PAIN�

153 (2012) 553–561

w w w . e l s e v i e r . c o m / l o c a t e / p a i n

Paclitaxel therapy potentiates cold hyperalgesia in streptozotocin-induceddiabetic rats through enhanced mitochondrial reactive oxygen speciesproduction and TRPA1 sensitization

David André Barrière a,b,⇑, Jennifer Rieusset c,d,e, Didier Chanteranne a,b, Jérôme Busserolles a,b,Marie-Agnès Chauvin c,d,e, Laëtitia Chapuis a,b, Jérôme Salles f,g, Claude Dubray a,b,h,1, Béatrice Morio f,g,1

a Pharmacologie Fondamentale et Clinique de la Douleur, Clermont Université, Université d’Auvergne, BP 10448, F-63000 Clermont-Ferrand, Franceb U766, INSERM [National Institute of Health and Medical Research], F-63000 Clermont-Ferrand, Francec U870, IFR62, INSERM, Oullins, Franced UMR1235, INRA [National Institute for Agricultural Research], Oullins, Francee Université Lyon 1, Lyon, Francef UMR1019 Nutrition Humaine, INRA, CRNH Auvergne, F-63000 Clermont-Ferrand, Franceg UMR1019 Nutrition Humaine, Clermont Université, Université d’Auvergne, F-63000 Clermont-Ferrand, Franceh U766, CIC 501, INSERM, F-63001 Clermont-Ferrand, France

Sponsorships or competing interests that may be relevant to content are disclosed at the end of this article.

a r t i c l e i n f o

Article history:Received 27 July 2011Received in revised form 16 November 2011Accepted 16 November 2011

Keywords:Diabetes mellitusPaclitaxelMitochondrial functioningSensory nervesOxidative stressCold hyperalgesiaNeuropathic pain

0304-3959/$36.00 � 2011 International Associationdoi:10.1016/j.pain.2011.11.019

⇑ Corresponding author. Address: Laboratoire de PhClinique de la Douleur, 24 place Henri Dunant, F-630Tel.: +33 473 178 230; fax: +33 473 274 621.

E-mail address: david.barriere@u-clermont1.fr (D.A1 These authors contributed equally to this work.

a b s t r a c t

Diabetes comorbidities include disabling peripheral neuropathy (DPN) and an increased risk of develop-ing cancer. Antimitotic drugs, such as paclitaxel, are well known to facilitate the occurrence of peripheralneuropathy. Practitioners frequently observe the development or co-occurrence of enhanced DPN, espe-cially cold sensitivity, in diabetic patients during chemotherapy. Preclinical studies showed that reactiveoxygen species (ROS) and cold activate transient receptor potential ankyrin-1 (TRPA1) cation channels,which are involved in cold-evoked pain transduction signaling in DPN. Additionally, paclitaxel treatmenthas been associated with an accumulation of atypical mitochondria in the sensory nerves of rats. Wehypothesized that paclitaxel might potentiate cold hyperalgesia by increasing mitochondrial injuriesand TRPA1 activation. Thus, the kinetics of paclitaxel-induced cold hyperalgesia, mitochondrial ROS pro-duction, and TRPA1 expression were evaluated in dorsal root ganglia of normoglycemic and streptozoto-cin-induced diabetic rats. In diabetic rats, paclitaxel significantly enhanced cold hyperalgesia incomparison to normoglycemic paclitaxel-treated control rats. These effects were prevented by N-acetyl-cysteine, a reducing agent, and by HC030031, an antagonist of TRPA1. In diabetic and control rats,paclitaxel treatment was associated with an accumulation of atypical mitochondria and a 2-fold increasein mitochondrial ROS production. Moreover, mRNA levels of glutathione peroxidase 4 and glutathione-S-reductase were significantly lower in diabetic groups treated with paclitaxel. Finally, TRPA1 gene expres-sion was enhanced by 45% in diabetic rats. Paclitaxel potentiation of cold hyperalgesia in diabetes mayresult from the combination of increased mitochondrial ROS production and poor radical detoxificationinduced by paclitaxel treatment and diabetes-related overexpression of TRPA1.

� 2011 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

1. Introduction

Type 1 and type 2 diabetes are characterized by chronic hyper-glycemia, which can lead to the development of diabetic peripheralneuropathy (DPN). Clinically, DPN causes significant pain, suffer-

for the Study of Pain. Published by

armacologie Fondamentale et00 Clermont-Ferrand, France.

. Barrière).

ing, and disability [36]. It leads to several sensitivity dysfunctionsthat strongly impact the patient’s quality of life. Anticancer treat-ments such as paclitaxel (Taxol; Bristol-Myers Squibb, New York,NY, USA) are known to induce similar neuropathies, which is themain reason for either changing or stopping chemotherapy. Inthese conditions, patients usually complain of numbness, tingling,and burning pains that generally disappear within months follow-ing paclitaxel treatment, however, in some cases, sensory abnor-malities and pain can become chronic [11,28]. Currently, theprogression of obesity, metabolic syndrome, and hyperglycemia

Elsevier B.V. All rights reserved.

554 D.A. Barrière et al. / PAIN�

153 (2012) 553–561

have been related to increased risks of developing colorectal,breast, or pancreatic cancers [25], and clinicians are treating anincreasing number of patients for cancer with abnormal glucosehomeostasis using neurotoxic drugs.

Preclinical studies have reported the contribution of oxidativestress in DPN, and several pathways have been highlighted, includ-ing enhanced aldose reductase activity [40], increased nicotin-amide adenine dinucleotide phosphate-oxidase (NADPH) activity[38], prostanoid imbalance [16,29], and overproduction of reactiveoxygen species (ROS) [5,26]. Clinically diabetic neuropathy hasbeen described to modify cold-detection thresholds, and theseimpairments of cold detection have been correlated with an en-hanced neuropathy [19,30]. Therefore, assessment of cold sensitiv-ity could be critical for evaluating peripheral neuropathy.

Low doses of paclitaxel can induce peripheral neuropathy andnotably, occurrence of cold hypersensitivity has been reported inseveral preclinical studies [6,28,35]. Interestingly, an accumulationof atypical mitochondria has been evidenced in sensory afferent ax-ons of saphenous nerve in response to paclitaxel treatment, and hasbeen correlated with the level of neuropathic injury [11,15]. Suchmitochondrial injuries suggest a direct impact of paclitaxel on mito-chondrial ontogenesis and function. Paclitaxel-mediated ROS pro-duction has been well established in a HeLa cell-line model andneuronal cortical cell cultures containing both neurons and astroglia[14,18,20]. The pivotal role of ROS in neuronal injuries has been fur-ther demonstrated by the beneficial impact of N-acetyl-cysteine(NAC) antioxidant therapy in the treatment of both diabetic- andpaclitaxel-induced neuropathies in rats and in humans [21,31].

