ISSN: 1524-4636 Copyright © 2007 American Heart Association. All rights reserved. Print ISSN: 1079-5642. Online

7272 Greenville Avenue, Dallas, TX 72514Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association.

DOI: 10.1161/ATVBAHA.106.132266 published online Feb 22, 2007; Arterioscler Thromb Vasc Biol

Ricardo Villa-Bellosta, Yolanda E. Bogaert, Moshe Levi and Víctor Sorribas Implications for Vascular Calcification

Characterization of Phosphate Transport in Rat Vascular Smooth Muscle Cells.

http://atvb.ahajournals.org/cgi/content/full/ATVBAHA.106.132266/DC1Data Supplement (unedited) at:

  http://atvb.ahajournals.org

located on the World Wide Web at: The online version of this article, along with updated information and services, is

http://www.lww.com/reprintsReprints: Information about reprints can be found online at  

journalpermissions@lww.com410-528-8550. E-mail:

Fax:Kluwer Health, 351 West Camden Street, Baltimore, MD 21202-2436. Phone: 410-528-4050. Permissions: Permissions & Rights Desk, Lippincott Williams & Wilkins, a division of Wolters 

http://atvb.ahajournals.org/subscriptions/Biology is online at Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

Characterization of Phosphate Transport in Rat VascularSmooth Muscle Cells

Implications for Vascular Calcification

Ricardo Villa-Bellosta, Yolanda E. Bogaert, Moshe Levi, Vı́ctor Sorribas

Objective—Hyperphosphatemia and inorganic phosphate (Pi) transport by vascular smooth muscle cells (VSMCs) havebeen implicated in the pathogenesis of vascular calcification. The aim of this work has been to characterize Pi transportin VSMCs.

Methods and Results—Primary cultures of VSMCs express both high affinity Na-dependent and Na-independentcomponents of Pi transport. Under physiological conditions both transport systems are saturated, show similar activity,and are inhibited by increasing pH. The Na-dependent transport is also weakly inhibited by phosphonoformic acid (PFA)(3.9 mmol/L IC50 at 0.05 mmol/L Pi). Real-time polymerase chain reaction shows that Pit1 and Pit2 are expressed tothe same degree, and no other Pi transporters are significantly expressed. When expressed in Xenopus oocytes they arestrictly Na-dependent, with high affinities for Pi, and are inhibited by increasing pH, but only weakly inhibited by PFA.We have used RNA interference to demonstrate that Pit1 and Pit2 are the transporters responsible for Na-dependent Pitransport in VSMCs.

Conclusions—Taken together these novel findings suggest new roles of Pi transport in the pathogenesis of VC and haveimplications as potential future clinical targets. (Arterioscler Thromb Vasc Biol. 2007;27:000-000.)

Key Words: vascular calcification � phosphate transport � VSMC � Pit1 � Pit2

Vascular calcification (VC), the accumulation of calciumphosphate products in the wall of arteries, is a common

complication of diabetes and chronic kidney disease that con-tributes to their morbidity and mortality.1–3 VC is now recog-nized as a complex pathological process that involves cellularossification and the participation of factors that either promote orinhibit the organized deposition of hydroxyapatite.4,5 Thesefactors include high phosphate concentrations,6 uremic toxins,7

or high glucose levels8 among others which induce the expres-sion of specific osteogenes. Medial calcification is primarilyobserved as a complication of CKD, and is mainly related,but not exclusively, to hyperphosphatemia.6,9–10 Hyperphos-phatemia appears to stimulate calcification through flux ofinorganic phosphate (Pi) by transporters present in the plasmamembrane of cells11 which, in addition, may induce the forma-tion of apoptotic bodies and matrix vesicles.12,13

Primary and subcultures of primary aortic VSMCs arecommonly used as an in vitro model to study the role ofphosphate in VC. In this model, the role of Pi transport incalcification has been described, as well as the consequences

of the changes in abundance of the corresponding transport-ers. In spite of that, the kinetic and molecular characteristic ofsuch transport has not been analyzed fully. Consequently, wewished to determine the kinetic expression of Pi transport inVSMCs with classical biochemical approaches. We havefound that VSMCs exhibit both Na-dependent and Na-independent Pi transport components with similar kineticbehavior, but that only the Na-coupled saturable uptake canbe explained by the expression of both type III NaPi (NaPi-III) transporters, Pit1 and Pit2.14 As an article has recentlybeen published regarding the characteristics of Pi transport byPit1 and Pit2 while preparing this manuscript,15 this articlewill focus on the different and novel findings we have found.

Materials and MethodsFor a detailed explanation of the methods used please see http://atvb.ahajournals.org. In short, primary cultures of VSMCs wereobtained from the thoracic aortas of 2-month-old rats by microdis-section and collagenase digestion. Transport assays were performedby determination of 32P-K2HPO4/KH2PO4 from uptake experimentsin VSMC monolayers and in defolliculated Xenopus oocytes. Pit1

Original received September 19, 2006; final version accepted February 7, 2007.From the Laboratory of Molecular Toxicology (R.V.-B., V.S.), University of Zaragoza, Spain; and the Departments of Medicine (Y.E.B., M.L.) and

Physiology and Biophysics (M.L.), Division of Renal Diseases and Hypertension, Denver VAMC and University of Colorado at Denver and HealthSciences Center, Denver.

Changes in phosphate plasma levels and, consequently, the increase in phosphate load by vascular cells have been implicated in vascular medialcalcification. In this work we have analyzed the kinetic characteristics of inorganic phosphate transport in vascular smooth muscle cells and describedthe implications for the total phosphate cellular load.

Correspondence to Vı́ctor Sorribas, Laboratory of Molecular Toxicology, University of Zaragoza, Veterinary Faculty, Calle Miguel Servet 177, 50013Zaragoza, Spain. E-mail sorribas@unizar.es

© 2007 American Heart Association, Inc.

Arterioscler Thromb Vasc Biol. is available at http://www.atvbaha.org DOI: 10.1161/ATVBAHA.106.132266

1 by on May 18, 2011 atvb.ahajournals.orgDownloaded from

and Pit2 transporters were expressed in Xenopus oocytes by injectionof the corresponding in vitro transcribed cRNAs, and Michaeliankinetic parameters were calculated by iterative nonlinear regression.The abundance of phosphate transporter transcripts in VSMCs wasquantified using a iQ Sybr Green Supermix kit in an iCycler iQReal-Time PCR Detection System (both from Bio-Rad), and calcu-lated with the comparative CT method. Finally, RNA interference ofPit1 and Pit2 transcripts was achieved by transfection of StealthRNAis (Invitrogen) into VSMCs.

