Circulating adiponectin levels increase in rats on caloric restriction:

the potential for insulin sensitization

Min Zhua, Junnosuke Miurac, Lucy X. Lua, Michel Bernierb, Rafael DeCaboa,Mark A. Lanea,1, George S. Rotha, Donald K. Ingrama,*

aLaboratory of Experimental Gerontology, Gerontology Research Center, National Institute on Aging, National Institutes of Health,

5600 Nathan Shock Drive, Baltimore, MD 21224, USAbDiabetes Section, Laboratory of Clinical Investigation, Gerontology Research Center, National Institute on Aging, National Institutes of Health,

5600 Nathan Shock Drive, Baltimore, MD 21224, USAcExperimental Medicine Section, Oral Infection and Immunity Branch, National Institute of Dental and Craniofacial Research,

National Institutes of Health, 9000 Rockville Pike, Bethesda, MD 20892, USA

Received 7 January 2004; received in revised form 3 March 2004; accepted 5 March 2004

Available online 4 May 2004

Abstract

Caloric restriction (CR) has a well-known insulin sensitizing effect in vivo. Although this effect has been confirmed in rodents and

primates for many years, its precise molecular mechanisms remain unknown. Here we show a significant increase in plasma adiponectin and

a decrease in blood glucose, plasma triglyceride and insulin levels in rats maintained on CR diet for 2, 10, 15, and 20 months. Long-term CR

rats exhibited significantly higher insulin-stimulated insulin receptor tyrosine phosphorylation and lower PTP-1B activity both in liver and

skeletal muscle than those observed in rats fed ad libitum (AL). In addition, the triglyceride levels in these tissues were significantly lower in

long-term CR animals. Interestingly, concentrations of plasma adiponectin in long-term CR rats were associated with increased expression of

the transcription factor mRNAs for the peroxisome proliferator-activated receptor (PPAR)a, g and d, but decreased expression for

SREBP-1c, resulting in a concerted modulation in the expression of key transcription target genes involved in fatty acid oxidation and energy

combustion in liver. Taken together, our findings suggest an important role for adiponectin in the beneficial effects of long-term CR.

q 2004 Elsevier Inc. All rights reserved.

Keywords: Caloric restriction; Insulin signaling; PTP-1B; Lipid metabolism; Adiponectin

1. Introduction

Obesity and insulin resistance are two detrimental

conditions whose incidence increases with advancing age,

and these conditions can give rise to a range of metabolic

disorders, including type 2 diabetes, hypertension, hyperli-

pidemia, and atherosclerosis (i.e. syndrome X) (Kahn and

Flier, 2000; Matsuzawa et al., 1999; Reaven, 1995). Caloric

restriction (CR) has been shown to increase systemic insulin

sensitivity in rodents (Masoro, 2000; Reaven et al., 1983)

and primates (Hansen and Bodkin, 1993; Kemnitz et al.,

1994), and has been shown to extend mean and maximal

lifespan while slowing aging processes (Masoro, 2000).

Although the molecular mechanisms underlying the insulin-

sensitizing effect of CR remain unknown, recent progress in

elucidating possible mechanisms has been accelerated

through studies highlighting the previously unrecognized

role for CR in the adipo-insulin axis.

In addition to its function as an inert tissue that serves

merely to store energy, white adipose tissue plays a vital

role in regulating energy and glucose homeostasis (Kahn

and Flier, 2000; Havel, 2002), in part by producing a

number of biologically active proteins. Proteins secreted by

adipose tissue, now referred to as adipokines or adipocy-

tokines (Matsuzawa et al., 1999), include leptin (Zhang

et al., 1994), adiponectin (Yamauchi et al., 2001; Berg et al.,

2001), TNFa (Hotamisligil et al., 1993) and resistin

(Steppan et al., 2001). Unlike many of the other adipokines,

the expression of adiponectin mRNA and circulating levels

of its product are significantly reduced in diabetic and obese

0531-5565/$ - see front matter q 2004 Elsevier Inc. All rights reserved.

doi:10.1016/j.exger.2004.03.024

Experimental Gerontology 39 (2004) 1049–1059

www.elsevier.com/locate/expgero

1 Present address: Merck and Co., Inc., RY 34-A576, P.O. Box 2000,

Rahway, NJ 07065-0900, USA.

* Corresponding author. Tel.: þ1-410-558-8180; fax: þ1-410-558-8323.

E-mail address: ingramd@grc.nia.nih.gov (D.K. Ingram).

conditions in mice (Combs et al., 2002), rhesus monkeys

(Hotta et al., 2001) and humans (Lindsay et al., 2002; Stefan

et al., 2002). Reduction in the plasma adiponectin levels in

the prediabetic state precedes the decrease in insulin

sensitivity, hence contributing to insulin resistance and the

development of type 2 diabetes (Lindsay et al., 2002; Stefan

et al., 2002; Krakoff et al., 2003), which are frequent

complications of obesity. Of interest, a quantitative

diabetes-susceptibility locus has been mapped on chromo-

some 3 in the region q27, where the adiponectin gene is

located (Luke et al., 2003; Kissebah et al., 2000). In a recent

study, administration of adiponectin improved insulin

sensitivity while lowering blood glucose in high fat-fed

obese mice, as well as in a mouse model of lipoatrophic

diabetes (Yamauchi et al., 2001). These observations

suggest that adiponectin may confer protection against the

development of insulin resistance and type 2 diabetes. In

female CR nondiabetic mice, the plasma adiponectin levels

are 2- to 3-fold higher than that in control mice fed ad

libitum (AL) (Berg et al., 2001). Therefore, increased food

intake together with larger fat mass may produce overlap-

ping effects in the negative control of adiponectin

production and secretion.

The peroxisome proliferator-activated receptors

(PPARs), i.e. PPARa, g, and d, are nuclear transcription

factors that have been implicated in the regulation of genes

involved in lipid metabolism, adipocyte differentiation, and

insulin sensitivity (Kaplan et al., 2001; Desvergne and

Wahli, 1999). Based on knockout studies in mice, PPARa

appears to activate the transcription of target genes that

encode for enzymes involved in fatty acid oxidation in

mitochondria (Leone et al., 1999; Aoyama et al., 1998).

On the other hand, PPARg has been described as an

important nuclear regulator, promoting the differentiation of

preadipocytes to normal and insulin-sensitive adipocytes

(Rosen and Spiegelman, 2001). The synthesis of adiponec-

tin during adiponeogenesis occurs through activation of

several mechanisms, including treatment with PPARg

agonists (Maeda et al., 2001; Yang et al., 2002; Combs

et al., 2002). PPARd is ubiquitously expressed in mammals;

however, its primary biological roles have yet to be defined.

