Available online at www.sciencedirect.com

www.elsevier.com/locate/yfgbi

Fungal Genetics and Biology 45 (2008) 117–126

Characterisation of Aft1 a Fot1/Pogo type transposonof Aspergillus fumigatus

Peter Hey a,b, Geoff Robson b, Mike Birch a, Mike Bromley a,*

a F2G Ltd, Lankro Way, Eccles, Manchester M30 OBH, UKb The University of Manchester, Oxford Road, Manchester M13 9PL, UK

Received 12 January 2007; accepted 16 October 2007Available online 23 October 2007

Abstract

In recent years the filamentous fungus Aspergillus fumigatus has become a significant cause of infection in man and as such hasbecome the focus of much study. It is thought to be the leading mould pathogen in leukaemia and transplant patients and is responsiblefor mortality in a large number of individuals with immunological disorders. In an attempt to develop molecular mutagenesis tools forassessment of this organism, the genome of A. fumigatus was analysed to identify possible functional transposable elements. An appar-ently intact Fot1/Pogo type transposon with 65% identity to the active Tan1 element of Aspergillus niger was identified and designatedAft1. Aft1 is a 1.9 kb element present in multiple (>20) highly conserved copies. It encodes a 332 amino acid transposase which containsall the functional motifs required for transposition. In addition, the transposase was expressed in cultures grown at 37 �C in all threestrains assessed and excision analysis suggests Aft1 may be active and of use in transposon tagging experiments. Southern hybridisationpatterns indicate that Aft1 is widely distributed amongst clinical isolates of A. fumigatus with considerable variation in genomic local-isation. A comprehensive analysis of the genomic localisation of Aft1 in the sequenced strain AF293 show that one insertion is 30 basesupstream of a predicted gene encoding a G-protein coupled receptor. Expression analysis indicates that this gene has been inactivated bythe insertion.Crown copyright � 2007 Published by Elsevier Inc. All rights reserved.

Keywords: Transposon; Aspergillus fumigatus; GPCR

1. Introduction

Aspergillus fumigatus is a filamentous Ascomycete and isan increasingly prevalent opportunistic fungal pathogenand major allergen. It is regarded as an asexual organismas no observed mating or meiosis has been reported. Inthe absence of sexual mechanisms, transposable elementshave been implicated as major forces behind the generationof genetic diversity in these ‘imperfect’ filamentous fungi(Daboussi, 1997; Daboussi and Capy, 2003). Mobilisationof transposons can cause a variety of localised effects ongenomes such as gene inactivation or modification (Dab-oussi and Langin, 1994; Hua-Van et al., 2001). As they

1087-1845/$ - see front matter Crown copyright � 2007 Published by Elsevier

doi:10.1016/j.fgb.2007.10.009

* Corresponding author. Fax: +44 161 7851273.E-mail address: mikebromley@f2g.com (M. Bromley).

are often found in multiple highly conserved copies theyalso present potential recombinational ‘hotspots’ that canresult in deletions, duplications, inversions and transloca-tions (Daviere et al., 2001; Mieczkowski et al., 2006). Anexample of the impact of transposons was recently uncov-ered in comparative analysis of sequence data from Asper-

gillus flavus and Aspergillus oryzae, where a translocationevent has resulted in disruption of synteny between thetwo genomes (Payne et al., 2006).

Transposons fall into two functional classes; type Iwhich transpose via an RNA intermediate but do notexcise from their point of origin and type II which trans-pose via a ‘cut and paste’ mechanism. Transposons of thelatter class provide a suitable basis for the developmentof mutagenesis tools as their excision and re-integration,when coupled with appropriate selection markers, can be

Inc. All rights reserved.

118 P. Hey et al. / Fungal Genetics and Biology 45 (2008) 117–126

tracked (Hua-Van et al., 2001). Type II transposons arefurther sub-divided into Tc1/Mariner, hAT-like and Muta-

tor-like superfamilies (Daboussi and Capy, 2003). Severalactive superfamily elements have been discovered in fila-mentous fungi by transposon trapping whereby transpo-sons are identified during insertion and inactivation of amarker gene. The Fot1, Fot2 and Impala elements of Fusar-

ium oxysporum, and the Ant1 and Vader elements of Asper-

gillus niger have all been identified using this method (seeDaboussi and Capy, 2003 for review). Although severaltransposons have been shown to be suitable as genetictools, to date only one of these elements, impala has beensuccessfully used in genome wide transposon-based muta-genesis studies (Firon et al., 2003). Two non-functionaltype I transposons have been reported in A. fumigatus,AfutI and AfutII (Neuveglise et al., 1996; Paris and Latge,2001) and a seemingly non-functional class II element Taf1

(Monroy and Sheppard, 2005). Here we discuss the identi-fication and characterisation of Aft1, a novel type II trans-poson of the Tc1/Mariner superfamily found in A.

fumigatus and examine its suitability for use in gene taggingexperiments.

2. Methods

2.1. Strains and culture conditions

The A. fumigatus strains used in this study were clinicalisolates kindly provided by Dr. D. Denning, Hope Hospi-tal, Salford UK and Dr. M. Anderson, University of Man-chester. All strains were grown on Sabauraud dextrose(SAB) agar plates or SAB liquid at 37 �C. Antibiotic selec-tion was carried out with Phleomycin (Invitrogen) at250 lg/mL or Hygromycin B (Cayla) at 250 lg/mL inComplete Media (2% malt extract, 2% glucose, 0.1% pep-tone, 1.5% agar).