The crucial molecular link between cold hypersensitivity andoxidative stress could be found in recent reports that have high-lighted the involvement of transient receptor potential channels(TRPs), particularly TRP ankyrin-1 (TRPA1) in noxious cold detec-tion and in the detection of oxidative stress products [7,9,12]. In-deed, TRPA1 channels may be activated by hydrogen peroxide [9]produced, in particular, by mitochondria during oxidative stressprocesses [2].

Therefore, in this study, we used the well-described short-termstreptozotocin-induced diabetes model, which has been shown tocause rapid and reproducible type I diabetes associated with theappearance of peripheral neuropathy [8,27,32,34] for (1) evaluat-ing the kinetics of paclitaxel-induced cold hyperalgesia in diabeticvs control rats, (2) measuring the mitochondrial ROS production inthese groups, and (3) exploring the involvement of TRPA1 in thedevelopment of cold hyperalgesia.

2. Research design and methods

2.1. Animals

Adult male Sprague–Dawley rats (250–300 g, Charles River,Lyon, France) were housed in groups of 4 in plastic cages filed withsawdust bedding. Artificial lighting was provided on a fixed 12-hour light/dark cycle with food and water provided ad libitum. Thisstudy was approved by the local ethics committee (number N�CE3-06, modified), and was conducted in accordance with the Guide-lines for Animal Research by the International Association for theStudy of Pain.

2.2. Drug administration

2.2.1. Experiment 1Diabetes was induced by an intraperitoneal (i.p.) injection of

streptozotocin (Stz; 52.5 mg/kg) (Zanosar; Upjohn, Saint-Quentin-en-Yvelines, France) dissolved in distilled water. Animals that didnot develop hyperglycemia after Stz injection have been excludedfrom the study. A Vehicle group was generated by an i.p. injection

of distilled water administrated simultaneously. Diabetes was con-firmed 21 days later (D0) by the measurement of glycemia withglucotide and a reflectance colorimeter (Glucometer 4; Bayer Diag-nostics, Puteaux, France). Stz-treated rats displaying a final bloodglucose level above 2 g L�1 were included in the study. At this time,16 animals were normoglycemic and 24 were hyperglycemic. Thenormoglycemic population was subdivided into 2 equivalent groups(n = 8) that received an i.p. injection of either dimethyl sulfoxide(DMSO; solvent) or 1 mg kg�1 mL�1 paclitaxel (Sigma–Aldrich,Lyon, France) at day D0, D2, D4, and D7. The behavioral test was per-formed 21 days after Stz injection, on the day of the first paclitaxelinjection (D0) and on day 10 (D10) and day 14 (D14) after paclitaxelinjection. The hyperglycemic population was subdivided into 3groups (n = 8); the first group received DMSO, the second group re-ceived paclitaxel in a similar fashion to those used in the normogly-cemic population, and the last group received both paclitaxel and adaily i.p. injection of NAC (10 mg kg�1 mL�1; Sigma–Aldrich). Thebehavioral test was performed at days D0, D10, and D14. Weightgain and glycemia was assessed every 2 days (mornings) from Stzinjection, in order to evaluate the impact of diabetes and/or paclit-axel chemotherapy on the clinical status of each animal. Only resultscorresponding to D0, D10, and D14 are presented.

2.2.2. Experiment 2In this experiment, a diabetic population (n = 32) was generated

as previously described and subdivided into 4 groups; 2 groups re-ceived an i.p. injection of 1 mg kg�1 mL�1 paclitaxel (n = 16) and 2groups received DMSO as a vehicle (n = 16) at days D0, D2, D4, andD7. At D14, TRPA1 channels were blocked by a specific antagonist,HC030031, administrated i.p. (100 mg kg�1 mL�1, Tocris Biosci-ence, Bristol, UK) (n = 8 for each population), or its vehicle (DMSO,n = 8 for each population). The behavioral test was performed be-fore HC030031 administration and 15, 30, 45, and 60 minutes afterHC030031 administration.

2.3. Intraperitoneal glucose tolerance test

At the end of the experiments, the animals from experiment 1were fasted for 15 hours and transferred to new cages with wateravailable ad libitum but no food. The animals were weighed, thetails were nicked horizontally at the tip with a razor blade, and50 lL of blood was gently withdrawn from the tail and transferredto an Eppendorf tube, which was immediately placed on ice. Wethen performed an i.p. injection of 2 g kg�1 mL�1 50% D-glucose(Aguettant Laboratories, Lyon, France). One hundred twenty min-utes later, 50 lL of blood was gently massaged from the tail andtransferred to a second Eppendorf tube. Glycemia was measuredfrom these samples using glucotide and a reflectance colorimeter(Glucometer 4). Insulinemia levels were measured on collectedserum using a rat/mouse insulin enzyme-linked immunosorbentassay 96-well strip plate (Millipore, Molsheim, France).

2.4. Cold hyperalgesia assessment

Blind experiments were performed by 2 independent manipula-tors. Animals were randomized to avoid chronobiological effectsand to assess the effect of different treatments under similar envi-ronmental conditions (n = 8). Rat hind paws were immersed in awater bath maintained at 4�C until paw withdrawal or the obser-vation of struggle signs (cut-off time, 15 seconds). Because this testrequires animal manipulation, rats were first handled in the testingenvironment 1 day before the experiment until they sat quietly inthe experimenter’s hand for 15 seconds (which corresponds to thecut-off time). This was repeated 2–3 times, depending on the rat’sability to be quiet. On the day of the experiment, rats were handledagain for 15 seconds above the immersion water bath. The hind

D.A. Barrière et al. / PAIN�

153 (2012) 553–561 555

paws of the rats were then immersed in water. The reaction time(i.e., the time required to observe paw withdrawal from the bath)was measured 2–3 times, with an interval of at least 15 minutesbetween the 2 measures, to obtain 2 consecutive values that dif-fered by no more than 10%. After the test, the hind paws of the ratswere immediately dried with soft cellulose paper to avoid pawcooling between the 2 measures. A shortening of the immersionduration was considered to reflect hyperalgesia. Results were ex-pressed as a percentage (%) to avoid an effect of the manipulator,using the following formula:

Cold threshold ð%Þ ¼ ðanimal value=mean of the vehicle groupÞ� 100:

These measurements were performed in all groups at D0, D10, andD14 for paclitaxel or vehicle treatment.