In this study, we show that CR rats have a significant

elevation in circulating adiponectin and a reduction in

triglyceride levels both in plasma and tissues (liver and

skeletal muscle), and that CR was capable of altering the

gene expression profile of key enzymes involved in lipid

oxidation and energy combustion through regulated

expression of a number of transcription factors. Because

CR increases insulin sensitivity, it may suggest that insulin

receptor (IR) signaling potential is improved. The IR is

a receptor tyrosine kinase, and the binding of insulin to

its receptor results in phosphorylation of the IR. The protein

tyrosine phosphatase 1B (PTP-1B) is a potent negative

modulator of IR phosphorylation and signaling (Elchebly

et al., 1999; Zinker et al., 2002; Rondinone et al., 2002).

Therefore, we examined if CR had a regulatory effect on

PTP-1B activity and expression. We have shown that rats

maintained on AL diet but not CR diet exhibited an

age-dependent reduction in IR phosphorylation in liver and

muscle following portal vein administration of insulin with

concomitant increase in PTP-1B activity in these tissues.

2. Materials and methods

2.1. Materials

Human recombinant insulin, protein A-Sepharose,

antibodies against mouse and rat b-actin, and triglyceride

assay kit (GPO Trinder) were from Sigma (St Louis, MO).

The antibodies against insulin b-subunit (06-492) and

phosphotyrosine (4G10), and malachite green phosphatase

assay kit were from Upstate Biotechnology (Lake Placid,

NY). Mouse monoclonal antibody against PTPase 1B

(AB-1) was purchased from Oncogene Research

(Cambridge, MA). Rat insulin ELISA kit was from

ALPCO (Windham, NH), whereas adiponectin and gluca-

gon RIA kits were obtained from Linco Research

(St Charles, MO). Reagents for RT-PCR, SDS-PAGE and

immunoblotting were purchased from Invitrogene Life

Technologies (Carlsbad, CA) and Geno Technology

(St Louis, MO). Protease inhibitor cocktail set III was

obtained from Calbiochem-Novabiochem Corporation

(La Jolla, CA). All other chemicals were from Sigma at

the highest quality available.

2.2. Animal protocols

Male Fischer-344 rats born at the Gerontology Research

Center were weaned at 28 days, housed individually and

randomly assigned to either AL, fed ad libitum supplied

with NIH-31 standard rodent chow (Harlan Teklad,

Indianapolis, IN), or CR, provided with a daily food

allotment of 60% of that eaten by the AL rats, supplied

with NIH-31 mineral and vitamin supplemented rodent

chow (Harlan Teklad). All rats were maintained on a 12-h

light/dark cycle in a separate vivarium at the Gerontology

Research Center under specific pathogen-free conditions. In

a fasting state, body weight was recorded, and whole blood

glucose was measured (9–10 a.m.) using a portable glucose

meter (One Touch II glucometer, Lifescan, Milpitas, CA).

At the same time, blood from snipped tails was collected in

microcapillary tubes for the determination of plasma

parameters. All animal protocols were approved by the

GRC ACUC committee (233-AWF-Ra).

At each experimental time-point (2-, 13-, and 25-month

CR), rats were fasted overnight and sacrificed by decapi-

tation. The abdomen was quickly opened. The liver,

pancreas and musculi gastrocnemius were excised, cleared

of extraneous lymph nodes and fat, and then immediately

frozen in liquid nitrogen prior to storage at 280 8C.

To examine insulin stimulation in vivo, the fasted rats

M. Zhu et al. / Experimental Gerontology 39 (2004) 1049–10591050

were anesthetized with sodium pentobarbital (60 mg/kg

body weight, i.p.). The abdominal cavity was opened, and

the portal vein was exposed. Then 4 ml of normal saline

(0.9% NaCl) with or without human recombinant insulin

(Sigma, St Louis, MO) at a dose of 10 U/kg body weight

(0.4 mg) was injected to the portal vein. The liver, pancreas,

and musculi gastrocnemius were excised 30, 60 and 90 s

after insulin injection, respectively, cleared of extraneous

lymph nodes and fat, and then immediately frozen in liquid

nitrogen prior to storage at 280 8C.

2.3. Plasma insulin, glucagon, and adiponectin

determination

Plasma insulin was determined using commercially

available ELISA kit with rat insulin standard. Plasma

adiponectin and glucagon were measured using commer-

cially available RIA kits.

2.4. Plasma and tissue lipid determination

Tissue triglycerides were extracted as described pre-

viously (Bligh and Dyer, 1959). Plasma and tissue

triglycerides were measured by an enzymatic colorimetric

method using a commercial kit. Briefly, triglycerides are

hydrolyzed by lipase to glycerol and free fatty acids. The

glycerol produced is then measured by coupled enzyme

reactions catalyzed by glycerol kinase, glycerol phosphate

oxidase and peroxidase.

2.5. Immunoprecipitation and Western blotting

The frozen tissues were homogenized in ice-cold lysis

buffer (50 mM Tris–HCl, pH 7.5, 120 mM NaCl, 1%

Nonidet P-40, 1 mM Na3VO4, 1 mM EDTA, 50 mM NaF,

1 mM benzamidine, 0.5 mM PMSF, and 1:500 protease-

inhibitor cocktail) using a polytron homogenizer. After

30 min incubation on ice, the insoluble material was

removed by centrifugation at 12,000 rpm for 20 min at

4 8C. Equal amount of protein (500 mg) from each tissue

was incubated in 0.5 ml of immunoprecipitation buffer

(20 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P-

40, 1% Triton X-100, 1 mM Na3VO4, 1 mM EGTA, 1 mM

PMSF, 1 mM NaF, 1 mM EDTA, and 1:500 protease-

inhibitor cocktail) with 1 mg of antibody against IR-b

subunit overnight at 4 8C with constant agitation. On the

following day, total protein lysate or immunocomplexes

were adsorbed to protein A-Sepharose beads (20 ml of 50%

slurry) during an additional 2-h incubation at 4 8C with

constant agitation. After extensive washing of the beads

with ice-cold immunoprecipitation buffer, the proteins were

eluted with boiling 2 X sample buffer before being separated

by 8% SDS-PAGE gel under reducing conditions and

transferred onto a 0.45 mm polyvinylidene difluoride

(PVDF) membrane. Detection of individual proteins was

conducted by immunoblotting with antibodies against

phosphotyrosine, IR, PTP-1B and b-actin, and visualized

by enhanced chemiluminescence detection system

(Amersham). Signals were quantitated by densitometry

using the NIH Image software.

