Breadth by depth: Expanding our understanding of the repair of transposon-induced DNA double strand...

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

http://www.elsevier.com/copyright

Author's personal copy

DNA Repair 10 (2011) 1023– 1033

Contents lists available at ScienceDirect

DNA Repair

jo u rn al hom epa ge: www.elsev ier .com/ locate /dnarepai r

Breadth by depth: Expanding our understanding of the repair oftransposon-induced DNA double strand breaks via deep-sequencing

Neil D. Huefnera, Yurie Mizunoa, Clifford F. Weilb, Ian Korfc, Anne B. Britt a,∗

a Department of Plant Biology, University of California, Davis, CA 95616, United Statesb Department of Agronomy, Purdue University, West Lafayette, IN 47907, United Statesc Department of Molecular and Cellular Biology, University of California, Davis, CA 95616, United States

a r t i c l e i n f o

Article history:Received 24 June 2011Accepted 26 July 2011Available online 1 September 2011

Keywords:Hairpin endalt-NHEJAc element excision

a b s t r a c t

The transposases of DNA transposable elements catalyze the excision of the element from the hostgenome, but are not involved in the repair of the resulting double-strand break. To elucidate the roleof various host DNA repair and damage response proteins in the repair of the hairpin-ended dou-ble strand breaks (DSBs) generated during excision of the maize Ac element in Arabidopsis thaliana,we deep-sequenced hundreds of thousands of somatic excision products from a variety of repair- orresponse-defective mutants. We find that each of these repair/response defects negatively affects thepreservation of the ends, resulting in an enhanced frequency of deletions, insertions, and inversions atthe excision site. The spectra of the resulting repair products demonstrate, not unexpectedly, that thecanonical nonhomologous end joining (NHEJ) proteins DNA ligase IV and KU70 play an important role inthe repair of the lesion generated by Ac excision. Our data also indicate that auxiliary NHEJ repair proteinssuch as DNA ligase VI and DNA polymerase lambda are routinely involved in the repair of these lesions.Roles for the damage response kinases ATM and ATR in the repair of transposition-induced DSBs are alsodiscussed.

© 2011 Elsevier B.V. All rights reserved.

1. Introduction

DNA double strand breaks (DSBs) pose a significant threat toa cell’s genomic integrity. Failure to rapidly and appropriatelyrespond to such breaks can lead to perturbations of the cell cycle,chromosomal rearrangements, or cell death. Multiple pathwaysfunction in the recognition of and response to DSBs; the highly con-served nature of these repair pathways across kingdoms highlightsthe importance of mounting an efficient response to these lesions[1–3]. The initial response to DSBs is coordinated in large part bythe checkpoint kinases ATM (ataxia-telangiectasia, mutated) andATR (ATM and Rad3-related), members of the phosphoinositide-3-kinase-related protein kinase (PIKK) family [4,5]. The ultimaterepair of a DSB may proceed via pathways requiring extensivehomology between the broken ends and the repair template, suchas homologous recombination or single-strand annealing, or viapathways that do not require such pairing [6]. Nonhomologous

Abbreviations: P-nucleotides, palindromic nucleotides; PEP, predominantexcision pattern.

∗ Corresponding author at: Department of Plant Biology, University of California,1 Shields Ave., Davis, CA 95616, United States. Tel.: +1 530 752 0699;fax: +1 530 752 5410.

E-mail address: [email protected] (A.B. Britt).

end-joining (NHEJ) does not rely on the presence of a repair tem-plate, and so can introduce deletions or insertions at the repair site.While factors such as DNA ligase IV (LIG4) and KU70 play an essen-tial role in the canonical NHEJ pathway, it is clear that alternativeNHEJ (alt-NHEJ) pathways exist which function independently ofthese factors; the identity and role of the proteins involved in thesealternative NHEJ pathways remain, in many cases, unclear [7–10].

The manner and location in which a DSB is generated can havea significant impact on its repair. Class II transposable elements,which mobilize via a cut-and-paste mechanism, provide a powerfultool in addressing questions regarding the diversity and distribu-tion of repair products produced from a single style of break at awell-defined locus. Members of the hAT superfamily of transposons,such as McClintock’s Ac element, encode transposases whose func-tion is similar to that of RAG recombinase in V(D)J recombination[11]. Cleavage of the transposable element begins with nicks onenucleotide into the host DNA that flanks both 5′ ends of the trans-poson; each of the broken ends is then sealed to its complementarystrand, forming a hairpin loop and releasing the transposable ele-ment [11–13] (Fig. 1). While excision of the transposable elementis mediated by the transposase [14], resolution of the hairpin loopsand rejoining of the DSB must be carried out by host-encoded pro-teins [12,15].

Given the existence of multiple DSB repair pathways and theflexibility of end-processing pathways, a wide variety of excision

1568-7864/$ – see front matter © 2011 Elsevier B.V. All rights reserved.doi:10.1016/j.dnarep.2011.07.011


1024 N.D. Huefner et al. / DNA Repair 10 (2011) 1023– 1033

Fig. 1. Model of transposition in hAT superfamily [11]. Nicks on opposing strands aremade in DNA flanking the transposable element (TE) by the transposase. Formationof hairpin loops results in excision of the TE and production of a DSB.

products can be produced. The spectra of repair products generatedand their relative distributions in different mutant backgroundsprovide insight into the repair of DSBs and the roles specific pro-teins play in that repair. Deep sequencing techniques provide anunprecedented look at the distribution of these repair products byenabling us to rapidly sequence millions of unique DNA repair prod-ucts; the ability to multiplex sequences from multiple replicatesand genetic backgrounds in a single run further increases the util-ity of this approach [16,17]. In order to gain a better understandingof the roles that various enzymes play in the repair of DSBs, wehave used this deep sequencing approach to analyze the spectrumof excision products in a variety of mutant backgrounds.

2. Materials and methods

2.1. Plant lines

The Arabidopsis T-DNA insertion line A3 was used as the parentalsource of the modified maize transposable element Ac�NaeI and asthe wild-type control [18]. The intact transposon is flanked by tar-get site duplications 8 bp in length and is embedded in a portion ofthe maize waxy (wx) gene; the transposable element with its flank-ing wx sequences is in turn embedded in the T-DNA construct usedto generate the A3 line. This T-DNA construct, which is carried onthe short arm of the fifth chromosome in the A3 line, is described ingreater detail elsewhere [12,18]. The following alleles were used ingenerating our mutant lines: lig4-2 [19], ku70 [20], lig6-1 [21], polL(salk 075391C) [22,23], atr-2 [24], and atm-2 [25]; all lines werein the Col ecotype. The primers used to detect the intact Ac�NaeIelement and in genotyping the mutant lines are summarized inTable 1.

2.2. Isolation of mutant lines

The Ac insertion line was crossed with each of the six differentDNA repair, putative DNA repair, or DNA repair checkpoint mutantlines: lig4, ku70, lig6, polL, atr, and atm. The F2 progeny was screenedby PCR to identify homozygous mutant lines that also carried anintact Ac construct. At least ten F3 seedlings from each homozygousmutant line were screened by PCR to distinguish lines homozy-gous for the Ac construct from lines segregating for its presence.For each of the mutant strains, with the exception of atr, a homozy-gous mutant line with two copies of the intact Ac construct wasidentified. Of the five homozygous mutant atr F2 lines identified

Table 1Primers used in the detection of the intact Ac�NaeI element and in genotypingmutant lines.

