Journal of Surgical Research 154, 78–84 (2009)

Adiponectin Receptor-1 Expression Is Decreased in the Pancreas ofObese Mice1

Terence E. Wade, M.D., Abhishek Mathur, M.D., Debao Lu, M.D., Deborah A. Swartz-Basile, Ph.D.,Henry A. Pitt, M.D., and Nicholas J. Zyromski, M.D.2

Department of Surgery, Indiana University School of Medicine, Indianapolis, Indiana

Submitted for publication February 23, 2008

doi:10.1016/j.jss.2008.05.006

Background. Obesity is epidemic in the 21st centuryand has been shown to be a risk factor for developingsevere acute pancreatitis. Adipose tissue producessmall molecules called adipokines, which are impor-tant in modulating metabolism and inflammation. Theanti-inflammatory adipokine adiponectin is decreasedin obesity and inversely mirrors the severity of pan-creatitis in a murine experimental model. Adiponectinacts through two receptors, AdipoR1 and AdipoR2; nodata are currently available regarding adiponectionreceptor expression in the obese murine pancreas.

Materials and methods. Immunohistochemical andreverse transcription-polymerase chain reaction anal-ysis were undertaken to determine expression of adi-ponectin receptors AdipoR1 and AdipoR2 in the pan-creas and liver of lean (C57BL/6J) and congenitallyobese (LepOb and LepDb) mice.

Results. Immunohistochemistry confirmed expres-sion of both AdipoR1 and AdipoR2 in the pancreas ofall three murine strains. Staining was positive in aci-nar cells and to a lesser extent in islet cells. Pancreaticgene expression of AdipoR2 was similar among leanand obese mice. AdipoR1 gene expression, however,was significantly (P < 0.001) decreased in the pancreasof both LepOb and LepDb mice compared to wild-typelean animals. Gene expression of both AdipoR1 andAdipoR2 was significantly less in the liver of obese(LepOb and LepDb) mice compared to wild-type leananimals (P < 0.001).

Conclusions. These data show for the first time thatthe adiponectin receptors AdipoR1 and AdipoR2 areexpressed in the obese murine pancreas. The paucity

1 Presented at the 41st meeting of the Association of AcademicSurgery, February 13, 2008, Huntington Beach, CA.

2 To whom correspondence and reprint requests should be ad-dressed at Department of Surgery, Indiana University School ofMedicine, 535 Barnhill Drive, RT 130, Indianapolis, IN 46202. E-

mail: nzyromsk@iupui.edu.

780022-4804/09 $36.00© 2009 Elsevier Inc. All rights reserved.

of AdipoR1 receptors may be important when consid-ering the role played by adipokines in the genesis ofsevere pancreatitis in obesity. © 2009 Elsevier Inc. All rights

reserved.

Key Words: adiponectin; adiponectin receptors; pan-creatitis; obesity.

INTRODUCTION

Obesity is epidemic in the 21st century. This burden-some problem affects over one-third of American adultsand results in more than $120 billion in yearly healthcare costs [1]. Obesity leads to fatty infiltration andorgan dysfunction in the heart, kidney, and liver [2–4];recent evidence supports the concept that a similarsituation occurs in the pancreas [5, 6]. The increasedincidence of obesity has been accompanied by a re-newed interest in adipose tissue biology, and the mech-anisms by which fat contributes to the pathophysiologyof disease are slowly being elucidated.

Adipose tissue is no longer viewed as an inert met-abolic storage tissue. In fact, it is now recognized to bean important endocrine organ producing biologicallyactive compounds collectively referred to as adipokines[7]. Adipokines are pleiotropic molecules that modulatemetabolism and inflammation. Two of the most prom-inent, and therefore best, characterized adipokines areleptin and adiponectin. Leptin is integral in control ofsatiety and has also been shown to function as a proin-flammatory agent in many systems [8]. Circulatingleptin concentration increases in proportion to in-creased adipose tissue volume. Adiponectin, in con-trast, is generally felt to be an anti-inflammatory adi-pokine. As obesity progresses, circulating adiponectinconcentration paradoxically decreases [9, 10]. Thesechanges in the adipokine milieu contribute to the gen-

eralized proinflammatory state observed in obesity.

