International Journal of Food Microbiology 146 (2011) 263–275

Contents lists available at ScienceDirect

International Journal of Food Microbiology

j ourna l homepage: www.e lsev ie r.com/ locate / i j foodmicro

Comparative transcriptome analysis of Lactococcus lactis subsp. cremoris strainsunder conditions simulating Cheddar cheese manufacture

Amel Taïbi a, Nassra Dabour a,b, Maryse Lamoureux c, Denis Roy a, Gisèle LaPointe a,⁎a STELA Dairy Research Centre, Institute of Nutraceuticals and Functional Foods, 2440 Hochelaga Blvd., Université Laval, Québec, QC, Canada G1V 0A6b Department of Dairy Science and Technology, Faculty of Agriculture, University of Alexandria, Alexandria, Egyptc Agropur, inc., 4700 Armand-Frappier St., St. Hubert, QC, Canada J3Z 1G5

⁎ Corresponding author. Tel.: +1 418 656 2131x4200E-mail address: gisele.lapointe@fsaa.ulaval.ca (G. LaP

0168-1605/$ – see front matter © 2011 Elsevier B.V. Aldoi:10.1016/j.ijfoodmicro.2011.02.034

a b s t r a c t

a r t i c l e i n f o

Article history:Received 23 July 2010Received in revised form 17 February 2011Accepted 26 February 2011

Keywords:Lactococcus lactis subsp. cremorisCheeseComparative transcriptome hybridizationCore transcriptomeRT-qPCR

Gene expression in response to technological variations can influence fermentation and flavor generation inCheddar cheese, and can vary from one lactococcal strain to another, perceived as differences in starterperformance. The aim of this studywas to determine the influence of cheese cooking temperature at 38 °C andsalting on the transcriptional profiles of four closely related strains of L. lactis subsp. cremoris under simulatedconditions of Cheddar cheese manufacture. Two responses could be distinguished, a core gene expression,corresponding to the common response of all strains and strain-specific response during the Cheddarsimulating process. For the core gene expression after heating of inoculated milk at 38 °C, two groups ofdifferentially expressed genes were identified: i) stress response and ii) carbohydrate and amino acidmetabolism. The response to combined stresses of heat, acid and salt resulted in: i) general decrease offunctions linked to cell division andmetabolism, ii) specific responses related to stress such as the induction ofgenes coding for chaperones and proteases and iii) expression of prophage lytic systems for certain strains.Strain-specific responses were mainly observed in three of the four tested strains. These responses were theinduction of genes related to osmotic stress or the release of CodY repression leading to the activation ofoligopeptide transporters as well as the bcaT gene, related to amino acid degradation for the production offlavor. Comparing transcriptomes provides a core expression profile that contributes to understanding geneexpression responses to environmental variations. The strain-specific responses identify predictive markersfor the transcriptional state of starter strains before they enter the cheese ripening phase.

; fax: +1 418 656 3353.ointe).

l rights reserved.

© 2011 Elsevier B.V. All rights reserved.

1. Introduction

Cheese is largely made by fermenting milk with lactic acid bacteria(LAB) added as starter cultures for acidification of milk or as adjunctcultures for the ripening process of cheese to achieve an attractive anddurable product (Marilley and Casey, 2004). Among LAB, Lactococcuslactis is the primary constituent of many industrial and artisanalstarter cultures used for the manufacture of different varieties ofcheeses. Processing steps of cheese making such as coagulation,acidification, heating, salting, and ripening, all affect the growth andperformance of lactococcal starters. Thus, successful cheese produc-tion depends on the characteristics of the strains belonging to thestarter culture (van Hylckama Vlieg et al., 2006). As the result of itstechnological ability, L. lactis has been the subject of numerous studiesto determine the main relevant characteristics useful for the selectionof the best strains for dairy applications (van Hylckama Vlieg et al.,2006). For the manufacture of Cheddar cheese, L. lactis subsp. cremoris

is preferred as strains belonging to this subspecies typically yieldcheese free of bitter flavors (Vedamuthu et al., 1966).

The diversity in characteristics of starter cultures has been stronglyreduced during the last years as a consequence of the need tostandardize product quality. However, a large strain-to-strain varia-tion still exists with respect to flavor formation and responses tocheese making stresses. Indeed, dairy lactococci undergo a variety ofstresses, including acid, temperature, and osmotic shocks duringcheese production (van de Guchte et al., 2002). Gene expression inresponse to technological variations can influence fermentation andflavor generation in cheese (Xie et al., 2004), and can vary from onestrain to another, leading to differences in starter performance.Lactococcal strains are characterized by significant polymorphism dueto genome organization and variations in gene expression, referred toas the transcriptome. Directly or indirectly, their metabolic productsinfluence a wide variety of textures, flavors and aroma of the finalproducts (Oberman and Libudzisz, 1998).

There are few comprehensive studies relating sequence variationto flavor production levels and genetic diversity to performance. Thedifferences in cheese flavor could be explained by the variations of thespecificity of the autolytic, lipolytic and proteolytic enzymes (Hickey

264 A. Taïbi et al. / International Journal of Food Microbiology 146 (2011) 263–275

et al., 2007; Wilkinson et al., 1994). For example, importantsequence variations occur among peptidase genes in L. lactis, but theeffect on enzyme activity was not determined (Mori et al., 2004). Ithas been demonstrated also that the amino acid sequence divergenceof the proteinase PrtP of L. lactis subsp. cremoris strains has aninfluence on its specificity for the cleavage of casein αS1, andconsequently, the accumulation of peptides and bitterness in Cheddarcheese (Broadbent et al., 2002; Exterkate et al., 1993).

The availability of a vastmolecular toolbox has opened new avenuesfor studying the natural diversity and the variability of response amonglactococcal strains. Currently, functional and comparative genomicanalyses are quickly exposing critical gene sets involved in functionalactivities and key performance. The advent of microarray technologyreveals a great deal about genetic stability, diversity (Bayjanov et al.,2009; Tan-a-ram et al., 2011) and expression (Dressaire et al., 2008;Redon et al., 2005b; Xie et al., 2004) among different strains oflactococci, as well as divulging specific responses in milk and cheese(Cretenet et al., 2011; Raynaud et al., 2005). We previously usedmicroarray-based comparative genomic hybridization (CGH) to inves-tigate genetic polymorphism and determine the minimal core ofcommon genes among L. lactis subsp. cremoris strains (Taïbi et al.,2010). The comparative genomic analysis showed that the majority ofchanges correspond to loss of plasmids and deletions of genomic areasamong strains. These gene profiles will strongly contribute to thedistinction between the strains by the identification of predictivemarkers which will allow a more informed strain selection. However,variation among strains may also be due to differential gene expressionof L. lactis subsp. cremoris.

The aim of this study was to investigate the transcriptionalresponses of four strains of L. lactis subsp. cremoris under simulatedconditions of Cheddar cheese manufacture. The results established acore gene expression and evidenced a strain-specific variation intranscriptional responses of L. lactis subsp. cremoris strains. This willcontribute to the development of tools for selecting strains exhibitingthe desired properties.

2. Material and methods

2.1. Bacterial strains and growth conditions

L. lactis subsp. cremoris SK11 was obtained from the NCIMBcollection (National Collection of Industrial, Marine and Food Bacteria,UK), and L. lactis subsp. cremoris E8S, HPS, and Wg2S were obtainedfrom the culture collection of NIZO (Netherlands Institute for DairyResearch). L. lactis subsp. cremoris strains were grown aerobically for15 h at 22 °C in 10 mL modified Elliker broth, composed of Ellikerbroth (Difco Laboratories, Sparks, MD, USA) supplemented with 0.5%yeast extract (Difco) and 0.08% Tween 80 (Sigma-Aldrich Canada Ltd,Oakville, ON, Canada). The second sub-cultures in Elliker broth servedas 1% (v/v) inoculum for 20 mL microfiltered, 3.25% milk fat (MF),homogenized milk (Natrel Inc., Longueuil, Quebec) which wasincubated for 15 h overnight prior to inoculating the Pearce activitytest.

2.2. Pearce activity test

The Pearce activity test (Feirtag and McKay, 1987; Sheehan et al.,2005) was used with additional modifications. The overnight milkcultures were used to inoculate 200 mL of the same type and batch ofmilk, whichwas then distributed into four 50 mL volumes for incubationin a water bath with the following temperature profile: 32 °C for 60 min(T1), increased to 38 °C over 30 min, held at 38 °C for 30 min (T2),decreased to 35 °C over 15 min and held at 35 °C for 210 min (T3).Finally, NaCl was added at T3 to obtain a final concentration of 4% (w/v)in the cheese curd and the incubation continued for 30 min at 35 °C (T4).Samples at T1, T2, T3 and T4 were collected for pH and viable bacterial

counts. Modified Elliker plates were spread-plated with ten-folddilutions in PBS and then incubated at 30 °C for 24 h. Samples for testingautolysis and for RNA extraction were collected after incubation at 32 °C(T1), after cooking at 38 °C (T2) and after salting (T4).

2.3. Measurement of strain autolysis

Autolysis of cultures during the modified Pearce activity test wasassessed as described previously (Wittenberger and Angelo, 1970) bymeasuring the activity of released intracellular lactate dehydrogenase(LDH) at T1, T2, and T4. Absorbance at 340 nmwasmeasured by usinga Thermo Spectronic HELIOS λ spectrophotometer and the resultswere expressed as LDH units/mL.

2.4. Extraction and purification of total RNA

The RNA was isolated at T1, T2, and T4 time points from twoindependent repetitions of the modified Pearce activity test. Twentymilliliters of cultures were stabilized by adding 2.5 mL of stoppingsolution (5% phenol at pH 4.6 and 95% ethanol) and incubation for10 minon ice. The sampleswere centrifuged (15 min, 8000×g and4 °C)and the pellets were washed twice with 2% (w/v) trisodium citratesolution. The cells were resuspended in 500 μL of 20% sucrose solutioncontaining 30 μg lysozyme (Sigma-Aldrich) and incubated 1 h at 37 °C.Acid phenol extractionwas then performed and followedby chloroformextraction. The RNAwas precipitated by addition of 1/10 volume of 3 Msodium acetate (pH 4.8) and two volumes of ethanol (4 °C) to theaqueous phase. After incubation at −20 °C for 2 h, the RNA wascollected by centrifugation at 20,000×g for 30 min at 4 °C, washedbriefly with 70% ethanol, and suspended in 100 μL of Rnase freesterilized water (Invitrogen Life Technologies, Carlsbad, CA, USA). RNAconcentration was quantified with a NanoDrop ND-1000 spectropho-tometer (NanoDrop Technologies, Wilmington, DE) and the RNAintegrity was estimated using the Agilent 2100 Bioanalyzer (AgilentTechnologies, Palo Alto, CA, USA).

