Our reference: YABBI 5718 P-authorquery-v8

AUTHOR QUERY FORM

Journal: YABBI Please e-mail or fax your responses and any corrections to:

Article Number: 5718

E-mail: corrections.essd@elsevier.sps.co.in

Fax: +31 2048 52799

Dear Author,

Please check your proof carefully and mark all corrections at the appropriate place in the proof (e.g., by using on-screen annotation in the PDF

file) or compile them in a separate list.

For correction or revision of any artwork, please consult http://www.elsevier.com/artworkinstructions.

We were unable to process your file(s) fully electronically and have proceeded by

h Scanning (parts of) your article h Rekeying (parts of) your article h Scanning the artwork

No queries have arisen during the processing of your article.

Thank you for your assistance.

Research highlights

YABBI 5718 No. of Pages 1, Model 5G

10 July 2010

" Ankrd1/CARP interacts with the tumor suppressor protein p53 " Ankrd1/CARP acts as a transcriptional co-activator, up-regulating p53activity " p53 operates as an upstream effector of Ankrd1/CARP

1

1

2 pr3

4 Ra5

6 10 B78

910

1 2

13141516

17181920212223

2 4m

25eat -26lex s27the s28ctu n

4041

42

43

44

45

46

47

48

49

50

51

52

Archives of Biochemistry and Biophysics xxx (2010) xxx–xxx

ail

m

w

YABBI 5718 No. of Pages 9, Model 5G

10 July 2010

A novel role for cardiac ankyrin repeatof the p53 tumor suppressor protein

Snezana Kojic a,*, Aleksandra Nestorovic a, LjiljanaAleksandra Divac a, Georgine Faulkner b,c

a Institute of Molecular Genetics and Genetic Engineering, University of Belgrade, 110b International Centre for Genetic Engineering and Biotechnology, 34012 Trieste, Italyc CRIBI, University of Padova, 35131 Padova, Italy

a r t i c l e i n f o

Article history:Received 6 April 2010and in revised form 24 June 2010Available online xxxx

a b s t r a c t s u

The muscle ankyrin repsensory signaling compwhere it participates inhave focused on its stru

Contents lists av

Archives of Bioche

journal homepage: ww

Keywords:29more insight into the regula d30ts a r31d1/ d32e a p33Furt P,34xim -35rd1 al36ble -37(M38c.

39

tr-el--fe

ty

53-54-55e56o57],58l59t-60A61o62g63-64n65

66-67-68f69d70r71-72e73e74].75/76-

ic1

at-

acT,e;ry

Ankrd1/CARPp53Transcription factorSkeletal muscleMyogenesis

interact and modulate iprotein p53 as an Ankrin vitro. We demonstratregulating p53 activity.by up regulating the protional co-repressor, Ankmuscle cells. It is probagenic regulatory factors

Introduction

Ankyrin repeat domain protein 1 or cardiac ankyrin repeaprotein Ankrd1/CARP, encoded by the ANKRD1 gene, togethewith ankyrin repeat domain protein 2 (Ankrd2/Arpp) and diabetes-related ankyrin repeat protein (DARP) are members of thmuscle ankyrin repeat protein (MARP)1 family. MARPs are locaized in the nucleus as well as in the central I-band of the sarcomere, reflecting a dual function for these proteins: regulation ogene expression in the nucleus and stretch sensing at sarcomer[1–3].

Ankrd1/CARP is a potent regulator of early cardiac developmen[4]. In adults, it is significantly up-regulated in cardiac hypertroph

0003-9861/$ - see front matter � 2010 Published by Elsevier Inc.doi:10.1016/j.abb.2010.06.029

* Corresponding author. Address: Institute of Molecular Genetics and GenetEngineering, Vojvode Stepe 444a, P.O. Box 23, 11010 Belgrade, Serbia. Fax: +381 13975808.

E-mail address: snezanakojic@eunet.rs (S. Kojic).1 Abbreviations used: MARP, muscle ankyrin repeat protein; Ankrd2, ankyrin repe

domain protein 2; DARP, diabetes-related ankyrin repeat protein; TGF-b; transforming growth factor b; C/EBP, CCAAT/enhancer-binding protein; CASQ2, cardicalcium-handling protein calsequestrin-2; YB-1, Y-box transcription factor 1; GSglutathione-S-transferase; FBS, fetal bovine serum; HRP, horseradish peroxidasIVTT, in vitro transcribed/translated; GO, gene ontology; MRFs, myogenic regulatofactors.

