Chicken pineal clock genes: implication of BMAL2 as a bidirectional regulator in circadian clock...

Chicken pineal clock genes: implication of BMAL2 as abidirectional regulator in circadian clock oscillation

Toshiyuki Okano1,2, Kazuyuki Yamamoto1,2, Keiko Okano1,2, Tsuyoshi Hirota1,2,Takaoki Kasahara1,2, Momoko Sasaki1,2, Yoko Takanaka1,2 and Yoshitaka Fukada1,2,*

1Department of Biophysics and Biochemistry, Graduate School of Science; 2JST, CREST, Japan, The University of Tokyo, Hongo7-3-1,

Bunkyo-ku, Tokyo 113-0033, Japan

Abstract

Background: In a transcription/translation-based auto-

regulatory feedback loop of vertebrate circadian clock

systems, a BMAL1-CLOCK heterodimer is a positive

regulator for the transcription of the negative element

gene Per. The chicken pineal gland represents a

photosensitive clock tissue, but the pineal clock genes

constituting the oscillator loop have been less well

characterized.

Results: We identified expression of the Per2, Bmal1,

Bmal2 and Clock genes in the chicken pineal gland.

Messenger RNA levels of these genes exhibited overt

circadian rhythms in the pineal cells, both in vivo and

in culture. In vitro functional analyses revealed the

formation of cBMAL1-cCLOCK and cBMAL2-

cCLOCK heteromers. Both of the cBMAL-cCLOCK

heteromers activated E-box element-dependent tran-

scription, which was negatively regulated by cPER2 in

luciferase assays. Co-expression of cCLOCK, cBMAL1

and cBMAL2 co-operatively activated E-box element-

dependent transcription, and a greater level of

expression of cBMAL2 inhibited the activation. In

the cultured pineal cells, an over-expression of either

cBMAL1 or cBMAL2 disrupted the circadian rhythm

of melatonin production.

Conclusion: The functional characterization of the

chicken pineal clock molecules supports the key roles

of BMAL1, BMAL2 and CLOCK which contribute to

the E-box-dependent transcriptional regulation in the

circadian clock system.

Introduction

Circadian rhythms in physiology and behaviour havebeen observed in a variety of living organisms, and areregulated by endogenous clocks (Pittendrigh 1993).These clocks oscillate autonomously, with a periodlength which is close to 24 h under constant condi-tions, and they can be entrained (synchronized) byenvironmental stimuli, most commonly by light(Dunlap 1999; King & Takahashi 2000). Similar tothe suprachiasmatic nucleus (SCN), which governscircadian functions in mammals, the pineal gland playsa pivotal role in the regulation of circadian physiologyin many non-mammalian vertebrates, and it producesmelatonin in a circadian and light-dependent mannerunder the control of the endogenous oscillator

(Zimmerman & Menaker 1979; Menaker & Wisner1983; Falcon et al. 1989; Takahashi et al. 1989). Amongothers, the chicken pineal gland has been a prominentmodel for the study of vertebrate circadian clocksystems at the cellular level, because the chickenpinealocyte retains the circadian oscillator, photic-input pathway and melatonin-output pathway evenunder culture conditions (Zatz et al. 1988; Takahashiet al. 1989; Okano et al. 1994; Bernard et al. 1997;Nakahara et al. 1997).

Recent studies on clock genes in rodents revealedthat circadian oscillators in mammals and Drosophilashare similar (but distinct) positive and negativeregulator genes forming a transcription/translation-based autoregulatory feedback loop (Dunlap 1999;King & Takahashi 2000). In the mouse, the negativeregulator genes include three period homologues, Per1(Sun et al. 1997; Tei et al. 1997), Per2 (Albrecht et al.1997; Shearman et al. 1997; Takumi et al. 1998a) andPer3 (Takumi et al. 1998b; Zylka et al. 1998), and twocryptochrome homologues, Cry1 and Cry2 (Kume et

q Blackwell Science Limited Genes to Cells (2001) 6, 825±836 825

Communicated by: Takao Shimizu*Correspondence: Department of Biophysics and Bio-chemistry, Graduate School of Science, The University ofTokyo, Hongo 7-3-1, Bunkyo-Ku, Tokyo 113-0033, Japan.E-mail: [email protected]

al. 1999; van der Horst et al. 1999). A functionalpositive regulator is a pair of basic helix-loop-helix(bHLH)-PAS transcription factors, BMAL1 andCLOCK, which together activate transcriptionthrough the CACGTG E-box found not only in thenegative regulator gene Per1 (Gekakis et al. 1998), butalso in clock controlled genes such as vasopressin (Jinet al. 1999) and albumin D-site binding protein genes(Ripperger et al. 2000). Messenger RNA levels of thepositive regulator Bmal1 also exhibit a circadianoscillation in anti-phase to those of the negativeregulators (Honma et al. 1998; Oishi et al. 1998),suggesting that the transcription of Bmal1 is interlockedor interacting with the feedback loop of the negativeregulators (Hardin & Glossop 1999; Shearman et al.2000). More recently, another regulator gene, Bmal2(also termed Mop9 or Clif) was identified in thezebrafish (Cermakian et al. 2000), human (Hogeneschet al. 2000; Maemura et al. 2000; Ikeda et al. 2000),mouse and rat (Okano et al. 2001), although thephysiological function of BMAL2 is unknown.

In birds, some of the clock genes have already beencloned (Larkin et al. 1999; Yoshimura et al. 2000;Chong et al. 2000), but their functions are almostcompletely unknown. In particular, the clock genes inthe chicken pineal gland will require investigation inorder to understand the cellular and molecular clock

system, including input and output pathways. In thisstudy we describe several clock gene orthologs whichare expressed in the gland. The functional character-ization of these genes and their products has revealedimportant roles for two of the BMALs in the clocksystem, as well as a more complex regulation of the E-box element-dependent clock gene expression thanwas expected.

Results

Identification of the chicken clock genes

In the molecular cloning of chicken pineal clock genes,we isolated cDNA clones encoding a PER-like proteinin addition to those encoding chicken CLOCK(cCLOCK; Larkin et al. 1999) and BMAL1b 0(cBMAL1; Chong et al. 2000). The PER-like proteinwas identified as cPER2 (Fig. 1A) on the basis of thehighest similarity to mPER2 among mouse PERs(Fig. 1B) and to quail PER2 (qPER2; Yoshimura et al.2000) among those deposited in the GenBankdatabase, though we found an additional 39-aminoacid stretch at the amino-terminus of cPER2 relative toqPER2. We also isolated a cDNA clone encoding aBMAL1 (ARNT3)-like protein, which was identified

Figure 1 Structure of cPER2. (A) The

amino acid sequence of cPER2. PAS

domains (PAS-A and PAS-B) and a

putative cytoplasmic localization domain

(CLD) are shown. (B) Amino acid iden-

tities (%) in domains among cPER2 and

three mouse PER proteins (mPER1-3).