2.2. Identification of Aft1 and sequence comparison

The basic local alignment search tool (BLAST) was usedto identify sequences similar to the type II transposon Tan1

(Nyyssonen et al., 1996) (GenBank Accession No.AAU58946) in the Sanger A. fumigatus sequence data.These sequence data were produced by the A. fumigatus

Sequencing Group at the Sanger Institute and can beobtained from ftp://ftp.sanger.ac.uk/pub/pathogens/A_fumigatus.

Other transposon sequence data was obtained from theEMBL (www.ebi.ac.uk) and NCBI databases. The follow-ing transposon sequences were used for analyses: Fot1

and Fot5 (F. oxysporum) [EMBL Accession Nos.X64799, AJ608703], Pot2, Pot3 and MGR586 (Magnapor-

the grisea)[EMBL Accession Nos. Z33638, AF333034,U60989], Flipper (Botrytis cinerea) [EMBL AccessionNo. U74294], Fcc1 (Cochliobolus carbonum) [EMBLAccession No. JC5096], F2PO8 (Aspergillus nidulans)EMBL Accession No. ENAC133], Taf1 (A. fumigatus)

[EMBL Accession No. AY971670] and Pogo (Drosophila

melanogaster) [GenBank Accession No. S20478]. Nucleo-tide and protein alignments were performed using theClustalX (Thompson et al., 1997) and Align (Hepperle,2001) software packages. Neighbour joining, maximumparsimony, maximum likelihood and bootstrap re-sam-pling analyses were carried out using PHYLIP v3.65 (Fel-senstein, 1989).

2.3. Screening for Aft1 in clinical isolates

Genomic DNA was extracted from 10 strains of A.

fumigatus using the Fastprep DNA extraction kit (Qbio-gene). To confirm the presence of the Aft1 element, aPCR screen was carried out using a single primer AFTN1specific for the Aft1 terminal inverted repeats (TIR) (Table1). To establish if the Aft1 copies identified in the AF293genome were present in the same locations in the other 9strains, PCR was carried out over four loci using primersets flanking the known insertion sites in AF293 (Table1). Absence of the transposon was determined by a1.9 kb decrease in amplicon size when compared to theAF293 product.

2.4. Transcriptional analysis

Expression of the Aft1 transposase and a putative G-pro-tein coupled receptor (GPCR) were determined by 2-stepRT-PCR. A 5 ml volume of SAB broth was inoculated with1 · 106 A. fumigatus spores, incubated for 18 h at 37 �C atwhich time the biomass was collected by filtration. TotalRNA was isolated using the Fastprep RNA extraction kit(Qbiogene). The RNA was DNAase treated overnight withTurbo DNAase (Ambion) before on-column DNAasetreatment and cleanup (Qiagen). Absence of contaminatingDNA in the RNA was confirmed by performing a PCRreaction using primers specific for the A. fumigatus b-tubu-lin gene. Synthesis of cDNA was carried out using the Pro-mega Reverse Transcription system. Amplification of theAft1 transposase and G-protein coupled receptor was per-formed using primer combinations RT-Aft1F with RT-Aft1R and GPCRexpF with GPCRexpR, respectively(Table 1).

2.5. Cloning of Aft1

Aft1 was amplified from an A. fumigatus BAC library(Pain et al., 2004) BAC No. AfB28 mq1_2h05 by PCRusing a single primer specific for the Aft1 inverted repeatsequence with six base SacI linkers [AFTN1(SacI)—Table1]. To ensure accurate amplification, PCR was performedusing high fidelity KOD polymerase (Stratagene). ThePCR product was ligated into pGEM-Teasy (Promega)and sequenced. The accuracy of amplification was con-firmed by comparison of the cloned transposon to the pub-lished A. fumigatus genomic sequence (GenBank SequenceEF100757).

Table 1Primers used in this study

Primer Description Sequence

AFTN1 Aft1 Inverted repeat specific primer TAACGTAATCGGTAAGCGAGCAFTN1

(SacI)Aft1 Inverted repeat specific primer with SacI linker GAGCTCTAACGTAATCGGTAAGCGAGC

RT-Aft1F Aft1 transposase specific forward primer TCGGCATGATGAGATCAAAART-Aft1R Aft1 transposase specific reverse primer GAAGCACCCAGCCAGTAGAGLocus1F Primer downstream of Aft1 insertion site in Af293 chromosome 1 bases 1564217–

1566754ATTCTGGCCTGTCGCCAAGA

Locus1R Primer upstream of Aft1 insertion site in Af293 chromosome 1 bases 1564217–1566754 ACACAGCACCCAGGCTTGTCLocus2F Primer upstream of Aft1 insertion site in Af293 chromosome 6 bases 1361854–1364255 GTTGGTGTTGCACGAGCACLocus2R Primer downstream of Aft1 insertion site in Af293 chromosome 6 bases 1361854–

1364255CTAGTCTCTCAAGTAGCCCAC

Locus3F Primer upstream of Aft1 insertion site in Af293 chromosome 3 bases 434813–438233 GACTGAGTGTAGTCGAGGTCLocus3R Primer downstream of Aft1 insertion site in Af293 chromosome 3 bases 434813–438233 CTGCAACCTGGATCCGAATTCLocus4F Primer upstream of Aft1 insertion site in Af293 chromosome 1 bases 1315165–1317305 CAGACTTCCATTCGCTCTGGLocus4R Primer downstream of Aft1 insertion site in Af293 contig. chromosome 1 bases

1315165–1317305CCGCCAGAGTTGGTAAGACATC

GPCRexpF Primer within GPCR predicted coding region GTCGACCATCGAGCGTGTATGGPCRexpR Primer within GPCR predicted coding region CACAGACTCCCCGTACACCTTGZeoF Sh-ble 50 end specific primer GAGGAACTAAACCATGGCCZeoR Sh-ble 30 end specific primer CTCGCCGATCTCGGTCATGGpdAF A. fumigatus GpdA specific primer GGCGCCAGTCCTGAATAGTAGTTTGTTrpCR A. fumigatus TrpC specific primer GGCGCCGAAGAGGTGATGACTTGAAT