Please cite this article in press as: S. Kojic et al., Arch. Biochem. Biophys. (2

otein Ankrd1/CARP as a co-activator

kicevic a, Anna Belgrano b, Marija Stankovic a,

elgrade, Serbia

m a r y

protein (MARP) family member Ankrd1/CARP is a part of the titin-mechanoin the sarcomere and in response to stretch it translocates to the nucleuregulation of cardiac genes as a transcriptional co-repressor. Several studieral role in muscle, but its regulatory role is still poorly understood. To gaitory function of Ankrd1/CARP we searched for transcription factors that coulctivity. Using protein array methodology we identified the tumor suppressoCARP interacting partner and confirmed their interaction both in vivo annovel role for Ankrd1/CARP as a transcriptional co-activator, moderately uhermore, we show that p53 operates as an upstream effector of Ankrd1/CARal ANKRD1 promoter. Our findings suggest that, besides acting as a transcrip

/CARP could have a stimulatory effect on gene expression in cultured skeletthat Ankrd1/CARP has a role in the propagation of signals initiated by myoRFs) during myogenesis.

� 2010 Published by Elsevier In

and heart failure [5–7]. Mutations in the ANKRD1 gene are responsible for human dilated [8,9] and hypertrophic [10] cardiomyopathies. Ankrd1/CARP is also expressed in skeletal muscle [4] wherits level is elevated after eccentric exercise [11], in response tacute resistance exercise [12], work-overload hypertrophy [13as well as in pathological conditions: Duchenne and congenitamuscular dystrophy, spinal muscular atrophy or amyotrophic laeral sclerosis [14–16]. Ankrd1/CARP is a member of the titin-N2mechanosensory complex. Upon stretch stimuli, it translocates tthe nucleus and acts as a nuclear-signaling protein modulatingene expression [1]. So far, it has been characterized as a transcriptional co-inhibitor, repressing the expression of cardiac proteins iin vitro systems [4,17].

Ankrd1/CARP expression is induced by a- and b-adrenergic signaling [18,19] and transforming growth factor b (TGF-b) [20]. Transcription from the ANKRD1 gene is stimulated by overexpression op38 and Rac1, components of the stress and mitogen-activateprotein kinase pathways implicated in hypertrophy of ventriculamyocytes [6]. The ANKRD1 gene is a downstream target of the cardiac-specific transcription factor Nkx2.5 [4,21]. Together with thzinc finger transcription regulator GATA4 it activates the mousANKRD1 promoter through a proximal GATA cis-element [5,18GADD153 (CHOP-10), the CCAAT/enhancer-binding protein (CEBP) family member, transcriptionally down-regulates the expres

able at ScienceDirect

istry and Biophysics

.e lsevier .com/ locate/yabbi

010), doi:10.1016/j.abb.2010.06.029

77 sio78 ad79

80 of81 tio82 ica83 sa84 pr85 to86 ce87 pr88 lig89

90 ied91 in92 m93 kn94 its95 CA96 To97 we98 th99 te

100 p5101 in102 of103 An104 ac

105 M

106 Pla

107

108 fro109 ga110 N-111 pG112 ex113

114 AT115 m116 ga117 An118 m119 an120 in121 m122 m123 clo

124 Ce

125

126 su127 (5128 20129 Re

130 Ex

131

132 de133 m134 Br

135Tr

136

137be138ity139Tr140fac141in142by143bo144de145wa

146GS

147

148one–Sepharose beads were incubated with cell lysates in binding149bu150ni

2 S. Kojic et al. / Archives of Biochemistry and Biophysics xxx (2010) xxx–xxx

YABBI 5718 No. of Pages 9, Model 5G

10 July 2010

Pl

n of Ankrd1/CARP after the induction of apoptotic cell death byriamycin [22].So far, several physical partners of Ankrd1/CARP with a varietyfunctions have been identified suggesting its pleiotropic func-n. Ankrd1/CARP interacts with titin [1], involved in biomechan-l stress sensing, and with myopalladin [23] implicated in

rcomeric integrity. It also binds the cardiac calcium-handlingotein calsequestrin-2 (CASQ2) [24], the Y-box transcription fac-r 1 (YB-1) associated with prevention of premature cell senes-nce and apoptosis [4], as well as the intermediate filamentotein desmin [25] and the muscle-specific RING finger ubiquitinases MuRF1/MuRF2 involved in protein quality control [26].Although the Ankrd1/CARP protein has been extensively stud-its function still remains enigmatic. The role of Ankrd1/CARP

mechanotransduction is well documented, but its function inyoblasts, before the development of the sarcomere is still un-own. Regarding its function of transcriptional co-inhibitor andnuclear localization in myocytes, we considered that Ankrd1/