TRPA1 inhibition by HC030031 administration was performedin similar conditions at D14. For this experiment, rats were admin-istered 100 mg kg�1 mL�1 of HC030031 or vehicle (DMSO) i.p.Three baseline stimulations were applied as previously describedto validate cold thresholds and repeated 15, 30, 45, and 60 minutesafter injection.

2.5. Electron microscopy

Assessment of mitochondria morphology was performed byelectron microscopy. At D14, one animal from each group was sac-rificed by decapitation, then dorsal root ganglia (DRG) (L4) and sci-atic nerve were freshly removed and fixed overnight at 4�C in 1.6%glutaraldehyde diluted in cacodylate buffer (0.2 M, pH 7.4). Fixedsamples were washed in cacodylate buffer, postfixed for 2 hoursat 4�C in buffered osmium tetroxide, dehydrated, and embeddedin Epon Araldite (Sigma Aldrich, France). Ultra-thin sections(70 nm) were cut with an ultramicrotome (UC6, Leica, Nanterre,France) and mounted onto copper grids. The sections were thenstained with uranyl acetate and lead citrate, observed with a Hit-achi H-7650 transmission electron microscope (Hitachi, Elexience,Verrières-le-Buisson, France) and photographed with a CCD AMTHR camera (10241024 pixels; Hamamatsu, Massy, France).

2.6. Complex I activity

Complex I activity was assessed at D14 from lumbar DRG (L3-L6). Complex I activity was performed with Complex I EnzymeActivity Dipstick Assay Kit (MitoSciences, Eugene, OR, USA). Briefly,Complex I was immunocaptured and immunoprecipitated in activeform on the dipstick. Secondly, the dipstick was immersed in Com-plex I activity buffer solution containing nicotinamide adeninedinucleotide (NADH) as a substrate and nitrotetrazolium blue asthe electron acceptor. Immunocaptured Complex I oxidizes NADH,and the resulting H+ reduces nitrotetrazolium blue to form a blue-purple precipitate at the Complex I line on the dipstick. The signalintensity of this precipitate corresponds to the level of Complex Ienzyme activity in the sample. The signal intensity is analyzedby a standard imaging system.

2.7. H2O2 production assay

ROS production was measured by fluorescence using an AmplexRed probe (Life Technologies, Carlsbad, CA, USA) in the presence ofhorseradish peroxidase (spectrofluorometer: SAFAS FLX-Xenius,Monaco). At D14, fresh DRG (L3–L6) were crushed with a potterin 1% bovine serum albumin Mannitol (225 mM) / Sucrose(75 mM) / Hepes (10 mM) / Bovine serum albumine (1%) [3]. Cho-lesterol-rich plasma membranes and myelin denaturation was

performed using digitonin (1/500) to improve the yield of mito-chondrial extraction (adapted from [24,33]). Thereafter, mitochon-drial-enriched fractions were separated by differentialcentrifugations at 4000 rpm (1�) and at 9800 rpm (3�). Final mito-chondrial-enriched pellets were conserved in sucrose–BSA buffer(300 mM). Protein concentrations were assayed on microtiterplates with BSA correction (Micro BSA protein assay kit, Pierce,Brebières, France). Mitochondrial ROS production by Complex 1was assessed as described by Batandier [3]. Briefly, mitochondria(0.25 mg/mL) were incubated for 30 minutes at 37�C with malate(2 mM) and glutamate (5 mM) substrates in the presence of rote-none (5 lM) to enhance Complex 1 ROS production. In these con-ditions, addition of rotenone has 2 potential effects at the level ofcomplex 1: increase ROS production linked to the forward fluxand decrease that linked to the reverse electron flux. Hence, ROSproduction from complex 1 is magnified and the signal/noise ratiois improved [3]. ROS production, corrected for background, wascalculated using the truncated area under the curve method.

2.8. Real-time quantitative RT-PCR analysis

Total RNA was extracted at D14 from L3–L6 DRG with TRIzolReagent (Invitrogen, Villebon sur Yvette, France). The level of tar-geted mRNAs was measured by retro-transcription followed byreal-time polymerase chain reaction (PCR) (realplex, Eppendorf,Paris, France). A standard curve was systematically generated with8 different amounts of purified targeted cDNA, and each assay wasperformed in triplicate. Briefly, following extraction and quantifi-cation steps, first-strand cDNA was synthesized from 1 lg totalRNA in the presence of 100 U Superscript II (Invitrogen) using ran-dom hexamers (500 lg/mL), oligo(dT) primers (500 lg/mL) (Invit-rogen, France), First Strand Buffer (Invitrogen, France) 5� and0.1 M Dithiothreitol (DTT) quantum satis in 20 lL distilled water.Real-time reverse transcription (RT)-PCR was performed in a finalvolume of 6.3 lL containing 1.3 lL of RT reaction medium at a60-fold dilution, 5 lL reaction buffer from the FastStart DNA Mas-ter SYBR Green kit (Roche, Boulogne-Billancourt, France), 25 lMMgCl2, and 20 lM specific forward and reverse primers (Invitro-gen, France). The primers used were as follows: hypoxanthinephosphoribosyl transferase (HPRT); (NM_012583.2), forward:AGTTGAGAGATCATCTCCAC, reverse: TTGCTGACCTGCTGGATTAC;Nav1.9; (NM_019265.2), forward: GCTTGGAGGACAGTGA-CATTTCTT, reverse: CCAGCCTGAGGATTCGACCAA [4]; TRPA1;(NM_207608.1), forward: CGTCCTCCTGAATTTCCAAG, reverse:TGCCAACTCATTCCTGAACA; glutathione-S-reductase (GSR);(NM_053906.2), forward: GGGCAAAGAAGATTCCAGGTT, reverse:GGACGGCTTCAT CTTCAGTGA [37] and glutathione peroxidase 4(GPX4); (NM_017165.2), forward: AACGTGGCCTCGCAATGA, re-verse: GGGAAGGCCAGGATTCGTAA [37].

The housekeeping gene HPRT has been demonstrated by previ-ous studies to be suitable as a reference gene [1,10,22,23]. Moreover,amounts of HPRT transcript have not been statistically modified bydiabetes mellitus or paclitaxel treatment in our study (not shown).Hence, HPRT gene has been used as a reference gene in this study.

