Specific expression of the Fusarium transposon Fot1 and effects on target gene transcription

Speci®c expression of the Fusarium transposon Fot1and effects on target gene transcription

Francine Deschamps, Thierry Langin, Patricia

Maurer, Catherine Gerlinger, BeÂatrice Felenbok and

Marie-JoseÂe Daboussi*

Institut de GeÂneÂtique et Microbiologie, UniteÂ de

Recherche AssocieÂe au CNRS no. 2225, UniversiteÂ

Paris-Sud, BaÃtiment 400, Centre Universitaire d'Orsay,

F-91405 Orsay Cedex, France.

Summary

The Fot1 transposon is active in some strains of the

plant pathogenic fungus Fusarium oxysporum. In a

high-copy-number strain that contains autonomous

elements, we have detected a transcript of 1.7 kb hybri-

dizing to Fot1 in very low amounts. Mapping the 38

and 58 termini of this transcript con®rms that it corre-

sponds to a Fot1-speci®c transcript. In this strain, ®ve

independent mutants of the transgene (niaD ) encoding

nitrate reductase have arisen by insertion of Fot1 into

the third intron. The analysis of the effect of Fot1

insertion in these mutants shows that, depending on

the orientation of Fot1 relative to niaD, different trun-

cated chimeric niaD±Fot1 transcripts are produced.

Mapping the 58 and 38 ends of these transcripts reveals

(i) premature polyadenylation at sites present in the 58

and 38 untranslated regions of Fot1, and (ii) initiation

of some transcripts in the 38 part of the niaD gene

at sites located immediately downstream of the Fot1

insertion. Thus, a novel promoter, associated with the

end of Fot1, directs transcriptional activity outwards

from the element into the coding sequence of the

niaD gene. These effects demonstrate that Fot1 inser-

tion provides an additional general mechanism con-

trolling fungal gene expression.

Introduction

The ubiquity of transposable elements has made them

objects of interest, particularly because of the effects they

may exert on host genomes. Transposons account for a

large number of spontaneous mutations (see for a review

McDonald, 1993; Britten, 1996; Kidwell and Lisch, 1997).

They have been shown to create mutations by simple

insertion within or near a gene in many organisms, bacteria

(Gupta et al., 1997), fungi (Kinsey and Helber, 1989), maize

(Walker et al., 1997), insects (Beeman et al., 1996) and

®sh (Koga et al., 1995). The insertion of a transposable

element into a gene causes a variety of effects on gene

expression, depending on both the location and the prop-

erties of the element (for a review see Boeke and Sand-

meyer, 1991; Smith and Corces, 1991; Chandler and

Hardeman, 1992). These effects include modi®cations of

transcriptional start sites (Rudenko et al., 1994; Cocherel

et al., 1996; Roelants et al., 1997; Vasicek et al., 1997),

RNA processing (Ortiz and Strommer, 1990; Pouteau et

al., 1991; Adachi et al., 1993; Hoover et al., 1993) and

transcription regulatory signals (Awasaki et al., 1996; Cam-

bareri et al., 1996). Because transposable elements appear

to offer a rich potential source of variation within the host

genome, it is not surprising that their activity has been

postulated to account for natural variation in different

organisms. This is the case for Fusarium oxysporum, an

important fungal plant pathogen that exists in many spe-

cialized forms and exhibits a high level of genetic variabil-

ity (Daboussi and Langin, 1994).

Work in our laboratory has focused on the characteriza-

tion of transposable elements in this organism, using a

strategy involving the inactivation of a gene whose mutant

phenotype can be easily scored. The investigation was per-

formed using the nitrate reductase structural gene (nia), a

gene easily studied by genetic and molecular techniques

(Johnstone et al., 1990; Punt et al., 1995). Numerous spon-

taneous mutants were selected using the chlorate resist-

ance scheme (Cove, 1976) and unstable alleles were

screened by the genetic criterion of reversion. As the nia

gene of Fusarium was not yet available at the beginning

of this study, we decided to screen unstable mutants in

a foreign gene, the niaD gene of Aspergillus nidulans,

which was introduced by transformation into a niaÿ recipi-

ent strain of Fusarium oxysporum (Malardier et al., 1989).

This gene is well expressed in F. oxysporum, regulated

exactly as the the F. oxysporum nia gene (Daboussi et

al., 1991), and stably maintained through mitosis when

introduced as a single copy (Malardier et al., 1989). From

such a transformed strain (TR7), niaD mutants were

selected and their molecular structure analysed using

the niaD gene as a probe. This analysis led to the identi®-

cation of three different families of transposable elements

Molecular Microbiology (1999) 31(5), 1373±1383

Q 1999 Blackwell Science Ltd

Received 3 June, 1998; revised 10 November, 1998; accepted 20November, 1998. *For correspondence. E-mail [email protected]; Tel. (�33) 1 69 15 62 13; Fax: (�33) 1 69 15 70 06.

(Daboussi et al., 1992; Daboussi and Langin, 1994; Langin

et al., 1995).

Fot1, the ®rst transposable element identi®ed in this

species, is 1928 bp long, with short inverted repeats of

44 bp and one large open reading frame (ORF) (Daboussi

et al., 1992). Its overall structure is similar to IS elements

in bacteria and to certain elements in eukaryotes, such as

P in Drosophila, Ac/Ds elements in maize and Tc1 in the

nematode Caenorhabditis elegans (Daboussi and Langin,

1994). Transposition of this element into the niaD gene

indicates that Fot1 active copies are present in the genome

of some strains. Recently, we have identi®ed autonomous

copies of the Fot1 element (Migheli et al., 1999), which now

allows a transposon tagging system to be developed.

However, exploitation of the potential of the Fot1 element

requires an understanding of the molecular mechanism

and regulation of transposition.

Transposition of Fot1 into the niaD gene results in the

creation of null alleles and its excision restores a wild-

type phenotype. This provides a good opportunity for an

analysis of the effect of a transposable element on a target

gene expression. Because Fot1 insertions can modify the

expression of the niaD gene in several ways, depending on

the location and the orientation of the transposon within the

target gene, we ®rst located Fot1 in ®ve independent niaD

transposon-induced mutations and then analysed the tran-

scription pattern in the mutant alleles. In this study, we

report on the speci®c transcript of Fot1, detected in low

abundance and only in high-copy-number strains. We also

demonstrate that insertion of Fot1 into the niaD gene is

accompanied by the generation of several chimeric tran-

scripts. The dissection of the molecular events underlying

the alteration of niaD transcriptional activity reveals that

Fot1 provides transcription initiation and 38 end processing

sites. Fot1-promoted transposon read-out transcription

adds an additional mechanism by which Fusarium trans-

posable elements might participate in controlling fungal

gene expression.