P. Hey et al. / Fungal Genetics and Biology 45 (2008) 117–126 119

2.6. Excision assay

Mobilisation of Aft1 was monitored by excision from aPhleomycin resistance cassette. The cassette consists of theSh-ble bleomycin resistance gene from pEM7zeo (Invitro-gen) coupled to the A. fumigatus gpdA promoter and trpC

terminator (pAFzeo; Fig. 1). The excision construct wasmade by sub-cloning Aft1 from the pGEM-Teasy vectorinto a unique SacI site located within the gpdA promoterof the resistance cassette (Fig. 1; pAft1-zeo). This constructwas linearised by digestion with XmnI and co-transformedinto A. fumigatus strain AF293 with the hygromycin resis-tance plasmid pAN7.1 (Punt et al., 1987). Presence of thepAft1-zeo construct in hygromycin resistant colonies wasconfirmed by PCR amplification using primers ZeoF and

pAft-zeo6810 bp

SacI - 1892

XmnI - 5041

SacI - 6810

Aft1

PgpdA

TtrpC

pUC

19

Sh-

Ble

Fig. 1. Plasmid map of pAft-zeo construct used to demonstrate transpo-son excision.

ZeoR (see Table 1). Transformants were purified by streak-ing and sub-culturing on 5 cm SAB agar plates with hygro-mycin. Spores harvested from these plates were used toinoculate CM Phleomycin plates with 1 · 107 spores perplate. Excision rates were determined by counting the num-ber of growing colonies after 3 days incubated at either 37or 45 �C. To confirm mobilisation of the transposon in allcases and to examine the excision footprint of Aft1, geno-mic DNA was extracted from Phleomycin resistant colo-nies and used as a template for PCR. Primers gpdAF andTrpCR (Table 1) designed to regions immediately flankingthe excision site were used; absence of the transposon wasdetermined by a 1.9 kb decrease in amplicon size.

3. Results

3.1. A transposable element with similarity to the active A.

niger Tan1 element is present in multiple copies in A.

fumigatus strain AF293 and other Aspergilli

Recent attempts to isolate transposable elements fromA. fumigatus using gene trapping by ourselves and othershave been unsuccessful (Bromley et al., unpublished; Mon-roy and Sheppard, 2005). In a further attempt to identify afunctional transposable element, BLAST searches of the A.

fumigatus genome were performed using the using a mem-ber of the Tc1/Mariner superfamily, Tan1 of A. niger. A1.9 kb element sharing 65% identity at the nucleotide levelto Tan1 was identified and designated Aft1. Aft1 is presentin 21 highly conserved (>99% identity at the nucleotidelevel) copies, one truncated copy (82% identity at the nucle-otide level) and two degenerate copies (�60% identity atthe nucleotide level).

120 P. Hey et al. / Fungal Genetics and Biology 45 (2008) 117–126

Alignment of the 21 similar copies allowed derivation ofa consensus sequence by majority rule. The consensus ele-ment has 45 bp terminal inverted repeats and harbours asingle ORF encoding a 556 residue protein sharing 56%identity to the active Tan1 transposase (Fig. 2A) and 57%identity to the F2P08 hypothetical transposase of A. nidu-lans. To assess the distribution of Aft1-like elements inother Aspergillus species, BLAST analysis was performedagainst the A. flavus, A. oryzae and A. clavatus genomesequences. Eleven conserved and three degenerate copiesof a previously undescribed Aft1-like element were identi-fied in the genome of A. oryzae. A consensus sequencederived for this element was designated Tao2 (transposonAspergillus Oryzae 2–GenBank in submission). Tao2 is an1888 bp element containing a single ORF potentially capa-ble of encoding a 558 amino acid protein with 70% identity

Fig. 2. Translated transposon open reading frame alignments (* indicate fullyarrows highlighting conserved motifs. Numbers indicate distance along Aft1.elements Fot1 and Fot2 from Fusarium oxysporum, MGR586, Pot2 and Pot3

Aspergillus niger, Fcc1 from Cocliobolus carbonum, Cirt2 from Candida albi

fumigatus. The Pogo element from Drosophila is also included to illustrate concharacteristic of Fot1/Pogo type transposons are highlighted. (B) Alignment ofPipsqueak (Psq) helix-turn-helix domain and CenPB putative DNA binding d

to the Aft1 transposase. A BLAST hit to an EST clonefrom A. oryzae (GenBank: AB224187) indicates this trans-posase is expressed. Multiple BLAST hits to regions ofAft1 were also identified in the A. flavus genome. Theregion flanking one of these hits showed 95% identity atthe nucleotide level with a region from A. fumigatus chro-mosome 1 indicating that A. flavus strain NRRL-3357has acquired a section of A. fumigatus DNA. Howeverattempts to amplify this section by PCR from genomicDNA extracted from NRRL-3357 failed (data not shown).In the A. clavatus genome, two fragments of an Aft1-likeelement were identified however no intact copies werefound.

Alignment of the deduced amino acid sequence of Aft1with Fot1/Pogo type elements from other species allowsthe assessment of motifs that are considered to be essential

conserved residues). (A) Alignment of Fot1/Pogo type transposases withAn alignment of 13 Mariner type transposases—the fungal transposablefrom Magnaporthe grisea, F2P08 from Aspergillus nidulans, Tan1 from

cans, Flipper from Botrytis cinerea and Taf1 and Aft1 from Aspergillus

servation between kingdoms. The DE motif (upper) is and D(35)D (lower)Fot-5 and three Aspergillus species mariner transposons with the consensusomain.

