAR) (Allenet al., 1996; Yoshida and Shinmyo, 2002) and transforma-tion of foreign bacteria DNA (Fisk and Dandekar, 1993;

Miyasaka, 2002) have enabled transgenic plants to avoidthe deletion of transgenes.

The successful transformation and expression of PHBVtransgenes based on A. tumefaciens in immature oil palmembryos play an important role in generating transgenicplants. This is because the oil palm plant requires longgrowth time prior to harvesting. It is hoped that the results

N. Ariffin et al. / Plasmid 66 (2011) 136–143 143

from this experiment will initiate suggestions and ideas to-wards the generation of PHBV in transgenic oil palm.

5. Conclusions

In conclusion, the main goal of this project was success-fully achieved. Two plasmids, pRMIN (19.967 kb) andpLMIN (17.557 kb), differing in the tdcB orientations wereconstructed in line with the objective to express PHBV inimmature oil palm embryos. The construction process in-volved manipulations of three different cassettes of thegenes bktB, phaB and phaC, driven by modified CaMV35spromoters from pJLPHB3 and tdcB cassettes driven by na-tive CaMV35s promoters from pMR109. The orientationsand integrity of the four transgenes were confirmed bydigestion with restriction enzymes and PCR. Both plasmidsintroduced in A. tumefaciens act as mediators to allow thetransfer of PHBV transgenes. It was proven that bothplasmids were stable in the A. tumefaciens before beingtransferred into the oil palm genome. The expression ofbktB, phaB, phaC and tdcB could be observed after transfec-tion. It is hoped that these results will promote thisapproach to engineer the production of PHBV in oil palm.

References

Abdullah, R., 2005. A decade of oil palm gene manipulation. Where are wenow?. In: 9th International Conference on AgriculturalBiotechnology: Ten Years After. hlm, pp. 1–25.

Allen, G., Hall, C., Michalowski, G., Newman, S., Spiker, W., Weissinger, S.,Thompson, W.F., 1996. High level transgene expression in plant cells:effect of a strong scaffold attachment region from tobacco. Plant cell8, 899–913.

Anderson, A.J., Dawes, E.A., 1990. Occurence, metabolism, metabolic roleand industrial uses of bacterial polyhydroxyalkanoates. Microbiol.Rev. 54, 450–472.

Arai, Y., Nakashita, H., Doi, Y., Yamaguchi, I., 2001. Plastid targetting ofpolyhydroxybutyrate biosynthetic in tobacco. Plant Biotechnol. 18,289–293.

Birnboim, H.C., Doly, J., 1979. A rapid alkaline extraction procedure forscreening recombinant plasmid DNA. Nucleic Acid Res. 7, 1513–1523.

Bohmert, K., Balbo, I., Kopka, J., Mittendorf, V., Nawrath, C., Proirier, Y.,Tischendorf, G., Trethewy, R.N., Willmitzer, L., 2000. TransgenicArabidopsis plant can accumulate polyhydroxybutyrate to up to 4%of their weight. Planta 211, 841–845.

Bohmert, K., Balbo, I., Steinbüchel, A., Tischendorf, G., Willmitzer, L., 2002.Constitutive expression of the beta-ketothiolase gene in transgenicplants. A major obstacle for obtaining polyhdroxybutyrate-producingplants. Plant Physiol. 128, 1280–1290.

Fisk, H.J., Dandekar, A.M., 1993. The introduction and expression oftransgenes in plants. Sci. Hortic. (Amsterdam) 55, 5–36.

Halfon, M.S., Kose, H., Chiba, A., Keshishian, H., 1997. Targeted geneexpression without a tissue-specific promoter: creating mosaicembryos using laser-induced single-cell heat shock. Proc. Natl. Acad.Sci. 94, 6255–6260.

Houmiel, K.L., Slater, S., Broyles, D., Casagrande, L., Colburn, S., Gonzalez,K., Mitsky, T.A., Reiser, S.E., Shah, D., Taylor, N.B., Tran, M., Valentin,H.E., Gruys, K.J., 1999. Poly (b-hydroxybutyrate) production in oilseedleucoplasts of Brassica napus. Plant 209, 547–550.

Miyasaka, H., 2002. Translation initiation AUG context varies with codonusage bias and gene length in Drosophila melanogaster. J. Mol. Evol. 55,52–64.

Nawrath, C., Poirier, Y., Somerville, C., 1994. Targeting of thepolyhydroxybutyrate biosynthetic pathway to the plastids ofArabidopsis thaliana results in high levels of polymer accumulation.Proc. Natl. Acad. Sci. USA 91, 12760–12764.

Omidvar, V., Siti Nor Akmar, A., Marziah, M., Maheran, A.A., 2008. Atransient assay to evaluate the expression of polyhydroxybutyrategenes regulated by oil palm mesocarp-specific promoter. Plant CellRep. 27, 1451–1459.

Parveez, G.K.A., Bahariah, B., Nor Hanin, A., Masani, A.M.Y., Rasid, O.A.,Tarmizi, A.H., Zamzuri, I., Arif, M.A.M., Kushairi, A.D., York, G., Jo, Y.B.,Sinskey, A.J., 2008. Transformation of PHB and PHBV genes driven bymaize ubiquitin promoter into oil palm for the production ofbiodegradable plastics. Journal of Oil Palm Research 2, 77–86.

Poirier, Y., Dennis, D.E., Klomparens, K., Somerville, C., 1992.Polyhydroxybutyrate, a biodegradable thermoplastic, produced intransgenic plants. Science 256, 520–523.

Proirier, Y., 2002. Polyhydroxalkanoate synthesis in plants as a tool forbiotechnology and basic studies of lipid metabolism. Prog. Lipid Res.41, 131–155.

Reddy, C.S.K., Ghai, R., Kalia, V.C., 2003. Polyhydroxyalkanoates: anoverview. Bioresource Technol. 87, 137–146.

Roa-Rodriguez, C., Nottenburg, C., 2003. Agrobacterium-mediatedtransformation of plants. CAMBIA. <www.patentlens.net>.

Schenk, P.M., Elliott, A.R., Manners, J.M., 1998. Assessment of transientgene expression in plant tissues using the green fluorescent protein asa reference. Plant Mol. Biol. Rep. 16, 313–322.

Senior, P.J., Dawes, E.A., 1973. Biochem. J. 134, 225–238.Somerville, C., Nawrath, C., Proirier, Y., 1994. Processes for producing

polyhydroxybutyrate and related polyhydroxyalkanoates in theplastids of higher plants. United States Patent No. 5610041.

Wrobel, M., Zebrowski, J., Szopa, J., 2004. Polyhydroxybutyrate synthesisin transgenic flax. J. Biotechnol. 107, 41–54.

Wrobel, M., Zebrowski, J., Starzycki, M., Jan Oszmianski, J., Szopa, J., 2007.Engineering of PHB synthesis causes improved elastic properties offlax fibers. Biotechnol. Progr. 23, 269–277.

Yoshida, K., Shinmyo, A., 2002. Transgene expression systems in plant, anatural bioreactor. J. Biosci. Bioeng. 90, 353–362.