Results

Characterization of a Fot1-speci®c transcript

The structure of the Fot1 element inserted in the niaD37

allele is outlined in Fig. 1A (see Daboussi et al., 1992 for

complete nucleotide sequence). Sequence analysis of this

copy reveals a single uninterrupted ORF that would encode

a putative polypeptide of 542 amino acids. It is assumed

that, as in bacterial transposons, this protein acts as the

transposase of Fot1. The Fot1 promoter ressembles those

of fungal nuclear genes in terms of an AT-rich region

found around 60 bp upstream of the presumed translational

start site. Two motifs, TATTTA at position ÿ76 bp and

ATAAAT at position ÿ62 bp, bear a close resemblance

to the canonical TATAAA box. These motifs are presented

as the putative TATA box for the oliC gene in Aspergillus

nidulans and for the cutA gene in Colletotrichum capsici

(Gurr et al., 1987). A pyrimidine-rich tract (CT block) pre-

ceding the translational initiation site and usually found in

highly expressed genes is also present in the 58-¯anking

sequence (Gurr et al., 1987) as shown in the upper part

of Fig. 1A. All Fot1 elements present the same structure

(Daboussi et al., 1992), although slight variation has been

observed in the nucleotide sequences of Fot1 copies

(T. Langin, unpublished). The high degree of internal

structure conservation suggests that Fot1 elements may

be similar in their transcriptional activity.

We investigated the presence of Fot1 mRNA in poly(A)�

RNA extracted from mycelia of various strains containing

different copy numbers of Fot1 (Fig. 1B). Northern blot

experiments (Fig. 1C) showed that only one transcript

hybridizing with the Fot1 probe is detected in the FOM24

strain containing more than 100 copies of Fot1 and in

which autonomous copies have been identi®ed (Migheli et

al., 1999). It has also been detected in FOLn3 strain with

about 50 Fot1 copies (not shown), but not in the FOL15

strain containing only two Fot1 copies, or in the Fot1-free

FO47 strain (not shown). The size of this transcript is in

good agreement with that predicted from the Fot1 nucleoti-

dic sequence and its detection correlates with the presence

of active Fot1 elements. These observations suggest that

the 1.7 kb mRNA corresponds to a Fot1-speci®c transcript.

It is noticeable that the amount of this transcript in the

strain with 100 copies appears extremely reduced in com-

parison to the actin mRNA. The non-detection of the Fot1-

speci®c transcript in a strain with only two copies could

re¯ect the absence of active copies in this strain or the

low level of Fot1 expression.

To characterize further the Fot1-speci®c transcript,

we have determined the 58 and 38 ends using the RACE

procedure. Sequencing of seven independent clones of

the PCR products showed three different 58 ends, located

at ÿ9 (1 clone), ÿ22 (5 clones) and ÿ38 (1 clone) with

regard to the ATG initiator (Fig. 1D). This demonstrates

that the 1.7 kb transcript is initiated in the Fot1 sequence,

predominantly at position ÿ22. The presence of a putative

TATA-like sequence, 40 nt downstream, is in agreement

with that reported for ®lamentous fungal genes (Gurr et

al., 1987) and strengthens the conclusion that a Fot1 spe-

ci®c promoter is present. For the 38 end of the Fot1-speci®c

transcript, sequencing of two clones showed that they

were co-linear with the genomic sequence and terminated

at two polyadenylation sites, 27 and 37 nt downstream of

the TAG codon respectively (Fig. 1D). Because Fot1 does

not contain the usual poly(A) signal AAUAAA, we consider

the sequence AAAUA, 10±20 nt upstream of the poly(A)

tail, to be the most likely candidate for the polyadenylation

signal.

Q 1999 Blackwell Science Ltd, Molecular Microbiology, 31, 1373±1383

1374 F. Deschamps et al.


Fig. 1. Transcript analysis of Fot1.A. Structure of the Fot1 element. The target site is the dinucleotide TA and the 44-bp terminal inverted repeats are represented by blacktriangles. Putative TATA motifs are enclosed in boxes and the CT block underlined. The location of oligonucleotides used for ampli®cation aregiven as numbers in circles, and the orientation is given by the arrow at the 38 terminus (see Table 1). The Fot1 probe corresponds to theentire element.B. Southern blot analysis of Fot1 sequences in different strains of F. oxysporum. Five micrograms of total genomic DNA from three wild-typestrains FOM24 (lane1), FO47 (lane 2) and FOL15 (lane 3) were digested with EcoRI (which does not cut within Fot1 in FOM24 and cuts oncein FOL15), separated on 0.6% agarose gel, transferred to a Hybond-N membrane, and hybridized with the radiolabelled Fot1 probe.C. Northern hybridization analysis of Fot1 expression in FOM24 (lanes 1±2) and FOL15 (lanes 3±4). Poly(A)� RNA was prepared from strainFOM24 (<100 Fot1 copies) and strain FOL15 (2 Fot1 copies). Aliquots of 1 mg (lanes 1 and 3) or 2 mg (lanes 2 and 4) were fractionated onthe 1% agarose-0.66 M formaldehyde gel, transferred to a nylon membrane, and hybridized successively with the Fot1 probe (top) and anactin probe (bottom).D. Nucleotide sequence of the 58 and 38 regions of Fot1. Arrows indicate the 58 ends of the transcript (with the number of clones initiating ateach position within parentheses) and 38 end formation sites determined by the RACE procedure (see Experimental procedures). In the Fot1sequence, putative TATA motifs and the polyadenylation signals are enclosed in boxes. Arrows indicate transcript initiation sites andtermination sites respectively.

