Journal of Molecular and Cellular Cardiology 49 (2010) 165–175

Contents lists available at ScienceDirect

Journal of Molecular and Cellular Cardiology

j ourna l homepage: www.e lsev ie r.com/ locate /y jmcc

Original article

Chronic treatment with anabolic steroids induces ventricular repolarizationdisturbances: Cellular, ionic and molecular mechanism

Emiliano Medei a,1, Moacir Marocolo a,1, Deivid de Carvalho Rodrigues b, Paulo Cesar Arantes a,Christina Maeda Takiya c, Juliana Silva a, Edson Rondinelli b, Regina Coeli dos Santos Goldenberg a,Antonio Carlos Campos de Carvalho a,d, José Hamilton Matheus Nascimento a,⁎a Universidade Federal do Rio de Janeiro, Instituto de Biofísica Carlos Chagas Filho, Laboratório de Eletrofisiologia Cardíaca “Antonio Paes de Carvalho”, Brazilb Universidade Federal do Rio de Janeiro, Instituto de Biofísica Carlos Chagas Filho, Laboratório de Metabolismo Macromolecular Firmino Torres de Castro, Brazilc Universidade Federal do Rio de Janeiro, Instituto de Ciências Biomédicas, Programa de Bioengenharia, Brazild Instituto Nacional de Cardiologia, Rio de Janeiro, Brazil

Abbreviations: AAS, anabolic androgenic steroids;HRV, heart rate variability; ANS, autonomic nervousduration; Ito, transient outward K+ current; APD90, actirepolarization; APD30, action potential duration at 30quantitative real-time RT-PCR; KChIP2, potassium chanleft ventricle; RV, right ventricle.⁎ Corresponding author. Laboratório de Eletrofisiolo

Carvalho”, Instituto de Biofísica Carlos Chagas Filho, CRio de Janeiro, Brazil. Tel.: +55 21 25626555; fax: +55

E-mail address: jhmn@biof.ufrj.br (J.H.M. Nasciment1 Authors had the same contribution.

0022-2828/$ – see front matter © 2010 Elsevier Ltd. Adoi:10.1016/j.yjmcc.2010.04.014

a b s t r a c t

a r t i c l e i n f o

Article history:Received 12 September 2009Received in revised form 21 April 2010Accepted 22 April 2010Available online 10 May 2010

The illicit use of supraphysiological doses of androgenic steroids (AAS) has been suggested as a cause ofarrhythmia in athletes. The objectives of the present study were to investigate the time-course and thecellular, ionic and molecular processes underlying ventricular repolarization in rats chronically treated withAAS. Male Wistar rats were treated weekly for 8 weeks with 10 mg/kg of nandrolone decanoate (DECAn=21) or vehicle (control n=20). ECG was recorded weekly. Action potential (AP) and transient outwardpotassium current (Ito) were recorded in rat hearts. Expression of KChIP2, Kv1.4, Kv4.2, and Kv4.3 wasassessed by real-time PCR. Hematoxylin/eosin and Picrosirius red staining were used for histologicalanalysis. QTc was greater in the DECA group. After DECA treatment the left, but not right, ventricle showed alonger AP duration than did the control. Ito current densities were 47.5% lower in the left but not in the rightventricle after DECA. In the right ventricle the Ito inactivation time-course was slower than in the controlgroup. After DECA the left ventricle showed lower KChIP2 (∼26%), Kv1.4 (∼23%) and 4.3 (∼70%) expressionwhile the Kv 4.2 increased in 4 (∼250%) and diminished in 3 (∼30%) animals of this group. In the rightventricle the expression of Ito subunits was similar between the treatment and control groups. DECA-treatedhearts had 25% fewer nuclei and greater nuclei diameters in both ventricles. Our results strongly suggest thatsupraphysiological doses of AAS induce morphological remodeling in both ventricles. However, the electricalremodeling was mainly observed in the left ventricle.

DECA, nandrolone decanoate;system; APD, action potentialon potential duration at 90% of% of repolarization; qRT-PCR,nel-interacting protein 2; LV,

gia Cardíaca “Antonio Paes deCS, Bloco G, UFRJ, 21941-902,21 22808193.o).

ll rights reserved.

© 2010 Elsevier Ltd. All rights reserved.

1. Introduction

Anabolic androgenic steroids (AAS) are synthetic derivatives oftestosterone. Among the types of AAS, nandrolone decanoate (DECA)has been used by athletes and non-athletes for almost five decadesin order to improve performance by increasing muscle mass andstrength [1]. However, the illicit use of AAS during recent years hasgenerated a serious public health problem [2] as AAS abuse has been

associated with cardiac conditions such as hypertrophic cardiomy-opathy [3] and sudden death [4]. In addition, arrhythmic events weredescribed secondary to the intake of AAS. While atrial fibrillation isthe more frequently observed arrhythmia [5], ventricular ectopicbeats, ventricular tachycardia and ventricular fibrillation were alsodescribed [6].

Several previous papers have demonstrated different measure-ments of ECG parameters that may provide independent prognosticinformation on ventricular arrhythmias such as QT interval, QTdispersion [7] and heart rate variability (HRV) analysis [8]. The latterhas been postulated as a potential tool for assessing the role of theautonomic nervous system (ANS) in ventricular arrhythmia [9].Accordingly, an imbalance of ANS activity has been associated withincreased cardiovascularmortality including sudden cardiac death [9].In fact, cardiac autonomic impairment with marked reductions inparasympathetic activity was demonstrated by our group in rats after8 weeks of treatment with DECA [10].

Left ventricular cardiac hypertrophy can produce alterations of re-polarization reflecting on the surface ECG. Cellular electrophysiological

166 E. Medei et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 165–175

studies have shown these alterations in repolarization to result fromprolongation of action potential duration (APD) [11]. In hypertrophiedrat hearts APD prolongation has been ascribed to a decrease in thetransient outward K+ current (Ito) density [12]. Ito is one of the moreimportant repolarizing currents that determine the early repolariza-tion phase of cardiac action potential and thus contribute to thedetermination of the repolarization phase as well as excitation–contraction coupling via modulation of Ca2+ and other K+ currents[13]. In human ventricles Kv4.3 is the main pore-forming α-subunit ofIto [14]. However, a general consensus exists that in rats Kv1.4, Kv 4.2and Kv 4.3 channels and KChIP2 beta subunits are responsible for Ito[15].

