Bartonella-like bacteria carried by domestic mite species

Jan Kopecky • Marta Nesvorna • Jan Hubert

Received: 3 December 2013 / Accepted: 27 March 2014 / Published online: 8 April 2014� Springer International Publishing Switzerland 2014

Abstract Bacteria of the genus Bartonella are carried by haematophagous mites, ticks,

fleas and flies, and attack the erythrocytes of mammals. Here we describe a Bartonella-like

clade, a distinct group related to Bartonellaceae, in stored-product mites (Acari: Astigmata)

and a predatory mite Cheyletus eruditus (Acari: Prostigmata) based on the analysis of

cloned 16S rRNA gene sequences. By using the clade-specific primers, closely related

Bartonella-like 16S rRNA sequences were amplified from both laboratory colonies and

field strains of three synanthropic mite species (Acarus siro, Lepidoglyphus destructor and

Tyrophagus putrescentiae) and a predatory mite. Altogether, sequences of Bartonella-like

bacteria were found in 11 strains, but were not detected in Dermatophagoides farinae and

D. pteronyssinus and two strains of L. destructor. All obtained sequences formed a separate

cluster branching as a sister group to Bartonellaceae and related to other separate clusters

comprising uncultured bacterial clones from human skin and hemipteran insects (Nysius

plebeius and Nysius sp.). The classification of sequences into operational taxonomic units

(OTUs) showed a difference between A. siro and T. putrescentiae suggesting that the

Bartonella-like bacteria are different in these two mite species. However, species specific

sequences in separate OTUs were observed also for C. eruditus. Possible symbiotic

interactions between Bartonella-like bacteria and their mite hosts are discussed.

Keywords Bartonella � Cheyletus � Acarus � Dermatophagoides � Lepidoglyphus �Tyrophagus � Symbionts � 16S rRNA

Introduction

Bartonella is a gram-negative bacterial genus of the order Rhizobiales (Alphaproteobac-

teria). Its members are small (0.3–1 lm) coccobacilli of hemotropic lifestyle, characterized

J. Kopecky � M. Nesvorna � J. Hubert (&)Crop Research Institute, Drnovska 507, 161 06 Praha 6-Ruzyne, Czech Republice-mail: hubert@vurv.cz

123

Exp Appl Acarol (2014) 64:21–32DOI 10.1007/s10493-014-9811-1

by long-lasting intra-erythrocyte infection in mammalian hosts. Bartonella spp. are

transmitted by blood sucking arthropods (Kosoy et al. 2012) and also by animal scratches

and bites (Maguina et al. 2009). The best known vector of Bartonella species associated

with humans and ‘‘large mammals’’ are sand flies (Lutzomyia verrucarum) and other biting

flies, human lice (Pediculus humanus humanus), fleas (Ctenocephalides felis, Pulex irri-

tans), and ticks (Ixodes spp., Dermacentor spp., Rhipicephalus sanguineus, Haemaphysalis

spp.) (Tsai et al. 2011). Dermanyssus spp. mites were suggested as the vector of Bartonella

quintana causing trench fever in one case study (Melter et al. 2012). Other Bartonella

species, e.g. B. doshiae, B. tamiae and unidentified Bartonella spp. are associated to bats

and small rodents or insectivores (Tsai et al. 2011). Their vectors are mesostigmatid

(Steatonyssus spp., Ornithonyssus bacoti) and chigger mites (Leptotrombidium spp.,

Schoengastia spp., Blankarrtia spp.) (Reeves et al. 2006, 2007; Kabeya et al. 2010).

Billeter et al. (2008) reviewed arthropod transmitters of Bartonella and suggested a

group of ‘‘miscellaneous arthropods as potential or suspected vectors’’. The group included

house dust mites (Valerio et al. 2005) and honey bees (Apis mellifera capensis) (Jeyap-

rakash et al. 2003). 16S rRNA sequences of Bartonella have been described in the house

dust mites (Dermatophagoides farinae and D. pteronyssinus) used for immunomodulation

and the authors suggested such bacteria as dominant symbionts (Valerio et al. 2005). Our

recent analysis of bacterial 16S rRNA sequences cloned from mites (Acarus siro, D.

farinae, Lepidoglyphus destructor and Tyrophagus putrescentiae) confirmed the presence

of Bartonella-like bacteria in A. siro and T. putrescentiae, but not in D. farinae and L.

destructor (Hubert et al. 2012a). The cloned ‘‘Bartonella-like’’ 16S rRNA sequences were

related to Bartonellaceae, but formed a separate cluster close to sequences of symbiotic

bacteria in ants of the genus Tetraponera (Stoll et al. 2007).