Genotype Name Sequence

Ac�NaeIAc 3′ENDOUT GGAATTCGTTTCCGTCCCGCC15 TATCCAGCTCGAGTGGGTGGTGAG

lig4-2LB3 TAGCATCTGAATTTCATAACCAATCTC(C)Lig4-2 CATTAAGACTTCAAGCATTAATCTC(B)Lig4-2 GGCATGAATGTCTTGATGTGC

lig6-1LBa1 TGGTTCACGTAGTGGGCCATCG(B)Lig6-R CCCTTGAATCTTCTTTGCATTC(A)Lig6-L CCTACCTCTGCGTCCAACAT

ku70LBb1 GCGTGGACCGCTTGCTGCAACTKu70 Rev ACGCTTCTTCAGTTGGTCCTKu70 Fw TAAAGACAGCAGATAAACGC

atr-2LBa1 TGGTTCACGTAGTGGGCCATCGatr2-1 GGATCAAGTACTACTGACTCAGatr2-3 CAACTCATTTTGAATATGAGAG

atm-2LBa1 TGGTTCACGTAGTGGGCCATCGATM126 TCTCTCCTTGTTTCAAGCTCTGCATM125 GTTGGGCAGTTCCAAAGATG

polLLBb1 GCGTGGACCGCTTGCTGCAACTPolL-gDNA-Rev CGCCGTAGCTCCTGACCAGGPolL-gDNA GGAAGTTTGGGGTGTCGGTC

that carried the Ac construct, each appeared to have only a singlecopy; an atr line in which seven of the ten F3 progenies tested pos-itive for the presence of the Ac construct was selected for use inthe excision product library. All lines appeared to carry active Acelements (as revealed by PCR for excision products). In all cases,Ac activity had no effect on the plants’ growth, development orfertility.

2.3. Growth conditions

Plants were grown at 20 ◦C and 60% humidity in ConvironCMP4040 growth chambers on either Sunshine Mix #1 soil (SunGro Horticulture, Bellevue, WA) or 1× nutritive MS (Sigma–Aldrich,Saint Louis, MO), Phytoagar (PlantMedia, Dublin, OH), pH 5.9. A16 h day/8 h night cycle was simulated using light from cool-whitelamps (100–150 �mol m−2 s−1) filtered through Clear UV-filteringProtect-O-Sleeves (McGill Electrical Product Group, Rosemont, IL).Seeds to be used in the generation of the DNA library were surfacesterilized for 4 h using the vapor-phase method [26]. Seeds weresown on MS-agar plates and stored at 4 ◦C for 4 days before beingtransferred to the growth chamber; the age of the seedlings wascounted from the time the seeds were transferred to the growthchamber. Plates were maintained in a near vertical orientation suchthat the roots grew along the surface of the agar.

2.4. Isolation of genomic DNA

Genomic DNA was isolated as follows: 10 five-day-old seedlingswere harvested in a single tube (in the case of the atr line, 13seedlings rather than 10 were used, as the Ac construct was seg-regating in this line). Seedlings were macerated using a disposablepestle immediately prior to the addition of 400 �L of extractionbuffer (200 mM Tris–HCl, pH 9.0, 400 mM LiCl, 25 mM EDTA, 1%SDS). Samples were incubated at room temperature for 5 min andthen centrifuged briefly before transferring the supernatant toan equal volume of isopropanol. Samples were centrifuged againbefore decanting the supernatant to allow the extracted DNA toair dry prior to resuspension in 200 �L TE. Samples were furtherpurified by phenol:chloroform extraction and again pelleted in


N.D. Huefner et al. / DNA Repair 10 (2011) 1023– 1033 1025

Fig. 2. Structure of amplified Ac excision products. Modified tandem repeats that flank the intact Ac element are shown as a shaded box with their sequence highlighted (aninversion of the two centermost nucleotides, as observed in the predominant excision product, is depicted in this sequence). Position of the primers used to amplify excisionproducts (AcN4pho and AcH1bio) as well as restriction sites in sequences upstream and downstream of the Ac excision site are shown. Numbers above the diagram indicatethe number of bases between the indicated restriction sites.

isopropanol and resuspended in TE [27]. Four biological replicateswere prepared for each line for a total of 28 samples.

2.5. Amplification of excision products

Ac excision products were amplified by PCR using Ex Taqpolymerase (TaKaRa Bio Inc.), a biotinylated primer withan engineered NheI restriction site (bold) ‘AcH1bio’ (biotin-5′-GTGTGGCGGCTAGCCAGCGCTCCATGGTTTAATAAG-3′), and aphosphorylated primer ‘AcN4pho’ (P-5′-TCATTTGGAGAGGAC-ACGCTCGAC-3′) (0.025 units/�L Ex Taq, 1× Ex Taq buffer, 200 �Meach dNTP, 0.24 �M each primer, 8.0 ng/�L template, 41.0 �Ltotal reaction volume) (Fig. 2). Thermocycling conditions were asfollows: denaturation at 98 ◦C for 10 s, annealing at 66 ◦C for 30 s,extension at 72 ◦C for 30 s, 28 cycles. Because PCR amplificationworked most effectively with a total reaction volume less than50 �L, six individual PCRs were run and then pooled for each ofthe 28 samples in order to obtain an ample amount of product forsubsequent steps.

2.6. Isolation of biotin labeled molecules

Biotin labeled molecules were isolated from PCR amplificationreactions using High Capacity NeutrAvidin Agarose Resin (ThermoFisher Scientific, Waltham, MA). Following amplification, 225 �L ofthe PCR mixtures were combined with 300 �L NeutrAvidin AgaroseResin slurry in 1.5 mL tubes and diluted to a final volume of 600 �Lwith 1× PBS, pH 7.4/1.0 mM EDTA. Samples were incubated on arotator at 25 ◦C for 12 h and then rinsed once with 1 mL 1× PBS, pH7.4/1.0 mM EDTA for 10 min and twice with 1 mL volumes of ddH2Ofor 5 min [28,29].

2.7. Preparation of indexed adapters

Custom indexed adapters were used in place of the standardIllumina adapters. Adapters included a unique 4 bp tag; each ofthe tags or ‘barcodes’ differed from the remaining barcodes in atleast two of the four nucleotide positions. A set of 28 barcodes wasselected that was split evenly between either a 25% or a 75% GCcontent and that did not end with either a G or T; each barcodewas assigned to a single genotype (Table 2). For each of the 28barcodes, three adapters were designed: Adapter1 with a 3′-Toverhang (oligoA1 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATC-TXXXXT-3′, oligoB1pho P-5′-XXXXAGATCGGAAGAGCTCGTATGCC-GTCTTCTGCTTG-3′, where ‘XXXX’ and ‘XXXX’ represent one ofthe 28 unique barcodes and its reverse complement), Adapter2with a 5′-CTAG overhang (oligoA2 5′-ACACTCTTTCCCTACACGA-CGCTCTTCCGATCTXXXX-3′, oligoB2pho P-5′-CTAGXXXXAGATC-GGAAGAGCTCGTATGCCGTCTTCTGCTTG-3′), and Adapter3 with a5′-CGCG overhang (oligoA3 5′-ACACTCTTTCCCTACACGACGCTC-TTCCGATCTXXXX-3′, oligoB3pho P-5′-CGCGXXXXAGATCGGAAG-AGCTCGTATGCCGTCTTCTGCTTG-3′); oligonucleotides wereordered through Invitrogen (Carlsbad, CA). Adapters were pre-pared from appropriate oligonucleotide pairs and diluted to aworking concentration of 15 �M [16].

Table 2Barcode sequences were used to label excision products. Genotypes were assignedunique barcodes for each of four biological replicates; all barcodes differ from oneanother in at least two of four nucleotide positions. Also reported is the number ofreads (n) from each dataset that aligned well with sequences both upstream anddownstream of the Ac excision site; only those reads corresponding to the XbaIdigested product collection are reported (see text).