T Okano et al.

Genes to Cells (2001) 6, 825±836 q Blackwell Science Limited826

as cBMAL2 (Fig. 2A,B) on the basis of a phylogeneticanalysis of ARNT family proteins (Okano et al. 2001).

A search in October 1999 revealed two humanEST clones (GenBank accession nos AA577389 andAI218390) encoding a protein similar to cBMAL2(hBMAL2). We then cloned full-length hBmal2cDNAs from a human embryonic kidney cell line(293EBNA) and identified four major variants(hBMAL2a±d; Fig. 2A). hBMAL2a±d are productsof the recently identified human gene hMop9/Clif/Bmal2 which is located at chromosome 12 (Hogen-esch et al. 2000; Maemura et al. 2000; Ikeda et al.2000).

Expression profiles of chicken clock genes in

the pineal gland in vivo and cultured pineal cells

in vitro

Temporal changes in the abundance of the chicken

clock gene transcripts (cBmal1, cBmal2, cPer2 andcClock) were examined by Northern blot analyses ofthe pineal glands in vivo (Fig. 3) and by quantitativereverse transcription-PCR (RT-PCR) analyses of thecultured pineal cells (Fig. 4). All four clock genetranscripts displayed daily fluctuations in abundance,with divergent phases and amplitudes in a 12 h-light/12 h-dark (LD) cycle and in constant darkness (DD)in vivo (Fig. 3); similar profiles were obtained in invitro experiments (Fig. 4). cPer2 mRNA levels showeda peak early in the morning and a trough at earlynight, a profile which was similar to mPer1 in themouse SCN (Sun et al. 1997; Tei et al. 1997). In thecultured pineal cells (Fig. 4), a high level expression ofcPer2 was sustained at the early light phase in LD(zeitgeber time, ZT2-6; Fig. 4), while it rapidlydeclined at circadian time (CT) 2±6 in DD. Thisindicates that pineal photoreception plays a role in theup-regulation of cPer2 expression in the middle of theday. The mRNA levels of cBmal1 and cBmal2 also

Figure 2 Structures of BMAL proteins.

(A) Comparison of the amino acid

sequences between mBMAL1b 0,cBMAL1b 0, cBMAL2 and hBMAL2a.

Basic helix-loop-helix region (bHLH),

and PAS domains are shown with bars,

and arrowheads indicate the insertion

sites of introns inferred from a compar-

ison of the cDNA sequences with human

genomic sequences in the database.

Complementary DNA clones for

hBMAL2b lack exon 4 (corresponding

to Val96±Arg109 in hBMAL2a), and those

for hBMAL2c lack both exons 3 and 4

(Gln75±Arg109) with an extended exon 1

to encode additional 11 amino acids

(GEVAGGEATAP) between Gly10 and

Gly11 in hBMAL2a. hBMAL2d is the

shortest variant whose cDNA lacks both

a part of exon 1 (as in hBMAL2a/b) and

exons 3/4 (as in hBMAL2c). (B) Amino

acid identities (%) in domains among

BMAL proteins.

Chicken pineal clock gene Bmal2


exhibited clear oscillations, and their phases wereopposite to that of cPer2. Notably, the phase of cBmal2mRNA rhythm was delayed by about 4 h relative tothat of the cBmal1 mRNA rhythm. In contrast, cClockmRNA levels showed a variation with a lower

amplitude and a broad peak at ZT10-18 and CT10-18, a peak which covered the peaks of the two BmalmRNA rhythms. A similar oscillation in cClockmRNA level has also been observed in the chickenretina (Larkin et al. 1999).

Figure 3 Temporal changes in mRNA levels of cBmal1, cBmal2, cPer2 and cClock in the chicken pineal gland. One-day-old chicks were

entrained to an LD cycle for 3 weeks, then placed in DD for 2 days, and the pineal glands were collected every 4 h over the last 3 days.

The horizontal bar at the top of the blots represents the lighting cycle (white � day; black � night; shaded � subjective day in the

dark). Each lane contained 6 mg of total RNA. The blots were first hybridized with cBmal2 or cPer2 probe, and then with histone H4.

Another blot was first hybridized with cBmal1 probe, then with histone H4, and finally with cClock probe. Signals for cBmal1 (open

circles) and cBmal2 (closed circles) were quantified by MacBAS software (Fujifilm), normalized to those for histone H4, and the mean

value was set as 1 in each case. A single cBmal1 transcript (3.3 kb), two cBmal2 transcripts (3.8 kb and 3.0 kb), three cPer2 transcripts

(9.7 kb, 7.5 kb and 4.1 kb) and a single cClock transcript (8.5 kb) were detected (arrowheads). Substantially similar expression profiles

were obtained by quantitative RT-PCR analysis in an independent experiment.

Figure 4 Temporal changes in mRNA

levels of cBmal1, cBmal2, cPer2 and cClock

in the cultured chicken pineal cells. The

pineal cells were cultured in LD cycle for

5 days and harvested every 4 h at days 6±

7. One group of cell cultures was

transferred to constant darkness (DD,

right) at day 6, and the other was kept

in LD followed by constant darkness (LD,

left). Relative mRNA levels in the

collected cells were quantified by RT-

PCR. The signal intensities were nor-

malized to those of GAPDH, and the

mean value for each gene in day 6 was set

to 1. All the values were then expressed

as the mean ^ SEM from three inde-

pendent cultures.

T Okano et al.


Interactions between cBMAL1/2, cCLOCK

and DNA

A close kinship between BMAL1 and BMAL2 amongARNT-family proteins suggested their functional similar-ity. First, we tested the physical interactions betweencBMAL1, cBMAL2andcCLOCKbyuseof a glutathione-S-transferase (GST) pull-down assay. We prepared threekinds of bacterially expressed GST-fusion proteins,

GST-cCLOCKD (a fusion of GST and Met1-Ser466

cCLOCK truncated at the carboxyl-terminal region),GST-cBMAL1 and GST-cBMAL2, each of which wasincubated with in vitro translated, 35S-labelled cBMAL1D(Met1-Ser449) or cBMAL2D (Met1-Leu458). Under con-ditions where neither of the in vitro translated proteinsboundwithGSTalone (Fig. 5, lanes 10±12),weobservedaspecific binding of GST-cCLOCKD with cBMAL1D andcBMAL2D (Fig. 5, lanes 1±3). GST-cBMAL2 bound withboth cBMAL proteins (lanes 4 and 5), and GST-cBMAL1showed similar binding profiles (lanes 7 and 8), indicatingthe potential formation of each cBMAL homodimer and acBMAL1-cBMAL2 heterodimer. The full-length forms ofcBMAL proteins also bound with the GST-fusion proteins,but their binding efficiencies were lower than the truncatedforms (not shown).