ResultsComponents of Pi Transport in VSMCsPreliminary experiments to determine the incubation time forinitial velocity are explained in Methods. To determine the

percentage of the uptakes in the presence and absence of Nathat correspond to transport, we inhibited uptake of0.05 mmol/L Pi with 10 mmol/L Pi itself (Figure 1A). Totaluptake in the absence of Na� corresponds to 35% of theuptake in the presence of Na�. In the presence of 10 mmol/LPi as inhibitor, total uptake in the presence or absence of Na�

was significantly inhibited to residual values of 3.0�0.2 and3.6�0.3 pmol Pi per mg cell protein per minute, respectively.These experiments demonstrate the novel finding of animportant Na-independent component of Pi transport ex-pressed in rat VSMCs.

To characterize the kinetics of Pi transport observed inVSMCs, Michaelian-saturating kinetics were performed from0.01 to 5 mmol/L Pi, in the presence or absence of Na�. Piuptake under these conditions was partially saturated asevidenced by inflection of the curves at low Pi points(supplemental Figure IB and IC, available online at http://atvb.ahajournals.org). Both experiments were fitted to equa-tion 1 (see Methods), containing a Michaelian-saturable(transport) plus a nonsaturable (diffusion plus nonspecificbinding) component. Both fits were then subtracted to assessnet Na-dependent Pi transport (supplemental Figure ID).Kinetic values are summarized in Table 1: Both total trans-port in the presence or absence of Na as well as netNa-dependent Pi transport exhibited the same affinity for Pi,0.1 mmol/L, a Km value 15 times smaller than reported forhuman VSMCs.16 Capacities of both Na-dependent andNa-independent Pi transport were also similar, and had anadditive effect on total uptake in the presence of NaCl.

These results suggest the existence of either 2 differenttransport systems with similar kinetic characteristics butdifferent dependence on Na, or alternatively the existence ofa unique transport system that can couple facultatively to Na�

when it is present, and has half the transport capacity in theabsence of Na�. The Na dependence of Pi transport was thenfurther analyzed with a Na-activation experiment. Fitting datato equation 2 (See Methods) produces a sigmoid curve(supplemental Figure II) and Hill coefficient of 1.6 (Table 1),suggesting a stoichiometry of Na:Pi more than 1:1. This

Figure 1. Pi transport in VSMCs. A, Pi uptake in the absence(open bars) or presence (black bars) of 10 mmol/L PO4 as inhibi-tor. *P�0.0001 compared with the absence of inhibitor. B, Inhi-bition of Na-dependent (open) and Na-independent (black)transport by increasing pH. *P�0.0001 and #P�0.001 com-pared with pH 6.

TABLE 1. Kinetic Parameters of Pi Transport

VSMCs

Pi Kinetics Vmax (pmol/mg protein.min) Km, Pi (mmol/L) Kd (nl/mg protein.min) df, r2

NaCl 393.4�31.2 0.11�0.02 75.6�10.2 20, 0.9717

Choline Cl 180.7�32.8 0.10�0.04 114.9�12.6 21, 09738

Net 212.8�0.04 0.12�0.00 � � � 7, 1

Na Kinetics Vmax (pmol/mg protein.min) Km, Na(mmol/L) NHill df, r2

29.9�13.0 41.6�29.5 1.59�1.21 30, 0.4476

Oocytes

Pi Kinetics Vmax (pmol/oocyte.min) Km, Pi (mmol/L) Kd (nl/oocyte.min) df, r2

Pit1 0.79�0.01 0.094�0.004 � � � 7, 0.9993

Pit2 1.17�0.01 0.19�0.01 � � � 7, 1

“NaCl” includes total uptake (transport plus free diffusion). “Net” includes only Na-dependenttransport. Values for Pit1 and Pit2 represent net transport, after subtraction of water-injected oocytevalues. For an explanation of the kinetic parameters and analysis see Methods.

2 Arterioscler Thromb Vasc Biol. May 2007

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

number is compatible with the expression of several transportsystems with different Na:Pi stoichiometries, or alternativelyto the activity of a transport system with two sodium bindingsites that exhibit allosteric cooperativity.

The kinetic analysis allows us to interpret the role of Pitransport in VC. A summary of the following study is shownin Table 2. Doubling the physiological Pi concentration from1 mmol/L17 to a hyperphosphatemic 2 mmol/L would onlyincrease the transport rate slightly to 1.05 times (1.22 times inthe case of total uptake). The explanation for this minimaleffect is that Pi transport is already saturated at 1 mmol/L(supplemental Figure IB and ID). To effectively increase thecell load of Pi there has to be an increase in the number offunctional transporters (ie, increase in capacity or Vmax of thetransport system): Doubling of Vmax (2�Vmax) doubles thetransport rate at either 1 or 2 mmol/L Pi (Table 2), and thiseffect is maintained with an increase in Pi concentration orincrease in Vmax. In conclusion, the induction of VC by highPi concentration cannot be explained exclusively as a directeffect on the transport rate of Pi as an increase in the numberof functional Pi transporters has to occur to consider the Piconcentration as a key factor in the pathogenesis of VC. Anincrease in the number of Pi transporters has been describedin response to several calcifying conditions.16,18–20

pH Dependence of Pi Transport in VSMCsA hallmark of Pi transport through the renal proximal tubulesis the increase in transport activity with increasing pH of theuptake medium.21 Because pH also affects VC,22 we analyzedthe effect of pH from 6.0 to 8.5 on VSMC Pi transport: Figure1B shows that Pi transport is inhibited with increasing pH inVSMCs. The effect was stronger in the presence of Na� thanin its absence, because Na-independent Pi uptake (black bars)is only inhibited at pH�7.5. The dependence of pH effect onthe presence of Na� points to an allosteric mechanism ratherthan a substitution of Na� by H� because in the latter case wewould expect a stronger effect in the absence of Na� than inits presence.

Phosphonoformic Inhibition of Pi Transportin VSMCsPhosphonoformic acid (PFA) is a well-known competitiveinhibitor of the renal Pi transport.23 It has also been success-fully used to prevent calcification and to inhibit Pi transportin VSMCs.16,19,24,25 Because the inhibition constant of PFA inkidney varies strongly with the animal species,26 we checkedwhether PFA was also an inhibitor of 0.05 mmol/L Pitransport in rat VSMCs (Figure 2A). Increasing concentra-tions of PFA inhibited Pi transport with an IC50 value of3.9 mmol/L (from logIC50 0.59�0.11) and 2.6 mmol/L Ki

(considering a Km of 0.1 mmol/L for Pi; see Methods). Thissuggests that PFA is very weak inhibitor of Pi transport inVSMCs compared with kidney, in which Ki values ranging0.03 to 0.21 mmol/L have been reported.26 The inability ofPFA to inhibit Pi transport can be further observed in Figure2B, as 1 mmol/L PFA has no effect on Pi transport and10 mmol/L PFA only inhibits the Na-dependent componentby 47%.