Effects of Fot1 transposon on niaD transcription 1375

Location and orientation of Fot1 insertions in the

niaD gene

Analysis of spontaneous mutants in the nitrate reductase

gene showed that ®ve independent niaD mutants have

resulted from the insertion of a Fot1 element (Daboussi

et al., 1992). The Fot1 element inserted in the niaD37

mutant (named Fot1-37 ) together with its ¯anking niaD

sequences was sequenced and localized (Daboussi et al.,

1992). Fot1-37 element lies in the third intron, in the same

transcriptional orientation as the niaD gene. The location

of Fot1 in the other mutants (niaD136, niaD132, niaD163

and niaD62 ), previously mentioned in (Daboussi and Lan-

gin, 1994), was determined by DNA sequencing after clon-

ing the niaD fragment containing the Fot1 insertions. As

shown in Fig. 2, all the insertions are located at a TA site,

at three different positions, within the third intron of the

niaD gene. Fot1-136 was inserted at the same position

and in the same orientation as Fot1-37, whereas Fot1-

132, Fot-163 and Fot1-62 were inserted in an opposite

orientation at 14 bp and 34 bp downstream of the Fot1-37

insertion respectively. After sequencing, we found that,

contrary to our previous assumptions, the insertion site

of the Fot1 element within the niaD62 allele is also located

in the third intron, rather than in the last exon as deduced

from Southern blot analysis (Daboussi et al., 1992). The

complete sequence of the Fot1-62 copy, which was demon-

strated to be autonomous (Migheli et al., 1999), shows

only one base pair substitution, located outside the ORF

compared with that of Fot1-37.

The Fot1 insertions alter niaD transcription

We have previously demonstrated that transcription of

the A. nidulans niaD gene in the TR7 Fusarium trans-

formed strain is regulated as in A. nidulans. The 2.9 kb

niaD mRNA levels vary depending upon the nitrogen

source. The abundance of the niaD transcript is greatly

increased in cells subjected to nitrate induction under the

control of the pathway-speci®c activator nirA, and is

severely decreased in wild-type cells incubated under con-

ditions of glutamine repression (Daboussi et al., 1991).

Insertion of Fot1 within the niaD gene determines a null

phenotype, and its excision restores niaD expression. To

understand how Fot1 can alter the target gene expression,

we analysed the transcription pattern in the mutant alleles,

as well as in one revertant from niaD37. Because of the

low level of some transcripts, poly(A)� RNA rather than

total RNA was used for hybridizations. Preliminary experi-

ments established that poly(A)� RNA and total RNA

showed the same regulatory pattern, indicating that all

the niaD transcripts analysed were polyadenylated.

In the niaD37 mutant, the transcriptional orientation of

the Fot1 element is the same as that of the niaD gene

(Fig. 2). Northern blots presented in Figs 3 and 4 show

that three transcripts of 2.7 kb, 2.1 kb and 1.1 kb can be

detected using the niaD probe a, which contains the

quasi-complete niaD sequence (see Fig. 5B), instead of

the 2.9 kb niaD transcript present in strain TR7 containing

the wild-type allele (Fig. 4). As expected, the revertant from

niaD37, resulting from the excision of the Fot1 element


Fig. 2. Location of Fot1 insertions within the niaD gene in different mutants. The niaD gene transcription unit is 2.9 kb long and containsseven exons (open boxes). The position of the insertions (triangle) was determined from sequence data. The Fot1 insertions are located at aTA site (in bold) in the third intron (upper part), at three positions. Transcriptional orientations of the niaD gene and the Fot1 elements areshown by arrows. The size of insertions in the ®gure is not shown to scale with the niaD map. The location of oligonucleotides used for theRACE procedure are as numbers in circles and the orientation is given by the arrow at the 38 terminus (see Table 1).


(Daboussi et al., 1992) presents the 2.9 kb transcript as

observed in the wild-type TR7 (data not shown). In the

two other mutants, niaD132 and niaD62, in which Fot1 was

inserted, respectively, at 14 and 34 nucleotides downstream

of the Fot1-37 insertion, in a transcriptional orientation

opposite to that of niaD (Fig. 2), the use of the same niaD

probe as above reveals only two transcripts of 2.1 kb and

1.1 kb (Fig. 3). We can observe that the absence of the

2.7 kb transcript in these mutants is correlated with an

increase in the amount of the 1.1 kb transcript.

To determine whether the truncated RNA species iden-

ti®ed in the three mutants contains part of Fot1, the North-

ern blot was hybridized with the Fot1 probe (Fig. 3). We

observe that in addition to the expected 1.7 kb Fot1-speci-

®c transcript present in all the mutants, the large transcript

of 2.7 kb is detected only in the niaD37 mutant. It therefore

corresponds to a chimeric niaD±Fot1 transcript. The shorter

transcripts of 2.1 kb and 1.1 kb may also be chimeric, but

the length of sequence homologous to Fot1 may not be

suf®cient to give a detectable hybridization signal, as will

be discussed later.

Structural analysis of the niaD37 transcripts

To determine whether the niaD transcripts are regulated

like the wild-type niaD gene, two different growth conditions

were used: speci®c induction by nitrate and repression by

glutamine. Figure 4 shows that in the niaD37 mutant, the

two transcripts of 2.7 and 1.1 kb are completely repressed,

whereas the steady-state level of the 2.1 kb transcript is

unchanged or slightly increased. From these data, it appears

that the ®rst two transcripts, which are regulated like the

niaD gene, are most likely initiated at the niaD promoter,

whereas the last one, which escapes from typical niaD

regulation, is initiated from another promoter.

Additional information on the structure of these tran-

scripts was obtained from hybridization to fractionated

niaD probes derived from the region upstream and down-

stream of the Fot1 integration site as depicted in Fig. 5B.

As seen in Fig. 5A, the 2.7 kb and 1.1 kb truncated niaD

transcripts hybridize with the niaD probe c, corresponding

to the 58 region of niaD, but not with the niaD 38 probe d. In

light of these data and those obtained above from the pat-

tern of regulation, we can conclude that both transcripts

are initiated at the niaD promoter but terminate early or

late in the Fot1 element. The size of the larger 2.7 kb tran-

script is in good agreement with a termination at the same

site as the Fot1-speci®c transcript, whereas the shorter

transcript of 1.1 kb probably terminates at the beginning

of the Fot1 sequence, as will be shown later. The 2.1 kb

transcript is detected with the niaD probe d, encompass-

ing niaD sequences located 38 from the point of insertion,

but not with the niaD 58 probe c (Fig. 5A). Therefore, this

transcript, previously shown to be constitutively expressed


Fig. 3. Northern blot analysis of transcripts in the niaD37, niaD62and niaD132 mutant alleles. Poly(A)� RNAs were prepared asdescribed in Experimental procedures from niaD37 (lanes 1±2),niaD62 (lane 3) and niaD132 (lane4) and hybridized to niaD probea (top), a Fot1 probe (middle) and an actin probe (bottom). Analiquot of 1 mg (lanes 2±4) or 2 mg (lane 1) is loaded.