While the role of the ANS has been well studied, the ventricularrepolarization profile induced by chronic high doses of AAS remainsunknown. Thus, the objectives of the present study were: 1 — toinvestigate “in vivo” the time-course of the ventricular repolarizationprofile after DECA treatment, and 2 — to compare the electrical andhistological or morphological remodeling in both right and leftventricles in rats treated with DECA for eight weeks.

2. Methods

2.1. Experimental animals: rats treated chronically with AAS

Male Wistar rats were kept at 25±2 °C with free access to ratchow and water. Animals were randomly allocated into one oftwo experimental groups: control (n=20) and DECA (n=21). Eachgroup was subdivided into two groups: one for patch-clamp andthe other for action potential recording, molecular and histologicalstudies.

All animals received humane care in compliancewith the “Principlesof Laboratory Animal Care” formulated by the National Society forMedical Research and the “Guide for the Care and Use of LaboratoryAnimals”publishedby theNational Institutes ofHealth (NIHpublication85-23, revised 1985). Over the course of 8 weeks the DECA groupreceived 10 mg/kg of intramuscular DECA (Deca Durabolin, Organon®)weekly and the control group received the same volume of vehicle,composed of peanut oil with benzyl alcohol (90:10, V/V) [10]. Thedose of DECA used in this study was based on the studies of Trifunovicet al. [16] and Woodiwiss et al. [17]. It is important to reinforce thatthis dose is higher than the supraphysiological dose used in human(600 mg/week or 8 mg/kg/week) [18].

2.2. Biometric measures in rats treated chronically with AAS

Body weights were measured weekly and at the end of the 8thweek animals were etherized and sacrificed by cervical dislocation.The adipose tissue was dissected and weighed. The hearts werequickly removed and weighed. The cardiac hypertrophy index wascalculated as the heart weight/body weight ratio. Next, the total bodyfat was measured from the sum of the individual fat pad weights:epididymal fat plus retroperitoneal fat. Adipose tissue measurementswere made by investigators blinded to treatment group.

2.3. Electrocardiographic measurements

For the ECG recordings, two platinum electrodes were placed indirect contact with previously shaved areas of the skin near to theapex and base of the heart to allow ECGs to be acquired in a lead IIconfiguration with prominent R wave peaks.

Electrodes were connected by flexible cables to a differential ACamplifier (model 1700, A-M Systems, USA), with signals low-passfiltered at 1 kHz and digitized at a 2–10 kHz sample rate by a 16-bit A/Dconverter (Digidata 1322-A, Axon Instruments, USA) using Axoscope9.0 software (Axon Instruments, USA). Data were stored on a PC for

offline processing. All recordings were conducted in a quiet environ-ment during morning hours (07:00–11:00 h).

2.4. Action potential recordings

Both right and left endocardial ventricles were used to assess theaction potential profile in the treated and untreated groups. Musclestrips (approximately 0.5 cm×1.5 cm×0.1 cm) were isolated andpinned with the endocardial side above the bottom of a tissue bath.The preparations were superfused with an oxygenated (95% O2, 5%CO2) Tyrode's solution (in mM: 150.8 NaCl, 5.4 KCl, 1.8 CaCl, 1.0 MgCl,11.0 D-glucose, 10.0 HEPES, pH 7.4 adjustedwith NaOH and 37±0.5 °C)at a flow of 5 mL/min (Gilson Minipuls 3, USA). The tissue wasstimulated at a basic cycle length (BCL) of 1000 ms using fieldstimulation. Transmembrane potential was recorded using glassmicroelectrodes filled with 2.7 M KCL (10–40 MΩ DC resistance)connected to a high input impedance microelectrode amplifier(MEZ7200, Nihon Kohden, Japan). Amplified signals were digitized(TL-2 A/D interface and Axotape software, Axon Instrument, Inc.) andstored on a personal computer for later analysis (Clampfit 6 software,Axon Instrument, Inc.). The following parameters were measured:action potential amplitude and duration at 30% (APD30) and 90%(APD90) of repolarization [19].

2.5. Patch-clamp recordings

Cells from rat ventricles were enzymatically dispersed as previ-ously described [19]. The electrophysiological assays were performedwithin 6 h of isolation. Voltage clamp of cardiomyocytes wasperformed using the conventional whole-cell patch-clamp techniqueto measure transient outward potassium currents (Ito) [19]. Isolatedmyocytes were placed in a bath mounted on the stage of a Nikoninverted microscope (Nikon, Japan). Patch electrodes (4–9 MΩ) wereprepared from borosilicate glass pipettes on a two-stage pipette puller(Sutter Instruments, P-97, USA).

After achieving whole-cell configuration, capacitance and seriesresistance were compensated. Cells were voltage-clamped using apatch-clamp amplifier Axopatch 200 (Axon Instruments, Foster City,CA) filtered through an 8-pole Bessel low-pass filter (FrequencyDevices, 902LPF1 Haverhill, MA) with 1 kHz cut-off frequency.Currents were digitized at a frequency of 2.5 kHz using an analog-to-digital converter (Digidata 1200 and pClamp 6.04 software, AxonInstruments) connected to a PC-compatible computer. Tomeasure thevoltage dependence of Ito, test pulses were applied every 6 s from theholding potential (−60 mV) to test potentials ranging from −50 to+60 mV in 10 mV increments for 500 ms after a short pre-pulse(80 ms) to −40 mV to inactivate fast INa. Steady-state inactivationwas determined using a double-pulse protocol consisting of a 200 msconditioning pulse ranging from −50 mV to +60 mV in 10 mVincrements followed by the 500 ms test pulse to+60 mV at which thepeak of the current was measured. For whole cell recording of Ito,patch pipettes contained the following internal solution (inmM): 50.0KCl, 1.0 MgSO4, 10.0 EGTA, 80.0 L-Aspartic acid, 10.0 KH2PO4, 5.0HEPES and 3.0 Na2ATP; pH was adjusted to 7.2 with KOH. The cellswere perfused with external Tyrode's solution containing nicardipine(1 μM) to block calcium currents and TEA-Cl (tetraethylammoniumchloride) to block Ik currents. All experiments were performed at roomtemperature (22–25 °C).