Next, a binding of cBMAL1-cCLOCK or cBMAL2-cCLOCK to the E-box element was examined byelectrophoretic mobility shift assay (EMSA). We recentlyfound a CACGTG E-box element in a promoter regionof the cPer2 gene (Doi et al. 2001), and used a 19 bpfragment corresponding to the cPer2 E-box element andits flanking sequences as a probe. Either cBMAL1 orcBMAL2 formed three or two complexes, respectively,with the probe in the presence of cCLOCK (Fig. 6,solid arrowheads in lanes 7 and 8), in addition to smallamounts of two complexes (Fig. 6, open arrowheads)which were probably attributable to endogenousproteins in the in vitro transcription/translation system.The former complexes (lanes 7 and 8) were notobserved in the absence of cCLOCK (lanes 3, 4, and6) or in the presence of cCLOCK alone (lane 5). Theseresults suggest that the cPer2 E-box element is one of thein vivo targets of the cCLOCK-cBMAL1/2 heteromer.

Transcriptional regulation by chicken clock

proteins

We investigated the ability of cBMAL1/2 to regulate

Figure 5 Physical interactions between

cBMAL and cCLOCK proteins in vitro.

GST-cCLOCKD, GST-cBMAL1, GST-

cBMAL2, or GST alone were adsorbed

to glutathione-Sepharose beads, and then

incubated with 35S-labelled cBMAL1D,

cBMAL2D or luciferase. The products

precipitated with the glutathione beads

(lanes 1±15) were analysed. Inputs (each

2.5%) were loaded in lanes 16±18, and

the faint signal observed in lane 17 is due

to an overloading of luciferase in lane 18.

Figure 6 Binding of in vitro translated PAS proteins to cPer2 E-

box-containing probe. Labelled probe was mixed with in vitro

translated products (lanes 2±8). An asterisk denotes the position

of the free probe. Solid arrowheads represent specific complexes

formed with the bHLH-PAS proteins, and open arrowheads the

complexes with proteins possibly derived from the translation

reaction mixture (background).



transactivation from the cPer2 E-box element (as a modelfor a role in the feedback loop) and from the mousevasopressin (mAVP) E-boxelement (as a model for a role inthe output pathway) by luciferase-reporter assays. Co-expression of cCLOCK, not only with cBMAL1 but alsowith cBMAL2, stimulated the transactivation from cPer2E-box (Fig. 7A, bars 6 and 7), and this stimulation wasdependent on the E-box sequence (Fig. 7A; bars 8±14).We obtained similar results using luciferase the reportergene linked either to 2.2 kb mouse Per1 promoter (mPer1promoter-luc, not shown) or to the SV40 promoter withone copy of the mAVP E-box element (Fig. 7B, mAVP E-box1-SV40-luc, bars 1±16). Interestingly, the transcrip-tional activation elicited by cBMAL2-cCLOCK showed apeak with a relatively lower dose of cBmal2 plasmid (20 ng;

bar 13), and a higher dose of cBmal2 plasmid significantlysuppressed the activation (bars 14±16). cBmal1 seems toexhibit no such inhibitory effect (bars 3±9), but this needsfurther evaluation through the amount of BMAL proteinsexpressed in 293EBNA cells. Under these conditions,neither endogenous activity of transactivation from theTPA-responsive element (TRE; bars 36±38) nor that fromthe SV40-promoter (not shown) was reduced by theapplication of a high dose (160 ng) of cBmal2.

The synchronous but slightly shifted expressionprofiles of cBmal1 and cBmal2 (Figs 3 and 4) promptedus to test the co-operative effect of cBMAL1 andcBMAL2 on transcriptional regulation. As shown in themiddle part of Fig. 7B, co-transfection of cBmal2 (10 ng)notably enhanced the cBMAL1-cCLOCK-mediated

Figure 7 Transcriptional regulation by cBMAL1, cBMAL2 and cCLOCK in 293EBNA cells. (A) Transactivation by cBMAL1,

cBMAL2 and cCLOCK assessed by SV40-driven luciferase reporter containing the cPer2-E-box element. The 293EBNA cells were

transfected with various combinations of plasmids containing cBmal1, cBmal2 and cClock cDNA. The total amount of these plasmids

applied to cells was adjusted to 1.0 mg by mixing with pcDNA3.1/V5/His empty vector. The luciferase activity derived from the

reporter was normalized by that from the internal control in each cell culture, and the data from three independent cultures were

averaged (^ SEM). The value of the control, for which only pcDNA3.1/V5/His empty vector and reporter vectors were transfected,

was set to 1. P-values were determined using Student's t-test. (B) Transactivation by cBMAL1, cBMAL2 and cCLOCK assessed by

SV40-driven luciferase reporter containing mouse vasopressin (mAVP) E-box element. The experimental conditions are the same as

those described in (A), except that fixed amounts of cBmal2 (0, 10 ng) or cBmal1 (0, 10 ng), and cClock (250 ng) plasmids were co-

transfected with various amounts (2.5, 5, 10, 20, 40, 80 or 160 ng) of cBmal1 or cBmal2 plasmid. A single copy reporter was used to

show that the co-operative effect of cBMAL1 and cBMAL2 in the presence of cCLOCK was exerted on a single E-box.

T Okano et al.


transactivation (bars 17±23), and a similar or morepronounced co-operative effect was observed with cBmal1(10 ng) for cBMAL2-cCLOCK transactivation (bars 24±30). In these cases, however, the co-operative transactiva-tion was suppressed by increasing the amount of cBmal2(80 ng and 160 ng; bars 29 and 30) or cBmal1 plasmid (40±160 ng; bars 21±23). The co-operative activation anddose-dependent suppression induced by cBMAL proteinswere also observed when cPer2 E-box3-SV40-luc or themPer1 promoter-luc was used as a reporter, albeit with lesspronounced degrees (not shown).