Fig. 4. Regulation of niaD transcripts in wild-type (TR7) andmutant (niaD37 ) strains. Poly(A)� RNAs were prepared from TR7and niaD37 mycelia grown under two metabolic conditions: nitrateinduced (I) and nitrate induced/glutamine repressed (RI). Increasingamounts of Poly(A)� were loaded: 1 mg (lanes 1, 2, 3, 6); 2 mg(lanes 4 and 7); 4 mg (lanes 5 and 8). The blot was hybridized tothe niaD probe a (top) and the actin probe (bottom).


(Fig. 4), is assumed to be initiated at an additional promoter,

lying either in the niaD sequence or in the 38 end of Fot1,

and may terminate as the wild-type niaD transcript.

Mapping the 5 8 and 3 8 ends of niaD transcripts

Taking into account the transcriptional regulation data of

niaD transcripts in the mutants, it is assumed that, in the

niaD37 mutant, both transcripts of 2.7 and 1.1 kb, which

are regulated like the niaD gene, are initiated at the same

transcriptional start as the one in the niaD gene. The

same argument is true for the 1.1 kb transcript in the

niaD132 and niaD62 alleles. To con®rm and to investigate

further the structure of the 1.1 kb and 2.1 kb transcripts,

the 38 end of the former and the 58 end of the latter were

determined in different alleles using the RACE procedure

(see Experimental procedures).

In the niaD37 mutant, the 58 end of the 2.1 kb was

mapped for two independent cDNA clones, at position

1184 in exon 4 of the niaD gene, and at a distance of

70 nt from the end of Fot1 (Fig. 6A), and was assumed to

correspond to the start of transcription. A putative TATA

box corresponding to the end of intron 3, TTATA, at 35 nt

upstream this 58 end, can be found. Two other TATA-like

sequences are present in the 38 untranslated region of

Fot1, at a distance of about 140 nt. Considering the size

of this transcript and the location from the start of tran-

scription, the 38 end formation site is most probably that

of the niaD gene. For the 1.1 kb transcript, the start of tran-

scription is assumed to correspond to that of the niaD gene,

as deduced from the pattern of regulation. The sequence

of one cDNA clone, representing its possible 38 end, termi-

nated in the 58 untranslated region of the Fot1 element, at

32 nt of the AUAAA motif (Fig. 6B), which is considered the

polyadenylation signal in other ®lamentous fungal genes

(Gurr et al., 1987). A schematic drawing of these transcripts

is presented in Fig. 6C.

In niaD62 and niaD132 mutants, the two transcripts of

2.1 kb and 1.1 kb have the same organization as those

described in the niaD37 mutant. However, the orientation

of Fot1 is different. Using the 58 RACE procedure, the 58

end of the 2.1 kb transcript in the niaD62 allele was mapped

at position 1210 in exon 4 of the niaD gene, 27 nt down-

stream of that determined for niaD37 (Fig. 6D). A putative

TATA box, TTATA, identical to that mentioned for the

niaD37 allele (see above) and composed of the 38 end of

intron 3 and the duplicated TA site upon Fot1 insertion,

lies at 60 nt from this 58 end. Another TATA-like sequence

can be found in Fot1 at about 140 nt. The 38 end of the

1.1 kb transcript in the niaD132 allele was similarly mapped.

It lies 145 nt in the 38 untranslated region of Fot1, at a dis-

tance of 39 nt downstream from the canonical polyadeny-

lation signal AAUAAA (Fig. 6E). A schematic drawing of

these transcripts is presented in Fig. 6F.

Discussion

We have investigated the transcription pattern of the trans-

posable element Fot1 and report here the characterization

of a speci®c transcript from this element. Our results indi-

cate that there is a single transcript extending almost the

entire length of Fot1. Mapping the 58 and 38 ends of this

transcript con®rms that it represents speci®c transcription

of Fot1 and not adventitious transcription of Fot1 sequ-

ences inserted in active genes. This Fot1 transcript has

been detected, at a low level, only in strains containing


Fig. 5. A. Northern analysis of niaD transcripts in wild-type (TR7)and mutant (niaD37 ) strains. Poly(A)� RNAs (1 mg) of strains TR7(wild-type allele) and niaD37 (mutant allele) were hybridized withprobes derived from fractionating niaD gene: probe a (the 2.7 kbEcoRI fragment which contains the quasi-totality of the niaD gene),probe c (an ampli®cation product corresponding to the 58 niaDregion, upstream of the Fot1 insertion), and probe d (anampli®cation product corresponding to the 38 niaD region,immediately downstream of the Fot1 insertions). Probe e (the1.3 kb EcoRI fragment located in the 58 upstream sequence) andprobe b (the 3.2 kb HindIII fragment immediately dowstream Fot1insertions) gave the same hybridization pattern as probe a andprobe d, respectively (data not shown)B. Locations of the niaD probes used to detect transcripts inNorthern blots.


many of these elements, some of which were demonstrated

to be autonomous (Migheli et al., 1999). An interesting

aspect of Fot1 function is the low abundance of Fot1

mRNA in high-copy-number strains. This could be due to

(i) the low level of transcription of Fot1, (ii) the transcription

of only some copies or (iii) the high turnover rate because

of instability of Fot1 mRNA species. The low steady-state

abundance of Fot1 transcript might be important in restrict-

ing the level of activity of Fot1, thus limiting the deleterious

consequences associated with transposition. However, if

Fot1 is tobeef®cientlyused for gene tagging inF.oxysporum

and other ®lamentous fungi, then it may be necessary to

increase the transposition frequency. One possibility is

that an increase in the level of transcription may in turn

raise the frequency of transposition. Experiments are

being performed in our laboratory to clarify the relationship

between the number of active Fot1 copies, the amount of

Fot1 transcript and the frequency of transposition.

The effects of Fot1 on gene expression were studied on

mutant alleles of the niaD gene. Five independent mutants

were isolated upon insertion of Fot1 transposing elements.