2.6. Total RNA extraction and quantitative RT-PCR

The levels of mRNA expression of collagen type I and III, KChIP2,Kv1.4, Kv4.2 and Kv4.3 genes in control and treated rats weremeasured by quantitative real-time RT-PCR (qRT-PCR) in both rightand left ventricles. Following DECA or vehicle treatment the left andright ventricles were dissected and immediately frozen in liquid

Fig. 1. DECA treatment in rats modifies total fat weight but not body weight. (A) showsthe total body weight (g) during 8 weeks of treatment with DECA or vehicle (control).Week 0 represents the condition before treatment. (B) shows the difference in total fatbetween groups. Data are expressed as mean±SEM. *pb0.01 vs. control.

167E. Medei et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 165–175

nitrogen. Total RNAwas extracted from 30 mg of frozenmuscle piecesand DNase treated using the RNeasy® Fibrous Tissue Mini Kit(Qiagen) following the manufacturer's instructions. Next, 1 μg oftotal RNA was reverse-transcribed into cDNA using random primersand Super-Script III reverse transcriptase (Invitrogen) according tothe manufacturer's instructions. Real-time amplifications were car-ried out in ABI Prism 7500 (Applied Biosystems). The amplificationreactions were performed in 96-well plates in a 25 μl final volumethat contained 1 μl of 10× diluted cDNA, 12.5 μl of 2× Power SYBRMaster Mix (Applied Biosystems) and 150 nM of each forwardand reverse primer (see Table 1). The amplification program was55 °C for 2 min, 95 °C for 10 min followed by 40 cycles of 95 °C for 30 sand 58 °C for 1 min. The RT-PCR efficiency was evaluated using serialdilutions of the template cDNA and melting curve data were collectedto check the RT-PCR specificity. Each cDNA was amplified in triplicateand a corresponding sample without reverse transcriptase (no-RTsample) was included as negative control. In addition, the expressionof the chosen genes was normalized to that of GAPDH as an internalcontrol.

The relative quantities of gene-specific mRNA expression weredetermined by the comparative CT method expressed by theformula 2−(ΔCt) [20] where by CT refers to the “threshold cycle” andis determined for each plate by the 7500 Real-time PCR SystemSequence Detection Software (Applied Biosystems). ΔCt is the Ct ofthe target mRNA minus the Ct of the endogenous control (GAPDH).The fold-change in the expression of the target genes in response totreatments was calculated as follows: mean±s.d. of 2−(ΔCt) for eachcontrol and treated group followed by the determination of the ratiobetween treatment/control.

2.7. Cardiac morphological and morphometric analysis

After weighing the heart was transversally cut, fixed in 4%formaldehyde, and embedded in paraffin. Five-µm thick sectionswere obtained at the level of the papillary muscles and stained withhematoxylin-eosin (HE) for the visualization of cellular structures andPicrosirius red (PS) for the analysis of collagen according to standardprotocols [21].

Sections from each heart were visualized and examined witha light microscope (Zeiss Axiovert 200) and images of longitudinallycut cardiomyocytes from both the right and left ventricles wereacquired with AxioCam HRC Zeiss color camera using a 40× objectivelens. Quantification of collagen was estimated in PS-stained sections(percentage of stained area) while nuclei diameter for estimatingcardiomyocyte hypertrophy [22–24] and the number of cardiomyo-cyte nuclei in the total area of the histological fields were obtainedfrom HE-stained sections using the Image Pro Plus 5.0 image analysissoftware (Media Cybernetics, Silver Springs, MD, USA). Twenty-five

Table 1Sequences of primers.

Gene name Primer sequence Product length (bp)

Kv1.4 Forward GGAGGAGGCGACAGCGAACTG 220Reverse TGTGGCAGTAGGTCAGTGTAGG

Kv4.2 Forward GCAAGCAAGTTCACCAGCATCCC 130Reverse CTCCGCTCAGAGAGCAGATAGAC

Kv4.3 Forward TCCGCCAGCAAGTTCACAAGCATC 150Reverse GCAGAGCAATGACCAGGACGC

KchiP2 Forward GAGCAAACCAAGTTCACACG 157Reverse TGAAGAGAAAAGTAGCGTAGGTG

Colagen1a Forward GGAGAGTACTGGATCGACCCTAAC 77Reverse CTGACCTGTCTCCATGTTGCA

Colagen3a Forward ACCTGGACCACAAGGACAC 90Reverse TGGACCCATTTCACCTTTC

GAPDH Forward TGATTCTACCCACGGCAAGT 150Reverse AGCATCACCCCATTTGATGT

randomly chosen fields per animal were analyzed for nuclei numberand diameter whereas for collagen the areas with the highest contentof interstitial collagen were captured and measured (hot spot).

2.8. Statistics

Data were analyzed with either the unpaired t test or ANOVA andare presented as mean±SEM. pb0.05 was considered significant.

3. Results

3.1. Anabolic steroids in rats

The mean body weight after 8 weeks of DECA treatment was notstatistically different from that of the control group. However, thetotal fat was different between groups at 5.1±0.4 g (n=13) higher(pb0.01) in the control group (5.1±0.4 g; n=13) than that in theDECA group (3.8±0.3; n=14) (Fig. 1). Neither the absolute nor therelative heart weight was statistically different between the groups(Table 2).

3.2. Electrocardiographic parameters in AAS-treated rats

The QTc interval began to differ statistically between the groupsstarting at the second week of DECA treatment and continued untilthe end of the experimental period (8 weeks) when the mean valuesof QTc were 214.60±1.2 ms in the DECA group and 181.20±1.2 msin the control group (pb0.0001; Fig. 2). The cycle length neither

Table 2Effect of DECA on body and heart rats weights.