Therefore, specific primers for 16S rRNA gene amplification from Bartonella-like

bacteria were designed to assess its spread among the Astigmata and their predators

Cheyletus eruditus (Prostigmata). Here we document the presence of Bartonella-like

bacteria in laboratory and wild populations of synanthropic (mostly domestic) mite species.

Materials and methods

Mites

The mite species included in the study were stored-product, house dust, and predatory

mites frequently occurring in human made habitats such as house dust and grain stores

(Table 1). The astigmatid mites were mass-reared in IWAKI tissue culture flasks with filter

cap plugs (P-Lab, Praha, Czech Republic). Different rearing diets were used. The stored-

product mite rearing diet (SPMd) was a mixture of oat flakes, wheat germ and Pangamin—

dried yeast extract (Rapeto, Bezdruzice, Czech Republic) (10:10:1 w/w). The house dust

mite rearing diet (HDMd) was composed of dog food, wheat germ, Aqua-tropic—dried fish

food, pangamin and gelatin (10:10:3:2:1 w/w). Both diets were ground up, sieved, and

heated to 70 �C for 30 min. The dog food was Friskies Junior dog food (Nestle-Purina, St.

Louis, MO, USA) The commercial diets were provided by Koppert (http://www.koppert.

com/) and differed in their composition among mite species. Approximately 50 mg of a

rearing diet was placed into each IWAKI chamber. The chambers were placed into Secodar

desiccators (P-Lab, Prague, Czech Republic) with saturated solution of KCl (85 % r.h.) or

NaCl (75 % r. h.) (Table 1) and kept at 25 ± 2 �C in darkness. From each culture, 50 mg

of mites were transferred to Eppendorf tubes using brush from the surface of the chamber

22 Exp Appl Acarol (2014) 64:21–32

123

or plug to avoid contamination by the rest of rearing diet. The samples were surface

sterilized (Hubert et al. 2012a) and homogenized.

The predatory mite C. eruditus was mass cultured in paper bags (7 9 10 cm) filled with

lettuce seeds according to the standardized protocol for CHEYLETINTM production

(Zdarkova 1986). Briefly, 10 specimens of predators and 1,000 individuals of A. siro were

added, resulting in an initial predator:prey ratio of 1/100. The rearing conditions were

75 % RH and 25 ± 2 �C in the dark. After 21 days, the seeds were sieved on an AS 240

Retsch digit sieve machine and predators were separated by a brush under dissection

microscope and transferred into 80 % ethanol. The field strains originated from the grain

debris samples incubated in controlled conditions the same way as previous strain. After

21–42 days the sample was extracted in Tullgren–Berlese funnels using bakers on ice. The

extraction time was 4–6 h. Cheyletus mites were immediately transferred with needles into

80 % ethanol using dissection microscope. From each sample, a microscopic slide was

Table 1 Samples of mite species and strains their origin, rearing conditions and number of obtainedsequences

Species Type Origin Rearing conditions No. ofsequences

Site and collector Samplingdate

Diet r.h.(%)

Acarus siro (L.) Lab. Grain, Bustehrad, CZ (EZdarkova col. 1996)

09/2010 SPMd 85 56

Field Rape seed debris, Zvoleneves, CZ(M. Nesvorna col. 2011)

10/2011 SPMd 85 33

Cheyletus eruditus(Schrank)

Lab. CHEYLETINTM strain 09/2011 A. siro 75 15

Field Grain debris, Nove Straseci, CZ(P. Horak col. 2011)

9/2011 A. siro 75 10

Field Grain debris, Rakovnik, CZ(P. Horak col. 2011)

9/2011 A. siro 75 14

Filed Grain debris, Slany, CZ (P. Horakcol. 2011)

9/2011 A. siro 75 13

Tyrophagusputrescentiae(Schrank)

Lab. Grain, Bustehrad, CZ (E.Zdarkova, col. 1996)

06/2010 SPMd 85 34

Com. Commercial strain Koppert 4/2013 Com.d. 85 33

Field Dog feed (J. Hubert col. 2007) 10/2011 Dogfeed

85 28

Lepidoglyphusdestructor(Schrank)

Lab. Food processing factory CZ(E. Zdarkova col. 1965)

06/2010 HDMd 85 11

Field Grain, Tuchomerice (col.R. Aulicky, 2011)

4/2013 HDMd 85 ND.