We have localized the sites of insertion to the third intron of

the niaD gene. Whether this hot spot implies a preference

for insertion in non-coding regions or is an outcome of the

particular type of mutants selected, remains unclear. These

transposable element-induced mutations were identi®ed

by their ability to produce a large number of somatic rever-

sions. Because somatic reversion is not commonly caused

by precise excision of the inserted element (Daboussi and

Langin, 1994; Daboussi et al., 1992), one can imagine how


Fig. 6. Mapping of the 58 and 38 ends of the 2.1 kb and 1.1 kb niaD transcripts in the niaD37 and niaD62 alleles.A and D. Mapping the 58 end of the 2.1 kb transcript. Partial nucleotide sequences of the niaD gene are given: exon 3 in uppercase letters,intron 3 in lowercase letters and the TA insertion site of Fot1 in bold. The Fot1 sequence, in italics, is framed. Two potential TATA-likesequences in Fot1 are boxed and one at the end in intron 3, grey-boxed. The transcriptional initiation site in exon 4 is indicated by an arrow.B and E. Mapping the 38 end of the 1.1 kb transcript. The letter symbols are as described above. The putative polyadenylation signal is boxedand the polyadenylation site is indicated by a vertical arrow.C and F. Schematic representation of the structure of the niaD transcripts in niaD37 and niaD62 alleles. niaD sequences are in grey and Fot1sequences in black. Transcriptional initiation sites are indicated by a circle and polyadenylation signals by a lozenge; the sites normally usedin niaD and Fot1 genes are ®lled and the additional signals are open.


insertions within introns or leader regions might be particu-

larly revertible and selected as such. However, the niaD

gene contains six introns (Johnstone et al., 1990), so the

preference observed for insertion into the third intron

raises the question of whether an intrinsic target sequence,

or some particular structure, is responsible. The target

choice can be dependent on primary sequence. For Tc1

elements that always integrate into a TA dinucleotide,

hot sites for integration were found to match with a consen-

sus sequence of 10 bp centred around the TA dinucleotide

(van Luenen and Plasterk, 1994). For one TA target site a

4 bp sequence on one side of the TA was found suf®cient

to make a site hot (Ketting et al., 1997). In the case of Fot1,

no discernable consensus sequence has been found based

on eight insertion events (Migheli et al., 1999). Hot spots

of integration have also been observed for elements that

do not integrate into a speci®c sequence. Some hot-spots

for P have no homology to the consensus sequence,

whereas insertions into some potential integration sites

that perfectly ®t the consensus sequences have never

been isolated (Engels, 1989). Besides the primary DNA

sequence, the functional state of the DNA can have a sig-

ni®cant effect on target site choice (Craig, 1997; Curcio

and Morse, 1996).

The results presented here clearly show that Fot1 inser-

tion affects transcription of the niaD gene by generating

several truncated niaD transcripts. The number of niaD

transcripts depends on Fot1 orientation and the location

and the strength of transcription signals within the element.

Interestingly, regardless of whether Fot1 and niaD are in

the same transcriptional orientation, niaD±Fot1 chimeric

transcripts are initiated preferentially at the niaD promoter,

indicating that this promoter is most probably a strong pro-

moter compared with that of Fot1. These transcripts are

polyadenylated in response to signals present in the trans-

posable element or in the niaD gene. Polyadenylation sites

were detected in Fot1 in the 58 and 38 untranslated regions

outside the terminal inverted repeats, con®rming that the

chimeric transcripts contain some sequences of Fot1.

The fact that chimeric Fot1±niaD transcripts initiating

at the promoter of Fot1 and terminating at the normal

38 end formation site of the niaD gene have never been

detected could be explained in several ways: (i) the Fot1

promoter is a very weak promoter, (ii) the Fot1 termination

signal is very ef®cient, (iii) transcription initiated at the Fot1

promoter is inhibited by the transcription events initiated

upstream at the niaD promoter, and (iv) such transcripts

could be unstable because of the presence of stop codons

present in the Fot1 sequence, as observed in other organ-

isms (Atwater et al., 1990).

The chimeric transcripts of 2.7 kb and 1.1 kb are both

inducible and nitrogen repressed, similar to niaD wild-

type allele in A. nidulans (Burger et al., 1991) and in F.

oxysporum (Daboussi et al., 1991). Thus, they are thought

to be directed by the niaD promoter and initiated at the nor-

mal transcription start site. The same speci®c DNA targets

are also expected to be used, i.e. nirA and GATA binding

sites, which mediate nitrate induction via the binding of the

speci®c activator NirA and the general activator AreA,

responsible for nitrogen derepression (Punt et al., 1995).

In the niaD37 mutant, the 1.1 kb premature polyadeny-

lated transcript comprises a 58 niaD messenger sequence

and 140 nt of the Fot1 element. This chimeric transcript

uses a 38 end formation site lying in the 58 part of Fot1.

Such premature polyadenylation of transcripts has been

reported in plants after transposition of elements such

as those of the the Spm family (Gierl et al., 1985) and

of the Mu family (Ortiz and Strommer, 1990). However, in

the longer chimeric niaD±Fot1 2.7 kb transcript, a read-

through of this ®rst 38 end formation site in Fot1 is observed.

Because no full-length readthrough Fot1±niaD transcript

has ever been detected, we conclude that the second

38 end formation signal is very ef®cient and most likely

corresponds to that used to produce the Fot1-speci®c tran-

script. When Fot1 is inserted in the opposite transcrip-

tional orientation, as in the niaD132 and niaD62 mutants,

only the 1.1 kb mRNA initiated at the niaD promoter is

detected. The 38 end formation signal used to produce

this RNA species appears very strong, as monitored by

the high amount of 1.1 kb RNA, and prevents any tran-

scriptional readthrough. Indeed, it ®ts with the canonical

polyadenylation signal (AAUAAA), whereas that used

in the niaD37 mutant (AUAAA) for generating the 1.1 kb

resembles the usual polyadenylation signal and allows

transcriptional readthrough. An additional explanation

for the increased amount of the 1.1 kb in niaD132 and

niaD62 mutants is that transcriptional activators, nirA and

areA, may not be limiting in their interaction with the tran-

scriptional machinery since only one transcript is produced.

It has to be pointed out that whatever the transcriptional

orientation of Fot1 with regard to niaD transcription, a new

promoter is created upon Fot1 insertion resulting in a

constitutively expressed 2.1 kb transcript. This transcript

is initiated in the 38 part of the niaD gene, mapping near

the end of the Fot1 element. Therefore, Fot1-mediated

read-out transcription can be assumed to be responsible

for the generation of this transcript. In fact several putative

TATA boxes can be found in the 38 and 58 untranslated

regions of Fot1 and also at the junction between the

niaD intron 3 and Fot1. We cannot discriminate between

the presence of potential promoters within the Fot1

sequences and their formation as a consequence of Fot1

insertion. Nethertheless, the putative TATA sequences

generated by the Fot1 insertion, found 30±60 nt upstream

of the start site, are in good agreement with that observed

for most ®lamentous fungal promoters (Gurr et al., 1987).