Body Weight (g) Final Heart Weight

Initial Final Absolute (g) Relative (mg.g−1)

CONTROL 275.7±11.4 323.2±14.3 1.97±0.02 6.06±0.2DECA 276.1±10.9 303.9±10.8 2.05±0.05 6.62±0.2

Fig. 2. Chronic DECA-treated rats show prolonged QTc. Fig. 2 shows prolonged QTcinterval in DECA group after the second week compared with control group. Data areexpressed as mean±SEM. Asterisk represent ***pb0.0001 vs. control.

168 E. Medei et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 165–175

differed significantly between groups at the beginning (control=143.3±4.0 ms vs. DECA=146.1±3.1 ms, pN0.05) nor at the end ofthe study (control: 132.2±2.7 ms vs. DECA: 137.8±2.1 ms).

Fig. 3. DECA treatment induces longer action potential in the left but not in the right ventrishowing that the chronic DECA treatment induced a longer AP in left (LV) but not in rightrepolarization shows that DECA significantly increased both the APD90 and APD30 in left ve

3.3. Action potential and Ito current

Action potentials were recorded in the right and the left ventriclesof both groups. TheDECA group showed longer APD30 (control: 8.40±0.3 ms, n=30 vs. DECA: 11.12±0.4 ms, n=28; pb0.0001) and APD90

(control: 80.63±1.4 ms, n=30 vs. DECA: 118.9±5.1 ms, n=28;pb0.0001) in the left ventricle when compared to the control group.However, in the right ventricle statistical differences were observedbetween groups neither in the APD90 (control=28.9±1.3 ms; n=28;vs. DECA=26.2±1.2 ms; n=28; pN0.05) nor in the APD30 (control=4.9±0.2 ms vs. DECA=3.8±0.1 ms; n=28; pN0.05) (Fig. 3).

The action potential amplitude was the same in both groups in theright (control: 82.5±1.4 mV; n=28 vs. DECA: 87.0±1.1 mV; n=28;pN0.05) and left (control: 92.5±1.5 mV,n=30vs.DECA:98.4±1.1 mV,n=28; pN0.05) ventricles.

Left ventricle Ito densities measured at the voltage range of +30 to+60 mVwere significantly decreased in the DECA group compared tothe control group (Fig. 4-A–B). Conversely, the right ventricle of bothgroups did not show statistical differences in Ito peak density at allpotentials tested (Fig. 5-A–B). In addition, the DECA treatment did not

cle. Representative traces of action potential (AP) elicited at 1000ms basic cycle length(RV) ventricle (A). In (B), AP duration measured at 90% (APD90) and 30% (APD30) ofntricle. Values are mean±SEM. ***pb0.0001.

Fig. 4. Ito density was lower in left ventricle of chronic DECA-treated rats. Representative current traces of Ito (A). Current–voltage curves show statistical difference from +30 to+60 mV in DECA (n=18) vs. control (n=15) group (B). DECA treatment did not alter the voltage dependence and kinetic of inactivation of Ito channel (C and D). Data are expressedas mean±SEM. *pb0.05, ***pb0.005 vs. control.

169E. Medei et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 165–175

modify the voltage dependence of Ito channel inactivation inmyocytesfrom both left (V50=−10.46±2.5 mV in control vs.−10.68±1.6 mVin DECA group; pN0.05; Slope=5.00±0.3 in control vs. 4.7±0.3 inDECA group; pN0.05; Fig. 4-C) and right ventricles (V50=−9.19±1.4 mV in control vs.−7.9±1.1 mV in DECA group; pN0.05; Slope=4.59±0.5 in control vs. 4.92±0.1 in DECA group; pN0.05; Fig. 5-C).However, the DECA treatment modified the inactivation kinetic ofIto in the right ventricle, as shown in Fig. 5-D. Conversely, DECA didnot modify this parameter in the left ventricle (Fig. 4-D).

The membrane capacitance measured in whole-cell patch-clampexperiments showed differences in the right ventricle when compar-ing the DECA and control groups (control: 58.46±2.2 pF vs. DECA:82.56±5.0 pF; p=0.01). In the left ventricle the capacitance ofthe DECA group was not statistically different from control (control:92.7±9.7 pF vs. DECA: 89.6±7.8 pF; p=0.8).

3.4. Kv1.4, Kv4.2 and Kv4.3 alpha subunits and KChIP2 beta subunitmRNA levels are differentially regulated in right and left ventricles afterDECA treatment

To address the potential molecular mechanisms underlying theelectrophysiological changes occurring after DECA treatment, weassessed the mRNA expression profile of KChIP2, Kv1.4, Kv4.3 andKv4.2 from either right or left ventricular homogenates. Fig. 6 showsthe normalizedmRNA levels of the Kv subunits and regulatory subunit

where the data related to the right and left ventricles of the controlgroup were set as one and the fold-change that occurred aftertreatment was determined using the ratio treatment/control. Theanalysis revealed that there was no significant difference in Kv1.4,Kv4.3 or Kv4.2 mRNA expression after treatment in right ventricles(Fig. 6-left). Nonetheless, the mRNA levels for KChIP2, Kv1.4, Kv4.3and Kv4.2 in the left ventricles changed significantly after treatment.For KChIP2, Kv1.4 and Kv4.3 the mRNA levels were found to decreasewith treatment in all hearts analyzed by 26.2%, 23.4% and 73.2%respectively. The Kv4.2 mRNA levels varied considerably among theDECA animals; themRNA levels increased by 250% in four animals anddecreased by 29% in three (Fig. 6-right).

3.5. Cardiac morphological and morphometric analysis

HE-stained sections of treated animals showed thickened ventric-ular walls with hypertrophic cardiomyocytes. Hypertrophy of cardi-omyocytes was confirmed by the significant increment in the nucleidiameter in both right (19.5%, p=0.004) and left ventricles (67.7%,pb0.0001) when compared with control animals.

Picrosirius-stained areas representing collagen deposition weremeasured and expressed as a percentage of total tissue area. Totalstained nuclei were counted and normalized by area.