2.9. Statistical analysis

Data were analyzed using SigmaStat Statistical Software version2.0 (Systat Software Inc, Chicago, IL, USA) and presented as mean-s ± SEM. Weight, glycemia, and behavioral data were analyzedusing 2-way repeated-measures analysis of variance (ANOVA,one factor) followed by Bonferroni multiple pairwise comparisons.Insulinemia, glycemia, Complex I, H2O2 measurements, and qPCRassays were analyzed using one-way ANOVA followed by Bonfer-roni multiple comparisons between treatments. When normalitytests failed (H2O2 assays and quantitative RT-PCR), Kruskal–Wallis

Fig. 2. Insulinemia and glycemia response to intraperitoneal (i.p.) glucose tolerancetest in normoglycemic and diabetic rats after paclitaxel chemotherapy. (A)Insulinemia values 2 hours after i.p. injection of 2 g kg�1 mL�1 of glucose in

556 D.A. Barrière et al. / PAIN�

153 (2012) 553–561

one-way ANOVA followed by multiple comparisons using the Dun-nett post hoc test was performed. The level of significance was setat P < 0.05.

3. Results

3.1. Paclitaxel chemotherapy does not alter body weight or glucosehomeostasis in normoglycemic and diabetic animals

Three weeks after Stz injection, the body weight of diabetic ratswas significantly lower than vehicle-treated animals (185 ± 8 vs310 ± 3 g, respectively, P < 0.001, Fig. 1A), whereas glycemia levelswere 3.6-fold higher (4.65 ± 0.39 vs 1.30 ± 0.04 g L�1, respectively,P < 0.001, Fig. 1B). During the i.p. glucose tolerance test, glycemia2 hours after glucose injection was 4.2-fold higher in diabetic ratscompared to vehicle-treated animals (2.4 ± 0.2 vs 0.57 ± 0.02 g L�1,P < 0.01, Fig. 2A), whereas insulinemia was 50% lower in diabeticrats than vehicle-treated controls (3.63 ± 0.02 vs 7.39 ± 0.1 ng L�1,P < 0.01, Fig. 2B). Paclitaxel treatment had no additional effectson body weight (Fig. 1A), glycemia (Fig. 1B), or i.p. glucose toler-ance test responses (Fig. 2) either in control or diabetic groups(P = ns). Thus, paclitaxel chemotherapy did not induce changes inglucose homeostasis in either the normoglycemic population orthe diabetic population.

3.2. Paclitaxel chemotherapy induces an earlier onset of coldhyperalgesia in diabetic animals compared to vehicle-treated animals

At D10, paclitaxel treatment reduced the paw withdrawal coldthreshold in both normoglycemic (73.0 ± 4.9 vs 100.0 ± 5.4%,P < 0.01, Fig. 3) and diabetic (50.0 ± 2.1 vs 100.0 ± 5.4%, P < 0.01,Fig. 3) rats compared to normoglycemic, vehicle-treated animals.Interestingly, at D10, the effect of paclitaxel treatment was

Fig. 1. Experiment 1: Weight and glycemic status of normoglycemic and diabeticrats after paclitaxel chemotherapy. (A) Ponderal follow-up of normoglycemic(Vehicle and PAC) and diabetic rats (DM, DM PAC, and DM PAC NAC) rats at D0, D10,and D14 following treatment with paclitaxel; paclitaxel was administered 21 daysafter Stz injection (n = 7–8 animals per group). (B) Glycemic follow-up of normo-glycemic and diabetic rats at D0, D10, and D14 (n = 7–8 animals per group).P > 0.05; ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001; vs Vehicle group. Data were analyzedwith a 2-way repeated measures analysis of variance with post hoc pairwisemultiple comparison Bonferroni t-test. F = 4.46 (A) and F = 2.27 (B). PAC, paclitaxel;DM, diabetes mellitus; DM PAC, diabetes mellitus and paclitaxel chemotherapy;DM PAC NAC, diabetes mellitus and paclitaxel chemotherapy treated with N-acetyl-cysteine; Stz, streptozotocin.

normoglycemic and diabetic rats at D14 (n = 4–5 animals per group). (B) Glycemiavalues 2 hours after i.p. injection of 2 g kg�1 mL�1 50% glucose in normoglycemicand diabetic rats at D14 (n = 4–5 animals per group). P > 0.05; ⁄ P < 0.05; ⁄⁄P < 0.01;⁄⁄⁄P < 0.001; vs Vehicle group. One-way analysis of variance with multiplecomparison Bonferroni t-test. PAC, paclitaxel; DM, diabetes mellitus; DM PAC,diabetes mellitus and paclitaxel chemotherapy; DM PAC NAC, diabetes mellitus andpaclitaxel chemotherapy treated with N-acetyl-cysteine.

significantly higher in diabetic rats than in normoglycemic rats(50.0 ± 2.1 vs 73.0 ± 4.9%, P < 0.05). Similar results were observedat D14 (52.1 ± 3.8 vs 71.3 ± 4%, P < 0.05) after paclitaxel treatment(Fig. 3). These data indicate that diabetic rats were more sensitiveto noxious cold after paclitaxel chemotherapy compared to normo-glycemic rats, suggesting potentiation of neuropathic pain by thecombination of diabetes and paclitaxel.

3.3. N-acetyl cysteine (NAC) treatment prevents cold hyperalgesiadevelopment in diabetic animals treated with paclitaxel

As shown in Fig. 3, in the diabetic population, paclitaxel-medi-ated cold hyperalgesia was abolished by daily injections of NAC(NAC-treated diabetic rats vs diabetic paclitaxel-treated rats,78.8 ± 6.6 vs 52.1 ± 3.8%, P < 0.01 at D14). The restoration of thecold threshold in paclitaxel-treated diabetic rats indicates that pro-phylactic antioxidant therapy was efficient in our model.

3.4. Paclitaxel induces a proliferation of atypical mitochondria in bothsensory neuron cell bodies and peripheral nerves

We evaluated the presence of atypical mitochondria in DRGneuronal cell bodies and in peripheral nerves (sciatic nerve) atD14. According to Flatters and Bennett, atypical mitochondria pos-sess a complete double membrane corresponding to ‘‘swollen andvacuolated mitochondria’’ [11]. In vehicle-treated rats (Fig. 4A),

Fig. 3. Experiment 1: Behavioral time-course of cold hyperalgesia (4�C) in normoglycemic and diabetic rats after paclitaxel chemotherapy. N-acetyl-cysteine adjuvanttherapy counteracted hyperalgesia induced by paclitaxel in a diabetic model. Graphs show the maximal percentage effect (MPE) ± SEM of cold stimulation in paw immersiontest at D0, D10, and D14 following paclitaxel administration; paclitaxel was administered 21 days after Stz injection (n = 7–8 animals per group). P > 0.05; ⁄P < 0.05;⁄⁄P < 0.01; ⁄⁄⁄P < 0.001; vs Vehicle group and between PAC and DM PAC. Two-way repeated measures analysis of variance with post hoc pairwise multiple comparisonBonferroni t-test, F = 2.68. PAC, paclitaxel; DM, diabetes mellitus; DM PAC, diabetes mellitus and paclitaxel chemotherapy; DM PAC NAC, diabetes mellitus and paclitaxelchemotherapy treated with N-acetyl-cysteine.