2.6. PTP-1B activity assay

An aliquot (100 mg) of the clarified tissue was resus-

pended to 0.1 ml in immunoprecipitation buffer and was

incubated with 1 mg of anti-PTP-1B antibody overnight at

4 8C with constant rotation. The next day, 10 ml of protein

A-Sepharose beads (10 ml of 50% slurry) was added to each

sample, and the incubation was continued for an additional

2-h at 4 8C with constant rotation. Samples were centrifuged

and washed six times with 10 mM Tris–HCl buffer, pH 7.4,

containing 200 mM DTT. The pellets were resuspended in

25 ml of 10 mM Tris–HCl buffer, pH 7.4. After 10 min

preincubation at 37 8C, the PTP-1B assay was initiated

by the addition of the tyrosine phosphopeptide substrate

(R-R-L-I-E-D-A-E-pY-A-A-R-G) (350 mM final conc.).

The reaction was allowed to proceed for 60 min at 37 8C

and was then terminated by addition of 100 ml of malachite

green stopping reagent. Absorbance was measured at

590 nm in a microtiter plate reader along with a free

phosphate standard curve (100–1000 pmole of Pi). PTP-1B

activity from duplicate samples was expressed as pmoles of

phosphate released per mg protein per hour. Important

controls included immunoprecipitated PTP-1B incubated

without peptide and complete reaction mixtures prepared in

the absence of anti-PTP-1B antibody.

To ensure that the observed differences in PTP-1B

activity between AL and CR rats were not due to the

different levels of amounts of PTP-1B protein used for

immunoprecipitation, we therefore analyzed amounts of

PTP-1B protein in either tissue by Western blot analysis

with anti-PTP-1B antibody, and b-actin antibody served as

loading controls. No significant difference in amounts of

PTP-1B protein was observed between AL and CR rats (data

not shown).

2.7. RNA extraction, synthesis of cDNA (RT)

and semi-quantitative polymerase chain reaction (PCR)

Total liver RNA was extracted using TRizol reagent

according to the manufacturer suggested protocols (Invitro-

gen). Single stranded complementary DNA (cDNA) was

synthesized from DNase-treated RNA samples using

M-MLV reverse transcriptase with a mixture of an oligo

(dT) primer and random hexanucleotide primer. Polymeri-

zation reactions were performed in a thermocycler in a

50-ml reaction volume containing 3 ml of cDNA (150 ng

total RNA equivalents), Taq PCR buffer, 60 mM of each

dNTP, 1.25 mM MgCl2, and 2.5 units of Taq DNA

polymerase. The samples were also tested without reverse

transcriptase to ensure that there was no contamination with

genomic DNA. The oligonucleotide primers and cycle

M. Zhu et al. / Experimental Gerontology 39 (2004) 1049–1059 1051

number used for multiplex PCR are indicated in Table 1.

The cycle number of each primer pair was chosen within the

exponential phase. The thermal cycle profile consisted of an

initial denaturation step (4 min at 94 8C), followed by the

number of amplification cycles (30 s of denaturation at

94 8C, 30 s of annealing at 55 8C, and 45 s of extension at

72 8C) and a final extension step of 7 min at 72 8C. The final

PCR products were separated by 8% polyacrylamide gels in

TBE buffer, and visualized by ethidium bromide staining.

Band intensity was measured with FujiFilm FLA-3000G

Image reader and quantified with NIH Image software.

The average intensity of each product was expressed

relative to the internal control gene 18S rRNA. These ratios

were then used to calculate the percent of AL expression for

each CR animals in the same RT-PCR.

2.8. Statistical analysis

Data are expressed as means ^ SEM. Statistical signifi-

cance was determined using a two-way (age by diet)

analysis of variance (ANOVA) with planned comparisons

by the least square difference (LSD) test. The level of

significance was set at p , 0:05:

3. Results

3.1. Body weight, blood and plasma parameters

We examined changes in body weight and various blood

and plasma parameters in fasted rats as a function of age and

diet (AL vs. CR). There were significant age and/or diet

effects, as well as significant age by diet interactions for

body weight, blood glucose, and plasma insulin, adiponectin

and triglyceride concentrations. These results are summar-

ized in Table 2. Regarding body weight, AL rats

significantly gained weight from 2 months of age, while

the CR rats did not and were significantly lighter than AL

counterparts at each age. Blood glucose was relatively

constant across age among AL rats but actually decreased

with age in the CR group. Except at 2 months of age where

blood glucose levels were actually higher among CR rats

compared to AL, glucose was significantly lower in the CR

group at all other ages. Plasma insulin increased with age

compared to the 2-month group in both the AL and CR

groups, but insulin levels were significantly lower in the CR

group at every age. Major CR effects were also observed in

plasma adiponectin levels. At every age, levels were 2- to 3-

fold higher in CR rats compared to AL. In the AL group,

adiponectin levels remained about the same across age but

compared to the level recorded for 2 months old rats, levels

were clearly higher in the CR group at all older ages. Plasma

glucagon levels also remained constant across age in the AL

group, while in the CR group the highest level was recorded

in the oldest group; however, we saw no significant CR

effects on glucagon at any age. Plasma triglyceride levels

were significantly reduced in rats maintained on 10, 15, and

20 months CR diet.

3.2. Effect of CR on levels of insulin receptor (IR) tyrosine

phosphorylation (pY) in liver, skeletal muscle and pancreas

To determine whether CR attenuated any defects in

insulin receptor signaling during aging, we assessed pY-IR

in liver, muscle and pancreas of rats maintained on either

CR or AL diet for 2 and 25 months. In these tissues, basal

p Y-IR levels did not differ significantly between diet

groups at either 2 or 25 months (data not shown). However,

after a single portal vein injection of insulin, pY-IR was

significantly increased in the liver ðp ¼ 0:06Þ and muscle

ðp ¼ 0:003Þ of rats maintained on the 25-month CR diet

compared with age-matched AL controls ðn ¼ 5–6Þ (Fig. 1).

Note that in rats maintained on AL diet, there was a

significant age-dependent reduction in insulin-induced pY-

IR in liver and muscle, but not in pancreas (Fig. 1). The pY-

IR levels were indistinguishable in all tissues tested for the

rats maintained on both AL and CR diets for 2 months. In

the 25-month group, however, pY-IR was significantly

higher in both CR liver (51%) and skeletal muscle (58%)

relative to the age-matched AL controls. pY-IR in CR

pancreas tended to increase (13%), but this diet-related

increase did not achieve statistical significance ðp ¼0:17Þ:

These results indicated that CR attenuated the age-related

Table 1

Sequences of oligonucleotide primers and PCR conditions

Gene name Size

(bp)

50oligonucleotide 30oligonucleotide GenbankTM

accession no.