P. Hey et al. / Fungal Genetics and Biology 45 (2008) 117–126 121

for active transposition (Figs. 2A and B). The DDE motifwhich has been shown to be required for catalytic activityin the Tc1 transposon of Caenorhabditis elegans (Vos andPlasterk, 1994) but is dispensable for the DNA bindingactivities of the transposase is present in Aft1 however aswith most Fot1/Pogo transposases the final glutamate resi-due in this domain is substituted by aspartate (Fig. 2A)(Doak et al., 1994). The pipsqueak helix-turn-helix(HTH) and CENPB (Fig. 2B) domains, implicated inDNA binding (vanPouderoyen et al., 1997) are also evidentin the Aft1 transposase. Examination of the terminalinverted repeats (TIR) allowed identification of internaldirect repeats similar to those of Tan1 and other Fot1-liketransposons (Fig. 3). Direct repeats within the terminalinverted repeats are characteristic of this group of transpo-sons (Kachroo et al., 1994) and in the human mariner typeSleeping Beauty transposon these have been implicated intransposase binding (Cui et al., 2002).

3.2. Evolutionary relationship of Aft1 to other Fot1/Pogo

type transposons

Transposase amino acid sequence of several transpo-sons, from filamentous fungi and Drosophila, were alignedand 100 bootstrap replicate datasets were produced. Thesewere analysed using the neighbour joining, maximum like-lihood and maximum parsimony packages of PHYLIP. Aconsensus tree from each analysis was obtained and a strictconsensus network utilising data from the three analysesproduced (Fig. 4). This shows the clustering of the A.

fumigatus Aft1, A. niger Tan1 and A. nidulans F2P08 ele-ments on the same branch illustrating the degree of similar-ity between these elements. Interestingly the A. fumigatus

Taf1 (Monroy and Sheppard, 2005) element, also a classII element of the Fot1/Pogo type, is more distantly relatedsuggesting independent ancestry.

3.3. Aft1 is present in different clinical isolates with varying

distribution and is transcribed

A PCR screen was performed on genomic DNAextracted from 10 clinical isolates of A. fumigatus to con-firm the presence of Aft1 using primers specific to the TIRs.A 1.9 kb amplicon was generated from each strain with theexception of AF6, which had a noticeably smaller PCRproduct (�1.7 kb) (data not shown). Sequencing of theamplicons confirmed that they were all derived from

Tan1 ACGTAATCAACGGTCGGGCGGGCCACACGGTCAGGCGGGCCACC

Aft1 ACGTAATCGGTAAGCGAGCGGATCACGCAACCGAGCGGATCACCA

Fot1 AGTCAAGCACCCATGTAACCGACCCCCCCTGGTAACCGACCCCCACCT

Pot2 ACGTGGTTCATCAGGACCCCGGACATATCAGGACCCCGGACA

Fig. 3. Alignment of Fot1/Pogo transposon TIR regions. Underlined andhighlighted are the (imperfect) internal repeat regions.

Aft1. Southern blot analysis of these 10 strains suggeststhat Aft1 is variably distributed in their genomes (Datanot shown). Furthermore, analysis of four specific Aft1

insertion sites in AF293 (as determined from genomicsequence data) by PCR confirmed that insertions at theseloci were unique to AF293 (Fig. 5). Sequencing the regionof one of these loci from AF6 and AF210 showed no signof transposon excision (no ‘‘footprint’’) therefore transpo-son had most likely inserted into this site in AF293 ratherthan excised in AF6 and AF210, indicating that the trans-poson has mobilised relatively recently and since the diver-gence of AF293 from AF6 and AF210.

Expression of the Aft1 transposase was determined byRT-PCR using primers located within the 5 0 region ofthe single exon. Aft1 was expressed in the four strainstested AF6, AF210, CEA10 and AF293 (Fig. 6) suggestingthis may be an active transposon. Furthermore, in a recentstudy of the effect of heat shock on the transcriptome ofAF293, six transcripts corresponding Aft1 transposases atdifferent loci have been shown to be transiently up-regu-lated when exposed to heat shock from 30 to 37 �C and30 to 48 �C (Nierman et al., 2005) indicating some levelof host derived control of expression.

3.4. Aft1 insertions in AF293 appear to have a TA target site

and can disrupt the function of genes

The transposons of the Tc1/mariner superfamily have avery limited target site specificity requiring only a TA dinu-cleotide recognition sequence for insertion, a sequence thatis characteristically duplicated upon integration (Plasterket al., 1999). The locations of the 23 full-length Aft1 inser-tions in the AF293 genome were assessed for any biastowards a target sequence in addition to this well definedsite. As expected all of the elements were flanked by TAnucleotides with no other obvious conservation in theremaining flanking sequence. This suggests that Aft1 hasthe ability to integrate almost anywhere in the genome.Despite this no ORFs were interrupted by transposoninsertion. Several Aft1 elements however lie within 2 kbof predicted genes and one insertion is located only 30bases upstream of a predicted start codon. To assess theimpact of this insertion on the expression of the nearbygene, a hypothetical G-protein coupled receptor(GPCR—GenBank XM743403), RT-PCR was performedon RNA isolated from AF293 to amplify the first three pre-dicted exons of the GPCR. As a comparator, RNA wasused from AF6 and AF210 where the insertion has beenshown to be absent by PCR (Fig. 5 Loc3) and CEA10where genome database information confirms the insertionis absent. PCR products were detected after 35 cycles inAF6, AF210 and CEA10 but no detectable expressionwas observed in AF293 (Fig. 6). It is therefore likely thistransposon insertion prevents GPCR expression inAF293. Interestingly, sequencing of the PCR productsfrom strains AF6 and AF210 suggested only a single 54

Fig. 4. Strict consensus network of Mariner superfamily type tranposons based on transposase amino acid sequence. Values represent bootstrap supportfrom 100 replicates (Maximum Parsimony/Maximum Likelihood/Neighbour Joining [using Kimura two parameter]). Aspergillus spp. transposons circled.