D.A. Barrière et al. / PAIN�

153 (2012) 553–561 557

DRG cell bodies and peripheral sciatic fibers showed characteristicdense, functional mitochondria (Fig. 4A). Some atypical mitochon-dria were observed in sciatic nerve sections and in cell body sec-tions from vehicle-treated animals, but in much lower quantitythan observed in paclitaxel-treated animals (data not shown). Sim-ilar morphology was observed in DRG and sciatic fibers of diabeticrats. In paclitaxel-treated animals (Fig. 4B), DRG neuronal cellbodies were overfilled with vesicles. These vesicles were also ob-served in peripheral myelinated fibers of the sciatic nerve. Similarobservations were made in diabetic animals that received paclit-axel (data not shown). Interestingly, NAC treatment did not restorethis paclitaxel-induced proliferation of atypical mitochondria inboth sensory neuron cell bodies and peripheral nerves (Fig. 4C).Moreover, small- and large-diameter cell bodies in the DRG seemto be similarly injured as peripheral myelinated and unmyelinatedfibers. These observations support the potential involvement ofmitochondria in paclitaxel-induced neuropathy already describedby Flatters and Bennett [11].

3.5. Paclitaxel chemotherapy enhances mitochondrial ROS production

The presence of atypical mitochondria in diabetic animals that re-ceived paclitaxel and the NAC efficiency on cold hyperalgesia sug-gested that ROS might be implicated in the pathogenesis andstability of cold hyperalgesia. To test this hypothesis, we isolatedmitochondria and evaluated their H2O2 production under rotenoneand substrates of complex I. We observed a 2.5-fold higher mitochon-drial H2O2 production in paclitaxel-treated rats at D14 compared tovehicle-treated groups (P < 0.001; Fig. 5A). These data were associ-ated with a significant increase in the catalytic activity of Complex Iin diabetic animals paclitaxel treated at D14 compared to vehicle-treated groups (P < 0.001; Fig. 5B). Increasing catalytic activity asso-ciated with enhancement of H2O2 production in diabetic animalstreated with paclitaxel demonstrates the chronic pro-oxidative ac-tion of paclitaxel onto the peripheral neurons of diabetic animals.

3.6. Paclitaxel chemotherapy decreases glutathione peroxidase 4 andglutathione reductase gene expression in DRG neurons

The overproduction of ROS and the efficiency of NAC as a cysteinedonor led us to study glutathione metabolism. We analyzed mRNA

levels of GPX4 and GSR, which are 2 major enzymes in glutathionemetabolism. As shown in Fig. 5, GPX4 mRNA levels were signifi-cantly lower in groups treated with paclitaxel compared to the vehi-cle-treated groups (Fig. 5C), that is, 48.8% in the normoglycemic rats(P < 0.05) and 33.9% in diabetic rats (P < 0.05). Furthermore, diabetesinducing a significant increase of GSR mRNA levels may be due tocellular adaptation to hyperglycemia (P < 0.05). This increase isabolished by paclitaxel treatment (Fig. 5D) in diabetic animals.

All these results suggest that mitochondrial-ROS production in-duced by paclitaxel is reinforced by a decrease of antioxidant de-fenses in peripheral neurons, suggesting a strong involvement ofoxidative stress in paclitaxel-induced cold hyperalgesia.

3.7. Streptozotocin-induced diabetes increases Nav1.9 and TRPA1expression in DRG neurons

Alterations in the expression and function of TRPA1 and Nav1.9channels have been previously reported in DPN [13,39]. Indeed,TRPA1 channels have been shown to be activated both by coldtemperature and H2O2 [2,9], and Nav1.9 overexpression has beenreported in diabetic rats [13]. We therefore analyzed TRPA1 andNav1.9 mRNA levels at D14 to investigate a potential link betweenmitochondrial H2O2 production, hypersensitivity to cold noxiousstimuli, and pain symptoms. As shown in Fig. 6A and B, TRPA1and Nav1.9 mRNA levels were 69.6% and 72.9% higher in diabeticvehicle-treated rats compared to normoglycemic vehicle-treatedrats (P < 0.05), respectively. In addition, paclitaxel treatment alonehad no effect on TRPA1 and Nav1.9 gene expression, supporting thehypothesis that alterations in TRPA1 and Nav1.9 gene expressionare specific to the diabetic condition.

3.8. TRPA1 inhibition decreases paclitaxel-induced cold hyperalgesia indiabetic rats

In this experiment, all animals are diabetic, hence, according tothe calculation method, the maximal percentage effect (%) valuehas been calculated for each animal from the mean of cold thresh-olds obtained from vehicle group (see ‘‘Research design and meth-ods’’). Because in this experiment the vehicle group is composed ofdiabetic animals (DM), the values obtained for this group are dif-ferent from those obtained in the DM group of Fig. 3. However,

Fig. 4. Swollen and vacuolated mitochondria are present in dorsal root ganglia (DRG) and peripheral sciatic fibers of paclitaxel-treated rat. (A) DRG (L4) neuronal cell bodiesand myelinated sciatic fibers at D14 after vehicle treatment (magnification: 4000�). Similar morphology was observed in DRG and sciatic fibers of diabetic rats (not shown).(B) Atypical mitochondria in DRG neuronal cell bodies (magnification: 4000�) and myelinated sciatic fibers (magnification: 8000�) at D14 after paclitaxel treatment. Inmyelinated axons from the sciatic nerve normal mitochondria are indicated by black arrowheads and atypical, swollen, and vacuolated mitochondria by empty arrowheads.(C) DRG neuronal cell bodies (magnification: 4000�) and myelinated sciatic fibers (magnification: 2000�) from diabetic paclitaxel-treated rats that received N-acetyl-cysteine at D14. As previously, normal mitochondria are indicated by black arrowheads and atypical, swollen, and vacuolated mitochondria by empty arrowheads.

558 D.A. Barrière et al. / PAIN�

153 (2012) 553–561

raw data extracted from both experiments showed no significantdifference (not shown). The synergistic effect of diabetes and pac-litaxel on cold hyperalgesia might reflect higher cellular activitydue to diabetes-induced TRPA1 overexpression within the DRG inthe presence of paclitaxel-enhanced mitochondrial H2O2 produc-tion. Therefore, we investigated the effect of TRPA1 inhibition onpaclitaxel-induced hyperalgesia in diabetic rats at D14. Fifteenminutes after HC030031 treatment, cold hyperalgesia was signifi-cantly reduced in paclitaxel-treated diabetic animals comparedto paclitaxel-treated diabetic rats that did not receive the antago-nist (at 15 minutes: 57.9 ± 4.9 vs 106.0 ± 14.0%, P < 0.01, Fig. 7).HC030031 treatment had no significant effect on cold hyperalgesiain vehicle-treated diabetic rats. Our results demonstrate that thetransient inhibition of TRPA1 by HC030031 fully suppressed thepaclitaxel-induced cold hyperalgesia in diabetic rats.