Cycles

PGC-1 302 CCACTACAGACACCGCACAC TGCATTCCTCAATTTCACCA AB025784 32

PPARb/d 284 CATTGAGCCCAAGTTCGAGT TCTTCAGCCACTGCATCATC U40064 30

PPARg(II) 266 TGACAGTGACTTGGCCATATTT GCAGAGGGTGAAGGCTCATA Y12882 33

PPARa 337 GCTTCATCACCCGAGAGTTC TTCTTGATGACCTGCACGAG M88592 26

Fatty acid synthase (FAS) 234 GCCCTGCTACCACTGAAGAG GTTGTAATCGGCACCCAAGT M76767 29

Hormone sensitive lipase (HSL) 285 CTGCCTTCCCTGATGGTTT GACACAGGGCTGCTAAGCTC X51415 31

SREBP-1c 250 GCCTATTTGATGCCCCCTAT AGTGGCACTGGCTCCTCTT AF286470 30

Acyl-CoA oxidase (ACO) 261 AGCTGTGCTGAGGAACCTGT GATTTCTTGGCCCACTCAAA J02752 26

M. Zhu et al. / Experimental Gerontology 39 (2004) 1049–10591052

Table 2

Body weight, blood and plasma parameters in a fasted state

Months (CR versus AL) ANOVA (p-value)*

2 10 15 20 Age Diet Age £ diet

Body weight (g)

AL 260.5 ^ 12.4b 377.4 ^ 6.6a 420.7 ^ 11.2a# 397.8 ^ 4.6a# ,0.0001 ,0.0001 ,0.0001

CR 213.4 ^ 8.4 209.2 ^ 3.7 204.7 ^ 2.7 199.2 ^ 7.7

Blood glucose (mmol/l)

AL 4.4 ^ 0.1c# 4.7 ^ 0.1d 4.7 ^ 0.1a 4.7 ^ 0.1b 0.005 ,0.0001 ,0.0001

CR 4.9 ^ 0.1 4.2 ^ 0.1# 3.6 ^ 0.0# 3.9 ^ 0.2

Plasmainsulin (pmol/l)

AL 157.9 ^ 10.7c# 233.3 ^ 25.1a# 245.9 ^ 25.1a# 227.9 ^ 14.3c# ,0.0001 0.001 0.044

CR 87.9 ^ 3.5 69.9 ^ 7.1 102.3 ^ 5.3 154.3 ^ 17.9#

Plasma adiponectin (mg/l)

AL 2.3 ^ 0.2d 2.3 ^ 0.1a 2.5 ^ 0.1a 2.0 ^ 0.4a 0.006 ,0.0001 0.006

CR 4.2 ^ 0.3 7.0 ^ 0.2 6.4 ^ 0.2# 6.1 ^ 0.8#

Plasma glucagon (ng/l)

AL 54.1 ^ 1.8 53.7 ^ 2.6 44.7 ^ 3.0 59.6 ^ 4.6 0.021 NS NS

CR 49.2 ^ 3.4 45.3 ^ 6.9 46.3 ^ 4.3 67.3 ^ 12.1#

Plasma triglycerides (mmol/l)

AL 1.05 ^ 0.20 1.52 ^ 0.11a# 1.66 ^ 0.15a# 1.31 ^ 0.25a NS ,0.0001 0.0003

CR 1.12 ^ 0.09 0.40 ^ 0.05 0.33 ^ 0.01# 0.43 ^ 0.04#

Data are represented as means ^ SE of 7 rats. a: p , 0:0001; b: p , 0:001; c: p , 0:01; d: p , 0:05 versus CR counterparts. * p-value, two-way ANOVA.

For those ANOVAs yielding a significant age by diet interactions, an additional one-way ANOVA was conducted to evaluate the effect of age within each diet

group followed by planned comparisons. # p , 0:05 between the 2-month group and the other age groups.

Fig. 1. CR attenuates age-related decline in insulin-stimulated tyrosine phosphorylation of insulin receptor (pY-IR) in liver and skeletal muscle. Rats ðn ¼ 5–8Þ

maintained on either AL or CR diet for 2 and 25 months were anesthetized in a fasting state. Normal saline with or without human recombinant insulin

(10 units/kg body weight) was injected to the portal vein. Liver, pancreas and gastrocnemius were excised 30, 60 and 90 s after injection, respectively, and

proteins from each tissue were isolated. Equal amount of protein lysates was subjected to immunoprecipitation with anti-insulin b-subunit antibody, and

separated by SDS-PAGE and Western blot analysis using either antibody against phosphotyrosine or IR-b subunit antibody. Data are expressed as the

percentage change of pY-IR as compared with total IR. The graph represents means ^ SEM, expressed as percent of 2-month AL group. #: two-way ANOVA

yielding a significant age effect between 2- and 25-month AL groups. * p , 0:05; ** p , 0:01 AL versus CR according to LSD test.

M. Zhu et al. / Experimental Gerontology 39 (2004) 1049–1059 1053

decline in insulin-stimulated pY-IR only in insulin sensitive

tissues.

3.3. Effect of CR on PTP-1B activity in liver, skeletal muscle

and pancreas

We next assessed whether these differences in the pY-IR

levels were associated with altered PTP-1B activity.

Skeletal muscle from AL-fed rats exhibited a significant

age-dependent increase in PTP-1B activity (Fig. 2). This age

effect, however, was not observed in liver and pancreatic

tissue. In rats maintained on the 25-month CR diet, there

was a significant 31 and 43% decrease in PTP-1B activity in

liver and skeletal muscle, respectively, but not in pancreas

ðp ¼ 0:28Þ (Fig. 2). Although rats maintained on the

13-month CR diet exhibited a lower PTP-1B activity in

pancreas compared to AL controls, this difference did not

reach statistical significance ðp ¼ 0:18Þ: The results demon-

strated that CR protected against age-related increase in

PTP-1B activity in insulin sensitive tissues.

3.4. Triglyceride (TG) content in liver, skeletal muscle

and pancreas

We then explored the possibility that the improved

insulin receptor signaling in CR rats was a consequence of

higher plasma adiponectin levels (Table 2) with concomi-

tant reduction in TG content in tissues. In the AL group,

there was an age-dependent increase in TG content in liver

ðp ¼ 0:04Þ and muscle ðp ¼ 0:07Þ; but not in pancreas

(Fig. 3). In contrast, rats maintained on CR diet exhibited no

increase in TG content in all tissues tested as a function of

age. Interestingly, rats maintained on the 25-month CR diet

exhibited a 43 and 41% reduction in TG content in liver and

Fig. 2. CR attenuates age-dependent increase in the activity of protein tyrosine phosphatase 1B (PTP-1B) in liver and skeletal muscle. Rats ðn ¼ 5–8Þ

maintained on either AL or CR diet for 2, 13 and 25 months were analyzed in a fasting state. Protein lysates from each tissue were subjected to

immunoprecipitation with the anti-PTP-1B antibody. PTP-1B immunocomplexes were used to measure phosphatase activity using the phosphopeptide (R-R-

L-I-E-D-A-E-Py-A-A-R-G) as a substrate. PTP-1B activities from duplicate for each sample, based on a phosphate standard curve, were expressed as pmoles of

phosphate released per hour per mg protein. The graph represents means ^ SEM. #: two-way ANOVA yielding a significant age effect between 2-month AL

and other AL groups. * p , 0:05; ** p , 0:01 AL versus CR according to LSD test.