Genotype Barcodes n Genotype Barcodes n

WT

AGGC 14,310 polL AAAC 4840CCTC 8879 CTGC 17,217GATA 18,443 GGCA 8300TACA 9387 TTGA 3435

lig4-2

AAGA 32,995 atr-2 ACAA 3600CTTA 16,400 CGAC 11,154GCAC 24,657 GTCC 2250TCGC 24,553 TGAA 2554

ku70

ATCA 4922 atm-2 AGTA 1613CACC 4291 CCCA 4110GGTC 3247 GAGC 6931TCTA 3022 TATC 4674

lig6-1

ACCC 3229CGGA 13,955GTAA 6757TTAC 1902

2.8. Restriction digests and ligation of adapters to Ac excisionproducts

For each of the 28 samples, four separate excision productcollections were created covering different regions of the originalPCR amplification products. Four parallel reactions were set upto cleave the amplification products a specific distance from theoriginal excision site and to affix an indexed adapter to one end.In this paper we report only our results obtained from productscleaved and sequenced from an XbaI restriction site 53 bp fromthe Ac excision site (Fig. 2); results from the remaining excisionproduct collections are consistent with these results. The reactionconditions used to generate the excision product collections wereadapted from Illumina’s library preparation protocol [16,30].Conditions for the XbaI excision product collection were as fol-lows: 35 �L NeutrAvidin Agarose Resin with bound biotinylatedamplification products (as described above), 4 �M Adapter2 withappropriate barcode and XbaI compatible overhang, 1× NE buffer4, 1 mM ATP, 400 U T4 DNA ligase, 40 U XbaI, 100 �g/mL BSA,ddH2O to a final volume of 75 �L. After 16 h incubation on arotator at 37 ◦C, the NeutrAvidin Agarose Resin from each reactionwas rinsed twice with 1 mL volumes of ddH2O for 5 min each.The amplified excision products, now modified with an indexedadapter on one end, were cleaved from the NeutrAvidin AgaroseResin (at the engineered NheI site in primer ‘AcH1bio’) and thesecond indexed adapter was ligated to the cleaved end; reactionconditions were as follows: 35 �L NeutrAvidin Agarose Resin withbound, adapter modified, amplification products, 4 �M Adapter2,1× NE buffer 4, 1 mM ATP, 400 U T4 DNA ligase, 40 U NheI,100 �g/mL BSA, and ddH2O to a final volume of 75 �L. Sampleswere incubated on a rotator at 37 ◦C for 16 h. Adapter-modified



DNA fragments were enriched by PCR using primers ‘SolPCR-A’ (5′-CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT-3′) and‘SolPCR-B’ (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCC-TACACGACGCTCTTCCGATCT-3′) and 1 �L of the cleavage/ligationreaction used as the template; reaction and cycling conditionswere as described above with a final volume of 25 �L and anannealing temperature of 68 ◦C over 38 cycles. For each sample,two independent PCRs were run and then pooled for a total volumeof 50 �L; a small aliquot of each reaction was run on an agarosegel to confirm the presence of the desired product.

Reaction conditions used to generate the three additional exci-sion product collections (Full length, BssHII digested, and BsaAIdigested) were similar to those used to generate the XbaI digestedcollections and are discussed in Supplemental text. For eachsample, the PCR enriched products from the four excision prod-uct collections were pooled and run on a 1.5% agarose gel. Theregions between 200 bp and 500 bp were excised and the DNAextracted using QIAquick Gel Extraction Kits (Qiagen, Valencia,CA); 5 �L of eluate from each of the 28 samples were pooled andmixed thoroughly. Adapter-modified DNA fragments were againenriched by PCR as above using the pooled eluate as the tem-plate. Reactions were run on a 1.5% agarose gel and the DNAfrom the 200 bp to 500 bp region was again excised and extractedusing Qiagen’s ‘Gel Extraction Spin Protocol’. The concentrationand quality of the resultant DNA library were checked using aNanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham,MA).

2.9. Sequencing of Ac excision product library

The DNA library was delivered to the DNA Technologies Coreat the UC Davis Genome Center (Davis, CA, USA) for flow cellpreparation and multiplex sequencing. The library was processedusing a Genome Analyzer IIx (Illumina, San Diego, CA) accordingto the manufacturer’s recommendations. Single-end sequencingdata were collected for 85 cycles over 120 tiles with an average of185,698 clusters per tile. Image analysis and base calling were per-formed automatically using Illumina’s Primary Analysis software.The resulting dataset is available upon request.

2.10. Sequence data processing

A total of 18,495,640 84 bp reads were generated from the Acexcision product library in a single sequencing run. Perl scriptswere used to sort the sequence data according to the 28 uniquefour-nucleotide barcodes (see Section 2.7); those reads that didnot include a valid barcode and those that contained ambigu-ous nucleotides in any position were discarded (12.8% of thetotal number of reads). Each of the reads was aligned to thesequence upstream or downstream of the Ac element with AB-BLAST (Advanced Biocomputing, LCC, Saint Louis, MO) with thefollowing parameters: M = 1, N = −5, W = 8, S = 8 – nogap. The singlehighest scoring alignment for the upstream sequence and down-stream sequence was identified for each read. Reads exhibitingpoor alignment with either the upstream or downstream sequenceor both (i.e., reads that aligned on only one side of the excisionsite, or did not align at all) were discarded. Given that the primersused to amplify excision products should legitimately amplifyonly those repair products that retain these sequences (see Sec-tion 2.5 and Fig. 2), some products, such as those with deletionsbeyond these limits and those exhibiting chromosomal rearrange-ments, are outside the scope of our detection. Perl scripts wereused to identify the sequence start position of each read and togroup the reads accordingly. As stated above, in this paper wereport only those results derived from reads beginning at theXbaI sequencing start position; this resulted in 261,627 legible

reads (see Table 2 for breakdown by genotype and barcode). Theupstream and downstream alignments from each read were com-pared to identify and characterize deletions or insertions presentat the excision repair site; reads of identical sequence at and acrossthe repair junction were pooled and tallied within each barcodeddataset.

3. Results and discussion

3.1. Spectrum of footprints in the wild-type line

The transposable element present in our lines is embedded in atransgenic sequence derived from maize. Thus there is no homolo-gous “wild-type” sequence available as a template for repair. OnlyNHEJ (in all its permutations) and single-strand annealing (SSA)are available as options for repair. The Ac element introduces an8 bp target site direct duplication upon insertion; this duplicationis present in our transgenic construct. Repair via SSA, employingthe duplicated target site as the direct repeat for rejoining of over-hanging ends, would restore the “wild-type” allele. However, ashas already been repeatedly demonstrated [31], in lines that lacka wild-type homologue Ac excision rarely restores the wild-typeallele. In our dataset, restoration of the “wild-type” (single copy ofthe target site duplication) allele constituted only 3.74 ± 1.17% ofall products formed in our repair-proficient lines. This fraction wassignificantly enhanced in the polL mutant (12.06 ± 1.42), and wassignificantly decreased in lig4 (1.82 ± 0.72). Far more rare was the“precise” excision product, in which both target site duplicationsare present in an unmodified form; this product was observed onlyonce in 261,000 reads.

The products observed here are comparable to those producedby zinc-finger nuclease (ZFN) generated breaks, in that the endsare well conserved, and both deletions and insertions are small[32–34] (Sup. Fig. 1 lists the sequences of the 47 excision prod-ucts that make up approximately 90% of all wild-type footprints).Ac excision products differ from ZFN-induced mutations, however,in their tendency to exhibit short palindromic (inverted repeat)sequences derived from the target site bordering the element. Thissuggests that while hairpin formation and (erroneous) re-openingare commonplace at Ac excision sites, hairpin formation is rare ornonexistent at ZFN-induced breaks.

Outside of palindromic sequences derived from hairpin reopen-ing, these Ac footprints, like ZFN-derived mutations, do not exhibitthe insertion of short duplications of random local sequences(chromosomal and T-DNA-derived) that are frequently observedin agrobacterial T-DNA insertion sites [35].

Excision of the Ac element leaves behind a characteristic “foot-print” – a modified 8 bp target site duplication – which we describebelow as the “predominant excision pattern (PEP)”. In all fourwild-type datasets, the PEP accounts for approximately half of allreads, averaging 55.0% ± 12.4 of all excision products. PEP is char-acterized by the presence of a modified 8 bp tandem repeat inwhich the two center-most bases are replaced with their com-plements (Fig. 3A). Production of this same footprint has beendescribed before [12,31] and is consistent with the model ofAc excision described above, in which transposition is coupledwith the production of hairpin structures on both ends of theexcision site; these hairpin structures must be opened beforethe broken ends can be rejoined. Opening of the hairpin loops,which can introduce stretches of palindromic (P) nucleotides atthe excision site [15,36–40], end-processing by either nucleasesor polymerases or both, and finally ligation, gives rise to thefinal excision repair product (Fig. 3B). A summary of the dis-tribution of the types of repair products observed is shown inTable 3.