2.5. Microarray analysis

A DNA microarray was designed based on the published L. lactissubsp. cremoris SK11 genome sequence (Makarova et al., 2006). Thedesign criteria and fabrication of the 60-mer oligonucleotidemicroarrayhas been described previously (Taïbi et al., 2010) with a total of 2566oligonucleotide probes. Out of these, 2540 probeswere specific for 1030gene targets annotated as having roles in lactococcal general metabo-lism (Makarova et al., 2006), while eight oligonucleotide probes werespecific for seven lactococcal bacteriophage genes (Genbank accessionno. AF011378, AF242738, AF323668, C2PVCG, DQ227763, DQ227764.1and L33769). The remaining eighteen probes included nine positivecontrol probes designed to detect spiked Arabidopsis thaliana genes(rbcL, RCP1 and ppKase), and eight negative control probes (five probesdesigned from Mus musculus and Bos taurus genes Hdac2, ARPc5 andGAPD and three probes specific for LLB and LysN genes from Escherichiacoli). All designed array probes in this study were printed by Agilent(Agilent Technologies, Palo Alto, CA, USA) with four repetitions usingthe 2×11 K format of two arrays per slide, each array containing 10,808features (4×2566 probes plus 544 spots reserved for Agilent's qualitycontrols).

Prior to cDNA synthesis, 20 μg of total RNA and 1.5 μg of randomhexamer oligonucleotides (Invitrogen) were heated at 70 °C for 5 min.RNA was reverse transcribed using SuperScript III reverse transcriptase(1600 U, Invitrogen) in the presence of dNTPs, one aminoallyl-modifiedand one aminohexyl-modified nucleotides (Invitrogen) at 46 °C for 3 h.After cDNA synthesis, the hydrolysis reaction was performed by theaddition of 1 MNaOH (10 min at 70 °C) to degrade the original RNA andthe reaction was neutralized with 1 M HCl. The first-strand cDNA wasthen purified using QIAquick PCR purification columns (Qiagen,

265A. Taïbi et al. / International Journal of Food Microbiology 146 (2011) 263–275

Mississauga, ON, Canada) according to the manufacturer's instructions.The cDNA was dried 30 min at 30 °C in a speed vac (Eppendorf,Vacufuge™, Westbury, NY, USA) until the volume was reduced to 3 μLand labeled using SuperScript™ Plus Indirect cDNA Labeling System kit(Invitrogen) following the manufacturer's instructions.

Labeled cDNA was purified using QIAquick PCR Purificationcolumns (Qiagen). A total of 700 ng of labeled cDNA was suspendedin hybridization buffer, denatured and hybridized for 17 h at 65 °Caccording to the Agilent protocol. The slides were washed andscanned with a Chipreader laser scanner (BioRad, Mississauga, ON,Canada). Average signal of probes and replicates was calculated usingBRB ArrayTools (Simon et al., 2007). Hybridization signals were thennormalized on the sample average for all genes with AMADA (Xia andXie, 2001). The statistical significance of changes in gene expressionamong strains and conditions was determined by SAM analysis(Significance of Microarrays), with a FDR of 1% (Saeed et al., 2003),using TMev software (Saeed et al., 2003).

2.6. PCR conditions and DNA sequencing

PCR was performed with primers designed for 16 genes (Table 1)related to different functional operons of L. lactis subsp. cremoris SK11sequence using Primer Express® software version 2.0 (Applied Biosys-tems Technologies, Streetsville, ON, Canada). Target genes wereamplified using the chromosomal DNAof the four L. lactis subsp. cremorisstrains as template. The PCR products were purified and the automatedDNA sequence analysis was carried as described by Taïbi et al. (2010).

2.7. Reverse-transcription quantitative real-time PCR (RT-qPCR)

The RT-qPCR primers were designed using Primer Express®software version 2.0 (Applied Biosystems) on the basis of the

Table 1Primers used for RT-qPCR with RNA from L. lactis subsp. cremoris strains.

Gene Locus tag Sequence 5′–3′ Tm(°C)

Amplicon(b)

atpDa LACR_1933 GAGTACGTTCCCCAACACCTG 58 104TGGTGCCGGTGTTGGTAAA 59

tuf a LACR_2054 CGTTCGATACGTCCTGAAGCA 60 101CCAACTCCAGAACGCGACA 59

rpoAa LACR_2375 CACGGGCAGGTTCAACTTG 59 108TTCCGGCTGACGAAAATAAAG 58

16S rRNAa LACR_r0552 ATGGTTGAGCCACTGCCTTT 58 103GCCGCGGTAATACGTAGGTC 58

bcaTb LACR_1409 ACTGTTGGTCCCACTTCTGTTTCA 58 99GGCTTGTGGAACGGCAGCAATTAT 60

clpEb LACR_0578 CGTGGACAATTTGAAGAACGG 59 110GCAGAACCAGCACCGACAA 59

dnaGb LACR_0570 ATGGAAACTGGGCGGATTC 58 112TCATTGGCGCAATCTGCTC 59

gapAb LACR_0580 CAGTTATTTCTGCCGGTTCTTG 58 92CATTGTCCCACCTTTAACACCA 58

glyAb LACR_0617 CACCTTGCGTTCCAGGGA 59 91TTAAGAGGCCCACGCGGT 60

groELb LACR_0440 GTTGATGGAGAAGCATTGCCA 60 105TTGAGCTTTACGGCGGTCA 59

ldhb LACR_1455 GCGTGTGACCAAACAGCAAA 58 102TCGTCAAGCATTGGCTGAAA 58

oppAb LACR_D17 CTTGTTTATGCGGCTCGTGTAG 59 91TCACTTTTACCCCAATTTTCTTCC 59

pepQb LACR_1813 GGCGGCTATGCATCTGATG 59 101GCCGCTTGTTGTGCCTCTT 60

purDb LACR_1601 ACTCCCCAGTCCCTCACCTT 58 153TTGTCTTGACCCCATCTGCTG 60

holin1b LACR_1755 TGTTATTTTAATCAACAACTTGCTGC 59 73CAACAACTCCAACAATTGCTAATAG 59

holin2b LACR_2088 AAAGCTTCTGACGCTGACCAC 58 94TGCCTTTTCGTGCTTGCAT 59

a Reference genes.b Target genes.

consensus regions of each of the sequences from the 16 genes of thetested lactococcal strains (Table 1). cDNA was synthesized using theSuperScript III First-Strand synthesis system (Invitrogen) as describedabove, but with dNTP instead of amino modified nucleotides.Amplification was performed in a 7500 Real Time PCR Systemapparatus (Applied Biosystems) in triplicate for each sample usingDNA SYBR®Green PCR Master Mix 1× (Roche Diagnostics, Laval, QC,Canada), 1 μL of cDNA dilutions and 5 μM of each primer in a finalvolume of 25 μL. PCR amplification was initiated at 95 °C for 3 minfollowed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min.Fluorescence due to the binding of the SYBR Green to double-stranded DNA was measured at each cycle. The threshold cycle value(Ct) was obtained by automatic positioning of the threshold baselineat the mid-exponential phase of the curve. Melting curve analysis wascarried out to confirm primer specificity by the absence of secondaryamplification products. Primer efficiency was calculated using theExcel based DART-PCR program (Peirson et al., 2003). For datanormalization, the stability of the reference genes (atpD, rpoA, tuf and16S rRNA) was evaluated under the experimental conditions testedusing geNorm (Vandesompele et al., 2002). The 32 °C condition wasassigned as the reference sample for calculating relative geneexpression using the comparative method as described previously(Livak and Schmittgen, 2001). Statistical significance was determinedby random permutations (50,000) performed with the REST 2005software (Pfaffl et al., 2002).

3. Results and discussion

3.1. Growth and acidification profiles

The modified Pearce activity test was used to determine thegrowth and activity of the four strains of L. lactis subsp. cremoris(SK11, E8S, HPS, and Wg2S) during milk fermentation undersimulated conditions for Cheddar cheese making. In this study, nodifferences in acidification rates were observed among the strainsover the first 3.5 h of the Pearce activity test (Fig. 1). Temperatureupshift to 38 °C during the Pearce test did not affect the growth of thecultures; only E8S and SK11 showed weak deceleration in growthcompared to 32 °C (step T0 to T1; Fig. 1). The variation in temperaturewas progressive over 30 min allowing adaptation of cells. Franks et al.(1980) also did not observe a decrease in growth rate during the first60 min of temperature upshift from 30 to 38 °C for strain HP in non-buffered M17 medium containing glucose. In our study, thetemperature downshift to 35 °C allowed an increase in growth rate,also in accordance with the results of Franks et al. (1980).

As expected, the addition of NaCl (4% w/v) at the end of the Pearceactivity test had a negative effect on acidification and growth of thefour strains (Fig. 1). In the case of SK11, HPS and Wg2S, the viablecount decreased by about 30%, while the E8S population declined byabout 20%. This variation in population was probably not the result ofautolysis, as LDH activity released into the supernatant was below0.01 LDH units/mL in all samples (data not shown). The decrease inviable cell count can be attributed to the accumulation of cells that arecatabolically and/or anabolically inactive and thus unable to multiply(Franks et al., 1980). According to these data, only slight phenotypicvariation was observed among the strains, so the transcriptionalprofiles will givemore information about the common strain responseduring cheese manufacture.

3.2. Comparison of gene expression profiles of L. lactis subsp. cremorisstrains at 32 °C

In milk as opposed to rich medium, L. lactis orients proteinsynthesis towards the activities of degrading milk proteins throughproteolysis and peptidolysis, producing amino acids and otherprecursors which will fulfill such needs as purine biosynthesis,

6.46.3 5.9

4.7 4.6

3.0

4.0

5.0

6.0

7.0

0 60 120 345 375

pH

Lo

g C

FU

/ml

Time (min)

E8S

35 C32 C

38 C

T0 T1 T2 T3 T4

NaCl10

9

8

7

6

5

6.36.1 5.7

4.64.6

3.0

4.0

5.0

6.0

7.0

0 60 120 345 375

pH

Lo

g C

FU

/ml

Time (min)

SK11NaCl

35 C32 C

38 C

T0 T1 T2 T3 T4

10

9

8

7

6

5

6.5 6.36.0

4.7 4.7

3.0

4.0

5.0

6.0

7.0

0 60 120 345 375p

H

Lo

g C

FU

/ml

Time (min)

HPS

35 C32 C

38 C

T0 T1 T2 T3 T4

NaCl10

9

8

7

6

5

6.4 6.25.9

4.84.7

3.0

4.0

5.0

6.0

7.0

0 60 120 345 375

pH

Lo

g C

FU

/ml

Time (min)

Wg2S

35 C32 C

38 C

T0 T1 T2 T3 T4

NaCl10

9

8

7

6

5

°°

°

°

°

°

°°

°

°

°

°

Fig. 1. Growth (lines with symbols) and acidification (histograms) of L. lactis subsp. cremoris strains during the Pearce activity test.