RP could play a role in signal transduction during myogenesis.

gain more insight into the regulatory potential of Ankrd1/CARP, 151bin

152sa

153In

154

155on156tra157Re158we

searched for its binding partners among transcriptional factorsat could modulate Ankrd1/CARP activity through protein–pro-in interactions. We identified the tumor suppressor protein3, known to participate in the process of myogenesis, as a new

teracting partner of Ankrd1/CARP. The functional consequencethis interaction was investigated revealing a novel role ofkrd1/CARP as a positive effector of p53-mediated transcriptional

tivation.

aterial and methods

smid constructs

The full-length human Ankrd1/CARP cDNA, amplified by PCRm human heart mRNA (Ambion) using primers gctgcagcgat-tggtactgaaa and taggatcctcagaatgtagctatgcg, was inserted into aterminal glutathione-S-transferase (GST) tag expression vectorEX6P-3 (GE Healthcare) and a N-terminal FLAG tag mammalianpression vector, pCMV-Tag2B (Stratagene, Agilent Technologies).The human ANKRD1 promoter region 448 bp upstream of theG codon (�206/+243) was amplified by PCR using human geno-

ic DNA and primers agaaaggtaccactgggggtgtga and atctc-ggttggctgaaggagtcttg. The proximal promoter region of humankrd2/Arpp gene (�439/+7) was amplified from human skeletaluscle mRNA (Ambion) with primers gcgactcgaggtacagaactgtcctgd atataagcttcgcctctgcaggcc. Both PCR fragments were clonedto the promoterless luciferase reporter gene vector pGL4.1 (Pro-ega). Human MyoD cDNA was amplified from skeletal muscleRNA (Ambion) and inserted into pCDNA3. The fidelity of the sub-ned fragments was confirmed by DNA sequencing.

ll culture and transfections

C2C12 mouse myoblasts and COS7 cells were cultured in DMEMpplemented with 10% fetal bovine serum (FBS) and gentamycin0 lg/ml). SaOs2 cells were grown in the same medium with% FBS. Cells were transfected using SuperFect Transfectionagent (QIAGEN) according to the manufacturer’s procedure.

pression and purification of GST-tagged recombinant proteins

GST-tagged recombinant proteins were produced as previouslyscribed [2]. The quantity and purity of the proteins were deter-ined by SDS–PAGE and subsequent staining with Coomassieilliant Blue.

tare

Co

scex

Im

tiobrprsewetePrte

Lu

SatraAnan(P

Re

Ide

sc

ease cite this article in press as: S. Kojic et al., Arch. Biochem. Biophys. (2010),

anscription factor interaction assay

Protein arrays were used to simultaneously screen a large num-r of transcription factors for Ankrd1/CARP protein binding activ-. The protein–protein interaction assay was carried out using the

ansSignal TF Protein Array II (Panomics) according to the manu-turer’s instructions. Briefly, purified GST-Ankrd1/CARP was

cubated with protein array membrane. Interaction was assessedmouse anti-GST antibody and secondary goat anti mouse anti-

dy conjugated with horseradish peroxidase (HRP) (Sigma),tecting GST-Ankrd1/CARP bound to spotted proteins. The signals visualized via chemiluminescent detection.

T pull-down assay

Equal amounts of GST fusion proteins immobilized on glutathi-

ffer (50 mM HEPES, pH 7.0, 250 mM NaCl, 0.1% NP-40), over-ght at 4 �C. Immobilized protein complexes were washed with

ding buffer, eluted by heating at 95 �C for 5 min in Laemmlimple buffer and separated by SDS–PAGE.

vitro binding assay

Probe proteins (GST-Ankrd1/CARP and GST) bound to glutathi-e–Sepharose matrix were incubated with radiolabeled in vitronscribed/translated (IVTT) p53 produced by the TNT Coupledticulocyte Lysate System (Promega) for 2 h at 4 �C. The resinsre washed and subjected to SDS PAGE, along with 30% of the to-

159l amount of radiolabeled IVTT p53 used in each of the binding160action. The gels were dried and exposed to autoradiography film.