Right (control=186.0±10.7 vs. DECA=142.7±4.9; pb0.0006) andleft (control=248.5±9.6 vs. DECA=176.6±8.2; pb0.0001) ventricles

Fig. 5. Chronic DECA treatment impair Ito kinetics but not density of right ventricle. Representative current traces of Ito (A). Current–voltage curves show no statistical differencebetween DECA (n=16) and control (n=13) groups (B). DECA treatment did not modulate the voltage dependence of the steady-state inactivation (C), but slowed the inactivationtime-course (tau) of Ito channel of right ventricle (D). Data are expressed as mean±SEM. *pb0.05, **pb0.005 vs. control group.

170 E. Medei et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 165–175

showed 23.3% and 28.9% less nuclei per area (μm2), respectively, inthe DECA group when compared with the control group. However,differences were observed in the Picrosirius red analysis neither in theright (control=0.8±0.1% vs. DECA=0.7±0.3%; p=0.6) nor the left(control=1.24±0.1% vs. DECA=1.3±0.2%; p=0.8) ventricles (Figs. 7and 8). Furthermore, this finding was confirmed by immunohistochem-istry protocol (data not shown). ThemRNA of collagen types I and III didnot differ between groups in both ventricles as shown in Fig. 8.

4. Discussion

The main findings of the present study are the following: 1 — AASinduces electrical ventricular repolarization alterations in rats; 2 — thedown-regulation of KChIP2, Kv1.4 and Kv4.3 explains, at least in part,the low Ito density and consequently the prolonged action potentials inthe left ventricle of the DECA group; and 3 — the presence ofapproximately 25% less nuclei and greater cardiomyocyte nucleidiameter in the ventricles of the DECA group with heart weight similarto that in the control group together suggest cardiac hypertrophy.

In the present work neither the total body weight nor the heartweight was statistically different between the groups. However, the

total fat of the DECA groupwas significant lower when comparedwiththe control group. This finding is in agreementwith the study of Rochaet al. [25] that used animals treated chronically with DECA. Becausecardiac hypertrophy is frequently associated with arrhythmias andsudden death in endurance athletes and AAS users [4], the heartweight/body weight ratio is frequently used as a metric for assessingcardiac hypertrophy [10]. Thus, in animals chronically treated withDECA Andrade et al. [26] showed an increase in heart weight andheart weight/body weight ratio, while Rocha et al. [25] only showedan increment in the heart weight/body weight ratio. Although in thepresent study this parameter was not significantly higher in the DECAgroup, other features usually present in cardiac hypertrophy such aselectrical remodeling (seen as low Ito density and prolonged actionpotential) and the low number and increased diameter of thecardiomyocyte nuclei were present in the ventricles of animalstreated with AAS.

On the other hand, our histological analysis showed an incrementneither in tissue collagen content nor in themRNA expression of typesI and III collagens. These data are partially in disagreement with thedata by Rocha et al. [25] demonstrating an increase in heart collagencontent but not mRNA expression. This discrepancy could be due to

Fig. 6. KChIP2, Kv1.4 and Kv4.3 mRNA expression levels were down-regulated in ventricles after DECA treatment. mRNA levels of Kv1.4, Kv4.3, Kv4.2 and KChIP2 in dissected piecesof right and left ventricles (RV and LV) from treated (black boxes, n=7) and control (white boxes, n=5) groups were measured by real-time RT-PCR. Data were normalized to theexpression level of the GAPDH gene. In RV (left graph) mRNA levels were not different between groups. In LV (right graph) Kv1.4, Kv4.3 and KChIP2 mRNA levels LV were down-regulated in all hearts analyzed. However, Kv4.2 was not statistically different (4 animals had mRNA levels increased and 3 animals had mRNA levels decreased after treatment).Mean±SEM data for the DECA group is expressed relative to control group. *pb0.05 vs. control group.

171E. Medei et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 165–175

differences in animal ages at the start of treatment as here we haveused rats older than those used by Rocha et al. and the treatment inthe present work was given during eight weeks (two week less thanby the other group). Furthermore, the reduction of total nuclei in theDECA-treated group also suggests a toxic effect of DECA that mayinvolve a pro-apoptotic mechanism. In this context, a previous workof Fanton et al. [27] has shown that AAS induces apoptosis. Thus,caspase-3 activity was found to be significantly increased in the heartsample from AAS-treated animals as compared to control. In additionZaugg et al. [28] also observed AAS-induced apoptotic cell death in ratventricle myocytes. Here, although we observed a toxic effect of DECAthe heart weight was the same in the two groups. Thus, the reductionin the number of nuclei per area could be interpreted as a reduction inthe number of cells and an increase in the cell volume. In fact, weobserved a greater nuclei diameter in cardiomyocytes of both rightand left DECA ventricles, a finding that is strongly related to thecardiomyocyte size [22–24]. However, in this study only the

capacitance from DECA right cardiomyocyte was greater than thatof control cells; no differences were found in the capacitance of theleft ventricles of both groups. A decreased density of T-tubules isobserved in experimental heart failure models [29,30]. Because heartfailure is associated with chronic AAS use [31,32], we can speculatethat the lower capacitance of the DECA left ventricle is due to adecreased T-tubule density.

The other novel finding described here was the participation of thepotassium current in the genesis of the longer QTc and actionpotential duration observed in the DECA group. The transient outwardK+ current, Ito, is one of the main repolarizing currents in themammalian myocardium and a general consensus exists that it flowsthrough Kv1.4, Kv4.2 and Kv4.3 channels in rats [33,34]. Changes in Itocurrent expression and/or kinetics significantly affect action potentialrepolarization as reflected in the duration of action potential and QTinterval. In addition this current is down-regulated in hearthypertrophy [35–37]. Here we show low Ito density and also Kv1.4

Fig. 7.H&E stain. Panels (A) and (C) show the RV and LV of the control group. Panels (B) and (D) represent the RV and LV of the DECA group. Note the reduction in number of nuclei inthe DECA-treated group. Magnification 400×. Bar: 20 µm.