Fig. 3. CR protects against age-related increase in triglyceride accumulation in tissues. Tissue triglycerides (rats from Fig. 2) were extracted as described

previously (Bligh and Dyer, 1959), and triglyceride content was determined by triglyceride assay kit. Data are means ^ SEM. #: two-way ANOVA yielding a

significant age effect between 2-month AL and other AL groups. * p , 0:05; ** p , 0:01 CR versus AL according to LSD test.

M. Zhu et al. / Experimental Gerontology 39 (2004) 1049–10591054

muscle, respectively, compared to age-matched AL controls

(Fig. 3). However, TG content was not significantly

different in all tissues tested for rats maintained on both

diets for 2 and 13 months.

3.5. Effects of CR on mRNA levels for the transcription

factors and genes involved in lipid metabolism

Because recent studies have indicated a role for

adiponectin as a mediator of fatty acid oxidation and

hepatic insulin sensitivity (Yamauchi et al., 2001; Berg

et al., 2001), we investigated possible alterations in the

expression of the transcription factors important for lipid

metabolism in the liver of rats maintained on both CR and

AL diets. As anticipated, the peroxisome proliferator-

activated receptors (PPARs) with several target genes

were reciprocally regulated during aging and CR. In the

AL group, there was a significant age-dependent reduction

in the expression of the transcription factor mRNAs for

PPARa and g, and PPARg-coactivator 1 (PGC-1), but a

significant age-related increase in the sterol regulatory

element binding protein-1 (SREBP-1) (Fig. 4A). In contrast,

the expression levels of the mRNAs for PPARs (a, d, and g)

and PGC-1 were significantly higher in the liver of rats

maintained on the 25-month CR diet than those observed in

age-matched AL controls (Fig. 4B). In addition, the

expression levels of the SREBP-1 were dramatically lower

in CR rats than those in age-matched AL controls over time,

but did not reach a statistically significant level in the 2- and

13-month groups due to large individual variation.

Moreover, the expression of these PPARs was essentially

identical for the animals maintained on both diets for 2 and

13 months.

Consistent with the role of CR in the regulation of

PPARa and SREBP-1, there was a significant age-

dependent increase in the expression of SREBP-1 transcrip-

tion target mRNA for fatty acid synthase (FAS) (Fig. 4A).

In addition, rats maintained on the 25-month CR diet

exhibited a significant decrease in the expression level of the

FAS gene, but a significant increase in the expression of

the hormone sensitive lipase (HSL) gene relative to

age-matched AL controls (Fig. 4B). Moreover, the perox-

isomal lipid oxidation enzyme acyl-CoA oxidase gene was

significantly upregulated by CR in the 25-month group, in

agreement with the CR-induced increase in the expression

of its transcriptional activator, PPARa.

4. Discussion

Adiponectin is the most abundant secretory protein in

adipocytes discovered to date, and has been shown to

enhance insulin sensitivity, improve plasma clearance of

free fatty acids, glucose and triglycerides, and

suppress hepatic glucose production (Berg et al., 2001;

Yamauchi et al., 2001; Fruebis et al., 2001; Combs et al.,

2001). In the present study, CR rats exhibited a significant

increase in plasma adiponectin accompanied by a significant

decline in plasma triglyceride levels, which may

contribute to a decline in tissue triglyceride accumulation

via a concerted modulation in the expression of key

transcription target genes involved in fatty acid oxidation

and energy combustion, thereby improving insulin receptor

signaling in those tissues.

Our finding that long-term CR improved insulin-

stimulated pY-IR in the liver and skeletal muscle of rats

maintained on a 25-month CR diet (Fig. 1) may account,

in part, for the protective effect of CR toward the

development or delay in the onset of type 2 diabetes

(Hansen and Bodkin, 1993; Okauchi et al., 1995). An

increasing body of evidence suggests that alteration in

insulin receptor expression, binding, phosphorylation

state, and/or kinase activity is present in insulin resistant

states. For example, insulin resistance seen in type 2

diabetes, obesity, and even aging is often accompanied

by an increase in PTP-1B activity (Elchebly et al., 1999;

Kennedy and Ramachandran, 2000; Nadiv et al., 1994).

Similarly, mutant mice lacking PTP-1B exhibit enhanced

insulin sensitivity, increased IR phosphorylation and

resistance to obesity (Klaman et al., 2000; Elchebly

et al., 1999). Thus, the attenuation of the insulin receptor

signaling, at least in part, by modulated PTP-1B activity

might be one way in which the age-dependent impair-

ment in IR function or sensitivity in rats maintained on

AL diet could be explained. The finding that a decline in

PTP-1B activity was observed in long-term CR rats

(Fig. 2) would be potentially important as it contributes

to preventing insulin resistance with age. In this regard,

higher secretion of adiponectin into the bloodstream

could regulate energy homeostasis by increasing insulin

receptor signaling in liver (Ye et al., 2003) and skeletal

muscle (Stefan et al., 2002). Future studies will be

directed at determining the relationship between adipo-

nectin and PTP-1B activity.

The finding that CR enhanced plasma adiponectin

concentrations, while reducing the triglyceride levels both

in the plasma and tissues of rats, indicated that CR might

alter the genes involved in the lipid biosynthetic path-

ways. Moreover, CR increased the expression of the

mRNAs for PPARa and its transcriptional target acyl-

CoA oxidase, and PPARg and d, as well as hormone

sensitive lipase. However, there was a reduction in the

expression of the transcription factor SREBP-1 and its

target fatty acid synthase gene during CR. Thus, CR may

reduce triglyceride accumulation in tissues by increased

expression of molecules involved in fatty acid oxidation.