Expression of Pi Transporters in VSMCsVSMCs express both NaPi-III type27 of phosphate transport-ers with Pit118,24 being more abundant than Pit2.11 Based onour kinetic differences of Pi transport with previous reports,we determined expression of all rat Pi transporters identifiedtoday (Figure 3A). The accession numbers to GenBank,sequences of primers, and size of amplicons are listed insupplemental Table I. No expression was obtained for NaPi-I,NaPi-IIa, -IIb, and -IIc, as well as NPT4 and Na/PO4. Thebrain derived Na/Pi transporter, BNPI, was also expressed,although the expression level was only 0.3% of the maintransporters. The type III NaPi transporters Pit1 and Pit2 werestrongly expressed in rat VSMCs, and with similar intensity.As compared with the control Arp CT value (16.9�0.1), Pit1CT was 21.6�0.2, and Pit2 CT was 21.7�0.09, whereas BNPIwas amplified at CT 30.6�0.3, and NaPiIIa at CT 32.0�0.23.As these values only refer to mRNA levels, there is a

TABLE 2. Consequences of Kinetic Parameters on Phosphate Uptake by VSMCs

Total Uptake, NaCl

1 mmol/L PO4 2 mmol/L PO4 Ratio 2 mmol/L/1 mmol/L

Vmax (393.4 pmol/mg protein.min) 429.1 523.5 1.22

2�Vmax (786.8 pmol/mg protein.min) 782.7 895.9 1.14

Ratio 2�Vmax/Vmax 1.82 1.71 2.09

Only Transport

1 mmol/L PO4 2 mmol/L PO4 Ratio 2 mmol/L/1 mmol/L

Vmax (393.4 pmol/mg protein.min) 353.5 372.4 1.05

2�Vmax (786.8 pmol/mg protein.min) 707.1 744.8 1.05

Ratio 2�Vmax/Vmax 2.00 2.00 2.11

Values represent theoretical velocity of Pi transport by VSMCs according to equation 1 and theparameters of Table 1. “Pi transport” are obtained considering only the first term of equation 1. Twopossible substrate concentrations are shown (1 or 2 mmol/L Pi, equivalent to two phosphataemicconcentrations). Vmax means a physiological No. of transporters (capacity �1, see Table 1). 2�Vmax

is a theoretical condition in which the No. of functional transporters has been duplicated. Bold valuesmean the ratio of between 2�Vmax at 2 mmol/L PO4 and Vmax at 1 mmol/L PO4.

Villa-Bellosta et al Pi Transport in Vascular Smooth Muscle Cells 3

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

consideration that they may not represent protein expressionor biological activity.

Expression of Pit1 and Pit2 in X laevis OocytesWe characterized the functional expression of Pit1 and Pit2 inXenopus laevis oocytes to ascertain whether they couldexplain the biochemistry of Pi transport in VSMCs. Initialvelocity of Pi transport in either Pit1 or Pit2 expressingoocytes lasted more than 12 hours (data not shown). Table 1summarizes the results of the kinetic analysis. Pit1 showed aPi affinity of 0.1 mmol/L (similar to that of VSMCs), whilePit2 affinity was almost half of Pit1, providing a Km of0.19 mmol/L. Both Pit1 and Pit2 follow the same Michaelianbehavior, and no sign of cooperative-sigmoidal increase in Pitransport has been observed for Pit2 as has been reported forthe human ortholog15 (supplemental Figure III).

To know whether Pit1 and Pit2 are strictly Na-dependentor could be at least partially responsible for the Na-independent Pi uptake by VSMCs, Li�, K�, NH4�, andcholine� were used to substitute for Na� in an equimolar ratiowhile Cl� was kept constant (Figure 3B). Only Li� was able

to significantly increase Pi transport above the water-injectedlevel: 5% with Pit1 and 11.7% with Pit2. However, Na-independent Pi transport was still minimal compared with thepresence of Na�, and no transport was observed with K�, orwith non–alkali-metal cations (NH4� and choline�).

Similar to the results seen in VSMCs, oocytes expressingeither Pit1 or Pit2 were sensitive to pH changes of Na�-containing uptake medium (Figure 4A). We also determinedthe effect of pH in the absence of Na� (Figure 4B) and foundthat Pit1 was not functional at any of the pH values testedwhereas Pit2 activity was only significant at pH of 6.0.However, Pit2 transport activity in the absence of Na� wasstill very small compared with the presence of Na� andtherefore could not explain the Na-independent Pi transportobserved in VSMCs.

PFA was also a weak inhibitor of oocyte Pit1- andPit2-expressed transport (Figure 4C and 4D). Net expressedtransports (thick lines) provided an IC50 and Ki for Pit1 of4.1 mmol/L and 2.7 mmol/L, respectively, whereas Pit2appeared even more resistant than Pit1 (IC50 5.8 mmol/L, Ki

4.6 mmol/L).

Figure 2. Effects of pH and PFA on VSMC Pi trans-port. A, Inhibition of 0.05 mmol/L Pi transport inVSMCs with PFA. B, Inhibition by PFA ofNa-dependent (white) and Na-independent uptake(black). *P�0.001 compared with Na-dependenttransport with 0 mmol/L PFA.

4 Arterioscler Thromb Vasc Biol. May 2007

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

Role of Pit1 and Pit2 on Pi Transport in VSMCsThe role of Pit1 and Pit2 on Pi transport measured in VSMCswas analyzed by RNA interference using Stealth RNAi.Expression of the corresponding mRNAs was inhibitedwithin 24 hours (supplemental Figure IV). In the case of Pit1,this correlated with only a 23% inhibition of total Pi uptake

(open bar), and 31% reduction in Na-coupled transport.Knock-down of Pit2, however, reduced total Pi uptake by55% (open bar) and Na-dependent transport by 71%. Na-independent Pi transport (black bars) was not affected byRNAi treatment. Maximal effects were always observed at 24hours after transfection decreasing substantially by 72 hours(data not shown). RNA interference was not performed onany other transporters shown in Figure 3A as their abundancewas less then 0.5% of the Type III family.