266 A. Taïbi et al. / International Journal of Food Microbiology 146 (2011) 263–275

according to proteomic analysis (Gitton et al., 2005), as nucleotidesare required for growth in milk. The expression of genes from thesecategories indicates that this adaptation has already been initiateddue to the initial preculturing and incubation in milk. At the start ofthe simulation of Cheddar cheese conditions, the transcriptomeprofiles of the four lactococcal strains were rather comparable. At32 °C, SAM identified 21 genes out of 1037 on the array that showvariable expression among strains (Supplementary data, Table S1).This total does not include genes previously identified as absent in oneor more of the strains by comparative genomic hybridization (CGH)(Taïbi et al., 2010). In addition to the genes identified by CGH, themost relevant difference between the strains at 32 °C was the lowerexpression of the oligopeptide transport genes (optCDF) in strain SK11only, indicating active CodY repression due to the branched chainamino acid pool in the cell. These genes could be selected as markers,as their expression increases in the same strain after heating butdecreases in all strains after salting (see below).

Table 2Number of genes differentially expresseda for four L. lactis subsp. cremoris strainsduring the Pearce activity test.

Strain 38 °C NaCl

Total Increase Decrease Total Increase Decrease

SK11 18 (1.7%)b 14 4 70 (6.7%)b 39 31E8S 18 (1.7%)b 8 10 46 (4.4%)b 25 21HPS 12 (1.1%)b 8 4 53 (5.1%)b 27 26Wg2S 16 (1.5%)b 12 4 41 (3.9%)b 20 21

a Genes were identified using significance analysis of microarray (SAM) with aFDRb1%.

b Percentages in parentheses were calculated on the basis of 1037 genes on themicroarray.

3.3. Core transcription response of L. lactis subsp. cremoris strains tosimulated Cheddar cheese making conditions

A total of 189 genes (18.3%), were differentially expressed in one ormore of the four strains during milk fermentation in response toconditions simulating Cheddar cheese making. In total, 57 genes (39induced and 18 repressed) after heating (T2=38 °C) and 153 genes (84induced and 69 repressed) after salting exhibited significant (Pb0.05)differential expression compared to the control condition of 32 °C. Thesetotal gene numbers represent 5.5% (T2=38 °C) and 14.9% (T4=salt) ofthe probes present on the array (Table 2). The total number ofresponding genes at T4 (after salting) was higher than at T2 (afterheating), which suggests that all the strains responded to thecumulative stress of temperature, acid, salt and growth phase. At thisstage, the pH had reached 4.7, which is much lower than usual forCheddar cheese curds (pH 5.2), but that is due to the high initialinoculum. At this pH, cellular growth is reduced, and gene transcriptionchanges due to cumulative stress responses (Rallu et al., 2000).Comparing transcriptomes of strains provides a perspective on coreexpression programs that could be used in adapting to environmentalstimuli during cheese manufacture. The strain-specific responses given

by the transcriptomic data allow the identification of gene markers fordistinguishing between the responses of starter strains.

A large number of the common genes that were downregulated inresponse to the temperature upshift had annotated functions in energyproduction and sugarmetabolism(CandG categories),whereasmost ofthe upregulated genes during this periodwere involved in oligopeptideand amino acid transport and metabolism (E) as well as genetranscription and translation (J and K categories) (Table 3 and Fig. 2).The cumulative effect of stress after the salting stage affected the globalresponse of the lactococcal strainsmore than heating alone. A cluster oforthologous groups (COG) of commonly expressed genes indicate thatthemajority belonged tometabolismandcellular processes (Table 4 andFig. 2). Amino acid transport and metabolism [E] and Nucleotidemetabolism [F] were the most down-regulated categories, and themajority of up-regulated genes were related to energy production (C),andmetabolismand transport of sugar (G), aminoacids (E) and ions (P),to DNA replication and repair (L) and finally, to posttranslationalmodification, protein turnover and chaperones (O).

3.3.1. Induction of stress responsesInterestingly, an increased transcription of cspD, coding for a cold

shock protein, was detected after heating (Table 3). This RNAchaperone is involved in the resistance of bacteria to low temperature(Wouters et al., 1998), but cold shock has also been found to enhancethermotolerance of L. lactis subsp. lactis IL1403 (Panoff et al., 1995),thus indicating an overlap between the two regulons. However,

Table 3Microarray hybridization results showing core genome features with significant differential expression in L. lactis subsp. cremoris strains after heating (38 °C) compared to thereference condition at 32 °C.

Category Locus tag Similar gene Description Expressiona

Information storage and processing UpTranslation, ribosomal structure and biogenesis (J)b LACR_0694 rpmGA 50S ribosomal protein L33 +

LACR_2374 rplQ 50S ribosomal protein L17 +LACR_2378 rpmJ 50S ribosomal protein L36 +

Transcription (K) LACR_0755 cspA Cold-shock DNA-binding protein family protein +LACR_0820 rmaG Transcriptional regulator +LACR_1390 ynaB Transcriptional regulator +LACR_C47 cspC Cold shock protein CspC +LACR_C48 cspD Cold shock protein D +

Metabolism +Amino acid transport and metabolism (E) LACR_0365 ydcB Amino acid ABC transporter ATP binding protein +

LACR_0831 metB2 Cystathionine beta-lyase +LACR_0832 cysK Cysteine synthase +LACR_1009 yjgC Amino acid ABC transporter substrate binding protein +

Metabolism DownEnergy production and conversion (C) LACR_1313 modF ABC transporter ATP binding protein –

LACR_1455 ldh L-lactate dehydrogenase –

Carbohydrate transport and metabolism (G) LACR_0103 ptsH Phosphocarrier protein Hpr –

LACR_0484 pgmB Beta-phosphoglucomutase –

LACR_2246 galP Galactose permease –

a Plus signs indicate higher expression while dashes indicate lower expression.b Letters in parentheses indicate specific gene function categories used in Fig. 2.

267A. Taïbi et al. / International Journal of Food Microbiology 146 (2011) 263–275

neither cspD nor cspE were expressed by L. lactis subsp. lactis biovarDiacetylactis at 12 °C in skim milk (Raynaud et al., 2005), which isconsistent with higher thermal tolerance of this subspecies. Amongthe genes identified after heating (Table 3), three encode 50Sribosomal proteins, which are considered as sensors of heat shockin bacteria (VanBogelen and Neidhardt, 1990), and have also beendetected after salt stress (Sánchez et al., 2005).

When subjected to moderate stress conditions, lactococcal strainscan develop an adaptive general response which involves multiplegenes such as dnaK, dnaJ, groEL and groES coding for heat shockproteins (HSPs) (Arnau et al., 1996; Hartke et al., 1997). According tothe microarray data, no significant changes in transcription of thesegenes were detected at the T2 stage. However, the data obtained byRT-qPCR at T2 reveal significantly higher expression of the genescoding for the GroEL chaperone and the stress-related protease ClpEwith response levels varying slightly among the four strains(Supplementarymaterial, Table S2). These results show the differencein sensitivity of the two analytical methods.

At T4, higher expression of dnaK was observed by microarray whilehigher expression of groEL and clpE was observed both by microarraydata and by qRT-PCR (Table 4 and Supplementary material, Table S2).These stress-induced genes have been described inmore detail in L. lactisduring adaptation todifferent stresses of heat, acid/cold and salt (Kilstrupet al., 1997; Xie et al., 2004). In skim milk at 34 °C in the absence of salt,dnaK expressionwas not detected, but groESwas transiently andweakly(less than2-fold)overexpressedwhile clpEwas2 to3-foldoverexpressedby L. lactis subsp. lactis biovar Diacetylactis (Raynaud et al., 2005). As thisstrain belongs to the L. lactis phenotype, itwould be expected to toleratehigher temperatures without a substantial stress response. This is thefirst time that the expression of these stress genes has been identified inL. lactis subsp. cremoris under cumulative stress conditions simulatingCheddar cheese manufacture, showing a much higher induction ofexpression (6 to 30-fold for GroEL) than observed under otherconditions. In chemically defined medium, L. lactis showed lowerinduction of GroEL protein expression in 2.5% NaCl compared to heatshock at 43 °C (Kilstrup et al., 1997). In UF-cheese, only slight inductionof dnaK and groES were observed at 8 h and up to 7 days of ripening(Cretenet et al., 2011). Acid response mechanisms were not expressedunder these conditions, leading the authors to conclude that stress was

only moderate in UF-cheese. Increased transcription of dnaK and groELhave also been noted with increased growth rate in chemically definedmedium for L. lactis subsp. lactis (Dressaire et al., 2008).

Salt shock response can also be accompanied by the induction ofgenes involved in the compatible solute glycine–betaine transport(busAA–busAB) (Obis et al., 1999;Xie et al., 2004). Ingeneral, prolineandbetaine transport is elevated during salt stress to allow cell resistance(Guillot et al., 2000; Obis et al., 2001). However, strains E8, Wg2, SK11andHPdo not accumulate betaine at 4%NaCl. In strainHPS, this is due tothe absence of these osmoprotection genes (Taïbi et al., 2010). Forstrains SK11, E8S and Wg2S, no significant difference in expression ofbusAA–busAB was observed after salting in our study (Table 4), whichconcords with the absence of growth in 4% salt (Obis et al., 2001).

Acid stress resistancediffers between L. lactis subsp. lactis and L. lactissubsp. cremoris, in part due to the functional arginine deiminase (ADI)pathway in the former. In addition, forMG1363, amultistress resistancephenotype has been associatedwith induction of the stringent response(Rallu et al., 2000). Reducedpurinenucleotidepools (guaAand relA) andreduced translation have also been associated with induction of thestringent response (Rallu et al., 2000), so these two responses maycontribute to multistress resistance and will be further discussed in thenext section.