172 E. Medei et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 165–175

and Kv4.3 down-regulation in the left ventricle of DECA group whereaction potential was longer compared to the control group. While theKv4.3 channel has a homogeneous distribution in the rat ventricularwall the Kv4.2 is higher in the epicardial and lower in the endocardialventricular wall [33,34]. These differences may explain, at least inpart, the presence of both the up-regulation of Kv4.2 in some animals(see Results) together with the longer QTc interval and actionpotential.

On the other hand, the electrophysiological properties of Ito, aremodulated by several β-subunits [38] among which KChIP2 K+

channel-interacting protein) is the most thoroughly investigated.KChIP2 increases peak Ito current density by promoting trafficking ofKv4.3 to the cell membrane [15,39], slowing inactivation, andaccelerating recovery from inactivation [40,41]. KChIP2 expressionhas been found to be significantly decreased in hypertrophy and heartfailure [9,15,42,43]. Interestingly, reduced expression of KChIP2 hasbeen reported to be responsible for the reduction in Ito noted inhuman heart failure and in a rodent model of hypertrophy and heartfailure [9,15]. In fact, KChIP2 was shown to be important for the

expression of Ito in the human heart [16] and KChIP2 deficiency inmice has been associated with a complete loss of Ito and increasedsusceptibility to ventricular arrhythmias [44] although no obviousstructural abnormalities were present. In this context, Jin H et al.(2010) showed that normalization of KChIP2 expression in hypertro-phied hearts can attenuate the development of the cardiac hypertro-phic response possibly through restoration of Ito densities andreduction of action potential duration [45]. In addition, the down-regulation of KChIP2 has been associated with mitogen-activatedprotein kinases that modulate the gene expression of this subunit[46]. Thus, in the present work this subunit was significantly down-regulated in the left ventricles of the DECA group. In this study wehave demonstrated that a decrease in KChIP2 was similar to those inthe pore-forming subunits (Kv 4.3 and 1.4).

The gene expression of Ito subunits can be modulated by thyroidhormone as shown by Abe et al. [47] and Gassanov et al. [48]. Thus, thelow thyroid hormone concentration observed in the DECA-treatedanimals, also previously shown by our group [49], could explain atleast in part the modulation of the mRNA expression profile of the Ito

Fig. 8. Chronic DECA treatment reduces total nuclei number and increase nuclei diameter in both right (RV) and left ventricles (LV). In both right and left ventricles (RV and LV) fromDECA-treated group (n=4) the number of nuclei per μm2 was significantly decreased (A), and the collagen deposition was not statistically different from control group (n=4) (B).The nuclei diameter was higher in both DECA ventricles. Data were normalized for each ventricle by the mean of the each control group (C). Both, types I and III collagen mRNAexpression was similar between groups (D and E). Data are expressed as mean±SEM. *pb0.01, **pb0.001, ***pb0.0001 vs. control group.

173E. Medei et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 165–175

alpha and beta subunits in the left ventricle in the present study.However, we did not found the canonical testosterone-receptorelement in the promoter of the genes encoding the proteins involvedon forming Ito channels. In this context, we reasoned that the effect ofthe thyroid hormone on Ito expressionmay be due to action on anotherunknown element or even by a post-transcriptional mechanism.

Even though we did not observe arrhythmias or sudden cardiacdeath, the electrical and histological remodelings mediated by DECAtaken together with the autonomic unbalance, previously observed byour group in the same model [10], strongly suggest that DECA treat-ment creates a conspicuous substrate to induce electrical disturbances.In fact, in humans it usually appears without previous symptoms, butwith structural alterations to the heart, such as myocyte hypertrophy,focal myocyte damage with myofibrillar loss, interstitial fibrosis andsmall vessel disease [50–52].

In the present study DECA was unable to induce sudden death;however, as documented in the literature this phenomena is morefrequently observed as a result of the combined effects of AAS use andexercise or vigorous weight training [50–52].

4.1. Study limitation

In the present study we used only one dose of nandrolonedecanoate and did not use any other AAS or testosterone. However,this dose of nandrolone decanoate was widely used by differentauthors to obtain a representative animal model of AAS abuse [25,26];this was the main objective of the present study. Another limitation ofthis study was that we studied only Ito. However, in rats this is themain repolarizing current. The repolarization of the action potential isalso associated with other ion channels such as other potassiumchannels, calcium channels and sodium channels [53,54]. In humanventricular repolarization other currents such as IKr, IKs, IKur, and IK1are involved in addition to Ito. Kv4.3 is the main alpha subunit of Ito inhumans and was strongly down-regulated in the DECA-treated rats,suggesting that AAS may also target this channel in humans. In fact,Kv4.3 down-regulation has been associated with increased actionpotential duration and heart failure [14,53]. In further research otherchannels involved in the AAS-induced cardiac electrical remodelingwill be investigated.

174 E. Medei et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 165–175

4.2. Conclusion

In conclusion, we have presented strong evidence suggesting thattreatment with AAS induces cardiac electrical and morphological orhistological remodeling. While the morphological cardiac remodelingwas similar in both ventricles an electrical remodeling (AP duration,ionic current density and ion channel expression) was observedmainly in the left but not in the right ventricles of the AAS-treatedgroup. Thus, the remodeling induced by DECA creates a conspicuoussubstrate for inducing electrical disturbances.

Sources of funding

The present work was supported by grants from the NationalResearch Council (CNPq-Brasil) and the Rio de Janeiro State ResearchAgency (FAPERJ).

Conflict of interest

None declared.

References

[1] Sullivan ML, Martinez CM, Gennis P, Gallagher EJ. The cardiac toxicity of anabolicsteroids. Prog Cardiovasc Dis 1998;41:1–15.

[2] Payne JR, Kotwinski PJ, Montgomery HE. Cardiac effects of anabolic steroids. Heart2004;90:473–5.

[3] Kennedy MC, Lawrence C. Anabolic steroid abuse and cardiac death. Med J Aust1993;158(5):346–8 1.

[4] Maron BJ. Sudden death in young athletes. N Engl J Med 2003;349(11):1064–7511.

[5] Sullivan ML, Martinez CM, Gallagher EJ. Atrial Fibrillation and anabolic steroids.J Emerg Med 1999;17:851–7.