DiscussionAn increasing number of articles are providing direct evi-dence for the role of Pi serum levels in the development ofVC. The seminal investigations of Dr C.M. Giachelli focusedon the role of Pi transport in the pathogenesis of VC,11,24 butmany basic characteristics of Pi transport in VSMCs are stillunknown. The main aim of our work has been to clarify thesecharacteristics, to understand the relationship between Pitransport kinetics and VC. Our work has provided severalnew findings, including the existence of a high-affinityNa-independent Pi transport. At this point we cannot differ-entiate between one transport system working facultativelywith Na�, or two different systems, one being Na-dependentand the other Na-independent. Although both options aretheoretically plausible as the affinity constants of Pi transportare similar, the fact that there are differences in the effects ofpH in the presence and absence of Na�, as well as the fact thatPit1 and Pit2 in VSMCs only work in a Na-dependentfashion, suggests the existence of two transport systems thatcan be distinguished by their Na-dependence. In addition,Na-independent Pi uptake was not altered when the expres-sion of Pit 1 and 2 were knocked down. An interesting and

Figure 3. Phosphate transporters in VSMCs. A, Real-time PCRshowing that Pit1 and Pit2 are the major Pi transporters. BNPIonly represents 0.3% of the type III transporters. B, Expressionof Pit1 and Pit2 in Xenopus oocytes shows that they are strictlyNa-dependent, with only partial activation by Li�. *P�0.01 com-pared with the corresponding water-injected level.

Figure 4. Effect of pH and PFA on Pit-expressed transport. A, Inhibition of bothPit1 and Pit2 Na-dependent transport byincreasing pH. *P�0.0001 comparedwith pH 6.0. B, In the absence of Na,only Pit2 expressed transport is inhibitedby increasing pH. *P�0.001 comparedwith the corresponding water level. Cand D, Inhibition of transport by PFA inPit1- and Pit2-(squares) and water-injected (triangles) oocytes.

Villa-Bellosta et al Pi Transport in Vascular Smooth Muscle Cells 5

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

novel finding is that the effect on Pi transport is strongerwhen Pit2 rather than Pit1 is knocked down.

At a physiological serum Pi concentration (1 to1.5 mmol/L) both Na-dependent and Na-independent compo-nents are saturated and therefore transport Pi at a rate similarto their Vmax. In other words, both components contributealmost equally to the total uptake of Pi by VSMCs. Our worksignificantly expands the understanding of the kinetics of Pitransport in VSMCs and describes a novel component,Na-independent Pi transport. This component plays a signif-icant role in Pi transport in VSMCs and as such may play animportant role in the pathogenesis of VC. Although it isspeculative to describe the molecular nature of the Na-independent transport system, it clearly must be coupled to adifferent energy source to overcome the electrochemicalgradient of the phosphate anion and therefore must be aprimary active transport system or an exchanger coupled tothe excretion of another anion.

An additional novel finding is that the Na-dependent Pitransport in VSMCs shows a high affinity (0.1 mmol/L) forPi, similar to the kidney cortex. To our knowledge, previousstudies only found Km values from 1.53�0.03 mmol/L16 inprimary human smooth muscle cells to 0.35�0.05 mmol/L inA-10 cells, an embryonic rat VSMC-derived permanent cellline.18 These differences may arise from variations in the cellmodel used and also from the methodology used to determinethe kinetic parameters (linear transformations versus non-linear regressions, equations used for the fits, weighing datato normalized distances from the curve, etc.). In addition, thehigh affinity for Pi in VSMCs is similar to the values of Pit1and Pit2 Km that we have obtained in Xenopus oocytes, andare in agreement with previous studies using different expres-sion systems.15,27–30

Although all published works have shown a strict Na-dependent Pi transport by Pit1, several groups have alsoreported a partial Na-independent activity of Pit2, with agradual selectivity for the different cations being, in general,Na� Li��K��NH4��choline��tris�.15,27–29 We haveonly found a significant expression of Na-independent Pitransport when Na� was substituted with Li�, but thisrepresented �10% of Na-coupled transport (Figure 3B). Inaddition, Pit2 is also expressed in the absence of Na� at acidicpH (6.0), which suggests that protons could mimic Na� or Li�

(Figure 4B). Regardless, the physiological relevance of thissmall activation is minimal and would not explain the largeNa-independent Pi uptake observed in VSMCs.

These kinetic characteristics are very relevant to vascularcalcification. Our finding that at physiological Pi concentra-tions the transport of phosphate in VSMCs is saturatedsuggests that an increase in the serum phosphate from1 mmol/L to 2 mmol/L or higher, as observed in patients withCKD, will not have immediate consequences in the cellularload of Pi. According to our analysis, Pi cell uptake inhyperphosphatemia can only be increased by expressing moreactive Pi transporters, as observed in an in vivo rat model ofCKD.20 Our finding might explain why diabetics who do nothave hyperphosphatemia are still at increased risk of VC asalterations in transport activity alone is enough to signifi-cantly alter Pi intracellular concentrations.

Another important finding refers to the inhibition of Pitransport by PFA. In contrast to the case of NaPiIIa, PFA isa very poor inhibitor of type III Pi transporters and of VSMCPi transport. Our results provide an IC50 of about 3.9 mmol/Lfor PFA in VSMCs when the concentration of Pi is0.05 mmol/L, and a Ki of 2.6 mmol/L (Figure 2A). The valuesfor PFA inhibition of Pit1 and Pit2 are in the same range,which can explain the inhibition observed in VSMCs (Figure4C and 4D). At first these results are in contrast withpublished results,16,24 because those authors reported half-maximal inhibition of 0.1 mmol/L Pi transport by 0.1 to0.5 mmol/L PFA. The same authors successfully inhibited Pi-and calcium-induced19 calcifications with only 0.05 mmol/LPFA, and Pi-mediated induction of osteocalcin and Cbfa-1with 0.3 mmol/L PFA. PFA (1 mmol/L) is also able toprevent the �-glycerophosphate induction of osteopontin andalkaline phosphatase in bovine VSMCs.25 However, we donot see any effect on Pi transport at this concentration. Themain difference between these reports and our work isprimarily the incubation time. Whereas our experiments havebeen performed at initial velocity times (ie, when onlysignificant entrance of Pi to the cells occurs), the incubationtime used to inhibit Pi transport in those reports was from 90minutes24 to several days for inhibition of calcification andgene induction.24,25 There is also the possibility that theeffects of PFA on calcification may occur through othermechanisms including cytotoxicity, as we have observed(Villa-Bellosta, unpublished results). It may also be possiblethat the small amount of transport inhibition observed isenough to bring the Pi transport beneath a “threshold” suchthat the osteogenic signaling pathways are not activated. Thiswould be consistent with both in vitro and in vivo workscorrelating increased VC with increasing levels of serumphosphate and with the theory that Pi influx works as a veryprecise sensor of calcifying conditions. This would explainnot only the prevention of calcification with PFA but why thepartial decrease in expression of just Pit1 expression withRNA interference could inhibit calcification.11

In conclusion, we have characterized the phosphate trans-port of a well-established in vitro model of vascular calcifi-cation, and we have shown that its properties provide impor-tant information in the pathogenesis of ectopic osteogenesis.Additional research is necessary to characterize the molecularnature of the Na-independent transport system, as well as theregulation, respective activity, and cell biology of both Pit1and Pit2 in VSMCs.