Conversely, the decline in PPARa and acyl-CoA oxidase

expression that we observed in the liver of aged AL-fed

rats may possibly account for the accumulation of

triglycerides in this tissue (i.e. liver steatosis) with age

(Kersten et al., 2000). Studies in vitro (Maeda et al.,

2001) and in vivo (Yang et al., 2002; Combs et al., 2002;

M. Zhu et al. / Experimental Gerontology 39 (2004) 1049–1059 1055

Kersten et al., 2000; Spiegelman, 1998) have reported that

the increase in adiponectin secretion by PPARg agonists,

i.e. thiazolidenediones (TZDs), results from the lowering

of lipid supply to muscle and liver through a ‘lipid-

stealing’ mechanism in adipose tissue in response to

PPARg activation. Interestingly, carriers of the rare

dominant negative mutations in PPARg gene have very

low or undetectable plasma adiponectin levels (Combs

et al., 2002). The data presented in this study demon-

strated that CR attenuated the decline in PPARg mRNA

levels in liver during aging. Functional activities of

PPARg in the liver remain largely unknown (Smith,

2001). In primary cultured rat Kupffer cells, PPARg and

RXR agonists caused inhibition of lipopolysaccharide-

induced production of nitric oxide and TNFa, suggesting

that PPARg/RXR ligands might be useful in treatment of

hepatic injury associated with endotoxic shock (Uchimura

et al., 2001). In addition, our data (unpublished) indicated

that CR rats exhibited highly differentiated adipocytes

evidenced by highly expressed PPARg and adiponectin

mRNAs in white adipocytes. Therefore, one could

envision how sustained high levels of plasma adiponectin,

Fig. 4. CR attenuates age-related changes in expression levels of transcription factor mRNAs and genes involved in lipid metabolism Total RNA was isolated

from liver (rats from Fig. 2), and mRNA levels were compared by semi-quantitative RT-PCR analysis. A representative RT-PCR product is shown in panel A

(left). After normalization of the specific gene to the internal control gene, 18S rRNA, age-related changes in the expression levels of mRNAs are expressed as a

percent of 2-month AL group in panel A (right), and diet-related changes are expressed as a percent of AL rats at comparable ages in panel B. #: two-way ANOVA

yielding a significant age effect between 2-month AL and other AL groups. * p , 0:05; ** p , 0:01; *** p , 0:001 AL versus CR according to LSD test.

M. Zhu et al. / Experimental Gerontology 39 (2004) 1049–10591056

via activation of PPARg in adipose tissue and liver, might

contribute to the anti-aging effects of CR.

The observation of enhanced adiponectin levels in CR

rats was robust, but some differences appeared in the

timing between enhanced adiponectin and changes in its

potential molecular targets. This raises the possibility that

the effect of adiponectin on insulin and lipid signaling

may require a major physiologic increase, i.e. folds

increase above the basal level of circulating adiponectin

or a combination with other factors, i.e. decreased plasma

TG concentration. Consistent with this possibility is the

fact that the adiponectin monomer has a relatively high

serum concentration (approximately 0.01% of total plasma

protein), which might reflect a relatively high Kd for any

receptor–adiponectin interactions. In addition, lower

glucose levels seen in CR rats could be a consequence

of higher adiponectin levels. This notion was supported by

an injection experiment, in which adiponectin sensitized

the liver to the effects of circulating insulin, resulting in a

reduction of hepatic glucose output (Berg et al., 2001). As

a consequence, plasma glucose dropped. Also, a

single injection of purified recombinant adiponectin led

to a 2- to 3-fold elevation in circulating adiponectin

levels, which triggered a transient decrease in basal

glucose levels in normal mice, and transiently abolished

hyperglycemia in diabetic mice. This effect on glucose

was not associated with an increased insulin secretion, and

a minimal 2-fold change in circulating adiponectin levels

was required for sensitizing the liver to the effects of

circulating insulin.

Like in CR rats, mice harboring an adipose-specific

insulin receptor knockout (FIRKO) have a marked

reduction in fat mass and whole body triglyceride stores,

but exhibit high plasma adiponectin concentration (Bluher

et al., 2002). These mice are protected from obesity and

insulin resistance induced both by diet and age (Bluher

et al., 2002). Interestingly, FIRKO mice were found to

have an increase in median and maximum lifespan

(Bluher et al., 2003). This suggests that a reduction of

fat mass per se without CR may be a key contributor to

extended longevity in FIRKO mice. The fat depots in

these mice contain both small and large adipocytes, which

differ in their expression of fatty acid synthase, C/EBPa,

and SREBP-1 (Bluher et al., 2003). Difference in the

expression profile among subsets of adipocytes is known

to contribute to their insulin responsiveness (Kahn and

Flier, 2000). Likewise, protection from excessive trigly-

ceride load that is conferred by a subset of adipocytes

could be sufficient against the development of obesity and

its associated complications toward glucose tolerance and

insulin sensitivity. Interestingly, Zucker fa/fa rats treated

with truglitazone exhibit both an increase in the number

of newly differentiated small adipocytes and a decrease in

the number of large adipocytes (Okuno et al., 1998).

Large adipocytes are thought to cause peripheral insulin

resistance (e.g. skeletal muscle and liver) partly by

secreting large amounts of TNFa and free fatty acids.

Thus, it is tempting to speculate that PPARg activation by

long-term CR promotes preadipocytes differentiation into

small and insulin-responsive adipocytes, which may result

in a greater production and secretion of adiponectin. The

observation by microarray analysis that the expression of

adipogenic genes is suppressed in obese and diabetic mice

(Nadler et al., 2000) defines a feedback inhibitory

pathway leading to transcriptional regulation of adipo-

nectin. Further studies are necessary to elucidate the

underlying mechanisms for the paradoxical decline in

overall adiposity with a dramatically increase in circulat-

ing adiponectin levels in CR rats.

In summary, the present study provides new insights into

the molecular events that may contribute to beneficial

effects of CR. Specifically, CR enhanced circulating

adiponectin and decreased plasma triglyceride levels,

resulting in reduced triglyceride accumulation in tissues,

thereby improving insulin receptor signaling. Thus,

adiponectin might represent a potential target for other

interventions that mimic the effects of CR without reducing

food intake.

References

Aoyama, T., Peters, J.M., Iritani, N., Nakajima, T., Furihata, K.,

Hashimoto, T., Gonzalez, F.J., 1998. Altered constitutive expression

of fatty acid-metabolizing enzymes in mice lacking the peroxisome

proliferator-activated receptor alpha (PPARalpha). J. Biol. Chem. 273,

5678–5684.

Berg, A.H., Combs, T.P., Du, X., Brownlee, M., Scherer, P.E., 2001. The

adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat.

Med. 7, 947–953.

Bligh, E.G., Dyer, W.J., 1959. A rapid method of total lipid extraction and

purification. Can. J. Biochem. Physiol. 37, 911–917.

Bluher, M., Michael, M.D., Peroni, O.D., Ueki, K., Carter, N., Kahn, B.B.,

Kahn, C.R., 2002. Adipose tissue selective insulin receptor knockout

protects against obesity and obesity-related glucose intolerance. Dev.

Cell 3, 25–38.