Com. Commercial strain Koppert 4/2013 Com.d. 85 ND.

Dermatophagoidesfarinae (Hughes)

Lab. Obtained from MedicalUniversity of Silesia, Poland(K. Solarz 2005)

06/2010 HDMd 75 ND.

Com. Commercial strain Alergeny 4/2013 HDMd 75 ND.

Dermatophagoidespteronyssinus(Trouessart)

Lab. Obtained from MedicalUniversity of Silesia, Poland(K. Solarz 2005)

06/2010 HDMd 75 ND.

Com. Commercial strain Alergeny 4/2013 HDMd 75 ND.

Com. D. commercial diet, HDMd house dust mite diet, SPMd stored product mite diet, ND not determined

Exp Appl Acarol (2014) 64:21–32 23

123

prepared for Cheyletus determination. The samples contained from 10 to 50 predatory

mites and were stored in 80 % ethanol.

Sample extraction

Before the DNA extraction, ethanol was replaced by PBST (phosphate buffered saline with

the detergent Tween� 20). PBST contained 3.2 mM Na2HPO4, 0.5 mM KH2PO4, 1.3 mM

KCl, 135 mM NaCl, 0.05 % Tween� 20. The sample was cleaned three times with PBST

using centrifugation to pellet the mites. The sample of a total volume 100 lL was

homogenized in Radnoti tissue grinder (cat No. 440613, Monrovia, Ca, USA). Total DNA

was extracted using Wizard� Genomic DNA Purification kit (Promega, Madison WI,

USA) according to manufacture’s instructions. The extracted DNA was stored in freezer at

-20 �C before the analyses.

PCR screening for Bartonella-like bacteria

Based on the alignment of Bartonella-like 16S rRNA gene sequences initially found in A.

siro and T. putrescentiae (Hubert et al. 2012a), the specific primers were designed

(Table 2). To exclude inhibition of PCR in extracted DNA, amplification of 16S rRNA

gene was performed with universal bacterial primers (UF: 50-GA-GTT-TGA-TYM-TGG-

C-30, position 8–23, and UR: 50-GYT-ACC-TTG-TTA-CGA-CTT-30, position

1,492–1,509) for all isolated DNA samples. Amplification was done on a C1000 Thermal

Cycler (Bio-Rad, Hercules, CA, USA). A total volume of 25 lL PCR reaction mixture

contained 200 lM dNTPs, 1.5 mM MgCl2; forward and reverse primers (100 nM each),

1.25 unit Taq polymerase (Top-Bio, Prague, Czech Republic) and from 50 to 300 ng

template DNA (including mite genomic DNA).

The resulting PCR products were purified with Wizard� SV Gel and PCR product

clean-up system Kit (Promega) and cloned using pGEM�-T Easy Vector system (Pro-

mega). Selected clones were sequenced by Macrogen (Seoul, Korea). Sequences were

assembled with CodonCode Aligner, version 1.5.2 (CodonCode Corporation, Dedham,

MA, USA) and assigned the bacterial taxonomy using the Ribosomal database project

naıve Bayesian rRNA classifier (Wang et al. 2007).

Table 2 Design of specific primers for Bartonella-like symbionts detection

Primer Sequence 50–30 Position(E. coli)

Tm(�C)

Specificity

Bart_1F TTTTAGGGTGAGCGGCA 82 62.3 Genus Bartonella

Bart_1R GCAGCACCTGTCTCCGAC 1,036 63.2 Bartonella-like clones only

Bart_2R TGTCTCCGACCCAGCCT 1,030 62.9 Genus Bartonella ? unspec.within order

Bart_3R TGCGCCACTGATAGGTAGAC 839 63.2 Bartonella-like clones only

r1492 TACGGYTACCTTGTTACGACTT 1,492 61.6 Bacteria

For PCR detection the following combinations were tested: (i) Bart 1F 9 Bart 1R; (ii) Bart 1F 9 Bart 2R;(iii) Bart 1F 9 R1492; (iv) Bart 1F 9 Bart 3R