The phenomenon of read-out transcriptional activity of

transposable elements has been previously reported with



Ds and Ac elements in transgenic plants (Rudenko et al.,

1994; Cocherel et al., 1996) and is responsible for the

expression of genes into which it has inserted. The read-

out transcription ability of Fot1 should be taken into account

in transposon tagging experiments. We have shown that

this 2.1 kb transcript escapes from typical niaD regulation.

Interestingly, it is detected under conditions in which the

amount of the wild-type transcript is reduced. Conversely,

the amount of the 2.1 kb transcript is increased in the

niaD37 allele when the 2.7 kb transcript is decreased by

repression. This would indicate an interference in the pro-

duction of these two transcripts. In fact, the signal for the

38 end formation of the 2.7 kb transcript is very close

to the initiation of the 2.1 kb transcript. Therefore, in this

region, a steric hindrance could occur between transcrip-

tional factors.

This work constitutes the ®rst analysis of the effects of

DNA transposon insertions on gene transcription in ®la-

mentous fungi. It demonstrates that the main effect of

Fot1 insertions is at the transcriptional level. It shows

that premature polyadenylation of transcripts is due to util-

ization of signals present in Fot1. This is also the ®rst

report showing the read-out transcriptional ability of Fot1.

This phenomenon provides an additional mechanism by

which this element might participate in controlling fungal

gene expression. Analysis of other Fot1 sites and of the

effects of other Fot1 elements on gene expression will per-

mit us to address questions regarding the evolutionary

consequences of the presence of Fot1.

Experimental procedures

Fungal strains and growth conditions

The F. oxysporum strains used in this study were the wild-type strains, FOM24, FOLn3 and FOL15, which are patho-genic on muskmelon, tomato and ¯ax, respectively, and thenon-pathogenic strain FO47. Various strains derived fromFOM24 were used: the transformant TR7 and the ®veunstable niaD mutants (niaD37, niaD62, niaD132, niaD136,niaD163 ) isolated by selection for chlorate resistance (Cove,1976) from TR7. In the transformant TR7, the nia321 mutationwas complemented by one copy of the A. nidulans niaD gene(Daboussi et al., 1992). One wild-type revertant from niaD37was also studied. The minimal and complete media and cul-ture conditions have been described previously (Daboussi-Bareyre, 1980).

niaD transcription was analysed under conditions of induc-tion and repression, as described in Daboussi et al. (1991).Flasks containing minimal medium with 5 mM urea as nitrogensource (non-induction/non-repression) were inoculated withconidial suspensions (109 per 100 ml) of TR7 or mutant strainsand grown with agitation at 268C for 24 h, then supplementedwith nitrogen sources: 23 mM sodium nitrate (induction) or23 mM sodium nitrate plus 20 mM glutamine (repression/induction). After incubation with agitation in this medium for2 h, mycelia were harvested and frozen at ÿ808C before use.

Genomic cloning

All cloning procedures, including plasmid preparation from E.coli, ligation and transformation were performed according toManiatis (Maniatis et al., 1982). DNA isolation and DNA blot-ting experiments were as previously described by Daboussi(Daboussi et al., 1992). Fot1 insertions, carried on a 4.6 kbEcoRI fragment (including the niaD allele with the inserted1.9 kb Fot1 ), were cloned from the four mutants (niaD62,niaD132, niaD136 and niaD163 ) using partial libraries, accord-ing to the procedure described by Daboussi (Daboussi et al.,1992). This library was obtained by digesting genomic DNAwith EcoRI; fragments were separated on agarose gel. Frag-ments between 3.5 and 4.5 kb were isolated by electroelutionand inserted into the EcoRI site of pUC19. Ligation productswere used to transform E. coli DH5a. The libraries werescreened using the niaD probe a (see Fig. 5B).

PCR ampli®cation

To determine the Fot1 insertion points in the niaD gene, Fot1speci®c primers deduced from the Fot1-37 sequence wereused to sequence the junctions of the four cloned Fot1 inser-tions. PCR was performed according to Saiki (Saiki et al.,1988) in a Biomed 60 Thermal Cycler (Braun) using 500 ngof total genomic DNA and 0.25 units of Bioprobe Taq Polymer-ase, for 30 cycles (1 min at 958C, 1 min at 608C, and 1 min at728C). One-tenth of the total ampli®cation reaction was run ona 1% agarose gel and stained with ethidium bromide. Ampli®-cation products were puri®ed using Spin columns (Pharmacia).

RNA isolation and Northern blot analysis

Total RNA was extracted from mycelia using the proceduredescribed by Deeley (Deeley et al., 1977). Poly(A)� RNAwas selected by adsorption to oligo(dT) cellulose and sepa-rated on 1% agarose gels containing 0.66 M formaldehyde.After electrophoresis, RNA was transferred to Hybond N mem-branes (Amersham). Hybridization and washing conditionswere as described by Church (Church and Gilbert, 1984).Loading of poly(A)� RNA was estimated by ethidium bromidestaining and hybridization with an actin probe. Transcript sizeswere determined by comparison with RNA molecular-weightmarker I (Boehringer Mannheim).

Preparation of 32P-labelled DNA probes

The Fot1 probe corresponds to an ampli®cation product fromplasmid pIN37 (Daboussi et al., 1992), using a primer corre-sponding to a part of the inverted terminal repeats. For thedetection of niaD sequences, different probes were used(Fig. 5B). Some were isolated by electroelution of fragmentsafter digestion of the plasmid pAN301 (Malardier et al., 1989)with different restriction enzymes. The 2.7 kb EcoRI fragmentcorresponds to the niaD probe a, the 1.3 kb EcoRI fragment tothe niaD probe e and the 3.2 kb HindIII fragment to the niaDprobe b. Other probes, niaD probe c corresponding to theniaD 58 region, and niaD probe d corresponding to the niaD38 terminus, were obtained by polymerase chain reaction



(PCR) with speci®c oligonucleotides. The probe correspond-ing to the A. nidulans actin gene was obtained by electroelu-tion of the 1.3 kb Nco I±BamHI fragment from plasmid pSF5(Fidel et al., 1988). Probes were labelled using the methoddeveloped by Feinberg (Feinberg and Vogelstein, 1984)using the T7 Quick Prime Kit (Pharmacia). Labelled niaD singlestrands, both sense and antisense, were produced using T7polymerase (Pharmacia) and speci®c primers.