4. Discussion

The aim of the present study was to determine the mechanismsinvolved in the increased frequency of cold hyperalgesia observedduring paclitaxel treatment in diabetic patients compared to the

global population. For this purpose, we investigated the cold painsensitivity of normoglycemic and Stz-induced diabetic rats treatedeither with paclitaxel or vehicle. Because paclitaxel is well knownto produce cold hypersensitivity and oxidative stress in neuronalcells, we hypothesized that oxidative stress mediated by paclitaxelmight enhance activity of TRPA1 channel, a putative cold sensor.For these reasons, we focused on changes in cold hyperalgesia.Our findings demonstrate that cold hyperalgesia is more severein diabetic animals treated with paclitaxel than in normoglycemiccontrols. Cold hypersensitivity was maintained for a few days afterthe last injection of paclitaxel, suggesting that the neuropathy in-duced by this antimitotic drug involves long-lasting mechanisms.Importantly, we showed that these mechanisms do not involve fur-ther paclitaxel-mediated alterations in glucose homeostasis. Thus,our results led us to hypothesize that paclitaxel-induced neuropa-thy might involve different pathways than those underlying DPN.

Thus, we attempted to validate the involvement of oxidativestress in the potentiation of paclitaxel-mediated cold hyperalgesia.We first confirmed our hypothesis using NAC–prophylactic treat-ment, which prevented the appearance of cold hyperalgesia in pac-litaxel-treated diabetic rats. This finding is in agreement with the

Fig. 5. H2O2 production from mitochondria is increased in dorsal root ganglia (DRG)of rats that received paclitaxel. (A) Quantification of paclitaxel-induced H2O2

production by mitochondria isolated from DRG (L3–L6) at D14 as determined by aspectrofluorometry assay (n = 3 animals per group). (B) Evaluation of mitochondrialComplex I activity in DRG (L3-L6) at D14 (n = 4–5 animals per group). (C)Quantification of the GPX4 transcript in DRG (L3–L6) at D14 by quantitativepolymerase chain reaction (PCR) normalized to HPRT (n = 4 animals per group). (D)Quantification of the GSR transcript in DRG at D14 by quantitative PCR normalizedto HPRT (n = 4 animals per group). P > 0.05; ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001; vsVehicle group. Kruskal–Wallis one-way analysis of variance with multiple com-parison Dunnett post hoc test. GSR, glutathione-S-reductase; GPX4, glutathioneperoxidase subtype 4; HPRT, hypoxanthine phosphoribosyl transferase; PAC,paclitaxel; DM, diabetes mellitus; DM PAC, diabetes mellitus and paclitaxelchemotherapy; DM PAC NAC, diabetes mellitus and paclitaxel chemotherapytreated with N-acetyl-cysteine.

Fig. 6. TRPA1 and Nav1.9 channel expression is increased in dorsal root ganglia(DRG) of diabetic rats. (A) Quantification of TRPA1 transcript extracted from DRG(L3–L6) at D14 by quantitative polymerase chain reaction (PCR) normalized to HPRT(n = 4 animals per group). (B) Quantification of Nav1.9 transcript in DRG (L3–L6) atD14 by quantitative PCR normalized to HPRT (n = 4 animals per group). Kruskal–Wallis one-way analysis of variance with multiple comparison Dunnett post hoctest. P > 0.05; ⁄ vs Vehicle group. PAC, paclitaxel; DM, diabetes mellitus; DM PAC,diabetes mellitus and paclitaxel chemotherapy; DM PAC NAC, diabetes mellitus andpaclitaxel chemotherapy treated with N-acetyl-cysteine; Nav1.9, sodium channel,voltage-gated, type XI; TRPA1, transient receptor potential cation channel, sub-family A, member 1; HPRT, hypoxanthine phosphoribosyl transferase.

D.A. Barrière et al. / PAIN�

153 (2012) 553–561 559

description of decreased paclitaxel-induced mechanical allodyniavia the reduction of oxidative stress using phenyl N-tert-butylnit-rone [17] or acetyl-L-carnitine [15]. However, NAC treatment didnot relieve the pathophysiological alterations observed in the pac-litaxel-treated diabetic group. Indeed, atypical mitochondria weresimilarly present in DRG cell bodies and sciatic fibers within bothgroups. Moreover, neither mitochondrial H2O2 production rate,nor Complex I activity, nor GPX4 and GSR transcript levels in the

DRG were modified by NAC treatment. Therefore, we may suggestthat the effect of NAC is restricted to the cell cytoplasm, particu-larly through its ability to generate glutathione de novo, whichcould limit the development of painful symptoms.

Because paclitaxel is known to promote the accumulation ofswollen and vacuole-filed mitochondria in A and C fibers [11,15],we evaluated mitochondrial H2O2 production (1) as a primarycomponent of oxidative stress, and (2) as a cause of mitochondrialstructural alterations. Our results demonstrated that mitochon-drial H2O2 overproduction was specifically enhanced in paclit-axel-treated rats but not in diabetic rats. In addition, we foundthat the catalytic activity of mitochondrial Complex I was en-hanced in diabetic paclitaxel-treated rats. Therefore, paclitaxel-in-duced alterations in mitochondrial function might be related to theaccumulation of atypical mitochondria within the peripheralnerves of paclitaxel-treated rats. Furthermore, the cytosolic antiox-idant response might not protect mitochondria against internalH2O2 overproduction. Indeed, in the DRG of rats treated with pac-litaxel, the mRNA levels of GPX4 and GSR were lower. The glutathi-one detoxification system may be altered and favor oxidativeinjuries in peripheral nerve cells.

To determine the involvement of these paclitaxel-induced alter-ations in the potentiation of diabetes-induced cold hyperalgesia,we investigated the expression of TRPA1 and Nav1.9 channels,which are both involved in the pathophysiology of DPN [13,39].We found an overexpression of both channels solely in diabeticrats. These changes were not observed in the paclitaxel group.