24 Exp Appl Acarol (2014) 64:21–32

123

Bioinformatics and phylogenetical analysis

We constructed a library of the 16S rRNA gene fragments. In the first step we obtained 247

sequences and defined operational taxonomic units (OTU0.995) at distance level 0.005 using

Mothur v. 1.32.0 software (Schloss et al. 2009). For the OTU comparison, we used 693 bp

fragments, i.e. all sequences were truncated according to the shortest amplicon yielded by

primers Bart_1F/Bart_3R (positions 108–839 according to Escherichia coli). In the second

step we selected only the sequences obtained with primers Bart_1F/r1492 (positions

108–1,491 in E. coli) from T. putrescentiae and A. siro and completed the set with the full-

length Bartonella-like sequences available in GenBank from previous studies (Hubert et al.

2012a, b). The set comprising 166 sequences of 1,256–1,259 bp was subjected to OTU and

phylogenetic analyses.

Alignments of partial 16S rRNA gene sequences were performed using SILVA Incre-

mental Aligner v.1.2.11 (Pruesse et al. 2012). For analysis of phylogenetic relationships,

the best-fit model of nucleotide substitution was selected using jModelTest 2 software

(Darriba et al. 2012; Guindon and Gascuel 2003). Based on the selection, model GTR with

gamma distribution in four rate categories (?G) was employed to infer phylogeny by

Bayesian analysis using PhyloBayes-MPI, v.1.4e (Lartillot et al. 2009), and maximum-

likelihood analysis in PhyML v.3.0 (Guindon et al. 2010).

Microanatomical analyses of the gut of astigmatid mites

About 50 specimens of A. siro, L. destructor and T. putrescentiae were fixed in modified in

modified Bouin-Dubosque-Brazil fixation, transfer to paraffin, sectioned to 4–6 lm sec-

tions and the sections are stained by Masson‘s triple stain (Smrz 1989). For transmission

microscopy we used protocol described previously (Sobotnik et al. 2008). Briefly, the

mites were fixed in a mixture of 2 % glutaraldehyde and 2.5 % formaldehyde (Poly-

sciences, EM Grade) in 0.1 M phosphate buffer (pH 7.2) at laboratory temperature for

1 day. The mites were washed in 0.1 M PBS and postfixed in 2 % osmium tetroxide in

PBS for 2 h. Subsequent washing in distilled water and dehydration in 50 %, 75 % and

ethanol was followed by embedding into Spurr resin. Ultrathin sections were prepared on

Reichert Ultracut ultramicrotome. Ultrathin sections were stained with uranyl acetate and

lead citrate (standard recipe) and studied using Jeol 1010 and Jeol 1011 transmission

electron microscopes.

Results

The fragments of 16S rRNA sequences of high similarity to Bartonella were detected in

both field and laboratory strains of A. siro, T. putrescetiae and C. eruditus and a laboratory

strain of L. destructor. No positive match was found for commercial and field strains of

L. destructor and house dust mites (Table 1). In all samples of extracted DNA, the

amplification of 16S RNA gene fragment by universal bacterial primers was performed to

exclude adverse effect of PCR inhibitors. Altogether, 247 partial 16S rRNA gene

sequences (693–1,259 bp long) were retrieved including 177 unique sequences deposited

in GenBank under Acc. Nos. KJ635029–KJ635205.

Phylogenetic analysis of the cloned fragments was performed with a set of reference

sequences comprising 92 type strains of the related Rhizobiales families Bartonellaceae,

Exp Appl Acarol (2014) 64:21–32 25

123

Brucellaceae and Rhizobiaceae retrieved from the RDP project (Cole et al. 2009) and 234

closely matching uncultured clone sequences available from GenBank database (Fig. 1).

The analyzed Bartonella-like clone sequences were classified into 16 OTUs0.995

(Table 3). The most of OTUs0.995 were identified as unique, i.e. OTUs0.995 No. 4–16. The

most frequent OTU0.995 No. 1 was shared by all species and the next one No. 2 by A. siro,

T. putrescentiae and C. eruditus. In laboratory and field strains of A. siro, the OTU No. 1

sequences were prevailing, these sequences were also abundant in predatory mite C. er-

uditus and L. destructor. Differently, in all strains of T. putrescentiae the sequences of

OTU No. 2 prevailed, which were also present in the field strains of C. eruditus.