Sources of FundingThis work was supported by grants from the Spanish Ministry ofEducation and Science BFU2006-06284/BFI (to V.S.) and NIH 1R01 DK066029-01 (to M.L.).

DisclosuresNone.

References1. Goodman WG, Goldin J, Kuizon BD, Yoon C, Gales B, Sider D, Wang

Y, Chung J, Emerick A, Greaser L, Elashoff RM, Salusky IB. Coronary-artery calcification in young adults with end-stage renal disease who areundergoing dialysis. N Engl J Med. 2000;342:1478–1483.

6 Arterioscler Thromb Vasc Biol. May 2007

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

2. Blacher J, Guerin AP, Pannier B, Marchais SJ, and London GM. Arterialcalcifications, arterial stiffness and cardiovascular risk in end-stage renaldisease. Hypertension. 2001;38:938–949.

3. Kestenbaum B, Sampson JN, Rudser KD, Patterson DJ, Seliger SL,Young B, Sherrard DJ, Andress DL. Serum phosphate levels and mor-tality risk among people with chronic kidney disease. J Am Soc Nephrol.2005;16:520–528.

4. Abedin M, Tintut Y, Demer LL. Vascular calcification. Mechanisms andclinical ramifications. Arterioscler Thromb Vasc Biol. 2004;24:1–10.

5. Shao JS, Cai J, Towler DA. Molecular mechanisms of vascular calcifi-cation. Lessons learned from the aorta. Arterioscler Thromb Vasc Biol.2006;26:1423–1430.

6. Moe SM, Chen NX. Pathophysiology of vascular calcification in chronickidney disease. Circ Res. 2004;95:560–567.

7. Chen NX, Duan D, O’Neill KD, Wolisi GO, Koczman JJ, LaClair R, MoeSM. The mechanisms of uremic serum-induced expression of bone matrixproteins in bovine vascular smooth muscle cells. Kidney Int. 2006;70:1046–1053.

8. Chen NX, Duan D, O’Neill KD, Moe SM. High glucose increases theexpression of Cbfa1 and BMP-2 and enhances the calcification of vascularsmooth muscle cells. Nephrol Dial Transplant. 2006;21:3435–3442.

9. Shanahan CM. Vascular calcification. Curr Opin Nephrol Hypertens.2005;14:361–367.

10. Jono S, Shioi A, Ikari Y, Nishizawa Y. Vascular calcification in chronickidney disease. J Bone Miner Metab. 2006;24:176–181.

11. Li X, Yang H-Y, Giachelli CM. Role of the sodium-dependent phosphatetransporter, Pit1, in vascular smooth muscle cell calcification. Circ Res.2006;98:905–912.

12. Proudfoot D, Skepper JN, Hegyi L, Bennett MR, Shanahan CM,Weissberg PL. Apoptosis regulates human vascular calcification in vitro:Evidence for initiation of vascular calcification by apoptotic bodies. CircRes. 2000;87:1055–1062.

13. Reynolds JL, Joannides AJ, Skepper JN, McNair R, Schurgers LJ,Proudfoot D, Jahnen-Dechent W, Weissberg PL, Shanahan CM. Humanvascular smooth muscle cells undergo vesicle-mediated calcification inresponse to changes in extracellular calcium and phosphate concen-trations: A potential mechanism for accelerated vascular calcification inESRD. J Am Soc Nephrol. 2004;15:2857–2867.

14. Collins JF, Bai L, Ghishan FK. The SLC20 family of proteins: dualfunctions as sodium-phosphate cotransporters and viral receptors.Pflugers Arch. 2004;447:647–652.

15. Bøttger P, Hede SE, Grunnet M, Høyer B, Klærke DA, Pedersen LE.Characterization of transport mechanisms and determinants critical forNa�-dependent Pi symport of the PiT-family paralogs, human PiT1 andPiT2. Am J Physiol Cell Physiol. In press.

16. Giachelli CM, Jono S, Shioi A, Nishizawa Y, Mori K, Morii MDH.Vascular Calcification and Inorganic Phosphate. Am J Kidney Dis. 2001;38:S34–S37.

17. Alfrey AC, Ibels LS. Role of phosphate and pyrophosphate in soft tissuecalcification. Adv Exp Med Biol. 1978;103:187–193.

18. Kakita A, Suzuki A, Nishiwaki K, Ono Y, Kotake M, Ariyoshi Y, MiuraY, Ltoh M, Oiso Y. Stimulation of Na-dependent phosphate transport byplatelet-derived growth factor in rat aortic smooth muscle cells. Athero-sclerosis. 2004;174:17–24.

19. Yang H, Curinga G, Giachelli CM. Elevated extracellular calcium levelsinduce smooth muscle cell matrix mineralization in vitro. Kidney Int.2004;66:2293–2299.

20. Mizobuchi M, Ogata H, Hatamura I, Koiwa F, Saji F, Shiizaki K, Negi S,Kinugasa E, Ooshima A, Koshikawa S, Akizawa T. Up-regulation ofCbfa1 and Pit1 in calcified artery of uraemic rats with severe hyperphos-phataemia and secondary hyperparathyroidism. Nephrol Dial Transplant.2006;21:911–916.

21. De la Horra C, Hernando N, Lambert G, Forster I, Biber J, Murer H.Molecular determinants of pH sensitivity of the type IIa NaPi cotrans-porter. J Biol Chem. 2000;275:6284–6287.

22. Lomashvili K, Garg P, O’Neill WC. Chemical and hormonal deter-minants of vascular calcification in vitro. Kidney Int. 2006;69:1464–1470.

23. Szczepanska-Konkel M, Yusufi AN, VanScoy M, Webster SK, DousaTP. Phosphonocarboxylic acids as specific inhibitors of Na�-dependenttransport of phosphate across renal brush border membrane. J Biol Chem.1986;261:6375–6383.

24. Jono S, McKee MD, Murry CE, Shioi A, Nishizawa Y, Mori K, Morii H,Giachelli CM. Phosphate regulation of vascular smooth muscle cell cal-cification. Circ Res. 2000;87:e10–e17.