Fig. 7. Experiment 2: Effect of TRPA1 antagonist HC030031 (100 mg kg�1 mL�1) on cold hyperalgesia in diabetic rats treated with paclitaxel. Histograms show latency time ofthresholds ± SEM in the paw immersion test after HC030031 or vehicle administration. The diabetic, paclitaxel-treated group showed transient analgesia after HC030031injection (n = 5–6 animals per group). P > 0.05; ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001; vs Vehicle group. Data were analyzed with a 2-way repeated-measures analysis of variancewith post hoc pairwise multiple comparison Bonferroni t-test, F = 3.45. DM Vehicle, diabetes mellitus treated with vehicle; DM PAC Vehicle, diabetes mellitus and paclitaxelchemotherapy treated with vehicle; DM HC030031, diabetes mellitus treated with TRPA1 antagonist; DM PAC HC030031, diabetes mellitus and paclitaxel chemotherapytreated with TRPA1 antagonist.

560 D.A. Barrière et al. / PAIN�

153 (2012) 553–561

Increased expression of Nav1.9 could potentially contribute tonociceptive neuron hyperexcitability reported in DPN [13]. Moreimportantly, as TRPA1 channels are sensitive to ROS [39], wehypothesized that TRPA1 participates in the complex mechanismsunderlying paclitaxel-induced cold hyperalgesia potentiation indiabetic rats. The sensitization of TRPA1 by H2O2 and the cellularhyperexcitability induced by Nav1.9 channels might induce an in-creased sensitivity to cold. Our data showed that HC030031-med-iated TRPA1 channel blockade has a transient analgesic effect andfully reverses paclitaxel-mediated cold hyperalgesia in diabeticrats. This potentiation of cold hypersensitivity may arise fromthe combination of paclitaxel-induced mitochondrial H2O2 over-production and increased TRPA1 expression induced by H2O2.

In conclusion, we propose that the potentiation of cold hyperal-gesia in diabetes by paclitaxel may be due to the combination of 3different mechanisms involving (1) diabetes-induced TRPA1/Nav1.9 overexpression; (2) paclitaxel-promoted ROS production,especially an overproduction of mitochondrial H2O2; and (3) poorradical detoxification resulting in paclitaxel-induced weakeningof antioxidative processes. Concomitance of these cellular misad-aptations may explain the increased occurrence of cold hyperalge-sia in diabetic patients receiving anticancer treatments and theprophylactic effects of NAC.

Cold hyperalgesia is a common symptom of neuropathic disor-ders, and a close correlation with spontaneous pain and cold-evoked hyperalgesia in neuropathic patients has been shown[30]. In our study, we highlight 2 distinct pathophysiological pro-cesses that act additively to potentiate cold hyperalgesia. However,previous studies have shown that paclitaxel and diabetes mellituscould also induce mechanical hypersensitivity, which is relieved byantioxidant therapies [15] and TRPA1 antagonist (Chembridge-5861528) [39], respectively. Taken together, our findings and pre-viously published data suggest some close cellular mechanisms forthe transduction of mechanical and cold-evoked pain throughTRPA1 receptor. Other mechanisms, involving inflammatory pro-cesses, protein kinase C activity, apoptosis [29], and other TRPchannels such as TRPV1 and TRPV4, have to be further explored[6] to understand how TRPA1 could enhance other symptoms asmechanical hyperalgesia in these models.

In summary, our findings support the use of antioxidantprophylaxis during anticancer chemotherapy, but only in patients

displaying a higher risk of developing neuropathy (such as patientswith diabetes mellitus, metabolic syndrome, alcoholism, or renalor hepatic insufficiency). Our data also provide support for the re-search and development of novel analgesics targeting TRPA1receptor channels, which may play a central role in these typesof neuropathic pain.

Conflict of interest statement

The authors declare that there are no conflicts of interest inpublication of this manuscript.

Acknowledgements

We thank Christelle Blavignac and Claire Szczepaniak (CICS,Université d’Auvergne, France) for technical assistance with elec-tron microscopy. We also thank Julien Matricon for his valuablecomments. This manuscript is dedicated to my friend Guillaume.

References

[1] Abdel Samad O, Liu Y, Yang FC, Kramer I, Arber S, Ma Q. Characterization of twoRunx1-dependent nociceptor differentiation programs necessary forinflammatory versus neuropathic pain. Mol Pain 2010;6:45.

[2] Andersson DA, Gentry C, Moss S, Bevan S. Transient receptor potential A1 is asensory receptor for multiple products of oxidative stress. J Neurosci2008;28:2485–94.

[3] Batandier C, Guigas B, Detaille D, El-Mir MY, Fontaine E, Rigoulet M, LeverveXM. The ROS production induced by a reverse-electron flux at respiratory-chain complex 1 is hampered by metformin. J Bioenerg Biomembr2006;38:33–42.

[4] Berta T, Poirot O, Pertin M, Ji RR, Kellenberger S, Decosterd I. Transcriptionaland functional profiles of voltage-gated Na(+) channels in injured and non-injured DRG neurons in the SNI model of neuropathic pain. Mol Cell Neurosci2008;37:196–208.

[5] Brownlee M. A radical explanation for glucose-induced beta cell dysfunction. JClin Invest 2003;112:1788–90.

[6] Chen Y, Yang C, Wang ZJ. Proteinase-activated receptor 2 sensitizes transientreceptor potential vanilloid 1, transient receptor potential vanilloid 4, andtransient receptor potential ankyrin 1 in paclitaxel-induced neuropathic pain.Neuroscience 2011;193:440–51.

[7] Chung MK, Jung SJ, Oh SB. Role of TRP channels in pain sensation. Adv Exp MedBiol 2011;704:615–36.

[8] Courteix C, Eschalier A, Lavarenne J. Streptozocin-induced diabetic rats:behavioural evidence for a model of chronic pain. Pain 1993;53:81–8.

[9] del Camino D, Murphy S, Heiry M, Barrett LB, Earley TJ, Cook CA, Petrus MJ,Zhao M, D’Amours M, Deering N, Brenner GJ, Costigan M, Hayward NJ, Chong

D.A. Barrière et al. / PAIN�

153 (2012) 553–561 561

JA, Fanger CM, Woolf CJ, Patapoutian A, Moran MM. TRPA1 contributes to coldhypersensitivity. J Neurosci 2010;30:15165–74.

[10] Ferrini F, Salio C, Lossi L, Gambino G, Merighi A. Modulation of inhibitoryneurotransmission by the vanilloid receptor type 1 (TRPV1) in organotypicallycultured mouse substantia gelatinosa neurons. Pain 2010;150:128–40.

[11] Flatters SJ, Bennett GJ. Studies of peripheral sensory nerves in paclitaxel-induced painful peripheral neuropathy: evidence for mitochondrialdysfunction. Pain 2006;122:245–57.

[12] Foulkes T, Wood JN. Mechanisms of cold pain. Channels (Austin)2007;1:154–60.