To confirm the differences of Bartonella-like sequences between A. siro and T.

putrescentiae we analyzed 166 sequence of 1,256–1,259 bp length. The analyzed

sequences formed 6 OTUs0.995, and the libraries from A. siro and T. putrescentiae were

formed from two different OTUs0.995 (Nos. 1 and 2) (Fig. 2). The libshuff analysis with

Cramer–von Mises test indicated significant differences between sequences in libraries

from A. siro and T. putrescentiae (dCXYScore = 0.000031; P = 0.0028) and sequences

from T. putrescentiae and A. siro (dCXYScore = 0.000017; P = 0.048).

The gut morphology of L. destructor and T. putrecentiae is similar to the situation

described in A. siro (Sobotnık et al. 2008). The midgut consists of ventriculus, paired caeca

are open laterally to the ventriculus (Fig. 3). The ventriculus continues to the colon and the

midgut followed as intercolon and postcolon. The differences between intercolon and

postcolon are hardly recognizable in paraffin sections. Postcolonal diverticula of A. siro

contained dark stained matter and microvilli (Fig. 3b). L. destructor and T. putrescentiae

had structure similar to postcolonal diverticula A. siro (Fig. 3c, d), but in the observed

sections they look empty.

The postcolonal diverticula of A. siro are inhabited by filamentous bacteria (Sobotnik

et al. 2008) (Fig. 4a). The bacteria are 3.6–4.8 lm long and 0.25–0.32 lm wide (Fig. 4b).

They were detected in every specimen. The bacteria were observed in ventriculus and

caeca of T. putrescentiae outside in food bolus (Fig. 4d, e). Their size 3–3.4 lm long and

0.2–0.24 lm wide was similar to those in A. siro. Such filamentous bacteria were not

observed in L. destructor. In L. destructor, coccoid bacteria were ingested and passed

through the gut in food boli. These bacteria showed hallo rings around the bacterial cells

indicating the exo-enzymatic activity (Fig. 4c).

Discussion

The Bartonella-like clones formed a distinct cluster related to Bartonellaceae and to other

separate clusters of uncultured bacterial clones from human skin (Grice et al. 2009; Kong

et al. 2012), midgut of Nysius plebeius and midgut and whole body of Nysius spp.

(Hemiptera: Lygaeidae) (Matsuura et al. 2012; Table 3). Another related uncultured cluster

was formed by symbionts of bees Apis andreniformis, Apis dorsata, A. mellifera capensis,

and bumble bees Bombus sonorous (Jeyaprakash et al. 2003; Martinson et al. 2011).

Martinson et al. (2011) suggested that A. mellifera gut hosted a bacterium related to the

genus Bartonella, with high similarity to symbiotic bacteria of ants (Russell et al. 2009).

Previously, we localized an abundant population of ‘‘symbiotic’’ bacteria in postcolonal

diverticula of A. siro in ultrastructure sections (Sobotnik et al. 2008). The open questions

are the postcolonal diverticula of T. putrescentiae and L. destructor. According to our

observation they were empty. However, T. putrescentiae has the bacterial community was

well developed in the mesodeum, inside of food bolus. No bacteria of similar size and

26 Exp Appl Acarol (2014) 64:21–32

123

shape were found in L. destructor. Without fluorescent in situ hybridization with specific

probe we are not able to confirm if the observed bacteria belong to Bartonella-like cluster.

The indirect indices are following: similar shape and size for the both species, where the

Sinorhizobium/Ensifer group

Brucellaceae

41 clones Apis andreniformis, Bombus sonorus, 23 cl. Apis dorsata (Martinson et al. 2011),2 cl. Apis mellifera capensis (Jeyaprakash et al. 2003)

Bartonella

JQ726809

JQ726808

JQ726804

JQ726800

JQ726793

JQ726787

GU272277

6 cl. Nysius sp. (Matsuura et al. 2012), 1 cl. rape phyllosphere

JF233144

JF233165

JF233103

JF221476

4 cl. human skin (Kong et al. 2012)

157 cl. human skin (Grice et al. 2009,Kong et al. 2012)