Next, we examined whether cPER2 inhibits thecBMAL-cCLOCK-mediated transactivation fromcPer2 E-box (Fig. 8A) and from mAVP E-box(Fig. 8B). In the both cases, cPER2 inhibited thetransactivation induced by cBMAL1-cCLOCK(Fig. 8A, bars 3 and 4; Fig. 8B, bars 3±7) and bycBMAL2-cCLOCK (Fig. 8A, bars 5 and 6; Fig. 8B,bars 8±12). Apparently, cBMAL2-cCLOCK was moresensitive to cPER2-dependent inhibition thancBMAL1-cCLOCK (Fig. 8B).

Then, the in vivo properties of cPer2 E-box-mediatedtransactivation were studied in cultured chick pinealcells. As shown in Fig. 8C, the intrinsic activity oftransactivation from the cPer2 E-box element wasmarkedly reduced by mutation of the E-box sequence,indicating that the chick pineal cells express a positivefactor which acts on the cPer2 E-box. Importantly, theover-expression of cPER2 specifically reduced cPer2 E-box-dependent activity (Fig. 8C). Taken together,these results suggest the endogenous expression of acPER2-sensitive cBMAL-cCLOCK heteromer as a

positive regulator of the E-box-dependent transcrip-tion in chicken pineal cells.

Over-expression of cBMAL1 and cBMAL2

ablated melatonin rhythm

To examine whether the rhythmic expression of cBmal1and cBmal2 is essential for maintenance of the clockoscillation, we finally over-expressed either cBMAL1 orcBMAL2 in the cultured chick pineal cells and investi-gated its effect on the rhythm of melatonin. In thisexperiment, cultured pineal cells were transfected with anempty vector (control) or an expression vector either forcBMAL1 or for cBMAL2, and the transfected cells wereselected by G418 treatment, which gave a slight phase-delaying effect on the pineal melatonin rhythm. Themelatonin rhythm was maintained in DD for several daysin control cells (Fig. 9A) and also in cells over-expressingclock-unrelated proteins such as m1- or m2-muscarinicacetylcholine receptor (our unpublished results). Incontrast to these control cells, cBMAL1- or cBMAL2-over-expressing cells displayed only a single oscillation inmelatonin production in DD (Figs 9B,C; 276±300 h),which was thereafter kept at almost constant level(Fig. 9B,C; 300±384 h). Notably, under the LD cycles,the daily fluctuation of melatonin release of cBMAL1- orcBMAL2- over-expressing cellswas quite similar to that ofcontrol cells (Fig. 9A, 232±276 h), indicating that thecellular machinery for light-dependent melatonin pro-duction was not perturbed by the over-expression ofcBMAL protein.

Figure 8 Effect of cPER2 on transcrip-

tional activation from E-box elements. (A,

B) Effect of cPER2 on cBMAL-

cCLOCK-dependent transactivation from

cPer2 E-box (A) and from mAVP E-box

(B) in 293EBNA cells. Experimental

conditions are the same as those described

in Fig. 7A, except that a constant amount

(200 ng; panel A) or various amounts (0,

5, 20, 80, 400 ng; panel B) of cPer2

plasmid were co-transfected. (C) Effect of

cPER2 on transcriptional activation from

cPer2 E-box in chick pineal cells. Chick

pineal cells were transfected with cPer2

expression plasmid or pcDNA3.1 (con-

trol) together with a reporter plasmid,

cPer2 E-box3-SV40-luc or cPer2 mut.E-

box3-SV40-luc. The values were

expressed as mean ^ SEM determined

from triplicate experiments.



Discussion

Messenger RNA levels for all the chicken clock genesexamined in this study showed circadian oscillation withcharacteristic profiles. The profiles of each gene in vivo andin vitrowere similar to each other (Figs 3 and 4), indicatingtheir close association with the oscillator intrinsic to the

pinealocyte. The results of GST-pull-down assay (Fig. 5),EMSA (Fig. 6), and transcriptional analyses (Figs 7 and 8)strongly suggest that cBMAL1, cBMAL2 and cCLOCKserve as positive regulators for the E-box element-dependent transactivation, and that they are negativelyregulated by cPER2 to form a transcription/translation-based negative feedback loop. With respect to thefundamental oscillatory mechanism, the chicken pinealclock seems to be similar to the rodent SCN clock.

Functionally, and depending on its dose, cBMAL2 islikely to act not only as an activator but also as an inhibitorfor transactivation from E-box elements, in combinationwith the other two positive regulators, cCLOCK andcBMAL1 (Fig. 7B, bars 13±16, 28±30). A similarinhibitory effect is also observed when an increasingamount of cBmal1 plasmid was co-transfected with a fixedamount of cBmal2 plasmid (Fig. 7B, bars 20±23), while anincreasing amount of cBmal1 plasmid without cBmal2plasmid apparently gave no inhibitory effect (Fig. 7B, bars3±9). These results, together with the in vitro observationof a homodimer and heterodimer composed of cBMAL1and/or cBMAL2 (Fig. 5) support the idea that thecBMAL2 homodimer or cBMAL1-cBMAL2 heterodi-mer, both lacking in transactivation ability, would competewith the active complex cBMAL-cCLOCK. Such acomplex of cBMAL1/2 homodimer or heterodimer withthe DNA probe was not detected in EMSA using fixedcombinations of in vitro translated proteins (Fig. 6), and wespeculate that additional factor(s) may be required for theDNAbinding and transcriptional regulation.Alternatively,we may assume the formation of more complex multimerscomposed of cBMAL1, cBMAL2 and cCLOCK on asingle E-box, because the cooperative transactivation andits inhibition was seen even when we used a reporter withjust a single copy of the E-box (Fig. 7B).

Considering the implication of the occurrence of twoBmal genes, we must emphasize the difference in phaseof circadian gene expression between cBmal1 and cBmal2(Figs 3 and 4). Such a slight shift would produce aremarkable change in relative ratio between the twoBMAL proteins. Since these proteins co-operativelygave stimulatory and inhibitory effects on transactivationin a dose-dependent manner (Fig. 7), cBMAL2 mayenhance and reduce cBMAL1-cCLOCK-mediatedtransactivation when cBMAL1 is in the accumulatingand the declining phase, respectively. Such a potentialfunction of cBMAL2 as a phase-dependent modulatormay contribute to sharpening of the timing of thetranscriptional activation from E-box elements.

Potential roles of the two cBMALs as pineal clockregulators are supported by the fact that an over-expressionof cBMAL1 or cBMAL2 in the cultured pineal cells causes

Figure 9 Effect of over-expression of cBMAL1 or cBMAL2 on

the melatonin rhythms of cultured chick pineal cells. Chick

pineal cells were transfected with pcDNA3.1-V5/His empty

vector (control, A) or with the same vector containing cDNA of

cBmal1 (B) or cBmal2 (C). After selection of the transfected cells,

the culture media were collected every 4 h. Averages of the

melatonin levels observed during the LD cycles were set to 1.