161-immunoprecipitation

162Co-immunoprecipitations were performed as previously de-163ribed [2]. Tagged proteins were immunoprecipitated from the164tracts using the EZview Red ANTI-FLAG M2 Affinity Gel (Sigma).

165munoblotting

166Protein complexes from GST pull-down or co-immunoprecipita-167n assays, resolved by SDS PAGE, were transferred to PVDF mem-168ane (Immobilon P, Millipore). Immunoblotting was performed as169eviously described [2]. Anti-p53 antibody (DO-1, Santa Cruz) and170condary goat anti mouse antibody conjugated with HRP (Sigma)171re used for p53 protein detection. FLAG-Ankrd1/CARP was de-172cted by anti-FLAG (M2) antibody conjugated with HRP (Sigma).173oteins were visualized by the chemiluminescence detection sys-174m (Millipore).

175ciferase assays

176Reporter assays were performed as previously described [2].177Os2 and C2C12 cells were grown for 24 h and transiently co-178nsfected with reporter constructs, expression vectors for p53,179krd1/CARP or MyoD, depending on the experimental design180d control plasmid expressing Renilla luciferase, pRL-TK181romega).

182sults

183ntification of p53 as an Ankrd1/CARP-binding protein

184Ankrd1/CARP has been implicated as a cardiac-specific tran-185riptional repressor [4,17]. In order to identify downstream tar-

doi:10.1016/j.abb.2010.06.029

186 gets of Ankrd1/CARP, we screened transcription factors for binding187 activity to Ankrd1/CARP, employing protein array methodology.188 Recombinant GST-Ankrd1/CARP protein was incubated with a189 commercial transcription factor protein array (TF protein array II,190 Panomics) containing 46 different recombinant proteins. After191 hybridisation several positive signals were obtained (Fig. 1). The192 list of the transcription factors that interact with Ankrd1/CARP,193 as well as their description and gene ontology (GO) terms [27]194 denoting the biological processes in which they are involved are gi-195 ven in Table 1. Ankrd1/CARP was found to bind with high affinity196 to HAND2, HOXA5, KLF12, LDB1, LHX2, MAX and MECP2 and with197 lower affinity to HDC1, HEY, IRF1, ISGF3G (IRF9), JUN, JUNB,198 MADH3 (SMAD3), MAFK, NFIL3 and p53 (Fig. 1).199 The majority of identified Ankrd1/CARP interacting partners are200 involved in developmental processes and some of them such as201 HAND2 and HEY1 are specific for cardiac development. We focused202 our attention on p53 due to its important role in the cell and also203 since we had previously shown that Ankrd2/Arpp could interacts204 and modulate p53 activity [2].

205 Ankrd1/CARP interacts with p53 in vitro and in vivo

206 GST pull-down and co-immunoprecipitation assays were per-207 formed in order to confirm the physical interaction between208 Ankrd1/CARP and p53 that was observed by protein array. The209 purified recombinant fusion protein GST-Ankrd1/CARP was incu-210 bated with in vitro transcribed and translated p53, lysates of211 COS7 cells expressing endogenous p53, or overexpressed GFP-212 p53. As demonstrated in Fig. 2, GST-Ankrd1/CARP, but not GST

213alone, interacted with p53. Interaction between GST-Ankrd1/CARP214and p53 from cell lysates of COS7 cells overexpressing GFP-p53215was not observed, probably due to the competition between the216endogenous p53 and overexpressed GFP-p53 proteins. The ob-217served in vitro interaction between p53 and Ankrd1/CARP was fur-218ther confirmed by co-immunoprecipitation analysis. COS7 cells219were transfected with either FLAG-Ankrd1/CARP or GFP-p53 or220both. Immunoprecipitation was performed with anti-FLAG anti-221body (immobilized on affinity gel), followed by immunoblotting222with anti-p53 antibody. After immunoprecipitation with anti-FLAG223antibody, p53 was detected in extracts of cells co-transfected with224Ankrd1/CARP and p53, but not in extracts from cells transfected225with Ankrd1/CARP or p53 alone (Fig. 3).226Taken together, the results of the GST pull-down and co-immu-227noprecipitation assays strongly suggest that Ankrd1/CARP inter-228acts with p53 both in vitro and in vivo.