3.3.2. Uncoupling growth and metabolism after heatingSome genes related to metabolism showed lower expression at T2

(Table 3). Genes galP and pstH play a significant role in sugar transportand utilization; galP codes for a galactose permease (Grossiord et al.,2003) while ptsH encodes the general PTS regulatory component HPr inL. lactis (Luesink et al., 1999). As expected, this pattern indicates ametabolism arrest during which the cell re-routes the energy usage.Microbial counts showed aweak growth deceleration during this period(Fig. 1). In addition, the ldh gene,which codes for lactate dehydrogenaseresponsible for pyruvate to lactic acid conversion, also showed reducedexpression (Table 3) leading to a reduction in acidification rate. In thestudy of Franks et al. (1980), when temperature was upshifted to 38 °Cduring growth of HP, the growth rate remained stable for 1 h while thedecline in specific acid production rate began immediately. Afterwards,growth rate declined more quickly than acid production, leading touncoupling of catabolism (acid production) from anabolic demand

SK11

Wg2S

E8S

HPSDown_38 C

SK11

Wg2S

E8S

HPS

F(1)

J,K (2)

G,T(2)

E(2)

UP_38 C

D(1)

D,E,F,P(5)

S(1)

C(2)

G(2)

M,S(3)

C,I,R(3)

H,P(2)

M(1)

SK11

Wg2S

E8S

HPS

H,R,U(3)

I(1)

O(2)

D(1)

M(2)

V(1)

C(1)

J,K(4)

P(1)

G(2)

S(1)

E,F(20)

Down_NaCl

SK11

Wg2S

E8S

HPS

F(1)

D(1)

K,X(3)

H(2)

J(1)

C,G,E,L,O, P,S, M

(17)

UP_NaCl

R(1)

V(1)

° °

Fig. 2.Venndiagramof the differentially expressed genes after heating and salting grouped by functional classification according the COG functional groups of L. lactis subsp. cremoris genomedatabase (http://genome.jgi-psf.org/mic_home): C, Energy production and Conversion, D, Cell Division and Chromosome Partitioning, E, AminoAcid Transport andMetabolism, F, NucleotideTransport andMetabolism, G, Carbohydrate Transport andMetabolism, H, CoenzymeMetabolism, I, Lipid Metabolism, J, Translation, Ribosomal Structure and Biogenesis, K, Transcription, L,DNA Replication, Recombination and Repair,M, Cell Envelope Biogenesis, OuterMembrane, N, Cell Motility and Secretion, O, PosttranslationalModification, Protein Turnover, Chaperones, P,Inorganic Ion Transport andMetabolism, R, General Function Prediction Only, S, Function Unknown, T, Signal TransductionMechanisms, U, Intracellular trafficking and secretion, V, Defensemechanisms, X, Prophage. Rectangles with full line=SK11; dotted line=HPS; short dashes=Wg2S; long dashes=E8S.

268 A. Taïbi et al. / International Journal of Food Microbiology 146 (2011) 263–275

(growth). This decline was slower at 36 °C compared to 38 °C, thusbiomass can continue to accumulate over at least 3.5 h. In our study, thetotal exposure time to 38 °C was under 60 min, and then thetemperature was decreased to 35 °C for 3.5 h. Thus, we can expect tosee a slightdecline ingrowth rate from32 °C (T1) to 38 °C (T2), followedby an increase in growth rate at 35 °C (T3), which were actuallyobserved. In accordance with a decline in catabolic rate, we observed adecrease in expression of catabolic genes at 38 °C. The apparentdownregulation of catabolic genes after temperature upshift may bedue to lower transcription, but also to RNA degradation and instabilityresulting from progressive damage to cell proteins, the translationmachinery inparticular,whichcontributes toprotectingsomeRNAfromdegradation (Redon et al., 2005a). However, glycolysis (gapA) wasmoderately induced at 38 °C in three strains (SK11, E8S andWg2S), andstrongly induced at T4 in E8S and Wg2S (Table S2), in accordance withthe continuedacid production. The gapA genewas also overexpressed inUF-cheese starting at 24 h and continuing to day 7 of ripening (Cretenetet al. 2011).

Increased anabolic functions such as gene transcription andtranslation at 38 °C would be more related to cellular response to

repair and would not necessarily be associated with an increase ingrowth rate. In this respect, Dressaire et al. (2008)were able to evaluatethe overlap in gene response by comparing the transcriptome profilesafter separately applying limiting growth rate, carbon or amino acidconditions on L. lactis subsp. lactis IL1403 grown in chemically definedmedium in a chemostat. Only about 27% of the gene responses werecommon between growth rate and carbon starvation, or isoleucinelimitation. Therefore, a large number of genes react only in response togrowth rate, but there is some overlap. Furthermore, they showed thatthe stringent response is not responsible for controlling growth rate,given the very low overlap in gene response (10%), indicating that theyconstitute two separate mechanisms. The stringent response had amuch higher overlap (69%) with isoleucine starvation. Responses suchas reduction in transcription of ribosomal proteins associated with thestringent response were also common to growth rate decrease as well.In our study, this decrease in ribosomal protein gene expressionmay bemore correlated with a decrease in growth rate, as other aspects of thestringent response or amino acid limitation were not observed. In fact,the relA and guaA genes central to regulating the stringent responsewere actually downregulated after salting in our study, suggesting that

Table 4Microarray hybridization results showing core genome features with significant differential expression by four L. lactis subsp. cremoris strains after salting compared to the referencecondition at 32 °C.

Category Locus tag Similar gene Description Expressiona

Information storage and processing UpTranslation, ribosomal structure and biogenesis (J)b LACR_0010 pth Peptidyl-tRNA hydrolase +

LACR_1870 serS Seryl-tRNA synthetase +LACR_2181 thrS Threonyl-tRNA synthetase +LACR_2228 hisS Histidyl-tRNA synthetase +LACR_2346 gltX Glutamyl-tRNA synthetase +

Transcription (K) LACR_0929 ahrC Transcriptional regulator +LACR_0956 yjaD Transcriptional regulator +LACR_1390 ynaB Transcriptional regulator +LACR_1427 rdrB Transcriptional regulator +LACR_1546 bglR Beta-glucoside operon antiterminator +LACR_1714 rarA Transcriptional regulator +LACR_1845 llrF Two-component system regulator +LACR_C47 cspC Cold shock protein CspC +

DNA replication, recombination, and repair (L) LACR_0438 ssbA Single-strand binding protein +LACR_0525 hslB HU like DNA-binding protein +LACR_0570 dnaG DNA primase +LACR_1095 radC DNA repair protein RadC +LACR_1172 nth Endonuclease III +LACR_2452 comX1 Competence regulator ComX +LACR_2553 recG ATP-dependent DNA helicase +

Cellular processesCell division and chromosome partitioning (D) LACR_0016 mesJ Cell cycle protein MesJ +

LACR_1058 ftsE Cell-division ATP-binding protein FtsE +LACR_2039 gida Glucose inhibited division protein GidA +

Cell envelope biogenesis, outer membrane (M) LACR_0143 dltE Oxidoreductase +LACR_0385 pbp2B Penicillin-binding protein 2B +LACR_1206 ylbB ABC transporter permease protein +LACR_2464 kdtB Pantetheine-phosphate adenylyltransferase +

Posttranslational modification, protein turnover, chaperones (O) LACR_0440 groEL 60 kDa chaperonin +LACR_0578 clpE ATP-dependent protease ATP-binding subunit +LACR_0700 clpP ATP-dependent Clp protease proteolytic subunit +LACR_1013 trxB1 Thioredoxin reductase +LACR_1027 dnaK DnaK protein +LACR_1883 smpB tmRNA-binding protein SmpB +LACR_2529 dnaJ DnaJ protein +

MetabolismEnergy production and conversion (C) LACR_0049 pdhC Dihydrolipoamide acetyltransferase component of PDH complex +

LACR_0613 yfiJ NADPH-flavin oxidoreductase +LACR_0751 qor Quinone oxidoreductase +LACR_0973 butB 2,3-Butanediol dehydrogenase +LACR_1885 nadh Putative NADH dehydrogenase +

Carbohydrate transport and metabolism (G) LACR_0283 enoB 2-Phosphoglycerate dehydratase +LACR_0878 yidC Beta-glucosidase +LACR_1291 xynB Xylan beta-1,4-xylosidase +LACR_1487 glpF2 Glycerol uptake facilitator +LACR_1864 ptnC Mannose-specific PTS system component IIC +LACR_2244 galK Galactokinase +

Amino acid transport and metabolism (E) LACR_0126 argH Argininosuccinate lyase +LACR_0536 yfcG Peptide-binding protein +LACR_0858 argD Acetylornithine aminotransferase +LACR_1009 yjgC Amino acid ABC transporter substrate binding protein +LACR_1010 yjgD Amino acid ABC transporter permease protein +LACR_1011 yjgE Amino acid ABC transporter ATP binding protein +LACR_1329 hisH Amidotransferase +LACR_2319 arcC1 Carbamate kinase +LACR_2322 arcA Arginine deiminase +

Inorganic ion transport and metabolism (P) LACR_0042 yafB Sulfate transporter +LACR_0078 cadA Cadmium efflux ATPase +LACR_1370 mgtA Cation-transporting P-ATPase +LACR_1715 yqeI Cation transporter protein +LACR_2311 dpsA Non-heme iron-binding ferritin +LACR_2554 phnA Alkylphosphonate uptake protein +

Poorly characterizedFunction unknown (S) LACR_0877 yidB Cellobiose-specific PTS system IIC component +

LACR_0946 yjcA ABC transporter ATP-binding protein +LACR_1029 mycA Myosin-crossreactive antigen +LACR_2070 rlrB LysR family transcriptional regulator +LACR_2206 yucG Chitin binding protein +LACR_2551 ywdE Transcriptional regulator +

(continued on next page)

269A. Taïbi et al. / International Journal of Food Microbiology 146 (2011) 263–275

Table 4 (continued)

Category Locus tag Similar gene Description Expressiona

Prophage (X) LACR_1755 holin Prophage encoded holin +

Information storage and processing DownTranslation, ribosomal structure and biogenesis (J) LACR_0842 metS Methionyl-tRNA synthetase –

LACR_1057 prfB Peptide chain release factor RF-2 –

LACR_1306 aldR Regulatory protein –

LACR_1902 rpsT 30S ribosomal protein S20 –

LACR_2374 rplQ 50S ribosomal protein L17 –

Transcription (K) LACR_0092 relA GTP pyrophosphokinase –

LACR_2324 argR Arginine catabolic regulator –

MetabolismEnergy production and conversion (C) LACR_1455 ldh L-lactate dehydrogenase –

Carbohydrate transport and metabolism (G) LACR_0103 ptsH Phosphocarrier protein Hpr –