62 cl. Tyr-put, 1 cl. Aca-sir

4 cl. Tyr-put,97 cl. Aca-sir

0.02

51/88

71/83

100/80

100/96

100/100

100/100

100/100

100/92

100/87

100/-

100/98

96/69

100/89

100/90

Fig. 1 Phylogenetic relatedness of Bartonella-like bacteria in mites to the closest taxa and unculturedbacteria cloned from other habitats. A Bayesian phylogram calculated using GTR ?G nucleotidesubstitution model for alignment of 166 cloned Bartonella-like 16S rRNA sequences with those of 92 type-species of the closest taxa within Rhizobiales and 234 matching uncultured bacterial sequences retrievedfrom the GenBank database. The branch labels indicate Bayesian posterior probability and bootstrapconfidence value calculated from 1000 replicates in maximum-likelihood analysis. Branch lengthscorrespond to the mean posterior estimates of evolutionary distances (scale bar 0.02)

Exp Appl Acarol (2014) 64:21–32 27

123

Table 3 The distribution of Bartonella-like sequences in 247 sequences contain library from the observedmites, the sequences are classified to OTU0.995

OTU Species of mites

No. N A. siro T. putrescentiae L. destructor C. eruditus

Lab. Field Lab. Com. Field Lab. Lab. Field1NS Field2R Field3S

1 124 53 32 3 10 5 10 6 5

2 108 1 29 33 28 7 6 4

3 2 2

4 1 1

5 1 1

6 1 1

7 1 1

8 1 1

9 1 1

10 1 1

11 1 1

12 1 1

13 1 1

14 1 1

15 1 1

16 1 1

No.OTU

247 56 33 34 33 28 11 15 10 14 13

TypeOTU

16 4 2 4 1 1 2 5 1 4 5

Field1NS site Nove Straseci, Field2R site Rakovnik, Field3S site Slany

1 2 3 4OTU 5 6

A B

Fig. 2 The difference in Bartonella-like sequence libraries from Acarus siro (a) and Tyrophagusputrescentiae (b) based on operational taxonomic units (OTUs0.995). For the analysis, 166 sequences of1,256–1,259 bp length were used

28 Exp Appl Acarol (2014) 64:21–32

123

Bartonella-like bacteria were frequently detected in 16 S rRNA gene libraries and using

specific primers. The low number of identified sequences in L. destructor and their high

similarity to those obtained from A. siro may be explained by contaminations. The bacteria

were present only in laboratory strain, not in the field and commercial strain. We can not

exclude some contamination of the cultures by feces etc. If the bacteria are present in

digestive tract, they can be expected in the feces. The fact that we surface-sterilize the

A B

C D

ev

c

pc

c

pc

v

pc

fb

pc

c

Fig. 3 The histological section of the gut of observed astigmatid mites; a Acarus siro, b detail onpostcolonal diverticula of A. siro, c Lepidoglyphus destructor and d Tyrophagus putrescentiae; thepostcolonal diverticula are pointed by arrows. Scales ad—100 lm; bc—50 lm; Legends: e—esophagus,c—colon, fb—food bolus, pc—postcolon, v—ventriculus

Exp Appl Acarol (2014) 64:21–32 29

123

mites, does not prevent amplification of DNA of Bartonella-like bacteria potentially

attached to the surface of sterilized mites.

The genus Bartonella is characterized by highly conservative 16S rRNA gene which

complicates the taxonomical determination based on this feature (Kosoy et al. 2012). Here,

we found significant differences in Bartonella-like sequences between A. siro and T.

putrescentiae (Table 3; Fig. 2). It indicates the presence of specific Bartonella-like taxa in

these two species.

A

B

C

D

E

Fig. 4 The transmission section midgut of astigmatid mite; a Postolonal diverticula of Acarus siro containsbacteria, b detail view on filamentous bacteria in postcolonal diverticula of A. siro; c detail view on ingestedcoccoid bacteria of Lepidoglyphus destructor in the esophagus, arrows point to hallo rings; d total view ofmidgut of Tyrophagus putrescentiae with filamentous bacteria outside the food bolus; e detail of filamentousbacteria in T. putrescentiae. Scales a—5 lm; b—1 lm; c—200 nm; d—3 lm; e—300 nm

30 Exp Appl Acarol (2014) 64:21–32

123

Cheyletus eruditus is a predatory mite feeding on astigmatid mites and insects

(Zdarkova 1998) and the observed Bartonella-like bacteria might originate from the

astigmatid mite prey. It is illustrated by OTU No. 1 which was shared by the prey labo-

ratory strain of A. siro and the predatory mites (Table 3). In our analyses five OTU

categories were unique for C. eruditus and the numbers of sequences were low. The

suggestion is that these sequences might originate from the bacteria of other prey astig-

matid mites. We can not exclude the mistakes during sequencing due tot he low distance

level for OTU.