229Ankrd1/CARP up-regulates p53-mediated transcriptional activation

230Previously, we had shown that the MARP family member231Ankrd2/Arpp could enhance the p53 up-regulation of the232p21WAF1/CIP1 promoter [2], as a result we were interested in the233functional consequences of interaction between p53 and Ankrd1/234CARP. Therefore, we investigated if Ankrd1/CARP had similar effect235on the trans-activation ability of p53. The luciferase gene reporter236assays were performed using the p53 responsive promoters of the237p21WAF1/CIP1 and the Mdm2 genes, as well as the promoter region of238the Ankrd2/Arpp gene. SaOs2 were used for testing p21WAF1/CIP1 and239Mdm2 promoters because they are null for p53. However since the

Fig. 1. Interaction between Ankrd1/CARP and transcription factors on TransSignal TF Protein Array II. GST-Ankrd1/CARP bound to transcription factors immobilized on thearray membrane was visualized using anti-GST antibody and HRP-based chemiluminescence detection. The proteins on the array are spotted in duplicate. HRP, as positivecontrol, is spotted along the bottom (row F) and in duplicate along the right side (columns 23 and 24) of the membrane (top panel). Schematic diagram of the TranSignal TFprotein array is given in bottom panel.

S. Kojic et al. / Archives of Biochemistry and Biophysics xxx (2010) xxx–xxx 3

YABBI 5718 No. of Pages 9, Model 5G

10 July 2010

Please cite this article in press as: S. Kojic et al., Arch. Biochem. Biophys. (2010), doi:10.1016/j.abb.2010.06.029

Table 1The list of the transcription factors that interact with ANKRD1/CARP. Gene ontology biological process terms are adopted from the GeneCards (www.genecards.org).

Position on thearray

Genesymbol

Protein description Gene ontology biological process terms

A1, 2 HAND2 HAND2: heart and neural crest derivatives expressed 2 GO:0001525 angiogenesisGO:0001701 in utero embryonic developmentGO:0001947 heart loopingGO:0006355 regulation of transcription, DNA-dependentGO:0006915 apoptosis

A3, 4 HDC1 HDAC1: histone deacetilase 1 GO:0006350 transcriptionGO:0006355 regulation of transcription, DNA-dependentGO:0006916 anti-apoptosisGO:0016568 chromatin modificationGO:0016575 histone deacetylation

A5, 6 HOXA5 Homeobox A5 GO:0006355 regulation of transcription, DNA-dependentGO:0007389 pattern specification processGO:0009952 anterior/posterior pattern formationGO:0030324 lung development IEAGO:0030878 thyroid gland development

A7, 8 HEY HEY1: hairy/enhancer-of-split related with YRPW motif 1 GO:0001570 vasculogenesisGO:0006355 regulation of transcription, DNA-dependentGO:0007219Notch signaling pathwayGO:0007275 multicellular organismal developmentGO:0007399 nervous system development

A19, 20 IRF1 IRF1, interferon regulatory factor 1 GO:0006350 transcriptionGO:0006355 regulation of transcription, DNA-dependentGO:0010468 regulation of gene expressionGO:0043374 CD8-positive, alpha–beta T cell differentiationGO:0045084 positive regulation of interleukin-12 biosynthetic process

A21, 22 ISGF3G ISGF3G: interferon-stimulated transcription factor 3,gamma 48 kDa

GO:0006350 transcriptionGO:0006355 regulation of transcription, DNA-dependentGO:0006366 transcription from RNA polymerase II promoterGO:0007166 cell surface receptor linked signal transductionGO:0009615 response to virus

B3, 4 JUN JUN: v-jun sarcoma virus 17 oncogene homolog (avian) GO:0006355 regulation of transcription, DNA-dependentGO:0007184 SMAD protein nuclear translocationGO:0009987 cellular processGO:0031953 negative regulation of protein amino acidautophosphorylationGO:0035026 leading edge cell differentiation