LACR_0726 glgA Glycogen synthase –

LACR_1581 lplC Putative ABC transporter permease protein –

LACR_1744 uxuT Na-galactoside symporter –

LACR_2341 yvdD Transporter –

Amino acid transport and metabolism (E) LACR_0341 pepN Aminopeptidase N –

LACR_0392 optC Oligopeptide ABC transporter permease protein –

LACR_0393 optD Oligopeptide ABC transporter ATP binding protein –

LACR_0394 optF Oligopeptide ABC transporter ATP binding protein –

LACR_0398 asnB Asparagine synthetase B –

LACR_0510 hicD2 L-2-hydroxyisocaproate dehydrogenase –

LACR_0617 glyA Serine hydroxymethyltransferase –

LACR_0621 serB Phosphoserine phosphatase –

LACR_0712 brnQ Branched-chain amino acid transport system carrier protein –

LACR_0859 argB Acetylglutamate kinase –

LACR_1280 hom Homoserine dehydrogenase –

LACR_1281 thrB Homoserine kinase –

LACR_1813 pepP Proline dipeptidase –

LACR_1996 pepT Peptidase T –

LACR_2187 ytjE Aminotransferase –

LACR_D17 oppA Oligopeptide ABC trasporter substrate binding protein –

LACR_D18 oppC Oligopeptide ABC trasporter permease protein –

LACR_D20 oppF Oligopeptide ABC trasporter ATP binding protein –

LACR_D21 oppD Oligopeptide ABC trasporter ATP binding protein –

Nucleotide transport and metabolism (F) LACR_1583 guaA GMP synthase –

LACR_1598 purK Phosphoribosylaminoimidazole carboxylase ATPase subunit –

LACR_1599 purE Phosphoribosylaminoimidazole carboxylase catalytic subunit –

LACR_1601 purD Phosphoribosylamine–glycine ligase –

LACR_1618 purF Phosphoribosylpyrophosphate amidotransferase –

LACR_1619 purL Phosphoribosylformylglycinamidine synthase II –

LACR_1620 purQ Phosphoribosylformylglycinamidine synthetase I –

LACR_1622 purC Phosphoribosylaminoimidazole-succinocarboxamide synthetase –

Inorganic ion transport and metabolism (I) LACR_0337 phnE Phosphonate ABC transporter permease protein –

LACR_0361 plpB Outer membrane lipoprotein precursor –

Poorly characterizedFunction unknown (S) LACR_0933 yiiF Transporter –

LACR_1223 mutX Mutator protein MutTLACR_1545 ptbA Beta-glucoside-specific PTS system IIABC component –

a Plus signs indicate higher expression while dashes indicate lower expression.b Letters in parentheses indicate specific gene function categories used in Fig. 2.

270 A. Taïbi et al. / International Journal of Food Microbiology 146 (2011) 263–275

nitrogen in the form of amino acids was not limiting. However,availability of some amino acids may be reduced at this stage, becausethe expression of five amino-acyl tRNA synthetases was increased(Table 4).

3.3.3. Carbon limitation at T4Although lactose is not exhausted from milk even after 7 days of

cheese ripening, localized consumption and acid production may leadto a lactose gradient and limitation of lactose flux causing localizedcarbon limitation (Cretenet et al., 2011). Carbon limitation leads toinduction of central carbon metabolism by alleviating CcpA-mediatedrepression. In this study, some genes known to be controlled throughCcpA showed higher expression at the end of the Pearce activity test.These included the Leloir pathway (galK, galT, and galM), pyruvatemetabolism (pdhA,B,C,D and butA,B genes) and one gene of cellobiosetransport (ptsB). CcpA activates pepQ transcription (Zomer et al.,2007), so the slightly reduced expression of pepQ in our study could

also be related to lower CcpA activity at T4 (Table S2). However, CcpAis also known to repress pur and glyA genes, at least during thetransition to stationary phase (Zomer et al., 2007), and these genesshowed lower expression at the salting stage in our study (see below).Both acid and salt stress reduced the expression of some pur genes inM17 medium containing glucose, however nucleotide availability isnot as limited as in milk (Xie et al., 2004). In UF-cheese, both purinemetabolism and central carbon metabolism were induced at 8 h, andoverexpression continued up to 7 days, corresponding to release ofcarbon catabolite repression (Cretenet et al., 2011).

3.3.4. Nucleotide metabolismAs mentioned above, the microarray data showed the repression

after salting of several genes encoding enzymes involved in the denovo pathway of purine nucleotide synthesis and salvage (purC, purD,purF, purE, purF, purK, purL, purQ and deoD) (Table 4). Nucleotides areessential for growth of L. lactis in milk (Dickely et al., 1995), as

271A. Taïbi et al. / International Journal of Food Microbiology 146 (2011) 263–275

substrates for RNA and DNA synthesis and the main energy donors forcellular processes as well as indicators of nitrogen starvation. Thetranscriptional regulation of purinemetabolism has important implica-tions in stress tolerance as severalmutants affected in genes involved inpurine metabolism induced multistress resistance in L. lactis (Duwatet al., 1999; Rallu et al., 2000). Our results show that the genesresponsible for the biosynthesis of purines were switched off aftersalting, which is correlatedwith the decrease in growth and cell divisionat this stage of milk fermentation. As reduced intracellular nucleotidepools are associated with the onset of stationary phase and lead tomultistress resistance (Rallu et al., 2000; Sonenshein, 2005), the relativeexpression levels of these genes could be used as indicators oflactococcal stress response and transition to stationary phase at thestart of cheese ripening. As mentioned above, in non-coagulated skimmilk, purine metabolism decreased from 24 h to 7 days of incubation(Raynaud et al., 2005; Yvon et al., 2011)while in UF-cheese (Cretenet etal., 2011), purinemetabolismwas inducedover the ripeningperiod. Thisdifference could be associated with lower water activity in cheesemediating a lower effect of stress or a higher purine limitation in cheesecompared to non-coagulated or semi-solid milk media.

3.3.5. Reduced expression of oligopeptide transport and peptidasesTheoligopeptide transporter genes opt andoppwereunderexpressed

in the four strains after salting compared to 32 °C. The oligopeptidetransport systems play a crucial role throughout the growth of L. lactis inmilk. They are also involved in the recycling of cell wall proteins, whichare likely one of the first targets of environmental stress (Richarme andCaldas, 1997). In L. lactis, acidification inhibits various amino acid andoligopeptide transport systems (Poolman et al., 1987). Our data indicatethat lactococcal strains may have reduced transport activity ofextracellular peptides at the end of the Cheddar cheese simulation. Thereduction in oligopeptide transport into the cells could be due to thecombined stress conditions (heat, salt and pH) as well as to CodYrepression from an increase in the internal branched chain amino acidpool. In B. subtilis, CodY is proposed to interact with GTP, so that adecrease in the GTP pool during the stringent response would lead toderepression by CodY (Eymann et al., 2002). However, it is not known ifCodY from L. lactis interacts in an equivalent manner with GTP. Thisdecrease in peptide transport would also incur consequences on thepeptidase activities of the cells, particularly those that are CodY-regulated such as pepN.

Our microarray results reveal that some genes coding for intracel-lular peptidases (pepN, pepP and pepT) were underexpressed at the endof the Pearce activity test, mainly in strains SK11, E8S andHPS (Table 4).RT-qPCR further confirms the lowered expression of oppA, pepQ andglyA in strains SK11, E8S and Wg2S after cumulative stresses(Supplementary data, Table S2). In another study using M17 glucosebroth, peptidase expressionwas unaffected by any stress condition, acidor salt, with the exception of pepDA while oligopeptide transport geneexpressionwas reduced themost after heat shock, but also after acid andsalt stress (Xie et al., 2004). The cumulative stress observed at the end ofthe simulated cheese manufacture process as well as amino acidaccumulation could contribute to the decrease in expression of genescoding for oligopeptide transport and other components of theproteolytic pathway. The pep genes do not seem to be affected by thestress conditions in strain Wg2S, with the exception of pepPwhich wasoverexpressed. This gene encodes an aminopeptidase that does notaffect lactococcal growth in milk (Matos et al., 1998). During theripening of UF cheese, nitrogen metabolismwas downregulated, whichwas explained by the accumulation of branched chain amino acidsissuing from proteolysis (Cretenet et al., 2011). Thus, CodY regulationrepressed oliopeptide transport and many peptidases at least until7 days of ripening. In contrast, amino acid starvation was observed inGouda cheese, leading to induction of the CodY regulon (Bachmannet al., 2010). As the strain used was PrtP negative in that study,proteolysis could not supply the nitrogen demands of the cells. In the

presence of a proteolytic starter culture, dppA (equivalent of opt)expression was effectively 100-fold lower (Bachmann et al., 2010).

3.3.6. Induction of phage gene expression after saltingThe microarrays revealed significant upregulation of holin genes

after salting in three out of the four strains tested (SK11, E8S and HPS)(Table 4). This phage-related gene is required for host lysis, as the smallprotein is able tomakeholes in the cytoplasmicmembrane, allowing thephage lysin to reach the cell wall peptidoglycan. Lactococcal lysis due topermeabilization of the cytoplasmic membrane through the action of aprophage-encodedholinwasdemonstratedunder starvation conditions(Lepeuple et al., 1998a). Cells of L. lactis are known to undergo extensivelysis during the early stages of Cheddar cheese molding and ripening(Lepeuple et al., 1998b), favored by stress conditions such as lactosedepletion, salt addition and acidity. In other studies, a temperatureupshift (39 to 40 °C) also supported prophage induction for tempera-ture-sensitive strains (Feirtag and McKay, 1987; Meijer et al., 1998).Strain SK11 is known to have thermoinducible autolytic activity, due tophage activation, depending on growth rate and optimal at pHabove 5.8(Meijer et al., 1998). However, the acmA gene, coding for the principalautolysin, is annotated as a pseudogene in the SK11 genome, containinga nucleotidemutation leading to a change in reading frame and thus to anon-functional protein that should not contribute to cell lysis.

Two genes were selected for quantifying expression of lysis systemsby RT-qPCR. LACR_1755 codes for a protein identified as a phage holin(SK11-3 prophage) and LACR_2088 codes for a cell wall-associatedhydrolase (SK11-4 prophage) (Ventura et al., 2007). After temperatureupshift, only HPS showed increased expression of holin1 (LACR_1755).After salting, the expression of holin1 appears to be induced in strainsE8S, HPS and Wg2S, whereas holin2 (LACR_2088) was significantlyoverexpressed after NaCl addition only for strain HPS. These results canbe considered as an indicator of prophage gene induction duringCheddar cheese manufacture, but a more specific microarray could bedesigned to target the many different phage sequences that areavailable.

Despite the induction of prophage gene expression, no significantlysis was observed. Moreover, no lactococcal autolysin genes wereidentified as significantly over-expressed at this stage. In our conditions,releasedLDHactivitywasnot significant (lower than0.01 LDHunits/mL)compared to another study using the modified Pearce activity test withaddition of NaCl (4.5% w/v) where autolysis was measured after onenight at 4 °C (Sheehan et al., 2005). LDH degradation by proteinases canbe excluded, as the positive control reaction of adding LDH enzyme tosupernatants did not show any reduction in activity (data not shown).One possible explanation could be the lack of LDH enzyme productiondue to anabsenceof ldh gene expression.However, ldh transcriptionwasstill measurable at the salting stage. Alternatively, there could be a delaybetween gene expression and translation before lysis can occur.Nevertheless, the absence of lysis is consistent with the lower cookingtemperature (38 °C to 35 °C) and lower salt concentration (4% instead of4.5%) used in our study, which may be insufficient for the cell lysis thatwas previously observed at 40 °C by Feirtag and McKay (1987). In UFcheese, phage-related gene expression was repressed during ripening.Moderate stress conditions are also suggested to have contributed topreventing prophage induction and lysis (Cretenet et al., 2011).