Bartonella-related bacteria showed symbiotic association with insects, mainly the ants.

It opens a question if the Bartonella-like bacteria are symbiotic in mites, too. The previous

reports discussed the associated bacteria interacting with the astigmatid mites (mainly T.

putrescentiae) and participating in digestive processes (Smrz 2003; Smrz et al. 1991; Smrz

and Trelova 1995; Smrz and Catska 1989, 2010; Hubert et al. 2012b). A further study is

necessary to characterize the interaction between Bartonella-like bacteria and mites.

Acknowledgement The work was supported by Czech Science Foundation, Grant No. GA525/09/1872.The authors are obligated to Jitka Stara for critical comments to manuscript, Zuzana Kucerova for Cheyletusidentification, Vaclav Stejskal and Radek Aulicky for Cheyletus samples.

References

Billeter SA, Levy MG, Chomel BB, Breitschwerdt EB (2008) Vector transmission of Bartonella specieswith emphasis on the potential for tick transmission. Med Vet Entomol 22:1–15

Cole JR, Wang Q, Cardenas E, Fish J, Chai B, Farris RJ, Kulam-Syed-Mohideen AS, McGarrell DM, MarshT, Garrity GM, Tiedje JM (2009) The ribosomal database project: improved alignments and new toolsfor rRNA analysis. Nucl Acids Res 37(Database issue):D141–D145

Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: more models, new heuristics and parallelcomputing. Nat Methods 9:772

Grice EA, Kong HH, Conlan S, Deming CB, Davis J, Young AC, NISC Comparative Sequencing Program,Bouffard GG, Blakesley RW, Murray PR, Green ED, Turner ML, Segre JA (2009) Topographical andtemporal diversity of the human skin microbiome. Science 324(5931):1190–1192

Guindon S, Gascuel O (2003) A simple, fast and accurate method to estimate large phylogenies by maxi-mum-likelihood. Syst Biol 52:696–704

Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms andmethods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. SystBiol 59:307–321

Hubert J, Kopecky J, Perotti MA, Nesvorna M, Braig HR, Sagova-Mareckova M, Macovei L, Zurek L(2012a) Detection and identification of species-specific bacteria associated with synanthropic mites.Microb Ecol 63:919–928

Hubert J, Nesvorna M, Sagova-Mareckova M, Kopecky J (2012b) Shift of bacterial community in synan-thropic mite Tyrophagus putrescentiae induced by Fusarium fungal diet. PLoS One 7:e48429

Jeyaprakash A, Hoy MA, Allsopp MH (2003) Bacterial diversity in worker adults of Apis mellifera capensisand Apis mellifera scutellata (Insecta: Hymenoptera) assessed using 16S rRNA sequences. J InvertebrPathol 84:96–103

Kabeya H, Colborn JM, Bai Y, Lerdthusnee K, Richardson JH, Maruyama S, Kosoy MY (2010) Detectionof Bartonella tamiae DNA in ectoparasites from rodents in Thailand and their sequence similarity withbacterial cultures from Thai patients. Vector Borne Zoonotic Dis 10:429–434

Kong HH, Oh J, Deming C, Conlan S, Grice EA, Beatson MA, Nomicos E, Polley EC, Komarow HD, NISCComparative Sequence Program, Murray PR, Turner ML, Segre JA (2012) Temporal shifts in the skinmicrobiome associated with disease flares and treatment in children with atopic dermatitis. GenomeRes 22:850–859

Kosoy M, Hayman DT, Chan KS (2012) Bartonella bacteria in nature: where does population variability endand a species start? Infect Genet Evol 12:894–904

Lartillot N, Lepage T, Blanquart S (2009) PhyloBayes 3: a Bayesian software package for phylogeneticreconstruction and molecular dating. Bioinformatics 25:2286–2288