122 P. Hey et al. / Fungal Genetics and Biology 45 (2008) 117–126

base intron was present in the GPCR gene rather than thetwo predicted in the genome database.

3.5. Aft1 copies exhibit RIP-like mutations

To date, all of the transposons identified in A. fumigatus

are reported to have been affected by a RIP-like process(Neuveglise et al., 1996; Monroy and Sheppard, 2005).RIP, first described in Neurospora crassa, is a fungal spe-cific method of homology-dependent gene silencing consid-ered to be a defence mechanism designed to protect againstthe disruptive activity of transposons and viruses resultingin the production of G:C to A:T transitions (Cambareriet al., 1989). To assess Aft1 for RIP-like mutations analignment of the nucleotide sequences of the 21 conservedcopies with the Aft1 consensus sequence was produced.The alignment reveals that 53 bases differ in at least onecopy over the whole length of the transposon sequence with52 resulting from RIP-like G:C to A:T transitions. Theimpact of these mutations have been significant for at least

13 of the transposons examined, resulting in the creation ofstop codons within the ORF, presumably abolishing trans-posase activity. Examining the flanking nucleotides of eachof these mutations a clear preference (90% of the muta-tions) for a CpA or CpG dinucleotide (or TpG and CpGon the complementary strand) context was observed. Suchsite requirements have been reported in N. crassa and mayindicate specificity of RIP enzymes (Cambareri et al.,1989). In total around 5% of C:G sites in the entire trans-poson sequence were affected by these transitions. This ismarkedly less than similar observations in A. oryzae where20–70% of C:G sites had been affected (Montiel et al.,2006).

3.6. Aft1 demonstrates transposase mediated excision in an

artificial construct

Having identified that several copies of Aft1 had all ofthe requirements for active transposition we next assessedone such element, with the CADRE genome identifier

Fig. 5. PCR over four loci containing an Aft1 insertion in Af293 genome sequence. Numbers refer to strain number. Presence of the transposon isindicated by the 2 kb shift in band size—this is only seen in Af293. Locus1 corresponds to Af293 chromosome 1 bases 1564217–1566754. Locus2corresponds to Af293 chromosome 6 bases 1361854–1364255. Locus3 corresponds to Af293 chromosome 3 bases 434813–438233 [this insertion lies 30bases upstream of the GPCR gene]. Locus4 corresponds to Af293 chromosome 1 bases 1315165–1317305 (Nierman et al., 2005).

Fig. 6. RT-PCR on AF6, AF210, CEA10 and AF293. Lane A, cDNAtemplate using RT-Aft1F and RT-Aft1R primer set; lane B, cDNAtemplate using GPCRExpF and GPCRExpR primer set; lane C, genomicDNA control using GPCRExpF and GPCRExpR primer set. Aft1

transposase is expressed in all strains tested. GPCR is not expressed inAF293. Size difference in gDNA and cDNA PCR reflects intron size.

P. Hey et al. / Fungal Genetics and Biology 45 (2008) 117–126 123

Afu2g01420, in an excision assay. The Aft1 element wasamplified by PCR and cloned into a Phleomycin resistancecassette between the A. nidulans gpdA promoter and Sh-ble

bleomyin resistance gene (see Fig. 1). This construct wasco-transformed into Af293 with pAN7.1 and hygromycinresistant colonies were screened for presence of the Sh-ble

gene by PCR. Excision analysis was performed on threetransformants by plating 1 · 107 spores from each strainonto Phleomycin selective media. After 3 days 3, 1 and 2resistant colonies were observed on each plate for transfor-mants 1, 2 and 3, respectively. PCR amplification over thePhleomycin cassette of the resistant colonies revealed lossof the Aft1 element. Sequencing of the PCR products from‘revertants’ from all three of these transformants confirmedimprecise excision of the transposon. The flanking TAdinucleotides remained, as did a two base GT footprintconsistent with sequence from the 3 0 end of the elementin each case. Such footprints are commonly left behindwith Tc1/Mariner type elements, for example the impala

transposon of F. oxysporum generally leaves a five basepair footprint, the duplicated TA target site along withthree bases from one of the transposon ends (Hua-Vanet al., 2001). This type of footprint is consistent withremoval of the protruding nucleotides from one side ofthe transposon during double strand break repair events(Raz et al., 1997).

124 P. Hey et al. / Fungal Genetics and Biology 45 (2008) 117–126

3.7. Aft1 excision frequency increases with increased

temperature

As described earlier, expression of the Aft1 transposaseappears to be up-regulated in response to heat shock. Toassess if this apparent increase in expression translates toincreased excision of Aft1 one of the transformant strainswas grown under selection at 37 and 45 �C. An approxi-mate doubling of aft1 excision was observed at 45 �C com-pared to that at 37 �C (3 days at 37 �C—1.5 colonies/107

spores (SD � 1.08), 3 days at 45 �C—2.8 colonies/107

spores (SD � 1.05), p = 0.034).