Bluher, M., Kahn, B.B., Kahn, C.R., 2003. Extended longevity in mice

lacking the insulin receptor in adipose tissue. Science 299, 572–574.

Combs, T.P., Berg, A.H., Obici, S., Scherer, P.E., Rossetti, L., 2001.

Endogenous glucose production is inhibited by the adipose-derived

protein Acrp30. J. Clin. Invest. 108, 1875–1881.

Combs, T.P., Wagner, J.A., Berger, J., Doebber, T., Wang, W.J., Zhang,

B.B., Tanen, M., Berg, A.H., O’Rahilly, S., Savage, D.B., Chatterjee,

K., Weiss, S., Larson, P.J., Gottesdiener, K.M., Gertz, B.J., Charron,

M.J., Scherer, P.E., Moller, D.E., 2002. Induction of adipocyte

complement-related protein of 30 kilodaltons by PPARgamma

agonists: a potential mechanism of insulin sensitization. Endocrinology

143, 998–1007.

Desvergne, B., Wahli, W., 1999. Peroxisome proliferator-

activated receptors: nuclear control of metabolism. Endocr. Rev. 20,

649–688.

Elchebly, M., Payette, P., Michaliszyn, E., Cromlish, W., Collins, S.A.,

Himms-Hagen, J., Chan, C.C., Ramachandran, C., Gresser, M.J.,

Tremblay, M.L., Kennedy, B.P., 1999. Increased insulin sensitivity and

obesity resistance in mice lacking the protein tyrosine phosphatase-1B

gene. Science 283, 1544–1548.

M. Zhu et al. / Experimental Gerontology 39 (2004) 1049–1059 1057

Fruebis, J., Tsao, T.S., Javorschi, S., Ebbets-Reed, D., Erickson, M.R., Yen,

F.T., Bihain, B.E., Lodish, H.F., 2001. Proteolytic cleavage product of

30-kDa adipocyte complement-related protein increases fatty acid

oxidation in muscle and causes weight loss in mice. Proc. Natl Acad.

Sci. USA 98, 2005–2010.

Hansen, B.C., Bodkin, N.L., 1993. Primary prevention of diabetes mellitus

by prevention of obesity in monkeys. Diabetes 42, 1809–1814.

Havel, P.J., 2002. Control of energy homeostasis and insulin action by

adipocyte hormones: leptin, acylation stimulating protein, and adipo-

nectin. Curr. Opin. Lipidol. 13, 51–59.

Hotamisligil, G.S., Shargill, N.S., Spiegelman, B.M., 1993. Adipose

expression of tumor necrosis factor-alpha: direct role in obesity-linked

insulin resistance. Science 259, 87–91.

Hotta, K., Funahashi, T., Bodkin, N.L., Ortmeyer, H.K., Arita, Y., Hansen,

B.C., Matsuzawa, Y., 2001. Circulating concentrations of the adipocyte

protein adiponectin are decreased in parallel with reduced insulin

sensitivity during the progression to type 2 diabetes in rhesus monkeys.

Diabetes 50, 1126–1133.

Kahn, B.B., Flier, J.S., 2000. Obesity and insulin resistance. J. Clin. Invest.

106, 473–481.

Kaplan, F., Al-Majali, K., Betteridge, D.J., 2001. PPARS, insulin resistance

and type 2 diabetes. J. Cardiovasc. Risk. 8, 211–217.

Kemnitz, J.W., Roecker, E.B., Weindruch, R., Elson, D.F., Baum, S.T.,

Bergman, R.N., 1994. Dietary restriction increases insulin sensitivity

and lowers blood glucose in rhesus monkeys. Am. J. Physiol. 266,

E540–E547.

Kennedy, B.P., Ramachandran, C., 2000. Protein tyrosine phosphatase-1B

in diabetes. Biochem. Pharmacol. 60, 877–883.

Kersten, S., Desvergne, B., Wahli, W., 2000. Roles of PPARs in health and

disease. Nature 405, 421–424.

Kissebah, A.H., Sonnenberg, G.E., Myklebust, J., Goldstein, M.,

Broman, K., James, R.G., Marks, J.A., Krakower, G.R., Jacob,

H.J., Weber, J., Martin, L., Blangero, J., Comuzzie, A.G., 2000.

Quantitative trait loci on chromosomes 3 and 17 influence

phenotypes of the metabolic syndrome. Proc. Natl Acad. Sci. USA

97, 14478–14483.

Klaman, L.D., Boss, O., Peroni, O.D., Kim, J.K., Martino, J.L., Zabolotny,

J.M., Moghal, N., Lubkin, M., Kim, Y.B., Sharpe, A.H., Stricker-

Krongrad, A., Shulman, G.I., Neel, B.G., Kahn, B.B., 2000. Increased

energy expenditure, decreased adiposity, and tissue-specific insulin

sensitivity in protein-tyrosine phosphatase 1B-deficient mice. Mol.

Cell. Biol. 20, 5479–5489.

Krakoff, J., Funahashi, T., Stehouwer, C.D., Schalkwijk, C.G., Tanaka,

S., Matsuzawa, Y., Kobes, S., Tataranni, P.A., Hanson, R.L.,

Knowler, W.C., Lindsay, R.S., 2003. Inflammatory markers, adipo-

nectin, and risk of type 2 diabetes in the Pima Indian. Diabetes Care

26, 1745–1751.

Leone, T.C., Weinheimer, C.J., Kelly, D.P., 1999. A critical role for the

peroxisome proliferator-activated receptor alpha (PPARalpha) in the

cellular fasting response: the PPARalpha-null mouse as a model of

fatty acid oxidation disorders. Proc. Natl Acad. Sci. USA 96,

7473–7478.

Lindsay, R.S., Funahashi, T., Hanson, R.L., Matsuzawa, Y., Tanaka, S.,

Tataranni, P.A., Knowler, W.C., Krakoff, J., 2002. Adiponectin and

development of type 2 diabetes in the Pima Indian population. Lancet

360, 57–58.

Luke, A., Wu, X., Zhu, X., Kan, D., Su, Y., Cooper, R., 2003. Linkage for

BMI at 3q27 region confirmed in an African-American population.

Diabetes 52, 1284–1287.

Maeda, N., Takahashi, M., Funahashi, T., Kihara, S., Nishizawa, H.,

Kishida, K., Nagaretani, H., Matsuda, M., Komuro, R., Ouchi, N.,

Kuriyama, H., Hotta, K., Nakamura, T., Shimomura, I., Matsuzawa, Y.,

2001. PPARgamma ligands increase expression and plasma concen-

trations of adiponectin, an adipose-derived protein. Diabetes 50,

2094–2099.

Masoro, E.J., 2000. Caloric restriction and aging: an update. Exp. Gerontol.