3.4. Strain-specific L. lactis subsp. cremoris gene expression

The reference strains used in this study are known to have differentautolytic and proteolytic capacity and consequently, vary in technolog-ical potential (Pillidge et al., 2002; Sheehan et al., 2005; St-Gelais et al.,1992). The four strains differ also on the basis of the protease PrtPsequence and specificity of casein αS1 cleavage sites (Exterkate et al.,1993). Strain SK11 is recognized for debittering activity (Lee et al.,1996),while HP is non-autolytic and is responsible for the developmentof bitterness in Cheddar cheese (Pillidge et al., 2002). Finally, strains

272 A. Taïbi et al. / International Journal of Food Microbiology 146 (2011) 263–275

Wg2S and E8S exhibit different proteolytic activities and lactic acidproduction (St-Gelais et al., 1992, 1993). A total of 61 genes out of 1037genes present on the array showed significant variation in expressionamong strains (Tables 5 and 6). In general, the distinction between thestrains was more evident at the end of the test simulation, with only afew specific responses after heating. Three of the four analyzed strainscould be distinguished by specific responses after heating and salting(SK11, E8S andHPS), whileWg2S showed few strain-specific responses(Table 6).

SK11 and E8S could be distinguished from other strains at 38 °C byinduction of the genes busAA and busAB, encoding for the glycinebetaine transporters. Glycine betaine is mostly known as anosmoprotectant, but it was shown that it acts as a thermoprotectantfor E. coli cells (Caldas et al., 1999). The induction of these genes couldcontribute to protecting the strains SK11 and E8S against temperaturevariation during cheese manufacture. Thus, SK11 and E8S appear tohave an induced stress response at this early stage of the cheesemanufacturing process. However, while E8 can accumulate somebetaine at low NaCl concentrations, SK11 does not (Obis et al., 2001).

The reference strain (SK11), which has been used in industry, wasdistinguished from the other strains by the higher expression ofoligopeptide transport genes (optCDF) after heating, suggesting a lackof amino acid accumulation that represses oligopeptide transportthrough CodY. The activation of oligopeptide transport would allow

Table 5Genes showing significant differential expression by microarray hybridization among four

Category Locus tag Similar gene

Cellular processesCell division and chromosome partitioning (D)a LACR_0016 mesJ

LACR_1695 ftsQSignal transduction mechanisms (T) LACR_2539 rcfBCell envelope biogenesis, outer membrane (M) LACR_0143 dltE

MetabolismEnergy production and conversion (C) LACR_1885 nadh

LACR_1896 yrjBCarbohydrate transport and metabolism (G) LACR_2540 yxbDAmino acid transport and metabolism (E) LACR_0392 optC

LACR_0393 optDLACR_0394 optFLACR_1541 busABLACR_1542 busAA

Nucleotide transport and metabolism (F) LACR_0657 aptCoenzyme metabolism (H) LACR_0771 menB

LACR_1072 ribGLipid metabolism (I) LACR_0100 acpD

LACR_0909 acpSInorganic ion transport and metabolism (P) LACR_0335 phnC

LACR_2554 phnA

Poorly characterizedGeneral function prediction only (R) LACR_0397 eraL

LACR_0879 mhpCLACR_2490 ywgA

Function unknown (S) LACR_1431 pgdALACR_2208 yucG

Cellular processesCell division and chromosome partitioning (D) LACR_0695 ftsW1Cell envelope biogenesis, outer membrane (M) LACR_0997 tagF

LACR_2242 galE

MetabolismAmino acid transport and metabolism (E) LACR_0617 glyANucleotide transport and metabolism (F) LACR_0277 nrdD

LACR_1468 pyrFInorganic ion transport and metabolism (P) LACR_0336 phnB

Poorly characterizedFunction unknown (S) LACR_1617 yphA

LACR_2207 yucG

a Letters in parentheses indicate specific gene function categories used in Fig. 2.

increased peptidase activity responsible for bitter peptide elimination(Lee et al., 1996), and consequently, act as indicator of a debitteringstrain. The opp transporter genes, also showing increased expressionin SK11, have been suggested as genetic markers for distinguishingcremoris strains by MLSA (Taïbi et al., 2010). By combiningmetabolomic and proteomic approaches, L. lactis strains could bedistinguished by a higher abundance in one strain of peptidase andOpp proteins, contributing to a higher proteolytic activity in UF cheese(Yvon et al., 2011).

At the end of cheese making simulation and after salt addition, SK11developedanother formof stress resistance, namely the inductionofhtrA,coding for a unique surface housekeeping protease in L. lactis and osmC,encoding anosmotically inducibleproteinC (OsmC). TheproteaseHtrA isconsidered as a key factor in the response to specific stress conditions(heat shock, ethanol, and NaCl) in L. lactis (Foucaud-Scheunemann andPoquet, 2003) and it is responsible for the degradation and irreversibleremoval of denatured proteins formed in the cellular envelope duringstress (Poquet et al., 2000). In L. lactis, the function of the envelopeprotein OsmC remains unclear, other than being cold-induced (Raynaudet al., 2005). In the caseof other bacteria, this proteinparticipates, directlyor indirectly, in the defense against osmotic stress (Gordia andGutierrez,1996), its up-regulation coincides with stationary phase increases inOsmC that have been observed in E. coli and Pseudomonas aeruginosa(Gordia and Gutierrez, 1996). The up-regulation of these two genes

strains of L. lactis subsp. cremoris after heating.

Description Expression

UPCell cycle protein MesJ SK11Cell division protein FtsQ HPSTranscriptional regulator HPSOxidoreductase Wg2S

Putative NADH dehydrogenase; NAD(P)H nitroreductase E8SOxidoreductase Wg2STransporter HPSOligopeptide ABC transporter permease protein SK11Oligopeptide ABC transporter ATP binding protein SK11Oligopeptide ABC transporter ATP binding protein SK11Betaine ABC transporter permease and substrate binding protein SK11, E8SBetaine ABC transporter ATP binding protein E8SAdenine phosphoribosyltransferase SK11Naphthoate synthase Wg2SDiaminohydroxyphosphoribosylaminopyrimidine deaminase HPSAcyl carrier protein phosphodiesterase Wg2SHolo-[acyl-carrier protein] synthase E8SPhosphonate ABC transporter ATP-binding protein Wg2SAlkylphosphonate uptake protein HPS

GTP-binding protein Era Wg2SNon-heme chloride peroxidase E8SRegulatory protein RecX Wg2SPeptidoglycan GlcNAc deacetylase Wg2SChitin binding protein Wg2S

DOWNCell division protein FtsW E8STeichoic acid biosynthesis protein F E8SUDP-glucose 4-epimerase Wg2S

Serine hydroxymethyltransferase E8SAnaerobic ribonucleoside-triphosphate reductase E8SOrotidine-phosphate decarboxylase E8SPhosphonate ABC transporter permease protein E8S

NADH dehydrogenase Wg2SChitin binding protein HPS

Table 6Genes showing significant differential expression by microarray hybridization among four strains of L. lactis subsp. cremoris after salting.

Category Locus tag Similar gene Description Expression

Cellular processes UPDefense mechanisms (V)a LACR_1215 hsdM Putative type I site-specific deoxyribonuclease HPSPosttranslational modification, protein turnover,chaperones (O)

LACR_0059 osmC Osmotically inducible protein SK11LACR_0969 ppiB Peptidyl-prolyl cis-trans isomerase SK11LACR_2439 htrA Housekeeping protease SK11

MetabolismCarbohydrate transport and metabolism (G) LACR_0580 gapA Glyceraldehyde 3-phosphate dehydrogenase SK11, E8SAmino acid transport and metabolism (E) LACR_0719 pepP Aminopeptidase Xaa-Pro aminopeptidase Wg2SNucleotide transport and metabolism (F) LACR_1002 deoD Purine-nucleoside phosphorylase SK11, HPSCoenzyme metabolism (H) LACR_0770 menE O-succinylbenzoic acid-CoA ligase E8S, Wg2S

LACR_0771 menB Naphthoate synthase Wg2SLACR_1661 hemH Ferrohelatase E8S

Poorly characterizedGeneral function prediction only (R) LACR_2490 ywgA Regulatory protein RecX E8S

LACR_363 dar Acetoin reductase SK11

Cellular processes DOWNCell division and chromosome partitioning (D) LACR_0695 ftsW1 Cell division protein FtsW HPSDefense mechanisms (V) LACR_0266 ycgA ABC transporter, ATP-binding/permease protein E8SCell envelope biogenesis, outer membrane (M) LACR_0388 murF UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate-D-alanyl-D-alanine

ligaseE8S, Wg2S

LACR_0998 tagB Teichoic acid biosynthesis protein B E8SLACR_1372 dltC D-alanyl carrier protein SK11LACR_1374 dltA D-alanine activating enzyme SK11

Intracellular trafficking and secretion (U) LACR_2277 ecsB ABC transporter permease protein SK11Posttranslational modification, protein turnover,chaperones (O)

LACR_0550 tig Trigger factor HPSLACR_1984 pepO2 Endopeptidase (PepO2) SK11

MetabolismEnergy production and Conversion (C) LACR_1938 atpB ATP synthase subunit A HPS

LACR_2413 yfiC FMN-binding protein HPSCarbohydrate transport and metabolism (G) LACR_0253 dhaM Dihydroxyacetone kinase SK11Amino acid transport and metabolism (E) LACR_1716 proA Glutamate-5-semialdehyde dehydrogenase E8SCoenzyme metabolism (H) LACR_1461 gpdA Glycerol-3-phosphate dehydrogenase SK11Lipid metabolism (I) LACR_0821 fabH 3-Oxoacyl-[acyl-carrier-protein] synthase III SK11

LACR_0822 acpA Acyl carrier protein SK11LACR_2434 cdsA Phosphatidate cytidylyltransferase E8S

Inorganic ion transport and metabolism (P) LACR_0337 phnE Phosphonate ABC transporter permease protein SK11LACR_0361 plpB Outer membrane lipoprotein precursor E8S

Poorly characterizedGeneral function prediction only (R) LACR_1454 yngG Sugar ABC transporter permease protein SK11

a Letters in parentheses indicate specific gene function categories used in Fig. 2.

273A. Taïbi et al. / International Journal of Food Microbiology 146 (2011) 263–275

(Table 6) in SK11 suggests that this strain expresses specific adaptiveresponses to the stress conditions in comparison with the other strains.