79WADE ET AL.: ADIPONECTIN RECEPTORS IN OBESITY

Acute pancreatitis also represents a significanthealth care problem. Each year in the United States,over 240,000 patients are hospitalized with the pri-mary diagnosis of acute pancreatitis, at a cost of over$2.3 billion [11]. It is generally accepted that prema-ture enzyme activation is responsible for the initiationof the inflammatory response seen in pancreatitis;however, the exact pathophysiology is incompletely un-derstood. The spectrum of illness in pancreatitis isbroad, with clinical manifestations ranging from mildepigastric tenderness and pancreatic edema to severe,life-threatening destruction of pancreatic and peripan-creatic tissue. The majority of patients with acute pan-creatitis manifest a mild, self-limiting disease course.Approximately 15–20% of patients, however, developsevere acute pancreatitis with a massive systemic in-flammatory response and local complications leadingto distant organ failure, and mortality rates that reach10–20% [12, 13]. Despite a tremendous amount of ba-sic and clinical research, no specific therapeutic modal-ity currently exists, and the treatment of acute pancre-atitis remains entirely supportive. Clinical studieshave consistently shown obesity to be an independentrisk factor for developing severe pancreatitis [14–16].Surprisingly little basic investigation has addressedthis association, and the mechanisms underlying thelethal combination of obesity and pancreatitis remaincompletely unknown.

We have recently shown that similar to the humansituation, congenitally obese mice develop more severepancreatitis than wild-type lean animals [5]. In theseexperiments, the severity of pancreatitis was not solelyrelated to volume of adipose tissue or concentrationof the proinflammatory adipokine leptin. An intrigu-ing observation, though, was that serum adiponectinconcentration inversely mirrored the severity of pan-creatitis, suggesting a protective effect provided bythis anti-inflammatory adipokine. Two adiponectinreceptors—AdipoR1 and AdipoR2—were identified in2003 [17]. Current evidence suggests that AdipoR1 isexpressed strongly in skeletal muscle and also dis-tributed throughout other tissues including the gut.AdipoR2 seems to be limited more preferentially to theliver in most systems [17–19]. A more complete under-standing of adiponectin physiology is in evolution, andno data are currently available regarding the expres-sion of adiponectin receptors in the obese murine pan-creas. Therefore, the aim of the current study was todefine the presence and relative density of AdipoR1and AdipoR2 in the pancreas of lean and congenitallyobese mice.

MATERIALS AND METHODS

All studies were performed with approval of the Indiana Univer-sity Institutional Animal Care and Use Committee and were inaccordance with the National Research Council guide for the care

and use of laboratory animals.

Animals and Diets

Sixteen lean (C57BL/6J), 8 obese leptin-deficient (LepOb) and 8obese leptin-resistant (LepDb) female mice were obtained from TheJackson Laboratory (Bar Harbor, ME) at 7 weeks of age. Mice werehoused in a light- (12 h light:dark) and temperature- (22°C) con-trolled room. During 1 week of environmental adjustment, mice werefed a standard low fat chow diet (Ralston Purina, St. Louis, MO). At8 weeks of age mice were fed a diet containing 25% fat (soybean oil �corn oil), 55% carbohydrate (sucrose and cornstarch), and 20% pro-tein derived calories (Dyets Inc., Bethlehem, PA) ad libitum for atotal of 4 weeks. Our lab has extensive experience and baseline dataunder these conditions. Animals and food were weighed weekly tomonitor growth and dietary intake.

Tissue Collection

At 12 weeks of age, mice were then sedated with isoflurane andanesthetized with an intraperitoneal injection of xylazine (15 mg/kg)and ketamine (50 mg/kg). The animals then underwent laparotomy andtotal pancreatectomy. A portion of each pancreas was preserved informalin for histological analysis and the remainder of each pancreaswas snap frozen in liquid nitrogen and stored at �80°C for subsequentreverse transcription-polymerase chain reaction (RT-PCR) analysis.Liver and skeletal muscle were rapidly harvested and a portion of eachwas preserved in formalin and liquid nitrogen. Blood was collected byventricular puncture and centrifuged at 15,000 rpm for 5 min to sepa-rate serum. Animals were then euthanized by exsanguination.