For each panel, data from four independent cultures were shown

with different symbols. The horizontal bar at the bottom of the

panels represents the lighting conditions.

T Okano et al.


a dampening of the melatonin rhythm in DD (Fig. 9). Itseems most likely that the over-expression fixed the E-boxenhancer activity at a constant level to result in dampeningof the rhythmic expression of clock genes such as Per2.Alternatively, the over-expression could have altered theperiod length of the circadian clock in each transfected celldiversely, depending on the amount of expressed BMALproteins. Such a heterogeneous effect might also cause theapparent and rapid dampening of the melatonin rhythm.The apparent rhythmicity in melatonin productionobserved in LD cycles could simply be attributable to theinhibitory effect of light on melatonin production(Takahashi et al. 1989). The possibility that the over-expression modified only the output pathway withoutaffecting the core feedback loop seems less likely, becausetheE-box-mediated circadian transcription is postulated tobe directly involved in both the core loop and the outputpathways for regulation of clock-controlled genes such asthe AVP gene in the mouse SCN (Jin et al. 1999).

A recent analysis of Bmal1 knockout mice (Bungeret al. 2000) demonstrated that BMAL1 is an essentialcomponent in the circadian oscillator in mammals.Although we have no information about a redundancyof BMAL2 for oscillator function, the present results ofthe over-expression experiments (Fig. 9), together withthe rhythmic expression of the mRNA (Figs 3 and 4)and the protein function (Figs 5±8), all supportimportant roles of the two BMALs in the circadianoscillator function regulating the melatonin rhythm. Theidentification of chicken clock genes and their functionalcharacterization in vivo and in vitro have opened a newmethod for the examination of molecular links betweenthe central clock components and the photic-input ormelatonin-output pathways in the pineal gland.

Experimental procedures

Animals

Animals were treated in accordance with the guidelines of The

University of Tokyo.

Cloning and sequencing

cClock cDNA was isolated from chicken pineal cDNA by PCR

using LA-Taq polymerase (Takara, Kyoto, Japan) with a pair of

primers (primers: 5 0-ACTAGTCGACTTATGTTTTTTACC

ATAAGCACC and 5 0-GTCGACCTGCGCTACTGTGGCT

GAGCTTTG) which were designed on the basis of sequences

of cClock genes in GenBank (accession nos AF132531 and

AF144425). One clone with no PCR error was selected

(GenBank accession no. AF246959). A 273 bp fragment of

cPer2 cDNA was first obtained by PCR using Taq-Gold

polymerase (Applied biosystems) with a pair of degenerate

primers [per-F, 5 0-CAGCAGAT(C/G)A(A/G)CTG(C/

T)IT(C/G)IGACAG(C/T)(A/G)TC(A/C)TCAG and per-R,

5 0-GCT(A/G)CACTG(A/G)CTG(A/G)TG(A/C)(C/G)IGAC

(A/G)CCAC(A/G)CTC] which were designed on the basis of

the nucleotide sequences of dPer and mammalian Per genes.

Based on the internal sequence of the amplified product, we

synthesized the cPer2-R1 primer (5 0-TTGCTGTACCAGG-

CACATTACAAC), which was used together with another

degenerate primer [YK-F1, 5 0-(A/G)TICA(C/T)TCIGGI-

TA(C/T)CA(A/G)GCICCI(A/C)GIATICC] to amplify a

longer cDNA fragment (P2-5, 886 bp). This fragment was used

as a hybridization probe for screening of the chicken pineal

cDNA library (lZAPII, 5 � 105 pfu) so as to isolate the clone

Pa (3584 bp) encoding a larger part of putative cPER2 (Met1±

Arg1014). This clone and a cDNA clone obtained by subsequent

3 0-RACE were ligated together to generate a full-length clone

for cPER2 (Met1-Thr1344; GenBank accession no.

AF246956). Partial cDNA clones encoding cBMAL1 and

cBMAL2 were obtained by PCR using LA-Taq polymerase with

a pair of degenerate primers [BMAL-F, 5 0-GTGCT(A/C)(A/C)

GGATGGC(A/T)GT(G/T)CAGC and BMAL-R, 5 0-GCG

(C/T)CC(A/G)ATTGC(A/C/G)AC(A/G)AGGCAG], which

were designed on the basis of nucleotide sequences of Bmal1

from mammals and Drosophila (dCycle). The amplified fragment

and cDNA clones obtained by subsequent 5 0-RACE were used

as probes for screening of the chicken pineal cDNA library

(lZAPII, 3.5 � 105 pfu), which resulted in the isolation of

cDNA clones covering entire coding regions for cBMAL1b 0

(GenBank accession no. AF246957) and cBMAL2 (AF246958).

The initiation methionine of cBMAL1b 0 was estimated by

comparison with the other BMAL1 sequences. The estimated

initiation methionine of cBMAL2 fulfilled the following three

criteria: (i) A nonanucleotide sequence (CCGCCATGG) near

the site completely matched Kozak's translation initiation

consensus (Kozak 1984). (ii) The cDNA clone (3.4 kb) and

mRNA (3.8 kb and 3.0 kb) were similar in size to each other.

(iii) A promoter region predicted from its genomic analysis

contained upstream in-frame stop codons (not shown). A

partial sequence information of hBmal2 (GenBank accession

nos AA577389 and AI218390) was obtained by in silico screening

using cBmal2 as a probe. Several cDNA clones containing the 5 0-untranslated region of the hBmal2 gene were isolated from

293EBNA cDNA by 5 0-RACE. Then, a pair of primers

(hB2F1, 5 0-GACCAAGTGGCTCCTGCGAT and hB2R1, 5 0-GCTAGAGGGTCCACTGGATG) were designed to amplify

the full-length clones. To eliminate PCR errors, we sequenced

17 full-length cDNA clones, and determined the entire coding

sequences of hBMAL2a±d (GenBank accession nos

AF246960±AF246963), which were completely consistent with

human genomic sequences (GenBank accession nos AC021737

and AC016008).