B5, 6 JUNB JUNB: jun B proto-oncogene GO:0001570 vasculogenesisGO:0001829 trophectodermal cell differentiationGO:0001892 embryonic placenta developmentGO:0006357 regulation of transcription from RNA polymerase IIpromoterGO:0009987 cellular process

B7, 8 KLF12 KLF12: Kruppel-like factor 12 GO:0000122 negative regulation of transcription from RNA polymerase II

B11, 12 LDB1 LDB1: LIM domain binding 1

B13,14 LHX2 LHX2: LIM homeobox 2

B19, 20 MADH3 SMAD3: SMAD, mothers against DPP homolog 3(Drosophila)

C1, 2 MAFK MAFK: v-maf musculoaponeurotic fibrosarcoma oncogenhomolog K (avian)

C3, 4 MAX MAX: MAX protein

e)

4 S. Kojic et al. / Archives of Biochemistry and Biophysics xxx (2010) xxx–xxx

YABBI 5718 No. of Pages 9, Model 5G

10 July 2010

Pl

C5, 6 MECP2 MECP2: methyl CpG binding protein 2 (Rett syndrom

C21, 22 NFIL3 NFIL3: nuclear factor, interleukin 3 regulated

ease cite this article in press as: S. Kojic et al., Arch. Biochem. Biophys. (2010),

promoterGO:0006350 transcriptionGO:0045944 positive regulation of transcription from RNA polymerase IIpromoterGO:0001702 gastrulation with mouth forming secondGO:0007275 multicellular organismal developmentGO:0009948 anterior/posterior axis specificationGO:0016055 Wnt receptor signaling pathwayGO:0021549 cerebellum developmentGO:0006355 regulation of transcription, DNA-dependentGO:0007399 nervous system developmentGO:0007420 brain developmentGO:0007498 mesoderm developmentGO:0009953 dorsal/ventral pattern formationGO:0000122 negative regulation of transcription from RNA polymerase IIpromoterGO:0001666 response to hypoxiaGO:0001707 mesoderm formationGO:0002076 osteoblast developmentGO:0006917 induction of apoptosis

e GO:0006355 regulation of transcription, DNA-dependentGO:0007399 nervous system developmentGO:0006355 regulation of transcription, DNA-dependentGO:0006366 transcription from RNA polymerase II promoterGO:0000122 negative regulation of transcription from RNA polymerase IIpromoterGO:0006350 transcriptionGO:0006355 regulation of transcription, DNA-dependentGO:0006350 transcriptionGO:0006355 regulation of transcription, DNA-dependent

doi:10.1016/j.abb.2010.06.029

240

241

242

243

244

245

246d247o248.249r250e251

252

253

254e255if256-257It258]259e260l261s

Table 1 (continued)

Position on thearray

Genesymbol

Protein description

D17, 18 P53 TP53: tumor protein p53 (Li-Fraumeni syndrome)

Fig. 2. Ankrd1/CARP interacts with p53 in vitro. GST pull-down was performed inc –Sepharose, (pannel on the left showing SDS–PAGE) with endogenous p53 from CO mtransfected COS7 cells (first, second and third panel on the right, respectively). The p

n),

o-d

wd).3

S. Kojic et al. / Archives of Biochemistry and Biophysics xxx (2010) xxx–xxx 5

YABBI 5718 No. of Pages 9, Model 5G

10 July 2010

Fig. 3. In vivo interaction between Ankrd1/CARP and p53. Co-immunoprecipitatioof Ankrd1/CARP and p53 from lysates of untransfected COS7 cells (first columnCOS7 cells transfected with only pCMV-FLAG-Ankrd1/CARP (second column), ctransfected with pCMV-FLAG-Ankrd1/CARP and pEGFP-p53 (third column) anwith only pEGFP-p53 (fourth column). The cell lysates were incubated with EZvieanti-FLAG affinity gel, proteins from complex were separated by SDS–PAGE anthen immunoblotted and probed using a monoclonal anti-p53 antibody (first rowCell lysates were immunoblotted using anti-FLAG (second row) and anti-p5antibodies (third row).

nhdts

P.