Immunohistochemical Analysis

Anti-AdipoR1 and anti-AdipoR2 human antibodies were obtainedfrom Vector Laboratories (Burlingame, CA). Briefly, pancreatic spec-imens fixed in formalin, embedded in paraffin, and sectioned into5-�m sections were rehydrated, and endogenous peroxidase activitywas blocked with 3% H2O2 (Sigma Aldrich, St. Louis, MO). Slideswere then blocked with 2% serum (Vector) and incubated overnightwith 100 �L of primary antibody (0.5–5.0 �g/mL in Wash Buffer-Saponin, 1:100) at room temperature in a humidified chamber.Slides were then washed three times in PBS and subsequently in-cubated at room temperature for 30 min with Vectastain Elite ABC-peroxidase reagent (Vector), peroxidase, and substrate. Counter-staining was performed with hematoxylin. Murine liver and skeletalmuscle were used as positive controls; negative control slides werestained without incubation with primary antibody. An independentand blinded observer reviewed each slide.

RT-PCR Analysis

To determine AdipoR1 and AdipoR2 mRNA expression levels inthe murine pancreata, we used PCR technique. Pancreata from leanmice were pooled two per pool and pancreata from obese mice werepooled one per group. Total RNA was isolated using RNeasy (Qiagen,Valencia, CA) according to the manufacturer’s instructions. Deter-mination of concentration, quality, and integrity of total RNA wasaccomplished with an Agilent 2100 Bioanalyzer (Agilent, SantaClara, CA). First strand cDNA synthesis was performed with SuperScript III Platinum Two-Step qRT-PCR kit (Invitrogen Life Technol-ogies, Inc., Carlsbad, CA). The cDNA used in each reaction wasderived from 100 ng of total RNA. Real-time PCR reactions werecarried out on an ABI 7500 Real-Time PCR system (Applied Biosys-tems, Foster City, CA) using Platinum Quantitative PCR SuperMix-UDG according to the manufacturer’s recommendation. The follow-ing specific primers were used: Adiponectin Receptor 1 sense:ACGTTGGAGAGTCATCCCGTAT; Adiponectin Receptor 1 anti-sense: CTCTGTGTGGATGCGGAAGAT; Adiponectin Receptor 2sense: TCCCAGGAAGATGAAGGGTTTAT; Adiponectin Receptor 2antisense: TTCCATTCGTTCGATAGCATGA (Invitrogen); 18S rRNA

was used as an internal control.

(

80 JOURNAL OF SURGICAL RESEARCH: VOL. 154, NO. 1, JUNE 1, 2009

Statistical Analysis

Statistical analyses were performed using Sigma Stat StatisticalSoftware (Jandel Corp., San Rafael, CA). All data are expressed asmean � SEM. ANOVA and the Tukey test were applied whereappropriate; P � 0.05 was considered statistically significant.

RESULTS

Animal Weight

Consistent with observations from our previous ex-periments, both congenitally obese strains of mice(LepOb and LepDb) were significantly heavier than leanC57BL/6J control animals (P � 0.001). The averageweight of lean mice was 19 � 1 g. Between the twocongenitally obese strains of mice, LepOb mice were(52 � 1 g) were significantly (P � 0.001) heavier than

LepDb mice (42 � 1 g).

Immunohistochemistry

Pancreata from eight mice in each strain were sub-jected to immunohistochemical staining for AdipoR1and AdipoR2. Representative photomicrographs dem-onstrating immunohistochemical staining of AdipoR1and AdipoR2 are depicted in Figs. 1 and 2, respectively.Immunohistochemical staining confirmed the presenceof both AdipoR1 and AdipoR2 in the pancreata of allthree murine strains. Both receptors were seen pre-dominantly in acinar cells, and to a lesser extent inislet cells. Positive results were observed for both re-ceptors in all sections examined, without grossly sig-nificant variability in the amount of staining of eachsection. No attempt was made to quantitate receptordensity based solely on immunohistochemical stain.There was no histological evidence of pancreatitis (i.e.,intraparenchymal edema, vacuolization, increased in-

FIG. 1. Immunohistochemical staining of AdipoR1 receptor inhe pancreas of (A) lean C57BL/6J, (B) obese LepOb, and (C) obeseepDb mice. Dark brown stain illustrates positive immunohisto-hemical stain (contrast Fig. 3A, negative control), which was ob-erved both on acinar cells, and to a lesser extent, on islet cellsarrows). (Color version of figure is available online.)

tLcs

flammatory cell infiltrate, or necrosis) observed in any

(a

81WADE ET AL.: ADIPONECTIN RECEPTORS IN OBESITY

strain. Representative positive and negative controlsare shown in Fig. 3. Adipo R1 stained strongly positivein skeletal muscle (positive control, Fig. 3B), whileAdipo R2 stained strongly positive in liver (Fig. 3C).