Fig. 3. (A) (Top) Diagram of the intact Ac element and adjacent DNA; target siteduplications are shown in bold. (Bottom) Sequence of the predominant excisionpattern (PEP) repair junction; circle highlights the inversion of the two center-mostnucleotides. (B) Model depicting the opening of hairpin loops and repair of the DSBat excision sites. Variability in the position in which each hairpin loop is opened, andthe subsequent processing of the broken ends by polymerases, nucleases, or both,leads to a variety of repair products.

3.2. The role of classic NHEJ proteins in the repair of Ac excisionproducts

Given that transposition of the Ac element involves the pro-duction of a DSB whose repair is host-factor dependent, it is notsurprising that plants employ NHEJ in the repair of transpositionproducts. Other work has shown that repair of Ac excision eventsin yeast cells is largely dependent upon KU70 and other essentialNHEJ factors [15]. Additional evidence that canonical NHEJ proteinsplay an important role in the repair of these DSBs is clearly seen inthe spectra of excision repair products in the ku70 and lig4 mutantlines (Fig. 4). While the overall frequency of excision repair eventsis not reflected in the sequencing data, it is apparent that the repairof these events is not strictly dependent upon the canonical NHEJpathway, as some repair is still carried out in both mutant lines.

3.3. A shift in the most common repair product in NHEJ deficientlines

One of the most obvious differences in the spectra of footprintsobserved in our NHEJ deficient lines as compared to wild-type,is a shift in the most common repair product from the PEP to afootprint with a six-nucleotide insertion at the excision site. Thisdifference is most striking in our lig4 line where the PEP accounts foronly 1.5% ± 0.5 of the reads observed, whereas the six-nucleotideinsertion product accounts for 64.5% ± 25.6 of the reads. In theku70 line, the PEP and six-nucleotide insertion product accountfor 23.1% ± 5.3 and 29.4% ± 4.4 of the reads respectively. A simi-lar, though less pronounced, shift towards this particular repairproduct is observed in several of our other mutant lines as well.The favorability of the six-nucleotide insertion product can likelybe explained in large part by the sequence of the target site dupli-cations that flank the intact Ac element. If the hairpins producedduring transposition are opened at or near the apex of the hairpinstructure, little or no microhomology will exist between the brokenends; in the wild-type background, these ends can be resolved toproduce the PEP. If, however, either one or both hairpins are openedfurther from the apex of the structure, the overhanging ends mayanneal, forming a highly stable repair intermediate with up to eightcomplementary bases. Resolution of this intermediate would favorproduction of the six-nucleotide insertion product. Either changesin the position in which the hairpins are opened or an increaseddependency on stabilizing microhomologies for repair would shiftthe distribution of repair products away from the PEP and towardsthe six-nucleotide insertion product.

3.4. A shift towards longer stretches of potential microhomologyis observed in lig4

Other work has shown that unlike other ligases, DNA ligase IV(LIG4) is capable of rejoining ends stabilized by little or no micro-homology [41], and that in the absence of LIG4, DSB repair productsgenerally exhibit an increase in the length of microhomology at therepair junction [42]. Plants, which lack a DNA ligase III homologue,may rely on DNA ligase I (LIG1) to rejoin broken ends in the absenceof LIG4. Considered as a nick ligase, LIG1 exhibits a greater prefer-ence for templates stabilized by longer stretches of homology thandoes LIG4 [41,43]; this preference could explain the dramatic shiftaway from the PEP in the lig4 mutant in favor of a product withmuch greater potential for microhomology. In order to determinewhether this is a general effect – whether microhomology playsa more significant role in DSB repair in the absence of LIG4 – wecompared the frequency of repair products potentially derived via

Table 3Distribution of repair products in wild-type and mutant lines. Mean values, reported as percentage of reads from a given background that fall within the specified category,were taken over the four replicates for each line; standard deviations are reported in parenthesis. Categories of repair products, as further described in the text, are as follows:PEP, predominant excision pattern; P, palindromic nucleotides present at repair junction; D, deletion at repair junction; I, insertion of non-palindromic nucleotides at repairjunction.

PEP P P&D P&I P&D&I D D&I I Total ‘P’ Total ‘D’ Total ‘I’

Wild-type55.0 5.5 10.7 0.2 4.2 19.9 4.6 0.0 20.6 39.3 9.0(12.4) (2.3) (3.7) (0.1) (0.4) (5.9) (0.4) (0.0) (6.3) (10.1) (0.9)

lig41.5 64.9 6.6 2.5 18.4 3.7 2.3 0.0 92.5 31.1 23.3(0.5) (25.4) (2.2) (0.8) (21.2) (1.2) (2.2) (0.0) (3.5) (25.9) (22.7)

ku7023.1 30.5 10.9 1.6 7.2 21.6 5.1 0.0 50.3 44.8 13.9(5.3) (4.8) (2.7) (0.5) (0.7) (1.1) (0.6) (0.0) (5.8) (1.2) (1.2)

lig627.4 27.0 8.5 1.5 7.1 22.5 5.9 0.0 44.1 44.1 14.6(3.5) (3.4) (1.3) (0.3) (0.6) (2.9) (2.9) (0.0) (3.1) (1.0) (2.8)

polL28.3 10.9 9.9 0.7 4.3 41.3 4.5 0.0 25.9 60.1 9.5(2.5) (4.7) (1.7) (0.3) (1.1) (4.3) (0.4) (0.0) (6.2) (3.7) (1.1)

atm37.9 21.6 10.6 0.9 7.5 17.3 4.3 0.0 40.5 39.7 12.7(9.5) (10.4) (2.0) (0.5) (1.6) (5.4) (0.9) (0.0) (10.8) (5.4) (0.8)

atr37.5 26.3 6.5 1.3 6.6 16.5 5.3 0.0 40.7 34.9 13.1(3.4) (9.0) (0.6) (0.4) (0.9) (5.8) (1.3) (0.0) (9.3) (6.5) (1.3)



Fig. 4. (Top) Spectra of excision products observed in wild-type and mutant backgrounds; rows correspond to the four biological replicates for each line. Patterns areorganized by category as described in the text (see also Table 3). PEP, predominant excision pattern; P, palindromic nucleotides present at repair junction; D, deletion atrepair junction; I, insertion of non-palindromic nucleotides at repair junction. The ordering of the excision products, and their color representation, is consistent across chartsfor all genotypes and replicates; within a given chart, each section represents a unique excision repair pattern. (Bottom) Sequences of major excision patterns representedin the spectra of repair products. Vertical dashed lines mark positions of hairpin axes. Nucleotides in lowercase correspond to palindromic sequences derived from the left,right, or both (underlined) sides of the excision site. Nucleotides in bold represent possible microhomologies between the left and right sides. Nucleotides centered betweendashed lines represent non-palindromic insertions. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

microhomology-mediated repair in wt versus lig4 lines. The distri-bution of repair products shows a significant shift towards longerstretches of potential microhomology in the absence of LIG4 (Fig. 5).We considered that the major product in the lig4 background mayovershadow the presence of other repair products, and so, exam-ined a subset of repair products, those with no insertion at therepair site, and found a similar shift in the length of junctionalmicrohomology (Fig. 5). Our results are consistent with a modelin which the bulk of Ac transposition events are repaired via NHEJin a LIG4-dependent fashion; other events, even in wild-type lines,may be repaired via alt-NHEJ in a LIG4-independent fashion, butsuch events appear to require more extensive microhomology atthe repair junction.

3.5. Deletions in Ac excision products are more frequent in ku70

The KU70/80 heterodimer associates rapidly with the exposedends of a DSB, where it serves as a scaffold for the assembly ofother essential NHEJ factors and prevents significant degradationof the exposed ends [44–46]. The absence of KU generally resultsin an increase in the size of deletions at the site of repair [47,48]. Toaddress the impact KU70 plays on deletion size during the repair

of Ac excision events, we analyzed each repair product for thepresence and size of deletions at the excision site. Because thelocation of the DSB is non-random, we were able to consider eachbroken end independently and determine how many nucleotideswere lost from each side of the break. In cases where we couldnot unambiguously determine the side from which a particularnucleotide was lost (i.e., nucleotides that exhibit microhomology),these nucleotides were not included in the calculation of deletionsize from either broken end (Fig. 6, inset). As seen in Fig. 6, there isa clear shift towards larger deletions among repair products in theku70 mutant, although there is no significant change in the over-all frequency of deletions (Table 3). Consistent with these results,increased deletion size has also been observed after repair ofendonuclease-induced DSBs in the ku80 mutant of Arabidopsis [32].