25. Chen NX, O’Neill KD, Duan D, Moe SM. Phosphorus and uremic serumup-regulate osteopontin expression in vascular smooth muscle cells.Kidney Int. 2002;62:1724–1731.

26. Yusufi AN, Szczepanska-Konkel M, Kempson SA, McAteer JA, DousaTP. Inhibition of human renal epithelial Na�/Pi cotransport by phospho-noformic acid. Biochem Biophys Res Commun. 1986;139:679–686.

27. Kavanaugh MP, Miller DG, Zhang W, Law W, Kozak SL, Kabat D,Miller AD. Cell-surface receptors for gibbon ape leukemia virus andamphotropic murin retrovirus are inducible sodium-dependent phosphatesymporters. Proc Natl Acad Sci U S A. 1994;91:7071–7075.

28. Olah Z, Lehel C, Anderson WB, Eiden MV, Wilson CA. The cellularreceptor for gibbon ape leukemia virus is a novel high affinity sodium-dependent phosphate transporter. J Biol Chem. 1994;269:25426–25431.

29. Wilson CA, Eiden MV, Anderson WB, Lehel C, Olah Z. The dual-function hamster receptor for amphotropic murin leukemia virus (MuLV),10A1 MuLV, and gibbon ape leukemia virus is a phosphate symporter.J Virol. 1995;69:534–537.

30. Tatsumi S, Segawa H, Morita K, Haga H, Kouda T, Yamamoto H, InoueY, Nii T, Katai K, Taketani Y, Miyamoto KI, Takeda E. Molecularcloning and hormonal regulation of PiT1, a sodium-dependent phosphatecotransporter from rat parathyroid glands. Endocrinology. 1998;139:1692–1699.

Villa-Bellosta et al Pi Transport in Vascular Smooth Muscle Cells 7

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

ONLINE PUBLICATION, VILLA-BELLOSTA ET AL.

Methods

Cell culture

VSMC from the rat thoracic aorta were isolated as described previously1, 2. Cells were

grown in Eagle’s minimal essential medium containing (Sigma, St. Louis, MO) 1 mM

L-glutamine, 2 g/liter NaHCO3, 100 IU/ml penicillin, 100 µg/ml streptomycin, and 10%

(v/v) fetal calf serum (Invitrogen, Carlsbad, CA) at 37 °C in a humidified atmosphere of

5 % CO2. The growth media concentration of calcium was 1.8 mM, of phosphate was

1.014 mM, and of glucose was 5.6 mM. VSMC were used from passages 5-9. Cells

were grown to 80% confluence and used directly, without a quiescent intermediate step.

For transport studies, VSMC were always plated in 24-well dishes.

Pi uptake assays in VSMC

Uptake of Pi was performed as described for other cell lines3 with 32P-orthophosphoric

acid (GE Healthcare, Buckinghamshire, UK) as radiotracer. Cells were washed twice

with 1 ml uptake solution (in mM, 137 NaCl, 5.4 KCl, 2.8 CaCl2, 1.2 MgSO4, and 14

HEPES, pH 7.4) without substrate at room temperature. To determine uptake in the

absence of sodium (which is equivalent to a Na-independent transport), NaCl was

substituted equimolarly with choline chloride in the washing and uptake solutions.

Measurement of phosphate transport was initiated by addition of 0.5 ml of transport

solution also containing K2H32PO4 (buffered to pH 7.4 with KH2PO4). Concentrations

of substrate and duration of incubation are indicated in the manuscript. As a reference, a

specific activity of 1.5 µCi H3PO4/ml uptake solution was used to measure Na/Pi

cotransport in the presence of 0.05 mM K2HPO4. In the case of Na-independent Pi

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

uptake determinations, a concentration of 3 µCi H3PO4/ml uptake solution was used.

For substrate saturation kinetics the specific activity of radiotracer was increased

proportionally to the unlabeled substrate. Uptake was terminated by aspiration of the

uptake solution and washing the monolayers four times with ice-cold stop solution (137

mM choline chloride, 14 mM Tris-HCl pH 7.4) at 4°C. The cells were then lysed in

0.5% Triton X-100 and analyzed for both 32P Cherenkov cpm in a scintillation counter

and protein concentration with the Lowry assay4.

Preliminary experiments showed that the initial velocity of 0.05 mM Pi transport in

VSMC was linear for at least 20 minutes in the presence of 137 mM NaCl. Uptake in

the absence of Na+ was linear for at least 30 min. These initial velocity times are very

long compared to other cell models of Pi transport, such as Opossum Kidney cells that

have 6 minutes of established initial velocity. Because of these findings, we therefore

chose 12 minutes of incubation time for later experiments based on the design of

experiments.

Quantitative and semiquantitative RT-PCR

Determination of the expression and relative abundance of phosphate transporters in

VSMC was performed by quantitative real-time PCR. Total RNA was isolated from

confluent VSMC, and contaminating DNA digested with Amplification Grade

Deoxyribonuclease I (Invitrogen) following manufacturer instructions. One microgram

of DNA-free RNA was transcribed into cDNA using an iScript cDNA Synthesis kit

(Bio-Rad, Hercules CA). Specific amplification and quantification of Pi transporters

transcripts was done using an iQ Sybr Green Supermix kit in an iCycler iQ Real-Time

PCR Detection System (both from Bio-Rad). The comparative CT method was used for

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

quantification as recommended by the manufacturer, using acidic ribosomal

phosphoprotein RNA (Arp, accession number NM022402) as an endogenous reference.

The CT values of Arp were always in the 15-17 range. Briefly, 25 µl of total reaction

mix contained 20 ng of reverse-transcribed cDNA, 100 nM forward/reverse primers,

and 1 x iQ Supermix from Bio-Rad Laboratories. All the data were calculated from

triplicate reactions. Primers were designed using Beacon Designer software (Premier

Biosoft International, Palo Alto, CA) and manufactured by Integrated DNA

Technologies (Coralville, IA). Accession numbers and specific primers are indicated in

Table 1 of this supplement.

In VSMC in which RNA interference was performed the abundance of of Pit1 and Pit2

mRNAs was determined semiquantitatively with traditional reverse transcription

followed by PCR. VSMC grown in 24-multiwell plates were lysed at different times

and total RNA extracted using a ChargeSwitch Total RNA Cell kit (Invitrogen). RNA

was then reverse transcribed with a Superscript III First-Strand Synthesis kit

(Invitrogen). Amplification of approximately 950 bp of rat Pit1 and Pit2 cDNAs was

done using a Thermus DNA polymerase (Biotools B & M Labs, Madrid, Spain) with 30

cycles, and the following primers (Invitrogen): For Pit1, sense CTG TGC CCT TAT

CGT CT , antisense ATG CCA ACA CCA CCA T; for Pit2 sense ACG TCA GCA

GGG AAC CA, antisense ATC CTC GTG AGG CTG GT were used.