262-263P264-2650-266-267d268e269e

Ankrd2/Arpp promoter is inactive in SaOs2 cells, it was tested iC2C12 mouse skeletal muscle cells. Cells were co-transfected witpromoter-reporter plasmids, a p53 expressing construct anincreasing amounts of Ankrd1/CARP. We observed modesenhancement of p53 mediated up-regulation of all three promoter(Fig. 4) suggesting fine tuning of the p53 activity by Ankrd1/CAR

Please cite this article in press as: S. Kojic et al., Arch. Biochem. Biophys. (2

Ankrd1/CARP alone had no influence on the activity of the testepromoters. We were able to show that Ankrd1/CARP, similarly tAnkrd2/Arpp, acts as a positive regulator of p53 trans-activationAnkrd1/CARP mediated up-regulation of the Ankrd2/Arpp promoteby p53 indicates that MARP family members could regulatexpression of each other.

p53 and MyoD up-regulate ANKRD1 promoter activityin C2C12 skeletal muscle cells

Transcriptional regulation of ANKRD1 gene in skeletal musclhas not been extensively studied. We wanted to investigatep53 could regulate Ankrd1/CARP promoter activity, as p53 is involved in regulation of muscle-specific protein expression [28].has previously been demonstrated by ChIP-on-chip analysis [29that Ankrd1/CARP is a target of MyoD. Taking into account thlow level of Ankrd1/CARP expression in fetal and adult skeletamuscle [4,17] and its presumed function in regulatory networkthat control myogenic differentiation, we used a promoter-reporter assay to test MyoD dependent regulation of the Ankrd1/CARpromoter in skeletal muscle. In silico analysis of the ANKRD1 proximal promoter region consisting of a 206 bp fragment of the 5flanking sequence and a 243 bp fragment of the 50-untranslated region of human ANKRD1 gene revealed several potential p53 anMyoD binding sites. In order to check if p53 and MyoD activatthe ANKRD1 promoter, C2C12 mouse skeletal muscle cells wer

Gene ontology biological process terms

GO:0006366 transcription from RNA polymerase II promoterGO:0006955 immune responseGO:0048511 rhythmic processGO:0000060 protein import into nucleus, translocationGO:0000122 negative regulation of transcription from RNA polymerase IIpromoterGO:0001701 in utero embryonic developmentGO:0001836 release of cytochrome c from mitochondriaGO:0002309 T cell proliferation during immune response

ubating equal amounts of GST and GST-Ankrd1/CARP, immobilized on glutathioneS7 cells, in vitro transcribed/translated (IVTT) p53 and overexpressed GFP-p53 fro53 protein bound to GST-Ankrd1/CARP was detected with anti-p53 antibody.

010), doi:10.1016/j.abb.2010.06.029

270 tra271 AN272 pC273 m274 M275 m276 su277 re278 ab

279 Di

280

281 do282 or283 co

284Ankrd1/CARP is also highly expressed during cardiac muscle devel-285opment, in the nuclei of cardiomyocytes, before sarcomeres are286formed [4]. The question of its function in undifferentiated muscle287cells is still to be resolved; we hypothesize that in the absence of288the sarcomere Ankrd1/CARP has only regulatory function and is in-289volved in the signaling cascade during myogenic differentiation.290Myogenesis is governed by myogenic regulatory factors (MRFs),291which include MyoD, a founding member of the MRF family. MRFs292activate the expression of genes that specify muscle. A regulatory293cascade induced by expression of MyoD and Myf5 subsequently294leads to expression of myogenin and MEF2, promoting conversion295of myoblasts to myotubes. MyoD regulates the expression of genes296necessary for terminal differentiation, such as p21, and myogenesis297proceeds through irreversible cell cycle arrest of myoblasts, fol-298lowed by their fusion into multinucleate myofibers. From research299to identify downstream targets of key muscle regulators MyoD,300myogenin and MEF2, it was found that transcription factors repre-301sent the most prominent functional group involved in propagation302and amplification of signals initiated by MRFs [29]. A striking out-303come of this study was identification of a cluster of genes that are304induced under stress conditions and that control stress response305pathways. Among them were factors involved in responding to306muscle-specific stress (stretch or sarcomeric dysfunction) such as307Ankrd1/CARP, Ankrd2, MLP and calcineurin.308

309CA310An311tio312qu313fac314fie315Fig316re317sh318re319sp320an321tio322in323to324ce325fie326tu327en328sp329ba330ca331its332tio333HE334An335ve336be337CA338of339sio340in341