3.6. Longer stretches of palindromic nucleotides (P-nucleotides)are observed in repair products from ku70

One of the clearest differences between the distribution of exci-sion repair products in ku70 as compared to wild-type is a majorshift away from the PEP in favor of a six-nucleotide insertion prod-uct. One possible cause for such a shift may be a change in the



Fig. 5. Percentage of reads exhibiting varying lengths of putative microhomology at the repair junction in wild-type (dark grey) and lig4 (light grey) backgrounds. Error barsdepict standard deviation across biological replicates. (Left) Distribution of all repair products. (Right) Distribution of repair products with putative microhomology, but noinsertion (palindromic or non-palindromic).

position at which the hairpin intermediates are opened. Giventhat the KU70/80 heterodimer is closely associated with the bro-ken ends of DNA, it is reasonable to conjecture that it may play arole in limiting the position at which the hairpin structures can benicked.

The introduction of P-nucleotides at the repair junction of manyexcision products is a common byproduct of the hairpin interme-diate step of the transposition mechanism [15,37,39,49,50]. Repairproducts arising from hairpins nicked far from their apex have thepotential to introduce longer stretches of P-nucleotides at the repairjunction than those that are nicked near the apex; the number of P-nucleotides present in a particular repair product can therefore givesome measure of the distance from the apex at which the hairpinstructure was opened. In our ku70 line, a clear shift is seen towardslonger stretches of P-nucleotides at the repair junction as com-pared to wild-type (Fig. 7). Our data support a model in which theKU70/80 heterodimer limits access to the hairpin structure, suchthat the endonuclease or endonucleases responsible for openingthe hairpin preferentially nick the loop within a few basepairs ofthe apex. In KU-deficient lines, greater accessibility to the hairpinstructure results in the production of longer overhangs, and in turn,longer stretches of P-nucleotides at repair junctions.

Fig. 6. Percentage of reads exhibiting varying sizes of deletions from ‘left’ and ‘right’sides of excision site in wild-type (dark grey) and ku70 (light grey) lines. Error barsdepict standard deviation across biological replicates. (Inset) Example of how dele-tion sizes was calculated for left and right sides of each excision pattern. Deletionsize for each side of the excision site was treated independently; nucleotides thatcould not be unambiguously assigned to either side (circled) were not included incalculation of deletion size from either side. The sequence depicted falls into both the1–4 bp deletion (see right side) and in the 5–8 bp (see left side) deletion categories.

3.7. The role of DNA ligase VI in the repair of Ac excision products

As mentioned above, transposition of the Ac element and V(D)Jrecombination demonstrate several similarities, including the pro-duction of hairpin structures at the DSB. In V(D)J recombination,hairpin structures at the coding ends of gene segments that areto become mature Ig or Tcr genes are opened by the endonu-clease ARTEMIS [51]. Sequence and structure analysis by othergroups identified DNA ligase VI (LIG6) as a potential homologue ofARTEMIS in Arabidopsis [52]. Given the similarities between LIG6and ARTEMIS, we sought to test whether LIG6 is involved in therepair of Ac excision products, and more specifically, if it is theendonuclease responsible for opening the hairpin structures pro-duced during transposition. The overall distribution of excisionrepair products exhibits a clear difference between lig6 and thewild-type background, indicating that LIG6 is indeed involved inthe repair of Ac transposition products (Fig. 4). To better understandthe role of LIG6 in the repair of transposition products, we lookedat the number of P-nucleotides present in the repair footprints toget a better sense of where the hairpin structures were opened

Fig. 7. Percentage of reads exhibiting varying sizes of P-nucleotide insertionsderived from either the ‘left’ or ‘right’ side of the excision site in wild-type (dark grey)and ku70 (light grey) lines. Error bars depict standard deviation across biologicalreplicates. (Inset) Example of how the P-nucleotide insertion sizes was calculatedfor left and right sides of each excision pattern. P-nucleotides derived from leftand right flanking sequences were treated independently; nucleotides that couldnot be unambiguously assigned to either side (circled) were included in calcula-tion of insertion size for both sides (comparable results are obtained if these samenucleotides are included in the calculation of insertion size for neither size). Thesequence depicted falls into both the 5–6 P-nucleotide and 9–10 P-nucleotide inser-tion length categories.



Fig. 8. Percentage of reads exhibiting varying sizes of P-nucleotide insertionsderived from either the ‘left’ or ‘right’ side of the excision site in wild-type (darkgrey) and lig6 (light grey) lines. Error bars depict standard deviation across biolog-ical replicates. See Fig. 6 for additional information on how P-nucleotide insertionlengths were calculated.

prior to rejoining. As in the case of ku70, we observed a reductionin the fraction of repair products that had between one and threeP-nucleotides and an increase in the fraction containing betweenfour and eight P-nucleotides (Fig. 8). There is a slight increase in thefraction of repair products with nine or more P-nucleotides; how-ever, unlike in the ku70 mutant, the difference was not statisticallysignificant in lig6. Our results suggest that while LIG6 is not essen-tial in opening hairpins produced during Ac excision, in its absence,hairpins tend to be opened further from the apex. While we cannotconclusively state that LIG6 is a functional homologue of ARTEMIS,our data support a model in which LIG6 binds hairpin structuresand either nicks or facilitates the nicking of hairpins close to theirapex. In the absence of LIG6, other nucleases may open the hairpinstructures, but tend to do so further from the apex. In either case,the presence of the KU70/80 heterodimer still appears to limit thedistance from the apex in which the hairpin may be opened.

3.8. Loss of DNA polymerase lambda causes a shift towards largerdeletions in repair products

Prior to ligation, the ends of a double strand break often mustbe processed to produce a substrate capable of being joined. Inmany cases this is accomplished through resection or trimming bya variety of nucleases; in other cases however, processing includesextension of the broken ends by polymerases [51,53–56]. Membersof the pol X polymerase family, which exhibit far more flexibilityin their substrate requirements than do other polymerases, havebeen shown to play important roles during both NHEJ and V(D)Jrecombination [55–57]. DNA polymerase lambda (POLL), the onlypol X member that has been identified in plants [22,58,59], may becapable of extending broken ends across a DSB, thereby produc-ing a substrate that may be rejoined by LIG4 with minimal loss ofnucleotides from the break site. The distribution of excision repairproducts in our polL mutant differs significantly from that of wild-type, suggesting some role for POLL in the repair of Ac excisionproducts (Fig. 4). The significant reduction in the contribution of thePEP in the polL background may provide insight into the mechanismwhereby the PEP is produced. As in V(D)J recombination [60,61], ourresults suggest that the hairpins produced during excision of this Acinsertion are most often cleaved at or near the apex of the hairpin.Cleavage of both hairpin structures at their apices would producestructures with non-complementary single base 3′ overhangs. Lig-ation of such products requires either the deletion of nucleotidesat the junction or gap filling across a non-continuous template; thetemplated extension of the broken ends across this gap, followed

Fig. 9. Percentage of reads exhibiting varying sizes of deletions from ‘left’ and ‘right’sides of excision site in wild-type (dark grey) and polL (light grey) lines. Error barsdepict standard deviation across biological replicates. See Fig. 5 for additional infor-mation on how deletion sizes were calculated.

by ligation, would lead to production of the PEP. The observationthat POLL enhances the frequency of the PEP relative to other prod-ucts may indicate that POLL is important in filling in such gaps priorto ligation. While the relative abundance of the PEP is reduced inthe polL mutant, POLL is not essential for its production; this isunsurprising given the flexibility in hairpin opening that producesa variety of intermediate products, some of which may be rejoinedto create the PEP without the need for a gap-filling step prior toligation.

While some members of the pol X family (i.e. terminal deoxynu-cleotidyl transferases) are capable of untemplated incorporation ofnucleotides [62], it is unlikely that POLL engages in such an activity.If it did, we would expect to see a decrease in the relative abun-dance of repair products with non-palindromic insertions in thepolL mutant as compared to wild-type, but we did not (9.5% ± 1.1and 9.0% ± 0.9 respectively).