[6] Nieminen MS, RamoMP, Viitasalo M, Heikkila P, Karjalainen J, Mantysaari M, et al.Serious cardiovascular side effects of large doses of anabolic steroids in weightlifters. Eur Heart J 1996;17:1576–83.

[7] Stolt A, Karila T, Viitasalo M, Mäntysaari M, Kujala UM, Karjalainen J. QT intervaland QT dispersion in endurance athletes and in power athletes using large doses ofanabolic steroids. Am J Cardiol Aug 1 1999;84(3):364–6 A9.

[8] Kleiger RE, Miller JP, Bigger JT, Moss AJ. The Multicenter Post-Infarction ResearchGroup. Decreased heart rate variability and its association with increasedmortality after acute myocardial infarction. Am J Cardiol 1987;59:256–62.

[9] Schwartz PJ, La Rovere MT, Vanoli E. Autonomic nervous system and suddencardiac death. Experimental basis and clinical observations for post-myocardialinfarction risk stratification. Circulation 1992;85(1 Suppl):I77–91.

[10] Pereira-Junior PP, Chaves EA, Costa-E-Sousa RH, Masuda MO, de Carvalho AC,Nascimento JH. Cardiac autonomic dysfunction in rats chronically treated withanabolic steroid. Eur J Appl Physiol 2006;96(5):487–94.

[11] Aronson RS. Characteristics of action potentials of hypertrophied myocardiumfrom rats with renal hypertension. Circ Res 1980;47:443–54.

[12] Tomita FA, Basset L, Myerbug R, Kimura S. Diminished transient outward currentin rat hypertrophied ventricular myocytes. Circulation 1994;75:296–303.

[13] Sah R, Ramirez RJ, Oudit GY, Gidrewicz D, Trivieri MG, Zobel C, et al. Regulation ofcardiac excitation–contraction coupling by action potential repolarization : role ofthe transient outward potassium current (Ito). J Physiol 2003;546:5–18.

[14] Dixon JE, Shi W, Wang H-S, McDonald C, Yu H, Wymore RS, et al. Role of theKv4.3 K+ channel in ventricular muscle. A molecular correlate for the transientoutward current. Circ Res 1996;79:659–68.

[15] Kobayashi T, Yamada Y, Nagashima M, Seki S, Tsutsuura M, Ito Y, et al. Contri-bution of KChIP2 to the developmental increase in transient outward current of ratcardiomyocytes. J Mol Cell Cardiol Sep 2003;35(9):1073–82.

[16] Trifunovic B, Norton GR, Duffield MJ, Avraam P, Woodiwiss AJ. An androgenicsteroid decreases left ventricular compliance in rats. Am J Physiol 1995;268:H1096–105.

[17] Woodiwiss AJ, Trifunovic B, Philippides M, Norton GR. Effects of an androgenicsteroid on exercise-induced cardiac remodeling in rats. J Appl Physiol 2000;88:409–15.

[18] Pope Jr HG, Katz DL. Affective and psychotic symptoms associated with anabolicsteroid use. Am J Psychiatry 1988;145(4):487–90.

[19] Medei EH, Nascimento JH, Pedrosa RC, Barcellos L, Masuda MO, Sicouri S, et al.Antibodies with beta-adrenergic activity from chronic chagasic patients modulatethe QT interval and M cell action potential duration. Europace Jul 2008;10(7):868–76.

[20] Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CTmethod. Nat Protoc 2008;3(6):1101–8.

[21] Dolber PC, Spach MS. Conventional and confocal fluorescence microscopy ofcollagen fibers in the heart. J Histochem Cytochem 1993;41:461–9.

[22] Koda M, Takemura G, Okada H, Kanoh M, Maruyama R, Esaki M, et al. Nuclearhypertrophy reflects increased biosynthetic activities in myocytes of humanhypertrophic hearts. Circ J 2006;70(6):710–8.

[23] Cunningham KS, Veinot JP, Butany J. An approach to endomyocardial biopsyinterpretation. J Clin Pathol 2006;59(2):121–9.

[24] Assad RS, Cardarelli M, AbduchMC, Aiello VD, MaizatoM, Barbero-Marcial M, et al.Reversible pulmonary trunk banding with a balloon catheter: assessment of rapidpulmonary ventricular hypertrophy. J Thorac Cardiovasc Surg 2000;120(1):66–72.

[25] Rocha FL, Carmo EC, Roque FR, Hashimoto NY, Rossoni LV, Frimm C, et al. Anabolicsteroids induce cardiac renin–angiotensin system and impair the beneficial effectsof aerobic training in rats. Am J Physiol Heart Circ Physiol 2007;293(6):H3575–83.

[26] Andrade TU, Santos MC, Busato VC, Medeiros AR, Abreu GR, Moysés MR, et al.Higher physiological doses of nandrolone decanoate do not influence the Bezold–Jarish reflex control of bradycardia. Arch Med Res 2008;39(1):27–32.

[27] Fanton L, Belhani D, Vaillant F, Tabib A, Gomez L, Descotes J, et al. Heart lesionsassociated with anabolic steroid abuse: comparison of post-mortem findings inathletes and norethandrolone-induced lesions in rabbits. Exp Toxicol Pathol2009;61(4):317–23.

[28] Zaugg M, Jamali NZ, Lucchinetti E, Xu W, Alam M, Shafiq SA, et al. Anabolic–androgenic steroids induce apoptotic cell death in adult rat ventricular myocytes.J Cell Physiol 2001;187(1):90–5.

[29] Lyon AR, MacLeod KT, Zhang Y, Garcia E, Kanda GK, Lab MJ, et al. Loss of T-tubulesand other changes to surface topography in ventricular myocytes from failinghuman and rat heart. Proc Natl Acad Sci U S A 2009;106(16):6854–9 21.

[30] He J, Conklin MW, Foell JD, Wolff MR, Haworth RA, Coronado R, et al. Reduction indensity of transverse tubules and L-type Ca(2+) channels in canine tachycardia-induced heart failure. Cardiovasc Res Feb 1 2001;49(2):298–307.