Gene Expression of Adipo R1 and Adipo R2—Pancreas

Pancreatic mRNA expression of AdipoR1 and AdipoR2is shown in Fig. 4A and B. No differences in pancreaticAdipoR2 mRNA expression were observed between anyof the three strains of mice. Interestingly, however, pan-creatic AdipoR1 mRNA expression was significantlylower in both congenitally obese strains of mice (LepOb

and LepDb) relative to lean mice (P � 0.001).

Gene Expression of AdipoR1 and AdipoR2—Liver

AdipoR1 and AdipoR2 mRNA expression in the liver is

represented in Fig. 5A and B. In the liver, mRNA expres-

sion of both AdipoR1 and AdipoR2 was significantly de-creased in both congenitally obese strains of mice (LepOb

and LepDb) relative to lean mice (P � 0.001).

DISCUSSION

Using immunohistochemical and RT-PCR tech-niques, these experiments have shown for the firsttime that adiponectin receptors AdipoR1 and AdipoR2are present in the pancreas of lean and congenitallyobese (LepOb and LepDb) mice. Immunohistochemicalstaining demonstrated both AdipoR1 and AdipoR2 tobe present predominantly in the acinar cells, and to alesser degree in islet cells of the pancreas. Gene expres-sion of AdipoR2 did not differ among the three strainsof animals studied, but interestingly, AdipoR1 mRNAwas significantly decreased in both LepOb and LepDb

FIG. 2. Immunohistochemical staining of AdipoR2 receptor ine pancreas of (A) lean C57BL/6J, (B) obese LepOb, and (C) obese

epDb mice. Dark brown stain illustrates positive immunohisto-emical stain (contrast Fig. 3A, negative control), which was ob-rved both on acinar cells, and to a lesser extent, on islet cellsrrow, C). (Color version of figure is available online.)

thLchse

mice relative to lean animals. Hepatic gene expression

82 JOURNAL OF SURGICAL RESEARCH: VOL. 154, NO. 1, JUNE 1, 2009

of both AdipoR1 and AdipoR2 were significantly de-creased in obese (LepOb and LepDb) mice relative to leananimals. It is possible that decreased hepatic expres-sion of AdipoR1 and AdipoR2 may potentiate the de-velopment of steatohepatitis. The finding of decreasedpancreatic AdipoR1 expression in congenitally obesemice may have potential significance when consideringthe contribution of an altered adipokine milieu to theincreased severity of pancreatitis observed in obesity.

Obesity leads to a generalized proinflammatorystate, a condition that exists in part because of analteration in the circulating adipokine milieu. Withincreasing obesity, circulating concentrations of theproinflammatory adipokine leptin increase, and circu-lating concentrations of the anti-inflammatory adipo-kine adiponectin paradoxically decrease. The contribu-tion of these adipokines to inflammatory disease inother organ systems such as the liver, kidney, and

cardiovascular system is well documented [2–4]. Clin-

ical studies have consistently shown obesity to be asignificant risk factor for increased severity of pancre-atitis; it is therefore logical to speculate that an alteredadipokine milieu contributes to this association. Re-markably little experimental work, however, has ad-dressed this important issue. Our group has recentlyshown that, similar to the human situation, congeni-tally obese mice develop more severe pancreatitis thanlean animals when subjected to cerulein hyperstimu-lation [5]. In these experiments, neither increased ad-ipose tissue volume per se nor the proinflammatoryeffect of leptin could fully account for this observation.However, it was noted that circulating adiponectin con-centration inversely mirrored the severity of pancre-atitis [5], suggesting that the anti-inflammatory effectof adiponectin may be important in modulating theseverity of pancreatitis.