Although strain E8S seems to have similar responses to SK11, celldivision could be slowed down in E8S after heating with therepression of the genes ftsW and pyrF. While bacterial viable countsdo not show a significant difference between SK11 and E8S, there is aperceptible difference in gene expression activity between these twostrains. Another specific response identified only in E8S after thesalting stage is the higher expression of the bcaT gene observed by RT-qPCR (Supplementary data, Table S2). This gene is linked to theproduction of flavor through amino acid degradation and could beused as a marker of performance among L. lactis subsp. cremorisstrains.

In the case of HPS, the regulator gene rcfB, involved in acid stressadaptation in L. lactis, was induced after the heating stage. In strongacidic conditions, rcfB is co-transcribed with genes encoding anuniversal stress-like protein and partially controls production of thechaperone GroEL (Madsen et al., 2005). The expression of this genecould be activated when cells encounter another stress such as thetemperature variation in this case, as pH is still at 6. In addition, theincrease in groEL gene expression at the heating stage was double thatof the other three strains (Supplementary data Table S2).

The gapAgene, encoding glyceraldehyde3-phosphatedehydrogenase(GAPDH), shows variation in expression among all strains. After salting,microarray analysis identified overexpression of this gene for SK11 only(Table 6), while RT-qPCR measured overexpression of gapA in threestrains SK11, E8S andWg2S, and lower expression for HPS (Supplemen-tary data, Table S2). As this step is essential in glycolysis, this biomarkercould show differences between strains inmetabolic state and activity atthe beginning of cheese ripening.

4. Conclusion

This first comparative transcriptome analysis of four lactococcalstrains contributes to understanding gene expression responses to theCheddar cheese manufacturing process. Identification of a coretranscriptome represents a common response of the starters duringmanufacture and specific responses make it possible to distinguishbetween the strains. These specific gene expression responses canserve as technological selection markers which may be used in thecheese industry, such as the oligopeptide transporters, stressresistance genes, and other genes related to flavor production orimprovement. The starter strain profile after cumulative stressrepresents the cellular response at the end of the cheese making

274 A. Taïbi et al. / International Journal of Food Microbiology 146 (2011) 263–275

process, giving an indication of the state of cells upon entering theripening phase. Finally, the differences in performance between thestarters are the combination of the absence of genes related tophysiological functions or metabolism, the variation in expressionbetween the strains, representing variable responses during thecheese making process and also the variations in the specificity ofcertain enzymes, and proteases such as PrtP. Proteomic andmetabolomic analyses would provide complementary informationon lactococcal strain responses to processing conditions.

Supplementarymaterials related to this article can be found onlineat doi:10.1016/j.ijfoodmicro.2011.02.034.

Acknowledgements

This workwas supported by an NSERC Strategic grant awarded to G.LaPointe and D. Roy in collaboration with Agropur, inc. The authorsgratefully acknowledge the financial contribution of industrial partner-ships (Agropur inc., Fromagerie Clément/Damafro inc., Novalait Inc,Parmalat Canada, Dairy Farmers of Canada, Groupe Saputo inc.) andNSERC (NSERC-Dairy Sector Industrial Research Chair in CheeseTechnology andTypicity).We thankMarie-Hélène Lessard for providingbcaT sequence data, Jean-François Spinella and Pauline Cassart fortechnical assistance.

References

Arnau, J., Sorensen, K.I., Appel, K.F., Vogensen, F.K., Hammer, K., 1996. Analysis of heatshock gene expression in Lactococcus lactisMG1363. Microbiology 142, 1685–1691.

Bachmann, H., de Wilt, L., Kleerebezem, M., van Hylckama Vlieg, J.E., 2010. Time-resolved genetic responses of Lactococcus lactis to a dairy environment.Environmental Microbiology 12, 1260–1270.

Bayjanov, J.R., Wels, M., Starrenburg, M., van Hylckama Vlieg, J.E.T., Siezen, R.J.,Molenaar, D., 2009. PanCGH: a genotype-calling algorithm for pangenome CGHdata. Bioinformatics 25, 309–314.

Broadbent, J.R., Barnes, M., Brennand, C., Strickland, M., Houck, K., Johnson, M.E., Steele,J.L., 2002. Contribution of Lactococcus lactis cell envelope proteinase specificity topeptide accumulation and bitterness in reduced-fat Cheddar cheese. Applied andEnvironmental Microbiology 68, 1778–1785.

Caldas, T., Demont-Caulet, N., Ghazi, A., Richarme, G., 1999. Thermoprotection byglycine betaine and choline. Microbiology 145, 2543–2548.

Cretenet,M., Laroute, V., Ulve,V., Jeanson,S., Nouaille, S., Even,S., Piot,M.,Girbal, L., Le Loir, Y.,Loubiere, P., Lortal, S., Cocaign-Bousquet, M., 2011. Dynamic analysis of the Lactococcuslactis transcriptome in cheeses made from milk concentrated by ultrafiltration revealsmultiple strategies of adaptation to stresses. Applied and Environmental Microbiology77, 247–257.

Dickely, F., Nilsson, D., Hansen, E.B., Johansen, E., 1995. Isolation of Lactococcus lactisnonsense suppressors and construction of a food-grade cloning vector. MolecularMicrobiology 15, 839–847.

Dressaire, C., Redon, E., Milhem, H., Besse, P., Loubiere, P., Cocaign-Bousquet, M., 2008.Growth rate regulated genes and their wide involvement in the Lactococcus lactisstress responses. BMC Genomics 9, 343.

Duwat, P., Dusko, E.S., Gruss, A., 1999. Effects of metabolic flux on stress responsepathways in Lactococcus lactis. Molecular Microbiology 31, 845–858.

Exterkate, F.A., Alting, A.C., Bruinenberg, P.G., 1993. Diversity of cell envelopeproteinase specificity among strains of Lactococcus lactis and its relationship tocharge characteristics of the substrate-binding region. Applied and EnvironmentalMicrobiology 59, 3640–3647.

Eymann, C., Homuth, G., Scharf, C., Hecker, M., 2002. Bacillus subtilis functionalgenomics: global characterization of the stringent response by proteome andtranscriptome analysis. Journal of Bacteriology 184, 2500–2520.

Feirtag, J.M., McKay, L.L., 1987. Thermoinducible lysis of temperature-sensitiveStreptococcus cremoris strains. Journal of Dairy Science 70, 1779–1784.

Foucaud-Scheunemann, C., Poquet, I., 2003. HtrA is a key factor in the response to specificstress conditions in Lactococcus lactis. FEMS Microbiology Letters 224, 53–59.

Franks, P.A., Hall, R.J., Linklater, P.M., 1980. Mechanistic model of the growth ofStreptococcus cremoris HP at superoptimal temperatures. Biotechnology andBioengineering 22, 1465–1487.

Gitton, C., Meyrand, M., Wang, J., Caron, C., Trubuil, A., Guillot, A., Mistou, M.Y., 2005.Proteomic signature of Lactococcus lactis NCDO763 cultivated in milk. Applied andEnvironmental Microbiology 71, 7152–7163.

Gordia, S., Gutierrez, C., 1996. Growth-phase-dependent expression of the osmoticallyinducible gene osmC of Escherichia coli K-12. Molecular Microbiology 19, 729–736.

Grossiord, B.P., Luesink, E.J., Vaughan, E.E., Arnaud, A., deVos,W.M., 2003. Characterization,expression, and mutation of the Lactococcus lactis galPMKTE genes, involved ingalactose utilization via the Leloir pathway. Journal of Bacteriology 185, 870–878.

Guillot, A., Obis, D., Mistou, M.Y., 2000. Fatty acid membrane composition andactivation of glycine–betaine transport in Lactococcus lactis subjected to osmoticstress. International Journal of Food Microbiology 55, 47–51.

Hartke, A., Frère, J., Boutibonnes, P., Auffray, Y., 1997. Differential induction of thechaperonin GroEL and the co-chaperonin GroES by heat, acid, and UV-irradiation inLactococcus lactis subsp. lactis. Current Microbiology 34, 23–26.

Hickey, D.K., Kilcawley, K.N., Beresford, T.P., Sheehan, E.M., Wilkinson, M.G., 2007.Starter strain related effects on the biochemical and sensory properties of Cheddarcheese. The Journal of Dairy Research 74, 9–17.

Kilstrup, M., Jacobsen, S., Hammer, K., Vogensen, F.K., 1997. Induction of heat shockproteins DnaK, GroEL, and GroES by salt stress in Lactococcus lactis. Applied andEnvironmental Microbiology 63, 1826–1837.

Lee, K.D., Lo, C.G., Warthesen, J.J., 1996. Removal of bitterness from the bitter peptidesextracted from Cheddar cheese with peptidases from Lactococcus lactis ssp. cremorisSK11. Journal of Dairy Science 79, 1521–1528.

Lepeuple, A.S., Van Gemert, E., Chapot-Chartier, M.P., 1998a. Analysis of thebacteriolytic enzymes of the autolytic Lactococcus lactis subsp. cremoris strainAM2 by renaturing polyacrylamide gel electrophoresis: identification of aprophage-encoded enzyme. Applied and Environmental Microbiology 64,4142–4148.

Lepeuple, A.S., Vassal, L., Cesselin, B., Delacroix-Buchet, A., Gripon, J.C., Chapot-Chartier,M.P., 1998b. Involvement of a prophage in the lysis of Lactococcus lactis subsp.cremoris AM2 during cheese ripening. International Dairy Journal 8, 667–674.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408.

Luesink, E.J., Beumer, C.M., Kuipers, O.P., de Vos, W.M., 1999. Molecular characterizationof the Lactococcus lactis ptsHI operon and analysis of the regulatory role of HPr.Journal of Bacteriology 181, 764–771.

Madsen, S.M., Hindré, T., Le Pennec, J.P., Israelsen, I., Dufour, A., 2005. Two acid-inducible promoters from Lactococcus lactis require the cis-acting ACiD-box and thetranscription regulator RcfB. Molecular Microbiology 56, 735–746.

Makarova, K., Slesarev, A., Wolf, Y., Sorokin, A., Mirkin, B., Koonin, E., Pavlov, A., Pavlova,N., Karamychev, V., Polouchine, N., Shakhova, V., Grigoriev, I., Lou, Y., Rohksar, D.,Lucas, S., Huang, K., Goodstein, D.M., Hawkins, T., Plengvidhya, V., Welker, D.,Hughes, J., Goh, Y., Benson, A., Baldwin, K., Lee, J.-H., Díaz-Muñiz, I., Dosti, B.,Smeianov, V., Wechter, W., Barabote, R., Lorca, G., Altermann, E., Barrangou, R.,Ganesan, B., Xie, Y., Rawsthorne, H., Tamir, D., Parker, C., Breidt, F., Broadbent, J.,Hutkins, R., O'Sullivan, D., Steele, J., Unlu, G., Saier, M., Klaenhammer, T., Richardson,P., Kozyavkin, S., Weimer, B., Mills, D., 2006. Comparative genomics of the lacticacid bacteria. Proceedings of the National Academy of Sciences 103, 15611–15616.