[31] Bispo M, Valente A, Maldonado R, Palma R, Glória H, Nóbrega J, et al. Anabolicsteroid-induced cardiomyopathy underlying acute liver failure in a young body-builder. World J Gastroenterol Jun 21 2009;15(23):2920–2.

[32] Nieminen MS, RämöMP, Viitasalo M, Heikkilä P, Karjalainen J, Mäntysaari M, et al.Serious cardiovascular side effects of large doses of anabolic steroids in weightlifters. Eur Heart J Oct 1996;17(10):1576–83.

[33] Wickenden AD, Jegla TJ, Kaprielian R, Backx PH. Regional contributions of Kv1.4,Kv4.2, and Kv4.3 to transient outward K+ current in rat ventricle. Am J Physiol1999;276(5 Pt 2):H1599–607.

[34] Casis O, Iriarte M, Gallego M, Sanchez-Chapula JA. Differences in regionaldistribution of K_ current densities in rat ventricle. Life Sci 1998;63:391–400.

[35] Knollmann BC, Knollmann-Ritschel BE, Weissman NJ, Jones LR, Morad M.Remodelling of ionic currents in hypertrophied and failing hearts of transgenicmice overexpressing calsequestrin. J Physiol Jun 1 2000;525(Pt 2):483–98.

[36] Gidh-Jain M, Huang B, Jain P, El-Sherif N. Differential expression of voltage-gatedK+ channel genes in left ventricular remodeled myocardium after experimentalmyocardial infarction. Circ Res Oct 1996;79(4):669–75.

[37] Kaprielian R, Wickenden AD, Kassiri Z, Parker TG, Liu PP, Backx PH. Relationshipbetween K+ channel down-regulation and [Ca2+]i in rat ventricular myocytesfollowing myocardial infarction. J Physiol 1999; May 15;517(Pt 1):229–45.

[38] Deschenes I, Tomaselli GF. Modulation of Kv4.3 current by accessory subunits.FEBS Lett 2002;528:183–8.

[39] AnWF, BowlbyMR, BettyM, Cao J, Ling HP, Mendoza G, et al. Modulation of A-typepotassium channels by a family of calcium sensors. Nature 2000;403:553–6.

[40] Rosati B, Grau F, Rodriguez S, Li H, Nerbonne JM, McKinnon D. Concordantexpression of KChIP2 mRNA, protein and transient outward current throughoutthe canine ventricle. J Physiol 2003;548:815–22.

[41] Deschenes I, DiSilvestre D, Juang GJ, Wu RC, An WF, Tomaselli GF. Regulation ofKv4.3 current by KChIP2 splice variants: a component of native cardiac I(to)?Circulation 2002;106:423–9.

[42] Soltysinska E, Olesen SP, Christ T,Wettwer E, Varró A, Grunnet M, et al. Transmuralexpression of ion channels and transporters in human non-diseased and end-stage failing hearts. Pflugers Arch 2009; Nov;459(1):11–23.

[43] Radicke S, Cotella D, Graf EM, Banse U, Jost N, Varró A, et al. Functional modulationof the transient outward current Ito by KCNE beta-subunits and regionaldistribution in human non-failing and failing hearts. Cardiovasc Res 2006; Sep1;71(4):695–703.

[44] Kuo HC, Cheng CF, Clark RB, Lin JJ, Lin JL, Hoshijima M, et al. A defect in the Kvchannel-interacting protein 2 (KChIP2) gene leads to a complete loss of I(to)and confers susceptibility to ventricular tachycardia. Cell 2001; Dec 14;107(6):801–13.

[45] Jin H, Hadri L, Palomeque J, Morel C, Karakikes I, Kaprielian R, et al. KChIP2attenuates cardiac hypertrophy through regulation of I(to) and intracellularcalcium signaling. J Mol Cell Cardiol 2010 Jan 4 Electronic publication ahead ofprint.

[46] Jia Y, Takimoto K. Mitogen-activated protein kinases control cardiac KChIP2 geneexpression. Circ Res 2006; Feb 17;98(3):386–93.

[47] Abe A, Yamamoto T, Isome M, Ma M, Yaoita E, Kawasaki K, et al. Thyroid hormoneregulates expression of shaker-related potassium channel mRNA in rat heart.Biochem Biophys Res Commun 1998; Apr 7;245(1):226–30.

[48] Gassanov N, Er F, Michels G, Zagidullin N, Brandt MC, Hoppe UC. Divergentregulation of cardiac KCND3 potassium channel expression by the thyroidhormone receptors alpha1 and beta1. J Physiol 2009; Mar 15;587(Pt 6):1319–29.

[49] Fortunato RS, Marassi MP, Chaves EA, Nascimento JH, Rosenthal D, Carvalho DP.Chronic administration of anabolic androgenic steroid alters murine thyroidfunction. Med Sci Sports Exerc 2006; Feb;38(2):256–61.

[50] Luke JL, Farb A, Virmani R, Sample RH. Sudden cardiac death during exercise in aweight lifter using anabolic androgenic steroids: pathological and toxicologicalfindings. J Forensic Sci 1990;35:1441–7.

175E. Medei et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 165–175

[51] Hausmann R, Hammer S, Betz P. Performance enhancing drugs (doping agents)and sudden death — a case report and review of the literature. Int J Leg Med1998;111(5):261–4.

[52] Di Paolo M, Agozzino M, Toni C, Luciani AB, Molendini L, Scaglione M, et al.Sudden anabolic steroid abuse-related death in athletes. Int J Cardiol 2007;114(1):114–7 2.

[53] Kääb S, Nuss HB, Chiamvimonvat N, O'Rourke B, Pak PH, Kass DA, et al. Ionicmechanism of action potential prolongation in ventricular myocytes from dogswith pacing-induced heart failure. Circ Res 1996;78(2):262–73.

[54] Kaprielian R, Sah R, Nguyen T, Wickenden AD, Backx PH. Myocardial infarctionin rat eliminates regional heterogeneity of AP profiles, I(to) K(+) currents,and [Ca(2+)](i) transients. Am J Physiol Heart Circ Physiol 2002;283(3):H1157–68.