RNA analyses

Northern blot analyses were performed as previously described



(Takanaka et al. 1998). After hybridization, the blots were

washed in 0.1 � SSC at 50 8C (10 min, three times), and then

subjected to analysis by FLA2000 bioimage analyser (Fujifilm,

Tokyo, Japan). The entire coding regions of cBmal1, cBmal2 and

cClock were used for the probes. cPer2 probe was prepared from

the cDNA clone P2-5 (see above). Chicken histone H4 cDNA

used as a probe was obtained by PCR with a pair of primers (5 0-CATGTCTGGCAGAGGCAAG and 5 0-TTAGCCGCCGA

AGCCGTAG) which were designed on the basis of the

sequence deposited in GenBank (accession no. M74533). A

quantitative RT-PCR analysis was performed as previously

described (Hirota et al. 2001). Briefly, the pineal cells prepared

from 1-day-old chicks were plated on a 35 mm dish (cells from

eight pineal glands per dish) and cultured in Medium 199 (Life

Technologies, Tokyo, Japan) supplemented with 10% foetal

bovine serum. At the indicated time points, the cells were

suspended in TRIzol reagent (Life Technologies) and stored at

280 8C until subsequent isolation of total RNA. One

microgram of total RNA was reverse-transcribed by SuperScript

II (Life Technologies) reverse transcriptase, and a portion of the

reaction product was used for the PCR analysis. We first

determined an optimal number of PCR cycles under our

experimental conditions for each primer set to give a linear

relationships between the template cDNA and the amplified

products. The primers and numbers of the PCR cycle were as

follows: For cBmal1, cB1F1600-primer 5 0-TCCAGACA

TTTCTTCAGCTGG and cB1REND-primer 5 0-GGATGTT

GAAGCAAGGTGC, 23 cycles; for cBmal2, cB2F1270-primer

5 0-ACGAGTACTGCCATCAAGATG and cB2REND-primer

5 0-GAGAGCCCATTGGATGTCAC, 23 cycles; for cClock,

cqCF862-primer 5 0-TTCTTGGATCACAGGGCAC and

cqCR1364-primer 5 0-GGAGTGCTAGTGTCCACTGTCA,

25 cycles; for cPer2, cP2RTF-primer 5 0-GGAAGTCCTTGC

AGTGCATAC and cP2RTR-primer 5 0-ACAGGAAGCGGAT

ATGCAG, 24 cycles; for GAPDH (GenBank accession no.

K01458), cGAF-primer 5 0-ACCACTGTCCATGCCATCAC

and cGAR-primer 5 0-TCCACAACACGGTTGCTGTA, 15

cycles. The products were subjected to 7.5% native polyacry-

lamide gel electrophoresis, stained with SYBR Green I

(Molecular Probes, OR), and quantified by FLA2000bioimage

analyser (Fujifilm).

Pull-down assay

GST-fusion proteins and GSTalone were bacterially expressed in

BL21 E. coli strain by use of a pGEX5X-1 expression vector.

Because a fusion protein composed of GST and full-length

cCLOCK was not solubilized by 2% Triton X-100, we used

instead a truncated cCLOCK protein (Met1±Ser466) fused to

GST. This protein (termed GST-cCLOCKD), GST-cBMAL1,

or GST-cBMAL2 was extracted with buffer A (10 mm Na-

phosphate [pH 7.4], 140 mm NaCl, 1 mm MgCl2, 10 mm

EDTA, 5 mm 2-mercaptoethanol) containing 2 mm PMSF and

one tablet per 50 mL Complete EDTA-free protease inhibitor

(Roche Diagnostics, Tokyo, Japan), and purified by glutathione-

Sepharose column (Amersham Pharmacia Biotech, Tokyo,

Japan). On the other hand, cBMAL1D (Met1±Ser449),

cBMAL2D (Met1±Leu458) or luciferase (control) was in vitro

transcribed and translated from the expression plasmid contain-

ing the cDNA with the aid of TNT-T7 Quick Coupled

Transcription/Translation System (Promega, Tokyo, Japan) in

the presence of [35S]methionine. An aliquot of each mixture

(8 mL) was mixed with 40 mL of glutathione-Sepharose beads,

to which GST-cCLOCKD (0.1 mg), GST-cBMAL1 (1.1 mg),

GST-cBMAL2 (3.3 mg), or GST alone (5.6 mg) had been

bound. The mixtures were then incubated in 140 mL of buffer B

(20 mm Hepes-NaOH [pH 7.9], 20%(w/v) glycerol, 15 mm

KCl, 0.2% Triton X-100, 2.5% skim milk, one tablet per 50 mL

Complete EDTA-free protease inhibitor) on ice for 1 h with

gentle rotation. After washing four times with buffer C (10 mm

Tris-HCl [pH 7.5], 0.2% Triton X-100, 150 mm NaCl, 2 mm

EDTA, 1 mm PMSF, one inhibitor tablet per 50 mL), the

mixtures were subjected to SDS±polyacrylamide (10%) gel

electrophoresis and the gel was analysed using an FLA2000 as

described above.

Emsa

For the preparation of a probe, we synthesized oligonucleotides

(cP2E1-S, 5 0-GTGTCACACGTGAGGCTTA, and cP2E1-AS,

5 0-TAAGCCTCACGTGTGACAC) corresponding to the E-

box element and its flanking sequences within a putative

promoter/enhancer region of cPer2 gene (Doi et al. 2001). These

were annealed together and subcloned into a pCR2.1 vector

(TOPO-TA cloning kit, Invitrogen, CA), from which a 39 bp

EcoRI fragment was excised and used as a probe. cBMAL1,

cBMAL2 and cCLOCK were in vitro transcribed and translated

from the expression plasmid containing the cDNA with the aid

of the TNT-T7 Quick Coupled Transcription/Translation

System (Promega). For the EMSA, an aliquot of each in vitro

translated mixture (5 mL) was incubated for 20 min at 23 8Cwith 32P-labelled probe (33 fmoles, 1.3 � 105 cpm) in 25 mm

Hepes-KOH (pH 7.6), 100 mm KCl, 0.1 mm EDTA, 10%(v/v)

glycerol, 7.5 mm MgCl2, 1 mm DTT, and 1 mg denatured

salmon sperm DNA in a total volume of 32 mL. The mixture

was separated by a 6% polyacrylamide gel and the gel was

analysed as described above.