4. Discussion

The Aft1 element is typical of Mariner-type transposonsexhibiting a normal ITR-transposase-ITR structure withinverted repeats of 45 bp. The highly conserved transposaseplaces this transposon in the Fot1/Pogo group of elements(Daboussi and Capy, 2003). Elements of this type mobiliseby an excision–insertion mechanism, employing the trans-posase to detect the inverted repeat boundaries, releasethe element from its flanking sequence and re-join it to tar-get DNA. Three functional domains have been detected inthe Aft1 transposase, the most N-terminal of these is a sin-gle putative helix-turn-helix domain similar to those foundin the Pipsqueak protein of Drosophila. The Drosophila

Pipsqueak protein has four HTH domains that combineto carry out its DNA binding function at GAGA recogni-tion sites (Lehmann et al., 1998). It is unlikely however thatGAGA is the target binding sequence for the Aft1 trans-posase as no such site appears in or near to the invertedrepeats. The second identifiable domain shares similarityto the mammalian centromere binding protein (CENP-B)and this too is thought to be a HTH DNA binding domain.It is possible that these two motifs act in concert as a bipar-tite DNA binding domain, similar to that described in theTc3 transposase of C. elegans (Watkins et al., 2004). TheCENP-B domain of the transposon pogo has been shownto recognise a repeated 12 bp sequence within its invertedrepeat (Wang et al., 1999) therefore it is possible that thisdomain alone could be responsible for sequence-specificidentification of the Aft1 repeats. Analysis of the ITRs ofAft1 has highlighted the presence of two copies of a precise12 bp direct repeat. These are most likely to be the targetsequences that enable the transposase to recognise theITRs. It is interesting to observe that these direct repeatsbear little or no sequence similarity to those present inpogo (4 of 12 bases align; data not shown) suggesting alevel of co-evolution between the repeats and the DNA rec-ognition motifs of the transposase. The C-terminal endo-nuclease domain in transposases of this type isresponsible for catalysing cleavage of DNA at the transpo-son termini and subsequent joining to a new targetsequence in four consecutive phosphoryl transfer reactions(Bolland and Kleckner, 1996). This process requires thepresence of suitable divalent metal cations that bind within

the ‘DDE’ catalytic core of the endonuclease domain,probably Mg2+ (Bolland and Kleckner, 1996). In mostcases for transposons of the Fot1/Pogo type, includingAft1, the distal glutamate residue has undergone a func-tionally conservative substitution to aspartate (Nyyssonenet al., 1996).

Using an excision assay we have been able to demon-strate that Aft1 is the first functional mobile element tohave been isolated from A. fumigatus. Two previousattempts to isolate elements from A. fumigatus usingtransposon-trapping methodologies have failed. In ourstudy 318 niaD� isolates from four different strains wereassessed for insertion of a mobile element (Bromleyet al., unpublished), and in a separate study 90 FOA resis-tant isolates from a single strain were assessed for trans-poson insertion at the pyrG locus (Monroy andSheppard, 2005). Given the low rate of transpositionexhibited by Aft1 in our excision analysis, it is perhapsnot surprising that Aft1 was not identified in the trappingscreens. The transposition rate of Aft1 is approximately100 fold lower than the frequencies published for transpo-sition of the impala element of Fusarium oxysporum in A.fumigatus (Firon et al., 2003), an element that was identi-fied by transposon trapping. The reasons for the lowtransposition rate observed for Aft1 are unknown but itis possible that the loci into which the transposon cas-settes were inserted were not conducive to transposition.This seems unlikely however as three separate transfor-mants exhibited similar excision frequencies. Sequencedivergence has been used to explain the variable excisionfrequencies observed from different impala transposases soit is possible that the element we have chosen to assess(CADRE gene identifier Afu2g01420) may encode asub-optimal transposase. Finally it is possible that A.

fumigatus has developed a host based mechanism to con-trol transposition of native elements. This is supported byevidence from micro-array studies that show that expres-sion of 6 Aft1 transposases are up-regulated in responseto heat shock (Nierman et al., 2005). The mechanism bywhich this control could take place is however unclearand it seems that it may not be as a direct consequenceof heat shock transcription factors as no heat shock ele-ment repeats (nGAAn-nTTCn; Santoro et al., 1998) couldbe detected in the putative promoter regions of these ele-ments. Post-transcriptional repression by RNA interfer-ence has been proposed by other authors as a methodof control of transposition and it has been shown thatRNAi does take place in A. fumigatus (Bromley et al.,2006), it is unclear at this time however if the heat shockresponse has any impact on RNAi but none of the genesknown to be associated with the RNAi process (Ham-mond and Keller, 2005) are expressed differently inresponse to heat shock (Nierman et al., 2005).

There are 23 full-length Aft1 insertions in AF293, noneof these lay within the coding region of a gene. However,Aft1 insertions can be found close to predicted genesequences and several lie within putative promoter regions

P. Hey et al. / Fungal Genetics and Biology 45 (2008) 117–126 125

that may alter gene expression. Two Aft1 copies lie nearbyother putative transposases suggesting that transposonsmay cluster in non-coding regions. This has been docu-mented in M. grisea where transposons have a tendencyto cluster in the centromere and chromosome ends (Thonet al., 2006). This clustering event may be as a result of inte-gration into ‘inactive’ regions of the genome where geneexpression is limited, once integrated in these regions it ispossible that transposons are trapped.

A unique strain-specific insertion in chromosome 3 ofAF293 was found to lie 30 bases upstream of a putativeG-protein coupled receptor protein (GPCR) coding region(Afu3g01750). This gene was expressed in three strains thatdid not harbour this insertion but not in AF293 suggestingthat the Aft1 insertion prevents transcription of this puta-tive GPCR in AF293. This gene is unique to A. fumigatus

and has been named gprL and defined as a Class V GPCRthrough phylogenetic comparisons to other GPCRs (Lafonet al., 2006). Although the role of this receptor is notunderstood receptors of this class in other filamentousfungi are thought to be involved in cAMP sensing (Gala-gan et al., 2003). A recent study has implicated the cAMPsignalling pathway in growth, development and virulence(Liebmann et al., 2004). It is interesting to speculate then,that this insertion may explain the reduced growth rateand virulence exhibited by AF293 when compared to otherA. fumigatus isolates (Paisley et al., 2005).