[13] Hong S, Wiley JW. Altered expression and function of sodium channels in largeDRG neurons and myelinated A-fibers in early diabetic neuropathy in the rat.Biochem Biophys Res Commun 2006;339:652–60.

[14] Jang HJ, Hwang S, Cho KY, Kim do K, Chay KO, Kim JK. Taxol induces oxidativeneuronal cell death by enhancing the activity of NADPH oxidase in mousecortical cultures. Neurosci Lett 2008;443:17–22.

[15] Jin HW, Flatters SJ, Xiao WH, Mulhern HL, Bennett GJ. Prevention of paclitaxel-evoked painful peripheral neuropathy by acetyl-L-carnitine: effects on axonalmitochondria, sensory nerve fiber terminal arbors, and cutaneous Langerhanscells. Exp Neurol 2008;210:229–37.

[16] Kellogg AP, Pop-Busui R. Peripheral nerve dysfunction in experimentaldiabetes is mediated by cyclooxygenase-2 and oxidative stress. AntioxidRedox Signal 2005;7:1521–9.

[17] Kim HK, Zhang YP, Gwak YS, Abdi S. Phenyl N-tert-butylnitrone, a free radicalscavenger, reduces mechanical allodynia in chemotherapy-inducedneuropathic pain in rats. Anesthesiology 2010;112:432–9.

[18] Kim HS, Oh JM, Jin DH, Yang KH, Moon EY. Paclitaxel induces vascularendothelial growth factor expression through reactive oxygen speciesproduction. Pharmacology 2008;81:317–24.

[19] Kramer HH, Rolke R, Bickel A, Birklein F. Thermal thresholds predictpainfulness of diabetic neuropathies. Diabetes Care 2004;27:2386–91.

[20] Lee JJ, Swain SM. Peripheral neuropathy induced by microtubule-stabilizingagents. J Clin Oncol 2006;24:1633–42.

[21] Lin PC, Lee MY, Wang WS, Yen CC, Chao TC, Hsiao LT, Yang MH, Chen PM, LinKP, Chiou TJ. N-acetylcysteine has neuroprotective effects against oxaliplatin-based adjuvant chemotherapy in colon cancer patients: preliminary data.Support Care Cancer 2006;14:484–7.

[22] Lolignier S, Amsalem M, Maingret F, Padilla F, Gabriac M, Chapuy E, EschalierA, Delmas P, Busserolles J. Nav1.9 channel contributes to mechanical and heatpain hypersensitivity induced by subacute and chronic inflammation. PLoSOne 2011;6:e23083.

[23] Meldgaard M, Fenger C, Lambertsen KL, Pedersen MD, Ladeby R, Finsen B.Validation of two reference genes for mRNA level studies of murine diseasemodels in neurobiology. J Neurosci Methods 2006;156:101–10.

[24] Moreira PI, Santos MS, Moreno AM, Proenca T, Seica R, Oliveira CR. Effect ofstreptozotocin-induced diabetes on rat brain mitochondria. J Neuroendocrinol2004;16:32–8.

[25] Nicolucci A. Epidemiological aspects of neoplasms in diabetes. Acta Diabetol2010;47:87–95.

[26] Nishikawa T, Edelstein D, Du XL, Yamagishi S, Matsumura T, Kaneda Y, YorekMA, Beebe D, Oates PJ, Hammes HP, Giardino I, Brownlee M. Normalizingmitochondrial superoxide production blocks three pathways ofhyperglycaemic damage. Nature 2000;404:787–90.

[27] Pabreja K, Dua K, Sharma S, Padi SS, Kulkarni SK. Minocycline attenuates thedevelopment of diabetic neuropathic pain: possible anti-inflammatory andanti-oxidant mechanisms. Eur J Pharmacol 2011;661:15–21.

[28] Polomano RC, Bennett GJ. Chemotherapy-evoked painful peripheralneuropathy. Pain Med 2001;2:8–14.

[29] Pop-Busui R, Marinescu V, Van Huysen C, Li F, Sullivan K, Greene DA, Larkin D,Stevens MJ. Dissection of metabolic, vascular, and nerve conductioninterrelationships in experimental diabetic neuropathy by cyclooxygenaseinhibition and acetyl-L-carnitine administration. Diabetes 2002;51:2619–28.

[30] Rasmussen PV, Sindrup SH, Jensen TS, Bach FW. Symptoms and signs inpatients with suspected neuropathic pain. Pain 2004;110:461–9.

[31] Sagara M, Satoh J, Wada R, Yagihashi S, Takahashi K, Fukuzawa M, Muto G,Muto Y, Toyota T. Inhibition of development of peripheral neuropathy instreptozotocin-induced diabetic rats with N-acetylcysteine. Diabetologia1996;39:263–9.

[32] Sharma SS, Sayyed SG. Effects of trolox on nerve dysfunction, thermalhyperalgesia and oxidative stress in experimental diabetic neuropathy. ClinExp Pharmacol Physiol 2006;33:1022–8.

[33] Sims NR, Anderson MF. Isolation of mitochondria from rat brain using Percolldensity gradient centrifugation. Nat Protoc 2008;3:1228–39.

[34] Talbot S, Chahmi E, Dias JP, Couture R. Key role for spinal dorsal hornmicroglial kinin B1 receptor in early diabetic pain neuropathy. J Neuroinflamm2010;7:36.

[35] Tatsushima Y, Egashira N, Kawashiri T, Mihara Y, Yano T, Mishima K, Oishi R.Involvement of substance P in peripheral neuropathy induced by paclitaxelbut not oxaliplatin. J Pharmacol Exp Ther 2011;337:226–35.

[36] Tomlinson DR, Gardiner NJ. Diabetic neuropathies: components of etiology. JPeripher Nerv Syst 2008;13:112–21.

[37] Venardos K, Ashton K, Headrick J, Perkins A. Effects of dietary selenium onpost-ischemic expression of antioxidant mRNA. Mol Cell Biochem2005;270:131–8.

[38] Vincent AM, McLean LL, Backus C, Feldman EL. Short-term hyperglycemiaproduces oxidative damage and apoptosis in neurons. FASEB J 2005;19:638–40.

[39] Wei H, Hamalainen MM, Saarnilehto M, Koivisto A, Pertovaara A. Attenuationof mechanical hypersensitivity by an antagonist of the TRPA1 ion channel indiabetic animals. Anesthesiology 2009;111:147–54.

[40] Yagihashi S, Yamagishi SI, Wada Ri R, Baba M, Hohman TC, Yabe-Nishimura C,Kokai Y. Neuropathy in diabetic mice overexpressing human aldose reductaseand effects of aldose reductase inhibitor. Brain 2001;124:2448–58.