Adiponectin acts through two receptors—AdipoR1

FIG. 3. Negative and positive control of immunohistochemicalstain. (A) Negative control in lean C57BL/6J pancreas, (B) positivecontrol for AdipoR1 in murine skeletal muscle, (C) positive control forAdipoR2 in human liver. (Color version of figure is available online.)

and AdipoR2—which were cloned in 2003 [17]. These

83WADE ET AL.: ADIPONECTIN RECEPTORS IN OBESITY

seven-transmembrane bound receptors are highly con-served from yeast to man [19, 20]. Interestingly, theN-terminus is intercellular topology that is oppositethat of all other G-protein coupled receptors. AdipoR1appears to preferentially bind globular adiponectin,while AdipoR2 interacts with the full-length molecule[20]. Initial reports suggested that AdipoR1 is ubiqui-tously distributed and prominently expressed in skel-etal muscle, while AdipoR2 appears to be primarilyfound in the liver [17–19]. Kharroubi and colleagueswere the first to report AdipoR1 and AdipoR2 mRNAexpression in human and pancreatic beta-cells [20].This finding has subsequently been confirmed by oth-ers at the gene expression and protein level [21, 22]. Inaddition, Zhou et al. showed expression of AdipoR1 inthe developing murine gut, including the pancreas[18]. The current experiments provide evidence for ex-pression of AdipoR1 and AdipoR2 in murine acinarcells, as well as islets. Adiponectin receptors are up-regulated in fasting and negatively regulated by insu-lin [23]. In addition, skeletal muscle and adipose tissuelevels of AdipoR1 and AdipoR2 were decreased in obesehumans and congenitally obese LepOb mice [24]. Thelatter finding is consistent with the current finding ofdecreased AdipoR1 mRNA expression in the pancreas,and decreased AdipoR1 and AdipoR2 mRNA expres-

FIG. 4. (A) Pancreatic expression of AdipoR1 mRNA standard-ized to expression in lean C57BL/6J. AdipoR1 gene expression issignificantly (P � 0.001) decreased in both obese strains of mice.(B) Pancreatic expression of AdipoR2 mRNA standardized to expres-sion in lean C57BL/6J. No change in AdipoR2 gene expression is seenbetween three strains of mice.

sion in the liver of obese mice relative to lean wild-type

animals. Both LepOb and LepDb mice are insulin resis-tant and hyperinsulinemic. It is therefore possible thatchanges in the circulating insulin concentration maycontribute to down-regulation of adiponectin receptorsin these obese mice. It is unclear, however, why thiseffect would be specific for AdipoR1 in the pancreas.

Circulating adiponectin concentration decreaseswith increasing obesity, both in humans as well as inLepOb and LepDb mice [5, 9, 10]. Our finding of de-creased AdipoR1 expression was therefore somewhatsurprising, as one would intuitively anticipate receptorup-regulation as a response to decreased ligand con-centration. Current understanding of adiponectin andadiponectin receptor biology is evolving and incom-plete. Adiponectin exists in three isoforms, globular,multimeric, and full length [7]. While somewhat con-troversial, it has been suggested that AdipoR1 has agreater affinity for globular adiponectin, and AdipoR2preferentially binds full-length adiponectin [9]. There-fore, it is possible that differential expression of adi-ponectin isoforms may be in some way related to de-creased AdipoR1 expression. Quantification of relativeadiponectin isoform concentrations in LepOb and LepDb

mice will be important to test this hypothesis.The mechanisms by which adiponectin exerts its

anti-inflammatory effects—i.e., by down-regulating theexpression of chemokines and adhesion molecules, andmodulating cytokine production—bear considerable

FIG. 5. (A) Hepatic expression of AdipoR1 mRNA standardizedto expression in lean C57BL/6J. (B) Hepatic expression of AdipoR2mRNA standardized to expression in lean C57BL/6J. Gene expres-sion of both AdipoR1 and AdipoR2 are significantly decreased in

obese mice (P � 0.001).

84 JOURNAL OF SURGICAL RESEARCH: VOL. 154, NO. 1, JUNE 1, 2009

similarity to the development of the inflammatory re-sponse in acute pancreatitis. The current findings ofdecreased pancreatic AdipoR1 expression are thereforeimportant, as strategies to up-regulate adiponectin re-ceptors may represent a unique method to attenuatethe inflammatory response of acute pancreatitis in obe-sity.

In conclusion, these data show for the first time thatadiponectin receptors AdipoR1 and AdipoR2 are presentin the obese murine pancreas. Interestingly, pancreaticmRNA expression of AdipoR1 (but not AdipoR2) wassignificantly decreased in two strains of congenitallyobese mice relative to wild-type lean animals. Thispaucity of pancreatic AdipoR1 receptors may be impor-tant when considering the role played by an alteredadipokine milieu in the pathogenesis of severe pancre-atitis in obesity.

REFERENCES1. Ogden CL, Carroll MD, Curtin LR, et al. Prevalence of over-

weight and obesity in the United States, 1999–2004. JAMA2006;295:1549.