The purpose of this study was to identify a transposonthat would be a suitable candidate for modification as atransposon mutagenesis tool. We believe that this elementshows many factors that make it a good candidate foruse as a mutagenesis tool. We have demonstrated thattransposable elements that share significant similarity toAft1 are present in other Aspergilli indicating a relativelybroad host range for this type of element and althoughwe are yet to demonstrate it’s functionality in other fungi,other transposons of this class have been shown to beactive across many species (Nicosia et al., 2001; Queirozand Daboussi, 2003) and similar elements have been usedas heterologous mutagenesis agents (Nicosia et al., 2001;Firon et al., 2003; Windhofer et al., 2002). Additionallyanalysis of the flanking regions of Aft1 insertions indicatethat no particular insertion site specificity exists with theexception of the TA dinucleotides as is common in all mar-iner elements (Plasterk et al., 1999). Finally we have someevidence to support the fact that excision frequency of thiselement increases at 45 �C when compared to 37 �C. Thismay be the result of increased expression of the Aft1 trans-posase when exposed to heat shock (Nierman et al., 2005).This would indicate that modifying the expression of Aft1

could lead to controllable transposition.In summary, we have identified a functional transposon

from A. fumigatus which may provide a useful basis for thedevelopment of a mutagenesis tool as it appears to have abroad host range and low insertion site specificity. By taggingthe element with an integral selection marker we hope to beable to track its movement. The low rate of mobilisation

exhibited by this transposon may prove problematic howeverthis may be addressed by over-expressing its transposase.

References

Bolland, S., Kleckner, N., 1996. The three chemical steps of Tn10/IS10transposition involve repeated utilization of a single active site. Cell 84(2), 223–233.

Bromley, M., Gordon, C., Rovira-Graells, N., Oliver, J., 2006. TheAspergillus fumigatus cellobiohydrolase B (cbhB) promoter is tightlyregulated and can be exploited for controlled protein expression andRNAi. FEMS Microbiol. Lett. 264 (2), 246–254.

Cambareri, E.B., Jensen, B.C., Schabtach, E., Selker, E.U., 1989. Repeat-induced G-C to A-T mutations in Neurospora. Science 244 (4912),1571–1575.

Cui, Z.B., Geurts, A.M., Liu, G.Y., Kaufman, C.D., Hackett, PB., 2002.Structure-function analysis of the inverted terminal repeats of thesleeping beauty transposon. J. Mol. Biol. 318 (5), 1221–1235.

Daboussi, M., Langin, T., 1994. Transposable elements in the fungal plantpathogen Fusarium oxysporum. Genetica 1–3 (93), 49–59.

Daboussi, M.J., 1997. Fungal transposable elements and genome evolu-tion. Genetica 100 (1–3), 253–260.

Daboussi, M.J., Capy, P., 2003. Transposable elements in filamentousfungi. Ann. Rev. Microbiol. 57, 275–299.

Daviere, J.M., Langin, T., Daboussi, M.J., 2001. Potential role oftransposable elements in the rapid reorganization of the Fusarium

oxysporum genome. Fungal Genet. Biol. 34 (3), 177–192.Doak, T.G., Doerder, F.P., Jahn, C.L., Herrick, G., 1994. A proposed

superfamily of transposase genes—transposon-like elements in ciliatedprotozoa and a common D35E motif. Proc. Natl. Acad. Sci.USA 91(3), 942–946.

Felsenstein, J. 1989. PHYLIP—Phylogeny Inference Package (Version3.2). Cladistcs 5, 164–166.

Firon, A., Villalba, F., Beffa, R., d’Enfert, C., 2003. Identification ofessential genes in the human fungal pathogen Aspergillus fumigatus bytransposon mutagenesis. Eukaryot. Cell 2 (2), 247–255.

Galagan, J.E. et al., 2003. The genome sequence of the filamentous fungusNeurospora crassa. Nature 422 (6934), 859–868.

Hammond, T.M., Keller, N.P., 2005. RNA silencing in Aspergillus

nidulans independent of RNA-dependent RNA polymerases. Genetics169 (2), 607–617.

Hepperle, D. 2001. Multicolor sequence alignment editor. Institute ofFreshwater Ecology and Inland Fisheries, 16775 Stechlin, Germany.

Hua-Van, A., Langin, T., Daboussi, M.J., 2001. Evolutionary history ofthe impala transposon in Fusarium oxysporum. Mol. Biol. Evol. 18(10), 1959–1969.

Kachroo, P., Leong, S.A., Chattoo, B.B., 1994. Pot2, an inverted repeattransposon from the rice blast fungus Magnaporthe grisea. Mol. Gen.Genet. 245 (3), 339–348.

Lafon, A., Han, K.H., Seo, J.A., Yu, J.H., d’Enfert, C., 2006. G-proteinand cAMP-mediated signaling in Aspergilli: a genomic perspective.Fungal Genet. Biol. 43 (7), 490–502.

Lehmann, M., Siegmund, T., Lintermann, K.G., Korge, G., 1998. Thepipsqueak protein of Drosophila melanogaster binds to GAGAsequences through a novel DNA-binding domain. J. Biol. Chem. 273(43), 28504–28509.

Liebmann, B., Muller, M., Braun, A., Brakhage, A.A., 2004. The cyclicAMP-dependent protein kinase: a network regulates development andvirulence in Aspergillus fumigatus. Infect. Immun. 72 (9), 5193–5203.