Template based extension by POLL across a DSB may producesufficient complementation between the broken strands to allowfurther extension by other polymerases followed by ligation, orpermit the direct ligation of the broken ends. In the absence ofsuch activity, some ends may fail to be rejoined unless additionalprocessing occurs to expose complementary regions between thebroken ends; without POLL, we would therefore expect to see anincrease in the frequency and size of deletions among repair prod-ucts. Compared to wild type, the distribution of repair productsin our polL line exhibits a significant shift towards more foot-prints with a deletion at the repair junction (39.3% ± 10.1 versus60.1% ± 3.7) (Table 3), as well as a shift towards larger deletions(Fig. 9).

3.9. Lines deficient in ATM or ATR exhibit changes in thedistribution of repair products

Given the important and complex role ATR and ATM play inthe recognition of and response to DSBs, we were interested in theeffects that mutations in these genes might have on the distribu-tion of excision repair products. Though less pronounced than insome of our other mutant lines, loss of either ATM or ATR doesalter the distribution of repair products as compared to wild-type(Fig. 4). The relatively subtle shifts in the distribution of repairproducts may be due in part to some functional overlap betweenATM and ATR; alternatively, ATM and ATR may each play a sub-tle and unique role in dictating the distribution of excision repairproducts. Another possibility is that the transposon system hasevolved a mechanism of DSB creation that, similar to the V(D)J



system, does not trigger the full ATM/ATR-mediated response tothe break. The overall distribution of repair products in atm and atras compared to wild-type exhibits a shift towards footprints with P-nucleotides present at the repair junction (40.5% ± 10.8, 40.7% ± 9.3,and 20.6% ± 6.3 respectively) (Table 3). The distribution in the num-ber of P-nucleotides present in excision repair products is similarfor atm and atr. This distribution, which shows a slight but sig-nificant increase in the fraction of repair products with four toeight P-nucleotides, is similar to the trend observed in our lig6 line.As discussed above, during V(D)J recombination ARTEMIS cleaveshairpins located at the coding ends of gene segments. It has beenshown that the endonuclease activity of ARTEMIS is observed onlywhen it is associated with DNA-PKcs [51,61,63], another member ofthe PIKK family; furthermore, both ATM and DNA-PKc have beenshown to phosphorylate ARTEMIS thereby modulating its nucle-ase function [64]. If LIG6 functions as one of the primary nucleasesinvolved in the opening of transposition induced hairpins as out-lined above, it is quite possible that its activity, like that of ARTEMIS,is modulated by one or more members of the PIKK family. Theabsence of a DNA-PKcs plant homologue may suggest that associa-tion with a PIKK family member is not necessary for endonucleaseactivity in LIG6, or that some other enzyme, such as ATM or ATR,may fill that role. It is interesting to note that the atm and the atrmutants have very similar effects on repair product distribution.This suggests that, while their functions are clearly not entirelyredundant, the two kinases are both involved in the generation ofthe PEP.

4. Conclusion

Next generation sequencing techniques present a novelapproach to addressing mutagenesis [65,66] and DNA repair. Theanalysis of several thousand independent repair products from avariety of mutant backgrounds provides insights into the mecha-nism of DSB repair and an unprecedented view of the distributionand diversity of repair products arising from a single, well-definedtype of DSB. Our results not only confirm the important role NHEJproteins play in the repair of excision-induced DSBs but also indi-cate that several non-canonical NHEJ proteins routinely play a rolein their repair; every mutant tested resulted in decreased preser-vation of the target site. Our results also suggest that DSB is repairis remarkably flexible – that there are many different paths to therejoining of ends. However, our methodology does not allow us tocomment on possible effects on the kinetics of repair, nor can wedetermine whether a substantial number of breaks remain unre-paired in any of our lines. In addition, our PCR-based method limitsthe size of observable deletions to those that do not extend beyondthe boundaries of our primers, and does not permit us to observetranslocation events.

From our results we propose the following model (Fig. 10). Uponexcision of the transposable element Ac (coupled with the pro-duction of hairpin structures at the free ends), KU heterodimerbinds the broken ends, perhaps providing a scaffold for additionalrepair proteins, and helps to limit the site at which the hairpinsare opened. LIG6 also clearly affects the location of the nick. Basedon its homology with ARTEMIS, it is tempting to suggest that LIG6itself acts as the endonuclease responsible for opening the hair-pins; however, the biochemical activities of this protein have notyet been investigated. Positioning of LIG6 through a physical inter-action with the KU complex, as well as functional regulation ofLIG6 by ATR, ATM, or both are possibilities that warrant furtherinvestigation. After nicking, in many cases POLL likely extends oneor both of the broken ends, polymerizing in a templated manneracross the break. The broken ends are then rejoined primarily, butnot exclusively, by LIG4. As has often been observed in nonhomolo-

Fig. 10. General model for the repair of DSBs induced during the excision transpos-able elements (TE). Hairpins produced at the broken ends of the TE excision site arebound by KU heterodimer. LIG6 is recruited to the hairpin loops where it partici-pates in the opening of the DNA near the apex of the hairpin structure; activity ofLIG6 may be governed in part by ATM, ATR, or both. Broken ends are processed togenerate a substrate that is rejoined by LIG4 as described in the text.

gous end-joining [67], the entire system is remarkably flexible, andeven in wild-type plants a variety of modes of repair are employed.

Contributions

N.D.H. and A.B.B. contributed to research design; C.F.W. con-tributed to the donation of Ac T-DNA insertion line and assistancewith identification of stock lines; N.D.H. and Y.M. contributed tothe construction of stock lines; N.D.H. contributed to the prepa-ration of materials; N.D.H. and I.K. contributed to the design andconstruction of Perl programs for sequence data processing; N.D.H.and A.B.B. contributed to data analysis; N.D.H. contributed to thepreparation of manuscript.

Conflict of interest statement

The authors declared that they have no conflict of interest.

Acknowledgments

We thank Drs. Kris Niyogi and Ben Gutman (Department ofPlant and Microbial Biology, University of California, Berkeley) forproviding us with seeds from their backcrossed lig6-1 line andDr. Tomoyuki Furukawa (Department of Plant Biology, Univer-sity of California, Davis) for providing us with seeds for the polLline. We thank Dr. Charles Nicolet (DNA Technologies and Expres-sion Analysis Cores, University of California, Davis) for technicalassistance with Illumina sequencing. This work was supportedby USDA NRICGP grant # 04-35301-14740 (to A.B.B.) and a grantfrom the University of California Davis Genome Center DNA Tech-nologies Core. Support for N.D.H. came from UC Davis’s NIH MCBtraining grant # T32 GM070377 and an Elsie Taylor Stocking Memo-rial Fellowship. Contributions received by Clifford F. Weil to thismanuscript were sponsored by the National Science Foundationand by Purdue University.



Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.dnarep.2011.07.011.

References

[1] J. Melo, D. Toczyski, A unified view of the DNA-damage checkpoint, Curr. Opin.Cell Biol. 14 (2002) 237–245.

[2] R.S. Pitcher, N.C. Brissett, A.J. Doherty, Nonhomologous end-joining in bacteria:a microbial perspective, Annu. Rev. Microbiol. 61 (2007) 259–282.

[3] J.Y. Bleuyard, M.E. Gallego, C.I. White, Recent advances in understanding of theDNA double-strand break repair machinery of plants, DNA Repair (Amst.) 5(2006) 1–12.

[4] K.M. Culligan, C.E. Robertson, J. Foreman, P. Doerner, A.B. Britt, ATR and ATMplay both distinct and additive roles in response to ionizing radiation, Plant J.48 (2006) 947–961.

[5] M. Cuadrado, B. Martinez-Pastor, O. Fernandez-Capetillo, ATR activation inresponse to ionizing radiation: still ATM territory, Cell Div. 1 (2006) 7.

[6] A. Pastink, J.C. Eeken, P.H. Lohman, Genomic integrity and the repair ofdouble-strand DNA breaks, Mutat. Res. 480–481 (2001) 37–50.

[7] G. Iliakis, Backup pathways of NHEJ in cells of higher eukaryotes: cell cycledependence, Radiother. Oncol. 92 (2009) 310–315.