Exp Appl Acarol (2014) 64:21–32 31

123

Maguina C, Guerra H, Ventosilla P (2009) Bartonellosis. Clin Dermatol 27:271–280Martinson VG, Danforth BN, Minckley RL, Rueppell O, Tingek S, Moran NA (2011) A simple and

distinctive microbiota associated with honey bees and bumble bees. Mol Ecol 20:619–628Matsuura Y, Kikuchi Y, Meng XY, Koga R, Fukatsu T (2012) Novel clade of alphaproteobacterial en-

dosymbionts associated with stinkbugs and other arthropods. Appl Environ Microbiol 78:4149–4156Melter O, Arvand M, Votypka J, Hulınska D (2012) Bartonella quintana transmission from mite to family

with high socioeconomic status. Emerg Infect Dis 18:163–165Pruesse E, Peplies J, Glockner FO (2012) SINA: accurate high-throughput multiple sequence alignment of

ribosomal RNA genes. Bioinformatics 28:1823–1829Reeves WK, Dowling AP, Dasch GA (2006) Rickettsial agents from parasitic Dermanyssoidea (Acari:

Mesostigmata). Exp Appl Acarol 38:181–188Reeves WK, Loftis AD, Szumlas DE, Abbassy MM, Helmy IM, Hanafi HA, Dasch GA (2007) Rickettsial

pathogens in the tropical rat mite Ornithonyssus bacoti (Acari: Macronyssidae) from Egyptian rats(Rattus spp.). Exp Appl Acarol 41:101–107

Russell JA, Moreau CS, Goldman-Huertas B, Fujiwara M, Lohman DJ, Pierce NE (2009) Bacterial gutsymbionts are tightly linked with the evolution of herbivory in ants. Proc Natl Acad Sci USA106:21236–22141

Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, Lesniewski RA, Oakley BB, ParksDH, Robinson CJ, Sahl JW, Stres B, Thallinger GG, Van Horn DJ, Weber CF (2009) Introducingmothur: open-source, platform-independent, community-supported software for describing and com-paring microbial communities. Appl Environ Microbiol 75:7537–7541

Smrz J (2003) Microanatomical and biological aspects of bacterial association in Tyrophagus putrescentiae(Acari: Acaridida). Exp Appl Acarol 31:105–113

Smrz J (1989) Internal anatomy of Hypochthonius rufulus (Acari: Oribatida). J Morphol 200:215–230Smrz J, Catska V (1989) The effect of the consumption of some soil fungi on the internal microanatomy of

the mite Tyrophagus putrescentiae (Schrank) (Acari: Acaridida). Acta Univ Carol-Biol 33:81–93Smrz J, Catska V (2010) Mycopahgous mites and their internal associated bacteria cooperate to digest chitin

in the soil. Symbiosis 52:33–40Smrz J, Trelova M (1995) The associations of bacteria and some soil mites (Acari: Oribatida and Acaridida).

Acta Zool Fenn 196:120–123Smrz J, Svobodova J, Catska V (1991) Synergetic participation of Tyrophagus putrescentiae (Schrank)

(Acari: Acaridida) and its associated bacteria on the destruction of some soil micromycetes. J ApplEntomol 11:206–210

Sobotnik J, Alberti G, Weyda F, Hubert J (2008) Ultrastructure of the digestive tract in Acarus siro (Acari:Acaridida). J Morphol 269:54–71

Stoll S, Gadau J, Gross J, Feldhaar H (2007) Bacterial microbiota associated with ants of the genusTetraponera. Biol J Linnean Soc 90:399–412

Tsai YL, Chang CC, Chuang ST, Chomel BB (2011) Bartonella species and their ectoparasites: selectivehost adaptation or strain selection between the vector and the mammalian host? Comp ImmunolMicrobiol Infect Dis 34:299–314

Valerio CR, Murray P, Arlian LG, Slater JE (2005) Bacterial 16S ribosomal DNA in house dust mitecultures. J Allergy Clin Immunol 116:1296–1300

Wang Q, Garrity GM, Tiedje JM, Cole JR (2007) Naıve Bayesian classifier for rapid assignment of rRNAsequences into the new bacterial taxonomy. Appl Environ Microbiol 73:5261–5267

Zdarkova E (1986) Mass rearing of the predator Cheyletus eruditus (Schrank) (Acarina: Cheyletidae) forbiological control of acarid mites infesting stored products. Crop Prot Sci 5:122–124

Zdarkova E (1998) Biological control of storage mites by Cheyletus eruditus. Integr Pest Manag Rev3:111–116

32 Exp Appl Acarol (2014) 64:21–32

123