Marilley, L., Casey, M.G., 2004. Flavours of cheese products: metabolic pathways,analytical tools and identification of producing strains. International Journal ofFood Microbiology 90, 139–159.

Matos, M., Nardi, M., Kumura, H., Monnet, V., 1998. Genetic characterization of pepP,which encodes an aminopeptidase P whose deficiency does not affect Lactococcuslactis growth in Milk, unlike deficiency of the X-prolyl dipeptidyl aminopeptidase.Applied and Environmental Microbiology 64, 4591–4595.

Meijer, W., Dobbelaar, C., Hugenholtz, J., 1998. Thermoinducible lysis in Lactococcuslactis subsp. cremoris SK110: Implications for cheese ripening. International DairyJournal 8, 275–280.

Mori, S., Mori, K., Suzuki, I., Kasumi, T., 2004. Phylogenetic analysis of Lactococcus lactissubspecies based on decoding the sequence of the pepT tripeptidase gene, the pepVdipeptidase gene and 16S rRNA. Systematic and AppliedMicrobiology 27, 414–422.

Oberman, H., Libudzisz, Z., 1998. In: Wood, B.J.B. (Ed.), Fermented milks, 2nd ed.Microbiology of Fermented Foods, vol. 1. Blackie Academic & Professional, London,pp. 308–350.

Obis, D., Guillot, A., Gripon, J.C., Renault, P., Bolotin, A., Mistou, M.Y., 1999. Genetic andbiochemical characterization of a high-affinity betaine uptake system (BusA) inLactococcus lactis reveals a new functional organization within bacterial ABCtransporters. Journal of Bacteriology 181, 6238–6246.

Obis, D., Guillot, A., Mistou, M.Y., 2001. Tolerance to high osmolality of Lactococcus lactissubsp. lactis and cremoris is related to the activity of a betaine transport system.FEMS Microbiology Letters 202, 39–44.

Panoff, J.M., Thammavongs, B., Laplace, J.M., Hartke, A., Boutibonnes, P., Auffray, Y.,1995. Cryotolerance and cold adaptation in Lactococcus lactis subsp. lactis IL1403.Cryobiology 32, 516–520.

Peirson, S.N., Butler, J.N., Foster, R.G., 2003. Experimental validation of novel andconventional approaches to quantitative real-time PCR data analysis. Nucleic AcidsResearch 31, e73.

Pfaffl, M.W., Horgan, G.W., Dempfle, L., 2002. Relative expression software tool (REST(C))for group-wise comparison and statistical analysis of relative expression results inreal-time PCR. Nucleic Acids Research 30, e36.

Pillidge, C.J., Rallabhandi, P.S.V.S., Tong, X.Z., Gopal, P.K., Farley, P.C., Sullivan, P.A., 2002.Autolysis of Lactococcus lactis. International Dairy Journal 12, 133–140.

Poolman, B., Driessen, A.J., Konings, W.N., 1987. Regulation of solute transport instreptococci by external and internal pHvalues.Microbiological Reviews 51, 498–508.

Poquet, I., Saint, V., Seznec, E., Simoes, N., Bolotin, A., Gruss, A., 2000. HtrA is the uniquesurface housekeeping protease in Lactococcus lactis and is required for naturalprotein processing. Molecular Microbiology 35, 1042–1051.

Rallu, F., Gruss, A., Ehrlich, D., Maguin, M., 2000. Acid and multistress-resistant mutantsof Lactococcus lactis: identification of intracellular stress signals. MolecularMicrobiology 35, 517–528.

Raynaud, S., Perrin, R., Cocaign-Bousquet, M., Loubiere, P., 2005. Metabolic andtranscriptomic adaptation of Lactococcus lactis subsp. lactis Biovar diacetylactis inresponse to autoacidification and temperature downshift in skimmilk. Applied andEnvironmental Microbiology 71, 8016–8023.

Redon, E., Loubiere, P., Cocaign-Bousquet, M., 2005a. Role of mRNA stability duringgenome-wide adaptation of Lactococcus lactis to carbon starvation. The Journal ofBiological Chemistry 280, 36380–36385.

275A. Taïbi et al. / International Journal of Food Microbiology 146 (2011) 263–275

Redon, E., Loubiere, P., Cocaign-Bousquet, M., 2005b. Transcriptome analysis of theprogressive adaptation of Lactococcus lactis to carbon starvation. Journal ofBacteriology 187, 3589–3592.

Richarme, G., Caldas, T.D., 1997. Chaperone properties of the bacterial periplasmicsubstrate-binding proteins. The Journal of Biological Chemistry 272, 15607–15612.

Saeed, A.I., Sharov, V., White, J., Li, W.L., Bhagabati, N., Braisted, J., Klapa, M., Currier, T.,Thiagarajan, M., Sturn, A., Snuffin, M., Rezantsev, A., Popov, D., Ryltsov, A.,Kostukovich, E., Borisovsky, I., Liu, Z., Vinsavich, A., Trush, V., Quackenbush, J., 2003.TM4: a free, open-source system for microarray data management and analysis.Biotechniques 34, 374–378.

Sánchez, B., Champomier-Vergès, M.C., Anglade, P., Baraige, F., de Los Reyes-Gavilán, C.G.,Margolles, A., Zagorec, M., 2005. Proteomic analysis of global changes in proteinexpressionduringbile salt exposureofBifidobacterium longumNCIMB8809. Journal ofBacteriology 187, 5799–5808.

Sheehan, A., O'Loughlin, C., O'Cuinn, G., FitzGerald, R.J., Wilkinson, M.G., 2005. Cheddarcheese cooking temperature induces differential lactococcal cell permeabilizationand autolytic responses as detected by flow cytometry: implications forintracellular enzyme accessibility. Journal of Applied Microbiology 99, 1007–1018.

Simon, R., Lam, A., Li, M.C., Ngan, M., Menenzes, S., Zhao, Y., 2007. Analysis of geneexpression data using BRB-array tools. Cancer Informatics 3, 11–17.

Sonenshein, A.L., 2005. CodY, a global regulator of stationary phase and virulence inGram-positive bacteria. Current Opinion in Microbiology 8, 203–207.

St-Gelais, D., Roy, D., Haché, S., 1992. Growth and activities of Lactococcus lactis in milkenriched with low mineral retentate powders. Journal of Dairy Science 75,2344–2352.

St-Gelais, D., Roy, D., Haché, S., Desjardins, S., 1993. Growth of nonproteolytic Lactococcuslactis in culture medium supplemented with different casein hydrolyzates. Journal ofDairy Science 76, 3327–3337.

Taïbi, A., Dabour, N., Lamoureux, M., Roy, D., LaPointe, G., 2010. Evaluation of the geneticpolymorphism among Lactococcus lactis subsp. cremoris strains using comparativegenomic hybridization and multilocus sequence analysis. International Journal ofFood Microbiology 144, 20–28.

Tan-a-ram, P., Cardoso, T., Daveran-Mingot, M.L., Kanchanatawee, S., Loubiere, P.,Girbal, L., Cocaign-Bousquet, M., 2011. Assessment of the diversity of dairyLactococcus lactis subsp. lactis isolates by an integrated approach combiningphenotypic, genomic, and transcriptomic analyses. Applied and EnvironmentalMicrobiology 77, 739–748.

van de Guchte, M., Serror, P., Chervaux, C., Smokvina, T., Ehrlich, S., Maguin, E., 2002.Stress responses in lactic acid bacteria. Antonie van Leeuwenhoek 82, 187–216.

van Hylckama Vlieg, J.E.T., Rademaker, J.L., Bachmann, H., Molenaar, D., Kelly, W.J.,Siezen, R.J., 2006. Natural diversity and adaptive responses of Lactococcus lactis.Current Opinion in Biotechnology 17, 183–190.

VanBogelen, R.A., Neidhardt, F.C., 1990. Ribosomes as sensors of heat and cold shock inEscherichia coli. Proceedings of the National Academy of Sciences 87, 5589–5593.

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman,F., 2002. Accurate normalization of real-time quantitative RT-PCR data bygeometric averaging of multiple internal control genes. Genome Biology 3,research0034.0031–research0034.0011.

Vedamuthu, E.R., Sandine,W.E., Elliker, P.R., 1966. Flavor and texture in Cheddar cheese. I.Role of mixed strain lactic starter cultures. Journal of Dairy Science 49, 144–150.

Ventura, M., Zomer, A., Canchaya, C., O'Connell-Motherway, M., Kuipers, O., Turroni, F.,Ribbera, A., Foroni, E., Buist, G., Wegmann, U., Shearman, C., Gasson, M.J., Fitzgerald,G.F., Kok, J., van Sinderen, D., 2007. Comparative analyses of prophage-likeelements present in two Lactococcus lactis strains. Applied and EnvironmentalMicrobiology 73, 7771–7780.

Wilkinson, M.G., Guinee, T., O'Callaghan, D., Fox, P.F., 1994. Autolysis and proteolysis indifferent strains of starter bacteria during Cheddar cheese ripening. Journal of DairyResearch 4, 141–160.

Wittenberger, C.L., Angelo, N., 1970. Purification and properties of fructose l–6diphosphate-activated lactate dehydrogenase from Streptococcus faecalis. Journalof Bacteriology 101, 717–724.

Wouters, J.A., Sanders, J.W., Kok, J., de Vos, W.M., Kuipers, O.P., Abee, T., 1998. Clusteredorganization and transcriptional analysis of a family of five csp genes of Lactococcuslactis MG1363. Microbiology 144, 2885–2893.

Xia, X., Xie, Z., 2001. AMADA: analysis of microarray data. Bioinformatics 17, 569–570.Xie, Y., Chou, L., Cutler, A., Weimer, B., 2004. DNA macroarray profiling of Lactococcus

lactis subsp. lactis IL1403 gene expression during environmental stresses. Appliedand Environmental Microbiology 70, 6738–6747.

Yvon, M., Gitton, C., Chambellon, E., Bergot, G., Monnet, V. 2011. The initial efficiency ofthe proteolytic system of Lactococcus lactis strains determines their responses to acheese environment. International Dairy Journal 21, 335–345.

Zomer, A.L., Buist, G., Larsen, R., Kok, J., Kuipers, O.P., 2007. Time-resolveddetermination of the CcpA regulon of Lactococcus lactis subsp. cremoris MG1363.Journal of Bacteriology 189, 1366–1381.