[8] C. Boboila, M. Jankovic, C.T. Yan, J.H. Wang, D.R. Wesemann, T. Zhang, A.Fazeli, L. Feldman, A. Nussenzweig, M. Nussenzweig, F.W. Alt, Alternativeend-joining catalyzes robust IgH locus deletions and translocations in the com-bined absence of ligase 4 and Ku70, Proc. Natl. Acad. Sci. U.S.A. 107 (2010)3034–3039.

[9] J.E. Haber, Alternative endings, Proc. Natl. Acad. Sci. U.S.A. 105 (2008) 405–406.[10] J.L. Ma, E.M. Kim, J.E. Haber, S.E. Lee, Yeast Mre11 and Rad1 proteins define a

Ku-independent mechanism to repair double-strand breaks lacking overlap-ping end sequences, Mol. Cell. Biol. 23 (2003) 8820–8828.

[11] L. Zhou, R. Mitra, P.W. Atkinson, A.B. Hickman, F. Dyda, N.L. Craig, Transpositionof hAT elements links transposable elements and V(D)J recombination, Nature432 (2004) 995–1001.

[12] T.A. Rinehart, C. Dean, C.F. Weil, Comparative analysis of non-random DNArepair following Ac transposon excision in maize and Arabidopsis, Plant J. 12(1997) 1419–1427.

[13] L. Krishnaswamy, J. Zhang, T. Peterson, Fusion of reverse-oriented Ds terminifollowing abortive transposition in Arabidopsis: implications for the mecha-nism of Ac/Ds transposition, Plant Cell Rep. 29 (2010) 413–417.

[14] B. McClintock, The origin and behavior of mutable loci in maize, Proc. Natl.Acad. Sci. U.S.A. 36 (1950) 344–355.

[15] J. Yu, K. Marshall, M. Yamaguchi, J.E. Haber, C.F. Weil,Microhomology-dependent end joining and repair of transposon-inducedDNA hairpins by host factors in Saccharomyces cerevisiae, Mol. Cell. Biol. 24(2004) 1351–1364.

[16] R. Cronn, A. Liston, M. Parks, D.S. Gernandt, R. Shen, T. Mockler,Multiplex sequencing of plant chloroplast genomes using Solexasequencing-by-synthesis technology, Nucleic Acids Res. 36 (2008) e122.

[17] D.R. Smith, A.R. Quinlan, H.E. Peckham, K. Makowsky, W. Tao, B. Woolf, L. Shen,W.F. Donahue, N. Tusneem, M.P. Stromberg, D.A. Stewart, L. Zhang, S.S. Ranade,J.B. Warner, C.C. Lee, B.E. Coleman, Z. Zhang, S.F. McLaughlin, J.A. Malek, J.M.Sorenson, A.P. Blanchard, J. Chapman, D. Hillman, F. Chen, D.S. Rokhsar, K.J.McKernan, T.W. Jeffries, G.T. Marth, P.M. Richardson, Rapid whole-genomemutational profiling using next-generation sequencing technologies, GenomeRes. 18 (2008) 1638–1642.

[18] A.M. Bhatt, T. Page, E.J. Lawson, C. Lister, C. Dean, Use of Ac as an insertionalmutagen in Arabidopsis, Plant J. 9 (1996) 935–945.

[19] J. Friesner, A.B. Britt, Ku80- and DNA ligase IV-deficient plants are sensitiveto ionizing radiation and defective in T-DNA integration, Plant J. 34 (2003)427–440.

[20] Y.K. Wang, W.C. Chang, P.F. Liu, M.K. Hsiao, C.T. Lin, S.M. Lin, R.L. Pan, Ovate fam-ily protein 1 as a plant Ku70 interacting protein involving in DNAdouble-strandbreak repair, Plant Mol. Biol. 74 (2010) 453–466.

[21] W.M. Waterworth, G. Masnavi, R.M. Bhardwaj, Q. Jiang, C.M. Bray, C.E. West,A plant DNA ligase is an important determinant of seed longevity, Plant J. 63(2010) 848–860.

[22] A. Amoroso, L. Concia, C. Maggio, C. Raynaud, C. Bergounioux, E. Crespan, R.Cella, G. Maga, Oxidative DNA damage bypass in Arabidopsis thaliana requiresDNA polymerase {lambda} and proliferating cell nuclear antigen 2, Plant Cell23 (2011) 806–822.

[23] S. Roy, S.R. Choudhury, S.K. Singh, K.P. Das, AtPollambda, a homolog of mam-malian DNA polymerase lambda in Arabidopsis thaliana, is involved in the repairof UV-B induced DNA damage through the dark repair pathway, Plant CellPhysiol. 52 (2011) 448–467.

[24] K. Culligan, A. Tissier, A. Britt, ATR regulates a G2-phase cell-cycle checkpointin Arabidopsis thaliana, Plant Cell 16 (2004) 1091–1104.

[25] V. Garcia, H. Bruchet, D. Camescasse, F. Granier, D. Bouchez, A. Tissier, AtATM isessential for meiosis and the somatic response to DNA damage in plants, PlantCell 15 (2003) 119–132.

[26] S.J. Clough, A.F. Bent, Floral dip: a simplified method forAgrobacterium-mediated transformation of Arabidopsis thaliana, Plant J.16 (1998) 735–743.

[27] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual,2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

[28] D.J. Lavery, L. Lopez-Molina, F. Fleury-Olela, U. Schibler, Selective amplifica-tion via biotin- and restriction-mediated enrichment (SABRE), a novel selectiveamplification procedure for detection of differentially expressed mRNAs, Proc.Natl. Acad. Sci. U.S.A. 94 (1997) 6831–6836.

[29] B. Kaboord, R. Liermann, Biotinylated DNA binding capacities of Pierce AvidinSupports, Pierce Application Notes, AN0014.1, 2006.

[30] M.A. Quail, I. Kozarewa, F. Smith, A. Scally, P.J. Stephens, R. Durbin, H. Swerdlow,D.J. Turner, A large genome center’s improvements to the Illumina sequencingsystem, Nat. Methods 5 (2008) 1005–1010.

[31] N.V. Fedoroff, Maize transposable elements, in: D.E. Berg, M.M. Howe (Eds.),Mobile DNA, American Society for Microbiology, Washington, DC, 1989.

[32] K. Osakabe, Y. Osakabe, S. Toki, Site-directed mutagenesis in Arabidopsis usingcustom-designed zinc finger nucleases, Proc. Natl. Acad. Sci. U.S.A. 107 (2010)12034–12039.

[33] S. de Pater, L.W. Neuteboom, J.E. Pinas, P.J. Hooykaas, B.J. van derZaal, ZFN-induced mutagenesis and gene-targeting in Arabidopsis throughAgrobacterium-mediated floral dip transformation, Plant Biotechnol. J. 7 (2009)821–835.

[34] F. Zhang, M.L. Maeder, E. Unger-Wallace, J.P. Hoshaw, D. Reyon, M. Christian,X. Li, C.J. Pierick, D. Dobbs, T. Peterson, J.K. Joung, D.F. Voytas, High frequencytargeted mutagenesis in Arabidopsis thaliana using zinc finger nucleases, Proc.Natl. Acad. Sci. U.S.A. 107 (2010) 12028–12033.

[35] P. Windels, S. De Buck, E. Van Bockstaele, M. De Loose, A. Depicker, T-DNAintegration in Arabidopsis chromosomes. Presence and origin of filler DNAsequences, Plant Physiol. 133 (2003) 2061–2068.

[36] J.J. Lafaille, A. DeCloux, M. Bonneville, Y. Takagaki, S. Tonegawa, Junctionalsequences of T cell receptor gamma delta genes: implications for gamma deltaT cell lineages and for a novel intermediate of V-(D)-J joining, Cell 59 (1989)859–870.

[37] V. Colot, V. Haedens, J.L. Rossignol, Extensive, nonrandom diversity of excisionfootprints generated by Ds-like transposon Ascot-1 suggests new parallels withV(D)J recombination, Mol. Cell. Biol. 18 (1998) 4337–4346.