cDNA synthesis and mapping experiments

Poly(A)� RNAs, isolated as described above, were used astemplates for 58 or 38 RACE procedures according to the manu-facturer's protocol (Gibco BRL). For the 38 ends, the ®rst-strand cDNAs were primed with the 38 RACE Adapter Primer.Then a portion of these cDNAs was used for one or two suc-cessive PCR ampli®cations, each time using the UniversalAnchor Primer and a different speci®c internal primer, Fot1-4or Fot1-5 for the Fot1 transcript, and niaD-6 or niaD-7 for the1.1 kb niaD transcript (see Table 1 for the primers). For the58 ends, the ®rst-strand cDNA was primed with the Fot1-3 pri-mer for the Fot1 transcript and with the niaD-9 primer for the2.1 kb niaD transcript. After puri®cation and dC-tailing, the®rst strands were ampli®ed with the 58 RACE Anchor Primerand speci®c internal primers, Fot1-2 and Fot1-1 for the Fot1transcript and niaD-8 primer for the 2.1 kb niaD transcript.The PCR conditions were: 30 cycles (1.5 min at 948C, 1 minat 608C, 1.5 min at 758C) and one cycle (15 min at 728C).The speci®city of the products was veri®ed by Southern blothybridization. PCR products were then puri®ed and clonedin the pGEM-T vector (Promega).

DNA sequencing

DNA sequencing was performed by the dideoxy chain termi-nation of Sanger (Sanger et al., 1977) on automatic sequen-cer ABI prism 373 using the ABI prism Dye Terminator DNAsequencing KIT from Perkin-Elmer Applied Biosystems.

Acknowledgements

This work was supported by grants from the MinisteÁre del'Education Nationale, de la Recherche et de la Technologie,and a GREG (no. 48) programme. We thank D. Page for theEnglish version.

References

Adachi, M., Watanabe, F.R., and Nagata, S. (1993) Aberranttranscription caused by the insertion of an early transpos-able element in an intron of the Fas antigen gene of lpr mice.Proc Natl Acad Sci USA 90: 1756±1760.

Atwater, J.A., Wisdom, R., and Verma, I.M. (1990) RegulatedmRNA stability. Annu Rev Genet 24: 519±541.

Awasaki, T., Juni, N., and Yoshida, K.M. (1996) An eye imagi-nal disc-speci®c transcriptional enhancer in the long ter-minal repeat of the tom retrotransposon is responsible foreye morphology mutations of Drosophila ananassae. MolGen Genet 251: 161±166.

Beeman, R.W., Thomson, M.S., Clark, J.M., DeCamillis, M.A.,Brown, S.J., and Denell, R.E. (1996) Woot , an activegypsy-class retrotransposon in the ¯our beetle, Triboliumcastaneum, is associated with a recent mutation. Genetics143: 417±426.

Boeke, J., and Sandmeyer, S. (1991) Yeast transposable ele-ments. In: The Molecular and Cellular Biology of the YeastSaccharomyces: Genome Dynamics, Protein Synthesis,and Energetics. Brach, J.R., Pringle, J.R., and Jones, E.W.(eds). Cold Spring Harbor, NY: Cold Spring HarborLaboratory Press, pp. 193±261.

Britten, R.J. (1996) DNA sequence insertion and evolution-ary variation in gene regulation. Proc Natl Acad Sci USA93: 9374±9377.

Burger, G., Tilburn, J., and Scazzocchio, C. (1991) Molecularcloning and functional characterization of the pathway-speci®c regulatory gene nirA , which controls nitrate assimi-lation in Aspergillus nidulans. Mol Cell Biol 11: 795±802.

Cambareri, E., Foss, H., Rountree, M., Selker, E., andKinsey, J. (1996) Epigenetic control of a transposon-inacti-vated gene in Neurospora is dependent on DNA methyla-tion. Genetics 143: 137±146.

Chandler, V.L., and Hardeman, K.J. (1992) The Mu elementsof Zea mays. Adv Genet 30: 77±122.

Church, G.M., and Gilbert, W. (1984) Genomic sequencing.Proc Natl Acad Sci USA 81: 1991±1995.

Cocherel, S., Perez, P., Degroote, F., Genestier, S., andPicard, G. (1996) A promoter identi®ed in the 38 end ofthe Ac transposon can be activated by cis-acting elementsin transgenic Arabidopsis lines. Plant Mol Biol 30: 539±551.

Cove, D. (1976) Chlorate toxicity in Aspergillus nidulans andcharacterization of chlorate resistant mutants. Heredity 36:191±203.

Craig, N. (1997) Target site selection in transposition. AnnuRev Biochem 66: 437±474.

Curcio, N., and Morse, R. (1996) Tying together integrationand chromatin. Trends Genet 12: 436±438.

Daboussi, M.J., and Langin, T. (1994) Transposable ele-ments in the fungal plant pathogen Fusarium oxysporum.Genetica 93: 49±59.

Daboussi, M.J., Langin, T., and Brygoo, Y. (1992) Fot1, anew family of fungal transposable elements. Mol GenGenet 232: 12±16.

Daboussi, M.J., Langin, T., Deschamps, F., Brygoo, Y.,Scazzocchio, C., and Burger, G. (1991) Heterologousexpression of the Aspergillus nidulans regulatory genenirA in Fusarium oxysporum. Gene 109: 155±160.


Table 1. Numbers and DNA sequences of oligonucleotides used forPCR.

Primers Sequence (58 ! 38) Position (nt)

Fot1-1 GCGACCTCGTAGGGTGCTGGG 271±251Fot1-2 CGCGTGAGTTGGAGCGTGGCCG 397±376Fot1-3 CTTCCTTCCTAATGGCGCGTGATCCCC 464±437Fot1-4 CGCAACGCCAAAGCGTGGCGGGC 1351±1373Fot1-5 AAGGCGATCTTGATTGTATTGTGGTG 1638±1664niaD-6 CCGTCACACAAGTGCGGACGGG 355±376niaD-7 CCGGAATCATGGCCCC 706±728niaD-8 GGCCCGTTGGAAGGCCGAGG 987±951niaD-9 GGGACGACATATCTGGCGTGACC 2175±2153


Daboussi-Bareyre, M.J. (1980) Heterokaryosis in Nectriahaematococca: complementation betwen mutants affectingthe expression of two differentiated states. J Gen Microbiol116: 425±433.

Deeley, R.G., Gordon, J.I., Burns, A.T., Mullinix, K.P., Bina-stein, M., and Goldberg, R.F. (1977) Primary activationof the vitellogenin gene in the rooster. J Biol Chem 252:8310±8319.