Cloning and transcription of rat Pit1 and Pit2

The open reading frame of rat Pit1 (Slc20a1, accession number NM_031148) was

cloned into PCR-Script (Stratagene, La Jolla, CA) by standard directional cloning

downhill of the T7 RNA polymerase promoter. A cDNA template was prepared from

rat kidney cortex RNA using a Superscript reverse transcriptase and Platinum Taq DNA

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

Polymerase High Fidelity (both from Invitrogen). The primers contained specific

restriction sites in the 5’-ends, and a 2618 bp fragment of Pit1 was amplified with the

following primers: Sense 5’-GAAAGCCGCTCAGTAATT-3’; antisense 5’-

ACATGTCAACAGAACCTG-3’. The absence of mutations in cDNAs was checked by

sequencing. The rat Pit2 Pi transporter plasmid (Slc20a2, accession number

NM_017223) was a kind gift of Dr. A. Dusty Miller (Fred Hutchinson Cancer Research

Center, Seattle, WA).

For in vitro transcription, Pit1 and Pit2 plasmids were linearized with Not I. They were

transcribed using a mMESSAGE mMACHINE kit (Ambion, Austin, TX), that includes

the capping step, and purified with NucAway spin columns (Ambion). cRNA transcripts

were also stabilized with a Poly(A) Tailing kit (Ambion).

Preparation, injection and uptake assays with X. laevis oocytes

Handling of X. laevis and their oocytes and transport assays have been described

previously5, 6. Briefly, oocytes were injected with different amounts of cRNA, using an

automatic nanoliter injector (World Precision Instruments, Hertfordshire, UK).

Transport assays were performed at room temperature for different times using

H3PO4/ml (GE Healthcare) at 5-50 µCi/ml as a tracer in accordance with the cold

substrate (buffered K2HPO4) concentration. For Na-dependent uptake, groups of 10

oocytes were incubated in an uptake medium [(in mM) 100 NaCl, 2 KCl, 1 CaCl2, 1

MgCl2, and 10 HEPES-Tris, pH 7.5] containing the cold and radiolabeled substrates.

For Na-independent uptake, NaCl was equimolarly substituted by choline chloride.

Before the uptake assay, the oocytes were washed for 1 min in the same uptake solution

without transport substrates. The assay was started with the addition of uptake solution

containing hot and cold Pi. After the specific incubation time, the radioactive medium

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

was recovered, and the oocytes were washed five times with 2 ml each of ice-cold

washing solution. Cherenkov cpm of each oocyte was determined in a scintillation

counter.

Kinetic analysis of Pi transport

Methods for fitting data have been explained before5. Generalized Michaelis-Menten

and Hill equations7, 8 were used to calculate the kinetic parameters by iterative,

nonlinear regression. Pi saturation kinetics were fit to an equation containing a

michaelian term and a non-saturable one (equation 1): V = [Vmax . S / (Km + S)] + (Kd

.

S); where V is velocity of transport, Vmax is the maximal velocity or capacity of the

transport system, S is the concentration of substrate (Pi), Km is the affinity constant, and

Kd is the diffusion constant. The first term of the equation involves saturable uptake

exclusively, i.e. transport. The second term refers to the non-saturable uptake, and

involves diffusion through the plasma membrane and intercellular junctions as well as

experimental unspecific binding (which is maximally reduced by extensive washing, as

mentioned). V and Vmax are measured in pmol Pi / mg . min (for VSMC) or pmol

/oocyte . min, while Km is in mmol/liter. In the case of Kd the units are nl/mg protein/

min or nl / oocyte/min, and derive from V = Kd . S. Values of Vmax in X. laevis oocytes

were determined but are not analyzed because they are mainly a function of the amount

of cRNA injected into the oocytes. Na saturation kinetics were fit to the Hill equation

(equation 2): V = [Vmax . Sn / (Km

n + Sn)] + V0, where n is the Hill coefficient, and V0 the

velocity when [Na+] equals zero. Given that total uptake in VSMC can include both Na-

dependent and Na-independent transport components plus a non-saturable component,

Na-dependent transport was calculated by subtracting the theoretical values of total

uptake for every concentration of substrate in the absence of NaCl from the

corresponding value in the presence of NaCl. The same approach was used to calculate

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

net expressed transport in oocytes from the endogenous or water injected oocytes

(cRNA injected oocytes include both the expressed transport and endogenous uptake

capacity). Fits were performed after weighing data as 1/V2 to normalize the distances of

the experimental values from the curves. GraphPad Prism 4.0c software for Macintosh

was used for statistical and kinetic analysis. All experiments were repeated between

three and five times with similar results, including saturation and Na-activation kinetics.

Inhibition of Pi transport with phosphonoformic acid

Inhibition of Pi transport with the competitive inhibitor phosphonoformic acid (PFA,

Sigma) was performed in VSMC and Pit1- and Pit2-expressing Xenopus oocytes. In

these experiments a constant concentration of 0.05 mM Pi was inhibited with increasing

concentrations of PFA. The inhibitor was added to the uptake medium in the presence

of substrates, and no pre-incubations were performed. Incubation times were always in

the initial velocity range. To calculate the mean inhibitory concentration (IC50), the

following equation (3) was used: V = Bottom + (Top-Bottom) / [1+10(S-logIC50)], where

Top and Bottom refers to the velocity of Pi transport in the absence of inhibitor and

maximal inhibition, respectively. IC50 was calculated by non-linear regression, as

explained in previous section. Inhibition constant, Ki, was calculated indirectly with the

following equation (4) Ki = IC50 / [1+(S/Km)], where S is the constant concentration of

Pi and Km the affinity constant for Pi.

RNA Intereference

In order to knock-down the expression of Pit1 and Pit2 mRNA, VSMC were transfected

with Stealth Select RNAis (Invitrogen). Optimization of transfection was determined

using several transfection reagents and a BLOCK-iT Fluorescent Oligo (Invitrogen) at

different concentrations of reagents. Maximal efficiency of transfection (80 %) was

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

obtained with 1 µl Lipofectamine 2000 (Invitrogen) and 50 pmoles oligo per well of a

24 mutiwell plate (Nunc). Knock-down of rat Pit1 RNA was optimal with the following

sense oligo (and the corresponding annealed antisense oligo): UAC ACC UGA GCC

UAC AGC UGU ACC A; Pit2 was successfully knocked down using the oligo: AAA

UAU CGA AGC CAG AAU GCA UGC C. Maximal inhibition of RNA level was

obtained after 24 hours transfection. Proof of RNA interference effectiveness was

limited to RNA levels and function (Pi transport) because determination of protein

levels of Pit1 and Pit2 failed due to antibody detection problems of both, commercial

and custom made polyclonal antibodies. In each transfection a negative control was

obtained with Stealth RNAi oligos containing similar (medium) percentage of CG

content. Each parameter was determined in four different experiments and in

quadruplicates (four wells).