Transcriptional assay using 293EBNA cells

Human embryonic kidney 293EBNA cells were plated at

3 � 105 cells per well in six-well plates, and the next day

transfected using Lipofectamine plus (Life Technologies) with a

total of 1.0 mg of the various expression plasmids containing the

indicated inserts in pcDNA3.1/V5/His (with a stop codon for

expression of the intact protein without tags) (Invitrogen), 25 ng

of firefly luciferase reporter (derivatives of pGL3-Promoter,

Promega), and 0.25 ng of Renilla luciferase (internal control)

reporter, pRL-CMV (Promega). Two days after transfection, cell

extracts were subjected to dual-luciferase assays by luminometry

(Promega) according to the manufacturer's protocol. For each

extract, the firefly luciferase activity was normalized by Renilla

T Okano et al.


luciferase activity. Reporter plasmids were as follows: (i) cPer2 E-

box3-SV40-luc. The E-box element, CACGTG and its flanking

sequences within the promoter/enhancer region of cPer2 gene

(Doi et al. 2001) were linked in tandem (5 0-GTGTCACACGT

GAGGCTTAGTGTCACACGTGAGGCTTAGTGTCACAC

GTGAGGCTTA), and it was inserted into Bgl II site in an

SV40-driven luciferase reporter (pGL3-Promoter). In a reporter

plasmid, cPer2 mut.E-box3-SV40-luc, the E-box sequences were

mutated into GGACCT in a similar way as previously reported

(Jin et al. 1999). (ii) mAVP E-box1-SV40-luc. The E-box

element, CACGTG and its flanking sequences within the

promoter/enhancer region of the mouse vasopressin (mAVP)

gene were linked (5 0-TCAGGCCCACGTGTCCCA), and it

was inserted into Bgl II site in the pGL3-Promoter vector. A

reporter plasmid, mAVP mut.E-box1-SV40-luc was prepared in

the same way as in (i). (iii) mAVP E-box3-SV40-luc. The E-box

element, CACGTG and its flanking sequences within the

promoter/enhancer region of (mAVP) gene were linked in

tandem, and it was inserted into the pGL3-Promoter vector as

previously reported (Jin et al. 1999). A reporter plasmid, mAVP

mut.E-box3-SV40-luc was prepared in the same way as in (i). (iv)

hCol TRE3-SV40-luc. TPA responsive element (TRE) and its

flanking sequences within human collagenase gene were linked

in tandem (5 0-CGGCTGACTCA TCAAGCTGACTCAT-

CAAGCTGACTCATCAA), and it was inserted into BglII site

in a TK-driven luciferase reporter (pGL3-TK-promoter vector)

which was produced by ligating a 752-bp BglII-HindIII

fragment of the pRL-TK vector (Promega) into a pGL3-Basic

vector.

Transcriptional assay using chicken pineal cells

The pineal cells prepared from 1-day-old chicks were plated at

4 � 105 cells per well in 24-well plates and cultured under an

LD cycle. At ZT9 on the third day, they were transfected with

500 ng of either cPer2 expression plasmid (as described above) or

pcDNA3.1/V5/His (control), in combination with 250 ng of

cPer2 E-box3-SV40-luc, or cPer2 mut.E-box3-SV40-luc, and

5 ng of pRL-CMV (Promega) by using Lipofectamine plus. At

ZT6 on the next day of the transfection, cell extracts were

subjected to dual-luciferase assay as described above.

Over-expression experiments

The chick pineal cells were cultured in 24-well cloning plates

(Greiner Labortechnik, Frickenhausen, Germany) for 2 days,

and transfected with 500 ng of either cBMAL1 or cBMAL2

expression plasmid (described above) or pcDNA3.1/V5/His

(control) using a combination of Lipofectamine plus (Life

Technologies) and Genefector (VennNova LLC, FL). From

2 days after transfection, the cells were cultured in media

containing 200 mg/L G418 (Life Technologies) for 4 days to

select the transfected cells, which were further cultured in the

media containing 50 mg/L G418. The culture medium was

exchanged with a new one every 4 h to quantify the released

melatonin as previously described (Sanada et al. 2000). Detailed

procedures will be described elsewhere (our unpublished

results).

Acknowledgements

We thank Dr K. Sanada, and Messrs. K. Yokoyama, M. Doi, Y.

Nakajima and K. Imazato for technical assistance. This study was

supported in part by Grants-in-Aid for Scientific Research from

the Japanese Ministry of Education, Culture, Sports, Science and

Technology. K.O., T.H., T.K. and Y.T. were supported by

Fellowships from the Japan Society for the Promotion of Science

for Young Scientists.

References

Albrecht, U., Sun, Z.S., Eichele, G. & Lee, C.C. (1997) A

differential response of two putative mammalian circadian

regulators, mper1 and mper2, to light. Cell 91, 1055±1064.

Bernard, M., Klein, D.C. & Zatz, M. (1997) Chick pineal clock

regulates serotonin N-acetyltransferase mRNA rhythm in

culture. Proc. Natl. Acad. Sci. USA 94, 304±309.

Bunger, M.K., Wilsbacher, L.D., Moran, S.M., et al. (2000)

Mop3 is an essential components of the master circadian

pacemaker in mammals. Cell 103, 1009±1017.

Cermakian, N., Whitmore, D., Foulkes, N.S. & Sassone-Corsi,

P. (2000) Asynchronous oscillations of two zebrafish CLOCK

partners reveal differential clock control and function. Proc.

Natl. Acad. Sci. USA 97, 4339±4344.

Chong, N.W., Bernard, M. & Klein, D.C. (2000) Characteriza-

tion of the chicken serotonin N-acetyltransferase gene. J. Biol.

Chem. 275, 32991±32998.

Doi, M., Nakajima, Y., Okano, T. & Fukada, Y. (2001) Light-

induced phase-delay of the chicken pineal circadian clock is

associated with the induction of cE4bp4, a potential

transcriptional repressor of cPer2 gene. Proc. Natl. Acad. Sci.

USA 98, 8089±8094.

Dunlap, J.C. (1999) Molecular bases for circadian clock. Cell 96,

271±290.

Falcon, J., Marmillon, J.B., Claustrat, B. & Collin, J.P. (1989)

Regulation of melatonin secretion in a photoreceptive pineal

organ: an in vitro study in the pike. J. Neurosci. 9, 1943±1950.

Gekakis, N., Staknis, D., Nguyen, H.B., et al. (1998) Role of the

CLOCK protein in the mammalian circadian mechanism.

Science 280, 1564±1569.

Hardin, P.E. & Glossop, N.R. (1999) The CRYs of flies and

mice. Science 286, 2460±2461.

Hirota, T., Kagiwada, S., Kasahara, T., Okano, T., Murata, M. &

Fukada, Y. (2001) Effect of brefeldin A on melatonin

secretion of chick pineal cells. J. Biochem. (Tokyo) 129, 51±59.

Hogenesch, J.B., Gu, Y.Z., Moran, S.M., et al. (2000) The basic

helix-loop-helix-PAS protein MOP9 is a brain-specific

heterodimeric partner of circadian and hypoxia factors. J.

Neurosci. 20, RC83.

Honma, S., Ikeda, M., Abe, H., et al. (1998) Circadian

oscillation of BMAL1, a partner of a mammalian clock gene



Clock, in rat suprachiasmatic nucleus. Biochem. Biophys. Res.