35, 299–305.

Matsuzawa, Y., Funahashi, T., Nakamura, T., 1999. Molecular mechanism

of metabolic syndrome X: contribution of adipocytokines adipocyte-

derived bioactive substances. Ann. N. Y. Acad. Sci. 18, 146–154.

Nadiv, O., Shinitzky, M., Manu, H., Hecht, D., Roberts, C.T. Jr., LeRoith,

D., Zick, Y., 1994. Elevated protein tyrosine phosphatase activity

and increased membrane viscosity are associated with impaired

activation of the insulin receptor kinase in old rats. Biochem. J. 298,

443–450.

Nadler, S.T., Stoehr, J.P., Schueler, K.L., Tanimoto, G., Yandell, B.S.,

Attie, A.D., 2000. The expression of adipogenic genes is decreased in

obesity and diabetes mellitus. Proc. Natl Acad. Sci. USA 97,

11371–11376.

Okauchi, N., Mizuno, A., Yoshimoto, S., Zhu, M., Sano, T., Shima, K.,

1995. Is caloric restriction effective in preventing diabetes mellitus in

the Otsuka Long Evans Tokushima fatty rat, a model of spontaneous

non-insulin-dependent diabetes mellitus? Diabetes Res. Clin. Pract. 27,

97–106.

Okuno, A., Tamemoto, H., Tobe, K., Ueki, K., Mori, Y., Iwamoto, K.,

Umesono, K., Akanuma, Y., Fujiwara, T., Yazaki, Y., Kadowaki, T.,

1998. Troglitazone increases the number of small adipocytes without

the change of white adipose tissue mass in obese Zucker rats. J. Clin.

Invest. 101, 1354–1361.

Reaven, G.M., 1995. Pathophysiology of insulin resistance in human

disease. Physiol. Rev. 75, 473–486.

Reaven, E., Wright, D., Mondon, C.E., Solomon, R., Ho, H., Reaven, G.M.,

1983. Effect of age and diet on insulin secretion and insulin action in the

rat. Diabetes 32, 175–180.

Rondinone, C.M., Trevillyan, J.M., Clampit, J., Gum, R.J., Berg, C.,

Kroeger, P., Frost, L., Zinker, B.A., Reilly, R., Ulrich, R., Butler,

M., Monia, B.P., Jirousek, M.R., Waring, J.F., 2002. Protein

tyrosine phosphatase 1B reduction regulates adiposity and

expression of genes involved in lipogenesis. Diabetes 51,

2405–2411.

Rosen, E.D., Spiegelman, B.M., 2001. PPARgamma: a nuclear regulator of

metabolism, differentiation, and cell growth. J. Biol. Chem. 276,

37731–37734.

Smith, S.A., 2001. Peroxisome proliferator-activated receptors and the

regulation of mammalian lipid metabolism. Biochem. Soc. Trans. 30,

1086–1090.

Spiegelman, B.M., 1998. PPAR-gamma: adipogenic regulator and

thiazolidinedione receptor. Diabetes 47, 507–514.

Steppan, C.M., Bailey, S.T., Bhat, S., Brown, E.J., Banerjee, R.R., Wright,

C.M., Patel, H.R., Ahima, R.S., Lazar, M.A., 2001. The hormone

resistin links obesity to diabetes. Nature 409, 307–312.

Stefan, N., Vozarova, B., Funahashi, T., Matsuzawa, Y., Weyer, C.,

Lindsay, R.S., Youngren, J.F., Havel, P.J., Pratley, R.E., Bogardus, C.,

Tataranni, P.A., 2002. Plasma adiponectin concentration is associated

with skeletal muscle insulin receptor tyrosine phosphorylation, and low

plasma concentration precedes a decrease in whole-body insulin

sensitivity in humans. Diabetes 51, 1884–1884.

Uchimura, K., Nakamuta, M., Enjoji, M., Irie, T., Sugimoto, R., Muta, T.,

Iwamoto, H., Nawata, H., 2001. Activation of retinoic X receptor and

peroxisome proliferator-activated receptor-gamma inhibits nitric oxide

and tumor necrosis factor-alpha production in rat Kupffer cells.

Hepatology 33, 91–99.

Yamauchi, T., Kamon, J., Waki, H., Terauchi, Y., Kubota, N., Hara, K.,

Mori, Y., Murakami, K., Tsuboyama-Kasaoka, N., Ezaki, O., Akanuma,

Y., Gavrilova, O., Vinson, C., Reitman, M.L., Kagechika, H., Shudo,

K., Yoda, M., Nakano, Y., Tobe, K., Nagai, R., Kimura, S., Tomita, M.,

Froguel, P., Kadowaki, T., 2001. The fat-derived hormone adiponectin

reverses insulin resistance associated with both lipoatrophy and obesity.

Nat. Med. 7, 941–946.

Yang, W.S., Jeng, C.Y., Wu, T.J., Tanaka, S., Funahashi, T., Matsuzawa,

Y., Wang, J.P., Chen, C.L., Tai, T.Y., Chuang, L.M., 2002.

Synthetic peroxisome proliferator-activated receptor-gamma agonist,

rosiglitazone, increases plasma levels of adiponectin in type 2 diabetic

patients. Diabetes Care 25, 376–380.

M. Zhu et al. / Experimental Gerontology 39 (2004) 1049–10591058

Ye, J.M., Iglesias, M.A., Watson, D.G., Ellis, B., Wood, L., Jensen, P.B.,

Sorensen, R.V., Larsen, P.J., Cooney, G.J., Wassermann, K., Kraegen,

E.W., 2003. PPARalpha/gamma ragaglitazar eliminates fatty liver and

enhances insulin action in fat-fed rats in the absence of hepatomegaly.

Am. J. Physiol. Endocrinol. Metab. 284, E531–E540.

Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., Friedman,

J.M., 1994. Positional cloning of the mouse obese gene and its human

homologue. Nature 372, 425–432.

Zinker, B.A., Rondinone, C.M., Trevillyan, J.M., Gum, R.J., Clampit,

J.E., Waring, J.F., Xie, N., Wilcox, D., Jacobson, P., Frost, L.,

Kroeger, P.E., Reilly, R.M., Koterski, S., Opgenorth, T.J., Ulrich,

R.G., Crosby, S., Butler, M., Murray, S.F., McKay, R.A., Bhanot, S.,

Monia, B.P., Jirousek, M.R., 2002. PTP1B antisense oligonucleotide

lowers PTP1B protein, normalizes blood glucose, and improves

insulin sensitivity in diabetic mice. Proc. Natl Acad. Sci. USA 99,

11357–11362.

M. Zhu et al. / Experimental Gerontology 39 (2004) 1049–1059 1059