Mieczkowski, P.A., Lemoine, F.J., Petes, TD., 2006. Recombinationbetween retrotransposons as a source of chromosome rearrangementsin the yeast Saccharomyces cerevisiae. DNA Repair 5 (9-10), 1010–1020.

Monroy, F., Sheppard, D.C., 2005. Taf1: a class II transposon ofAspergillus fumigatus. Fungal Genet. Biol. 42 (7), 638–645.

Montiel, M.D., Lee, H.A., Archer, D.B., 2006. Evidence of RIP (repeat-induced point mutation) in transposase sequences of Aspergillus

oryzae. Fungal Genet. Biol. 43 (6), 439–445.

126 P. Hey et al. / Fungal Genetics and Biology 45 (2008) 117–126

Neuveglise, C., Sarfati, J., Latge, J.P., Paris, S., 1996. Afut1, aretrotransposon-like element from Aspergillus fumigatus. NucleicAcids Res. 24 (8), 1428–1434.

Nicosia, M.G.L., Brocard-Masson, C., Demais, S., Van, A.H., Daboussi,M.J., Scazzocchio, C., 2001. Heterologous transposition in Aspergillus

nidulans. Mol. Microbiol. 39 (5), 1330–1344.Nierman, W.C. et al., 2005. Genomic sequence of the pathogenic and

allergenic filamentous fungus Aspergillus fumigatus. Nature 438 (7071),1151–1156.

Nyyssonen, E., Amutan, M., Enfield, L., Stubbs, J., Dunncoleman, N.S.,1996. The transposable element Tan1 of Aspergillus niger var awamori,a new member of the Fot1 family. Mol. Gen. Genet. 253 (1–2), 50–56.

Pain, A. et al., 2004. Insight into the genome of Aspergillus fumigatus:analysis of a 922 kb region encompassing the nitrate assimilation genecluster. Fungal Genet. Biol. 41 (4), 443–453.

Paisley, D., Robson, G.D., Denning, D.W., 2005. Correlation betweenin vitro growth rate and in vivo virulence in Aspergillus fumigatus.Med. Mycol. 43 (5), 397–401.

Paris, S., Latge, J.P., 2001. Afut2, a new family of degenerate gypsy-likeretrotransposon from Aspergillus fumigatus. Med. Mycol. 39 (2), 195–198.

Payne, G.A., Nierman, W.C., Wortman, J.R., Pritchard, B.L., Brown, D.,Dean, R.A., Bhatnagar, D., Cleveland, T.E., Machida, M., Yu, J.,2006. Whole genome comparison of Aspergillus flavus and A. oryzae.Med. Mycol. 44 (Suppl. 1), S9–S11.

Plasterk, R.H.A., Izsvak, Z., Ivics, Z., 1999. Resident aliens—the Tc1/mariner superfamily of transposable elements. Trends Genet. 15 (8),326–332.

Punt, P.J., Oliver, R.P., Dingemanse, M.A., Pouwels, P.H., Vandenhon-del, C.A.M.J.J., 1987. Transformation of aspergillus based on thehygromycin-b resistance marker from Escherichia coli. Gene 56 (1),117–124.

Queiroz, M.V., Daboussi, M.J., 2003. Impala, a transposon fromFusarium oxysporum, is active in the genome of Penicillium griseoro-

seum. FEMS Microbiol. Lett. 218 (2), 317–321.

Raz, F., van Luenen, H.G.A.M., Schaerringer, B., Plasterk, R.H.A.,Driever, W., 1997. Transposition of the nematode Caenorhabditis

elegans Tc3 element in the zebrafish Danio rerio. Curr. Biol. 8 (2), 82–88.

Santoro, N., Johansson, N., Thiele, D.J., 1998. Heat shock elementarchitecture is an important determinant in the temperature andtransactivation domain requirements for heat shock transcriptionfactor. Mol. Cell. Biol. 18 (11), 6340–6352.

Thon, M.R., Pan, H.Q., Diener, S., Papalas, J., Taro, A., Mitchell, T.K.,Dean, R.A. 2006. The role of transposable element clusters in genomeevolution and loss of synteny in the rice blast fungus Magnaporthe

oryzae. Genome Biol. 7(2), Art. No. R16.Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins,

D.G., 1997. The CLUSTAL_X windows interface: flexible strategiesfor multiple sequence alignment aided by quality analysis tools.Nucleic Acids Res. 25 (24), 4876–4882.

vanPouderoyen, G., Ketting, R.F., Perrakis, A., Plasterk, R.H.A., Sixma,T.K., 1997. Crystal structure of the specific DNA-binding domain ofTc3 transposase of C. elegans in complex with transposon DNA.EMBO J. 16 (19), 6044–6054.

Vos, J.C., Plasterk, R.H., 1994. Tc1 transposase of Caenorhabditis elegans

is an endonuclease with a bipartite DNA binding domain. EMBO J. 13(24), 6125–6132.

Wang, H.M., Hartswood, E., Finnegan, D.J., 1999. Pogo transposasecontains a putative helix-turn-helix DNA binding domain thatrecognises a 12 bp sequence within the terminal inverted repeats.Nucleic Acids Res. 27 (2), 455–461.

Watkins, S., van Pouderoyen, G., Sixma, T.K., 2004. Structural analysisof the bipartite DNA-binding domain of Tc3 transposase bound totransposon DNA. Nucleic Acids Res. 32 (14), 4306–4312.

Windhofer, F., Hauck, K., Catcheside, D.E.A., Kuck, U., Kempken, F.,2002. Ds-like Restless deletion derivatives occur in Tolypocladium

inflatum and two foreign hosts, Neurospora crassa and Penicillium

chrysogenum. Fungal Genet. Biol. 35 (2), 171–182.