Statistics

The data are shown as means ± SE. The statistical significance was determined by t-test,

or analysis of variance (ANOVA) followed by a Tukey’s multicomparison test,

depending on the number of means to be compared. In all cases P<0.05 was considered

significant.

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

References

1. Caramelo C, Okada K, Tsai P, and Schrier RW. Mechanisms of the vascular effect

of pressor hormones. Am J Cardiol. 1988;62: 47G–53G.

2. Kaplan-Albuquerque N, Bogaert YE, Van Putten V, Weiser-Evans MC, Nemenoff

RA. Patterns of Gene Expression Differentially Regulated by Platelet-derived

Growth Factor and Hypertrophic Stimuli in Vascular Smooth Muscle Cells. J Biol

Chem. 2005;280: 19966-19976.

3. Sorribas V, Markovich D, Verri T, Biber J, and Murer H. Thyroid hormone

stimulation of Na/Pi-cotransport in opossum kidney cells. Pflügers Arch. 1995;431:

266-271

4. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the

folin phenol reagent. J Biol Chem. 1951;193:265-275

5. Blasco T, Aramayona JA, Alcalde AI, Catalán J, Sarasa M, Sorribas V. Rat kidney

MAP17 induces transport of Na-mannose and Na-glucose in Xenopus laevis

oocytes. Am J Physiol Renal Physiol. 2003;285: F799-F810.

6. Werner A, Biber J, Forgo J, Palacín M, and Murer H. Expression of renal transport

systems for inorganic phosphate and sulfate in Xenopus laevis oocytes. J Biol Chem.

1990; 265: 12331–12336.

7. Brot-Laroche E, Serrano MA, Delhomme B, Alvarado F. Temperature sensitivity

and substrate specificity of two distinct Na -activated D-glucose transport systems in

guinea pig jejunal brush border membrane vesicles. J Biol Chem. 1986; 261: 6168–

6176.

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

8. Restrepo D, Kimmich GA. Kinetic analysis of mechanism of intestinal Na -

dependent sugar transport. Am J Physiol Cell Physiol. 1985; 248: C498–C509.

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

Table I: Primers for Real-Time PCR

Name/GenBank Forward Reverse Size

NaPiIa/U28504 CCCAGGGAGCAGTGTCAAC TCACAAGCAGGGCAATAAATGG 129

NaPiIIa/NM_013030 CTCACTGGTGTTTGGCATTTC AACAAGCACCACGAAGGC 94

NaPiIIb/AF157026 GGAGGCATTGGTGTTCTTGGTC GCAGATGGTCCCGAGTGGTAG 98

NaPiIIc/AB077042 TGTGAAGACCGTTATCAATGC AATGGCTGCCGTGAAGAC 127

Pit1/NM_031148 CCGTCAGCAACCAGATCAACTC CCCATGCAGTCTCCCACCTTG 121

Pit2/NM_017223 CTATTCCAAGAAGAGGCTCCG TCAGGATCGGTCAGCTCAG 126

BNPI/NM_053859 GTGTCGAGGAACCCCACTC AGAAGGAGAGAGGGCTGGTC 92

Na+/PO4/XM_225338 TCAGGGTCAATGCTTGGAACG GGAACCAGAGCAGGCAACAG 127

NPT4/NM_153622 AACCCAAGGAATCATCTTCAGC AGAGTGAGCAGTGACGATCC 135

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

Figure I: A. Time course of 0.05 mM Pi in VSMC showing that transport is linear for

20 min in the presence of Na+ (squares) and for 30 min at least in Na-free medium

(triangles). B and C. Saturating kinetics in the presence of Na+ or choline+, and

decomposition into transport and diffusion. D. Breakdown of total transport into Na-

dependent and Na-independent components.

0 5 10 15 20 25 30

0

1

2

3

4

Minutes

B A

0 1 2 3 4 50

100

200

300

400

500

600

700

800

PO4, mM

NaCl

Total uptake

Transport

Diffusion

C

0 1 2 3 4 50

100

200

300

400

PO4, mM

Total NaCl

Na-dependent

Na-independent

Choline Cl

0 1 2 3 4 50

100

200

300

400

500

600

700

800

PO4, mM

Total uptake

Transport

Diffusion

D

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

Figure II: Na activation of Pi transport in VSMC measured with increasing

concentrations of Na+ while maintaining osmolarity with choline+. Values were fitted to

a generalized Hill equation. The corresponding sigmoidal shape suggests a Hill

coefficient > 1, consistent with more than a single Na+ being transported per phosphate

molecule.

0 20 40 60 80 100 120 140

20

30

40

50

60

70

NaCl, mM

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

Figure III: Expression of Pit and Pit2 in Xenopus oocytes. Stage V oocytes were

injected with Pit1 and Pit2 cRNAs and exposed to increasing concentrations of Pi.

Triangles show Pit-expressed Pi transport and squares represent endogenous levels

obtained from water-injected oocytes. The thin curves correspond to non-linear

regressions of the triangle and square values, and were obtained after fitting data to

equation 1. The thick curves show net transport after subtracting fits of both Pit-

expressed transport and the endogenous level and then fitting this result to an equation

containing a single michaelian member.

Pit1

0.0 0.5 1.0 1.5 2.00.0

0.5

1.0

1.5

2.0

PO4, mM

Pit2

0.0 0.5 1.0 1.5 2.00.00

0.25

0.50

0.75

1.00

1.25

PO4, mM

by on May 18, 2011 atvb.ahajournals.orgDownloaded from

Figure IV: Knock down of Pit1 and Pit2 with stealth RNAi. A. RNA levels of Pit1

and Pit2 as indicated by ethidium bromide fluorescent bands after RT-PCR. B. The

effect of Pit1 and Pit2 RNAi on Na-dependent uptake (open bars) and Na-independent

Pi uptake (black bars). *p<0.05, **p<0.01 compared to control.

Control Pit1 Pit2 Pit1+2

0

10

20

30

40

50

60

70

80

90

100

11024 hours

**

*

**

RNAi RNAi RNAi RNAi

Pit1 Pit2

A

B

by on May 18, 2011 atvb.ahajournals.orgDownloaded from