[38] P.W. Atkinson, W.D. Warren, D.A. O’Brochta, The hobo transposable element ofDrosophila can be cross-mobilized in houseflies and excises like the Ac elementof maize, Proc. Natl. Acad. Sci. U.S.A. 90 (1993) 9693–9697.

[39] P. Grappin, C. Audeon, M.C. Chupeau, M.A. Grandbastien, Molecular and func-tional characterization of slide, an Ac-like autonomous transposable elementfrom tobacco, Mol. Gen. Genet. 252 (1996) 386–397.

[40] S.M. Lewis, P nucleotides, hairpin DNA and V(D)J joining: making the connec-tion, Semin. Immunol. 6 (1994) 131–141.

[41] J. Gu, H. Lu, B. Tippin, N. Shimazaki, M.F. Goodman, M.R. Lieber, XRCC4:DNAligase IV can ligate incompatible DNA ends and can ligate across gaps, EMBO J.26 (2007) 1010–1023.

[42] R.J. Romeijn, M.M. Gorski, M.A. van Schie, J.N. Noordermeer, L.H. Mullenders, W.Ferro, A. Pastink, Lig4 and rad54 are required for repair of DNA double-strandbreaks induced by P-element excision in Drosophila, Genetics 169 (2005)795–806.

[43] L. Liang, L. Deng, S.C. Nguyen, X. Zhao, C.D. Maulion, C. Shao, J.A. Tis-chfield, Human DNA ligases I and III, but not ligase IV, are required formicrohomology-mediated end joining of DNA double-strand breaks, NucleicAcids Res. 36 (2008) 3297–3310.

[44] K. Tamura, Y. Adachi, K. Chiba, K. Oguchi, H. Takahashi, Identification of Ku70and Ku80 homologues in Arabidopsis thaliana: evidence for a role in the repairof DNA double-strand breaks, Plant J. 29 (2002) 771–781.

[45] C.E. West, W.M. Waterworth, G.W. Story, P.A. Sunderland, Q. Jiang, C.M. Bray,Disruption of the Arabidopsis AtKu80 gene demonstrates an essential role forAtKu80 protein in efficient repair of DNA double-strand breaks in vivo, Plant J.31 (2002) 517–528.

[46] S.A. Nick McElhinny, C.M. Snowden, J. McCarville, D.A. Ramsden, Ku recruitsthe XRCC4-ligase IV complex to DNA ends, Mol. Cell. Biol. 20 (2000)2996–3003.

[47] S.J. Boulton, S.P. Jackson, Saccharomyces cerevisiae Ku70 potentiates illegitimateDNA double-strand break repair and serves as a barrier to error-prone DNArepair pathways, EMBO J. 15 (1996) 5093–5103.

[48] F. Liang, M. Jasin, Ku80-deficient cells exhibit excess degradation of extrachro-mosomal DNA, J. Biol. Chem. 271 (1996) 14405–14411.

[49] A.B. Britt, V. Walbot, Germinal and somatic products of Mu1 excision from theBronze-1 gene of Zea mays, Mol. Gen. Genet. 227 (1991) 267–276.

[50] E.S. Coen, T.P. Robbins, J. Almeida, A. Hudson, R. Carpenter, Consequences andmechanisms of transposition in Antirrhinum majus, in: D.E. Berg, M.M. Howe(Eds.), Mobile DNA, American Society for Microbiology, Washington, DC, 1989,pp. 413–436.

[51] Y. Ma, U. Pannicke, K. Schwarz, M.R. Lieber, Hairpin opening and over-hang processing by an Artemis/DNA-dependent protein kinase complexin nonhomologous end joining and V(D)J recombination, Cell 108 (2002)781–794.

[52] D. Bonatto, L.F. Revers, M. Brendel, J.A. Henriques, The eukaryoticPso2/Snm1/Artemis proteins and their function as genomic and cellular care-takers, Braz. J. Med. Biol. Res. 38 (2005) 321–334.

[53] M.R. Lieber, The mechanism of human nonhomologous DNA end joining, J. Biol.Chem. 283 (2008) 1–5.

[54] Y. Ma, H. Lu, B. Tippin, M.F. Goodman, N. Shimazaki, O. Koiwai, C.L. Hsieh, K.Schwarz, M.R. Lieber, A biochemically defined system for mammalian nonho-mologous DNA end joining, Mol. Cell 16 (2004) 701–713.



[55] T.E. Wilson, M.R. Lieber, Efficient processing of DNA ends during yeast nonho-mologous end joining. Evidence for a DNA polymerase beta (Pol4)-dependentpathway, J. Biol. Chem. 274 (1999) 23599–23609.

[56] J.M. Daley, R.L. Laan, A. Suresh, T.E. Wilson, DNA joint dependence of pol Xfamily polymerase action in nonhomologous end joining, J. Biol. Chem. 280(2005) 29030–29037.

[57] S.A. Nick McElhinny, J.M. Havener, M. Garcia-Diaz, R. Juarez, K. Bebenek, B.L.Kee, L. Blanco, T.A. Kunkel, D.A. Ramsden, A gradient of template dependencedefines distinct biological roles for family X polymerases in nonhomologousend joining, Mol. Cell 19 (2005) 357–366.

[58] Y. Uchiyama, S. Kimura, T. Yamamoto, T. Ishibashi, K. Sakaguchi, Plant DNApolymerase lambda, a DNA repair enzyme that functions in plant meristematicand meiotic tissues, Eur. J. Biochem. 271 (2004) 2799–2807.

[59] M. Garcia-Diaz, O. Dominguez, L.A. Lopez-Fernandez, L.T. de Lera, M.L. Saniger,J.F. Ruiz, M. Parraga, M.J. Garcia-Ortiz, T. Kirchhoff, J. del Mazo, A. Bernad, L.Blanco, DNA polymerase lambda (Pol lambda), a novel eukaryotic DNA poly-merase with a potential role in meiosis, J. Mol. Biol. 301 (2000) 851–867.

[60] H. Lu, K. Schwarz, M.R. Lieber, Extent to which hairpin opening by theArtemis:DNA-PKcs complex can contribute to junctional diversity in V(D)Jrecombination, Nucleic Acids Res. 35 (2007) 6917–6923.

[61] D. Niewolik, U. Pannicke, H. Lu, Y. Ma, L.C. Wang, P. Kulesza, E. Zandi, M.R.Lieber, K. Schwarz, DNA-PKcs dependence of Artemis endonucleolytic activity,differences between hairpins and 5′ or 3′ overhangs, J. Biol. Chem. 281 (2006)33900–33909.

[62] F.J. Bollum, Thermal conversion of nonpriming deoxyribonucleic acid to primer,J. Biol. Chem. 234 (1959) 2733–2734.

[63] A.A. Goodarzi, Y. Yu, E. Riballo, P. Douglas, S.A. Walker, R. Ye, C. Harer, C.Marchetti, N. Morrice, P.A. Jeggo, S.P. Lees-Miller, DNA-PK autophosphorylationfacilitates Artemis endonuclease activity, EMBO J. 25 (2006) 3880–3889.

[64] K. Dahm, Functions and regulation of human Artemis in double strand breakrepair, J. Cell. Biochem. 100 (2007) 1346–1351.

[65] S.R. Birkeland, N. Jin, A.C. Ozdemir, R.H. Lyons Jr., L.S. Weisman, T.E. Wilson,Discovery of mutations in Saccharomyces cerevisiae by pooled linkage analysisand whole-genome sequencing, Genetics 186 (2010) 1127–1137.

[66] M. Lynch, W. Sung, K. Morris, N. Coffey, C.R. Landry, E.B. Dopman, W.J. Dickinson,K. Okamoto, S. Kulkarni, D.L. Hartl, W.K. Thomas, A genome-wide view of thespectrum of spontaneous mutations in yeast, Proc. Natl. Acad. Sci. U.S.A. 105(2008) 9272–9277.

[67] M.R. Lieber, The mechanism of double-strand DNA break repair by the nonho-mologous DNA end-joining pathway, Annu. Rev. Biochem. 79 (2010) 181–211.

Breadth by depth: Expanding our understanding of the repair of transposon-induced DNA double strand...

Documents

Transcript of Breadth by depth: Expanding our understanding of the repair of transposon-induced DNA double strand...