Engels, W. (1989) P element in Drosophila melanogaster. In:Mobile DNA. Berg, D., and Howe, M. (eds). WashingtonDC: American Society for Microbiology Press, pp. 437±484.

Feinberg, A.P., and Vogelstein, B. (1984) `A technique forradiolabeling DNA restriction endonuclease fragments tohigh speci®c activity'. Addendum. Anal Biochem 137:266±267.

Fidel, S., Doonan, J.H., and Morris, N.R. (1988) Aspergillusnidulans contains a single actin gene which has uniqueintron locations and encodes a g-actin. Gene 70: 283±293.

Gierl, A., Schwarz-Sommer, Z., and Saedler, H. (1985) Mole-cular interactions between the components of the En-Itransposable element system of Zea mays. EMBO J 4:579±583.

Gupta, A., Verma, V., and Qazi, G.N. (1997) Transposoninduced mutation in Gluconobacter oxydans with specialreference to its direct-glucose oxidation metabolism.Fems Microbiol Lett 147: 181±188.

Gurr, S.J., Unkles, S.E., and Kinghorn, J.R. (1987) The struc-ture and organization of nuclear genes for ®lamentousfungi. In: Gene Structure in Eukaryotic Microbes. Kinghorn,J.R. (ed.). Oxford: Academic press, pp. 93±139.

Hoover, K.K., Chien, A.J., and Corces, V.G. (1993) Effects oftransposable elements on the expression of the forkedgene of Drosophila melanogaster. Genetics 135: 507±526.

Johnstone, I.L., McCabe, P.C., Greaves, P., Gurr, S.J., Cole,G.E., Brow, M.A., et al. (1990) Isolation and characterisa-tion of the crnA-niiA-niaD gene cluster for nitrate assimila-tion in Aspergillus nidulans. Gene 90: 181±192.

Ketting, R.F., Fischer, S., and Plasterk, R.H. (1997) Targetchoice determinants of the Tc1 transposon of Caenorhab-ditis elegans. Nucleic Acids Res 25: 4041±4047.

Kidwell, M.G., and Lisch, D. (1997) Transposable elementsas sources of variation in animals and plants. Proc NatlAcad Sci USA 94: 7704±7711.

Kinsey, J.A., and Helber, J. (1989) Isolation of a transposableelement from Neurospora crassa. Proc Natl Acad Sci USA86: 1929±1933.

Koga, A., Inagaki, H., Bessho, Y., and Hori, H. (1995) Inser-tion of a novel transposable element in the tyrosinase geneis responsible for an albino mutation in the medaka ®sh,Oryzias latipes. Mol Gen Genet 249: 400±405.

Langin, T., Capy, P., and Daboussi, M.J. (1995) The transpo-sable element impala, a fungal member of the Tc1-marinersuperfamily. Mol Gen Genet 246: 19±28.

van Luenen, H., and Plasterk, R.H. (1994) Target site choice

of the related transposable elements Tc1 and Tc3 ofCaenorhabditis elegans. Nucleic Acids Res 22: 262±269.

Malardier, L., Daboussi, M.J., Julien, J., Roussel, F., Scaz-zocchio, C., and Brygoo, Y. (1989) Cloning of the nitratereductase gene (niaD ) of Aspergillus nidulans and its usefor transformation of Fusarium oxysporum. Gene 78:147±156.

Maniatis, T., Fritsch, E., and Sambrook, J. (1982) MolecularCloning: a Laboratory Manual. Cold Spring Harbor, NY:Cold Spring Harbor Laboratory Press.

McDonald, J.F. (1993) Evolution and consequences of trans-posable elements. Curr Opin Genet Dev 3: 855±864.

Migheli, Q., LaugeÂ, R., DavieÁre, J., Gerlinger, C., Kaper, F.,Langin, T., and Daboussi, M. (1999) Transposition of theautonomous Fot1 element in the ®lamentous fungus Fusar-ium oxysporum. Genetics (in press).

Ortiz, D.F., and Strommer, J.N. (1990) The Mu1 maize trans-posable element induces tissue-speci®c aberrant splicingand polyadenylation in two Adh1 mutants. Mol Cell Biol10: 2090±2095.

Pouteau, S., Spielmann, A., Meyer, C., Grandbastien, M.A.,and Caboche, M. (1991) Effects of Tnt1 tobacco retrotran-sposon insertion on target gene transcription. Mol GenGenet 228: 233±239.

Punt, P.J., Strauss, J., Smit, R., Kinghorn, J.R., van denHon-del, Ca., and Scazzocchio, C. (1995) The intergenic regionbetween the divergently transcribed niiA and niaD genes ofAspergillus nidulans contains multiple NirA binding siteswhich act bidirectionally. Mol Cell Biol 15: 5688±5699.

Roelants, F., Potier, S., de Souciet, J.L., and de Montigny, J.(1997) Delta sequence of Ty1 transposon can initiate tran-scription of the distal part of the URA2 gene complex inSaccharomyces cerevisiae. Fems Microbiol Lett 148:69±74.

Rudenko, G.N., Nijkamp, H.J., and Hille, J. (1994) Ds read-out transcription in transgenic tomato plants. Mol GenGenet 243: 426±433.

Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi,R., Horn, G.T., Mullis, K.B., and Erlich, H.A. (1988) Pri-mer-directed enzymatic ampli®cation of DNA with a thermo-stable DNA polymerase. Science 239: 487±491.

Sanger, F., Nicklen, S., and Coulson, A.R. (1977) DNA sequ-encing with chain-terminating inhibitors. Proc Natl Acad SciUSA 74: 5463±5467.

Smith, P., and Corces, V. (1991) Drosophila transposable ele-ments: mechanisms of mutagenesis and interactions withthe host genome. Adv Genet 29: 229±300.

Vasicek, T.J., Zeng, L., Guan, X.J., Zhang, T., Costantini, F.,and Tilghman, S.M. (1997) Two dominant mutations in themouse fused gene are the result of transposon insertions.Genetics 147: 777±786.

Walker, E.L., Eggleston, W.B., Demopulos, D., Kermicle, J.,and Dellaporta, S.L. (1997) Insertions of a novel class oftransposable elements with a strong target site preferenceat the r locus of maize. Genetics 146: 681±693.



Specific expression of the Fusarium transposon Fot1 and effects on target gene transcription

Documents

Transcript of Specific expression of the Fusarium transposon Fot1 and effects on target gene transcription