2. Mokdad AH, Bowman BA, Ford ES, et al. The continuing epi-demics of obesity and diabetes in the United States. JAMA2001;286:1195.

3. Tsochatzis E, Papatheodoridis GV, Archimandritis AJ. Theevolving role of leptin and adiponectin in chronic liver diseases.Am J Gastroenterol 2006;101:2629.

4. Kumada M, Kihara S, Sumitsuji S, et al. Association of hypoa-diponectinemia with coronary artery disease in men. Arterio-scler Thromb Vasc Biol 2003;23:85.

5. Zyromski NJ, Mathur A, Yancey K, et al. Non-alcoholic steato-pancreatitis (NASP)—obesity or leptin. J Surg Res 2007;137:222.

6. Mathur A, Megan M, Lu D, et al. Nonalcoholic fatty pancreasdisease. HPB (Oxford) 2007;9:312.

7. Fantuzzi G. Adipose tissue, adipokines, and inflammation. JAllergy Clin Immunol 2005;115:911.

8. Fantuzzi G, Faggioni R. Leptin in the regulation of immunity,inflammation, and hematopoiesis. J Leukoc Biol 2000;68:437.

9. Peake PW, Kriketos AD, Campbell LV, et al. The metabolism ofisoforms of human adiponectin: Studies in human subjects and

in experimental animals. Eur J Endocrinol 2005;153:409.

10. Bruun JM, Lihn AS, Verdich C, et al. Regulation of adiponectinby adipose tissue-derived cytokines: In vivo and in vitro inves-tigations in humans. Am J Physiol Endocrinol Metab 2003;285:527.

11. Fagenholz PJ, Fernandez-del Castillo C, Harris NS, et al. Di-rect medical costs of acute pancreatitis hospitalizations in theUnited States. Pancreas 2007;35:302.

12. Uhl W, Warshaw A, Imrie C, et al. IAP Guidelines for thesurgical management of acute pancreatitis. Pancreatology2002;2:565.

13. Howard TJ, Patel JB, Zyromski N, et al. Declining morbidityand mortality rates in the surgical management of pancreaticnecrosis. J Gastrointest Surg 2007;11:43.

14. Suazo-Barahona J, Carmona-Sanchez R, Robles-Diaz G, et al.Obesity: A risk factor for severe acute biliary and alcoholicpancreatitis. Am J Gastroenterol 1998;93:1324.

15. Papachristou GI, Papachristou DJ, Avula H, et al. Obesityincreases the severity of acute pancreatitis: Performance ofAPACHE-O score and correlation with the inflammatory re-sponse. Pancreatology 2006;6:279.

16. Martinez J, Johnson CD, Sanchez-Paya J, et al. Obesity is adefinitive risk factor of severity and mortality in acute pancre-atitis: an updated meta-analysis. Pancreatology 2006;6:206.

17. Yamauchi T, Kamon J, Ito Y, et al. Cloning of adiponectinreceptors that mediate antidiabetic metabolic effects. Nature2003;423:762.

18. Zhou Y, Sun X, Jin L, et al. Expression profiles of adiponectinreceptors in mouse embryos. Gene Expr Patterns 2005;5:711.

19. Kadowaki T, Yamauchi T. Adiponectin and adiponectin recep-tors. Endocrine Rev 2005;26:439.

20. Kharroubi I, Rasschaert J, Eizirik DL, et al. Expression ofadiponectin receptors in pancreatic � cells. Biochem BiophysRes Commun 2003;312:1118.

21. Staiger K, Stefan N, Staiger H, et al. Adiponectin is function-ally active in human islets but does not affect insulin secretoryfunction or � cell lipoapoptosis. J Clin Endocrinol Metab 2005;90:6707.

22. Huypens P, Moens K, Heimberg H, et al. Adiponectin-mediatedstimulation of AMP-activated protein kinase (AMPK) in pan-creatic beta cells. Life Sci 2005;77:1273.

23. Tsuchida A, Yamauchi T, Ito Y, et al. Insulin/Foxo1 pathwayregulates expression levels of adiponectin receptors and adi-ponectin sensitivity. J Biol Chem 2004;279:30817.

24. Ouchi N, Kihara S, Arita Y, et al. Adiponectin, an adipocyte-derived plasma protein, inhibits endothelial NF-�B signalingthrough a cAMP-dependent pathway. Circulation 2000;102:

1296.