Commun. 250, 83±87.

van der Horst, G.T., Muijtjens, M., Kobayashi, K., et al. (1999)

Mammalian Cry1 and Cry2 are essential for maintenance of

circadian rhythms. Nature 398, 627±630.

Ikeda, M., Yu, W., Hirai, M., et al. (2000) cDNA cloning of a novel

bHLH-PAS transcription factor superfamily gene, BMAL2: its

mRNA expression, subcellular distribution, and chromosomal

localization. Biochem. Biophys. Res. Commun. 275, 493±502.

Jin, X., Shearman, L.P., Weaver, D.R., Zylka, M.J., de Vries,

G.J. & Reppert, S.M. (1999) A molecular mechanism

regulating rhythmic output from the suprachiasmatic circa-

dian clock. Cell 96, 57±68.

King, D.P. & Takahashi, J.S. (2000) Molecular genetics of

circadian rhythms in mammals. Annu. Rev. Neurosci. 23, 713±

742.

Kozak, M. (1984) Compilation and analysis of sequences

upstream from the translational start site in eukaryotic

mRNAs. Nucl. Acids Res. 12, 857±872.

Kume, K., Zylka, M.J., Sriram, S., et al. (1999) mCRY1 and

mCRY2 are essential components of the negative limb of the

circadian clock feedback loop. Cell 98, 193±205.

Larkin, P., Baehr, W. & Semple-Rowland, S.L. (1999) Circadian

regulation of iodopsin and clock is altered in the retinal

degeneration chicken retina. Mol. Brain Res. 70, 253±263.

Maemura, K., de la Monte, S.M., Chin, M.T., et al. (2000)

CLIF, a novel cycle-like factor, regulates the circadian

oscillation of plasminogen activator inhibitor-1 gene expres-

sion. J. Biol. Chem. 275, 36847±36851.

Menaker, M. & Wisner, S. (1983) Temperature-compensated

circadian clock in the pineal of Anolis. Proc. Natl. Acad. Sci.

USA 80, 6119±6121.

Nakahara, K., Murakami, N., Nasu, T., Kuroda, H. &

Murakami, T. (1997) Individual pineal cells in chick possess

photoreceptive, circadian clock and melatonin-synthesizing

capacities in vitro. Brain Res. 774, 242±245.

Oishi, K., Sakamoto, K., Okada, T., Nagase, T. & Ishida, N.

(1998) Antiphase circadian expression between BMAL1 and

period homologue mRNA in the suprachiasmatic nucleus and

peripheral tissues of rats. Biochem. Biophys. Res. Commun. 253,

199±203.

Okano, T., Sasaki, M. & Fukada, Y. (2001) Cloning of mouse

BMAL2 and its daily expression profile in the suprachiasmatic

nucleus: a remarkable acceleration of Bmal2 sequence divergence

after Bmal gene duplication. Neurosci. Lett. 300, 111±114.

Okano, T., Yoshizawa, T. & Fukada, Y. (1994) Pinopsin is a

chicken pineal photoreceptive molecule. Nature 372, 94±97.

Pittendrigh, C.S. (1993) Temporal organization: reflections of a

Darwinian clock-watcher. Annu. Rev. Physiol. 55, 16±54.

Ripperger, J.A., Shearman, L.P., Reppert, S.M. & Schibler, U.

(2000) CLOCK, an essential pacemaker component, controls

expression of the circadian transcription factor DBP. Genes

Dev. 14, 679±689.

Sanada, K., Hayashi, Y., Harada, Y., Okano, T. & Fukada, Y.

(2000) Role of circadian activation of mitogen-activated

protein kinase in chick pineal clock oscillation. J. Neurosci. 20,

986±991.

Shearman, L.P., Sriram, S., Weaver, D.R., et al. (2000)

Interacting molecular loops in the mammalian circadian

clock. Science 288, 1013±1019.

Shearman, L.P., Zylka, M.J., Weaver, D.R., Kolakowski, L.F. Jr

& Reppert, S.M. (1997) Two period homologs: circadian

expression and photic regulation in the suprachiasmatic

nuclei. Neuron 19, 1261±1269.

Sun, Z.S., Albrecht, U., Zhuchenko, O., Bailey, J., Eichele, G. &

Lee, C.C. (1997) RIGUI, a putative mammalian ortholog of

the Drosophila period gene. Cell 90, 1003±1011.

Takahashi, J.S., Murakami, N., Nikaido, S.S., Pratt, B.L. &

Robertson, L.M. (1989) The avian pineal, a vertebrate model

system of the circadian oscillator. Recent Prog. Horm. Res. 45,

279±352.

Takanaka, Y., Okano, T., Iigo, M. & Fukada, Y. (1998) Light-

dependent expression of pinopsin gene in chicken pineal

gland. J. Neurochem. 70, 908±913.

Takumi, T., Matsubara, C., Shigeyoshi, Y., et al. (1998a) A new

mammalian period gene predominantly expressed in the

suprachiasmatic nucleus. Genes Cells 3, 167±176.

Takumi, T., Taguchi, K., Miyake, S., et al. (1998b) A light-

independent oscillatory gene mPer3 in mouse SCN and

OVLT. EMBO J. 17, 4753±4759.

Tei, H., Okamura, H., Shigeyoshi, Y., et al. (1997) Circadian

oscillation of a mammalian homologue of the Drosophila period

gene. Nature 389, 512±516.

Yoshimura, T., Suzuki, Y., Makino, E., et al. (2000) Molecular

analysis of avian circadian clock genes. Mol. Brain Res. 78,

207±215.

Zatz, M., Mullen, D.A. & Moskal, J.R. (1988) Photoendocrine

transduction in cultured chick pineal cells: effects of light,

dark, and potassium on the melatonin rhythm. Brain Res. 438,

199±215.

Zimmerman, N.H. & Menaker, M. (1979) The pineal gland: a

pacemaker within the circadian system of the house sparrow.

Proc. Natl. Acad. Sci. USA 76, 999±1003.

Zylka, M.J., Shearman, L.P., Weaver, D.R. & Reppert, S.M.

(1998) Three period homologs in mammals: differential light

responses in the suprachiasmatic circadian clock and oscillat-

ing transcripts outside of brain. Neuron 20, 1103±1110.

Received: 31 May 2001

Accepted: 25 June 2001

T Okano et al.


Chicken pineal clock genes: implication of BMAL2 as a bidirectional regulator in circadian clock...

Documents

Transcript of Chicken pineal clock genes: implication of BMAL2 as a bidirectional regulator in circadian clock...