342wi343as344M345ne346to347m348of349[2

FigtrareptogArpindtheRennome

6 S. Kojic et al. / Archives of Biochemistry and Biophysics xxx (2010) xxx–xxx

YABBI 5718 No. of Pages 9, Model 5G

10 July 2010

Pl

nsiently co-transfected with the reporter plasmid pGL4.10-KRD1 (�206/+243) and the expression vectors pCDNA3-p53 orDNA3-MyoD. The luciferase activity driven by the ANKRD1 pro-

oter was increased in a dose-dependent manner, when bothyoD (Fig. 5A) and p53 (Fig. 5B) were expressed. MyoD aug-ented the ANKRD1 promotor activity more than p53. Our resultsggest that p53 and MyoD might mediate the transcriptional up-gulation of Ankrd1/CARP in skeletal muscle cells and that p53 isle to regulate expression of its co-activator.

scussion

The structural and regulatory function of Ankrd1/CARP is wellcumented in differentiated muscle cells where sarcomere is fullydered and functional; it acts as a messenger, shuttling from sar-mere to the nucleus, mediating stress response [1,3]. But,

. 4. Ankrd1/CARP enhances the transcriptional ability of p53. Cells were co-nsfected with p21WAF1/CIP1 promoter-LUC reporter (500 ng), Mdm2 promoter-LUCorter (150 ng) and Ankrd2/Arpp promoter (�439/+7)-LUC reporter (500 ng)ether with pCDNA3-p53 (2 ng for p21WAF1/CIP1 and Mdm2 and 250 ng for Ankrd2/p) either alone or with increasing amounts of pCDNA3-Ankrd1/CARP asicated. The amount of total DNA used in transfections was kept constant byaddition of pCDNA3 vector. The cells were also co-transfected with 30 ng of

illa luciferase reporter (pRL-TK) as a control. The firefly luciferase activity wasrmalized against Renilla luciferase. Values are the means ± SD of three experi-nts performed in triplicate. *p < 0.05 versus control sample.

ease cite this article in press as: S. Kojic et al., Arch. Biochem. Biophys. (2010),

In order to identify potential downstream targets of Ankrd1/RP that could further propagate MRFs signals we screenedkrd1/CARP for its ability to interact with and modulate the func-n of known transcriptional factors. We used protein array as aick method to survey direct interactions between transcriptiontors and Ankrd1/CARP. As a result of this experiment we identi-d 17 transcription factors as potential Ankrd1/CARP targets (see. 1 and Table 1) with different binding affinity as judged by the

lative intensity of the signal. Although the intensity of the signalould be proportional to the binding affinity, interpretation of thesults must be made with caution because recombinant proteinsotted on the membrane are denatured and unphosphorylatedd the probe protein is also unphosphorylated. Once an interac-n has been identified it represents a starting point for further

vestigation. Several of the proteins identified with the potentialinteract with Ankrd1/CARP are involved in developmental pro-

sses, these are HOXA5, KLF12, LDB1, MECP2, LHX2. Other identi-d binding partners are involved in regulation of apoptosis andmor suppression (IRF1, p53, HDAC1), cell proliferation and differ-tiation (MAX), the TGF-b signaling pathway (SMAD3), immune re-onse (NFIL3) and hematopoiesis (MAFK). It is notable that thesic helix-loop-helix transcription factors HEY1 and HAND2 arerdiac-specific and their interaction with Ankrd1/CARP supportsrole in heart development. The role of HEY1 and HEY2 in regula-n of Ankrd1/CARP expression has already been documented [30].Y1 is exclusively active in the atria [31] and it is interesting thatkrd1/CARP is expressed at higher levels in atria as compared tontricles [4,17] thus indicating a possible role of HEY1 in cham-r-dependent ANKRD1 gene expression. Interaction of Ankrd1/RP with c-jun and v-jun could implicate their role in regulationdownstream genes activated upon mechanical stimuli, as expres-n of both Ankrd1/CARP [32] and c-jun [33] mRNAs are rapidly

creased in response to mechanical stress.We focused our attention on the interaction of Ankrd1/CARP

th p53 for several reasons. First, it was not entirely unexpectedwe had previously shown that p53 interacted with another

ARP family member Ankrd2/Arpp [2]. Thus, p53 represents aw common interacting partner for both MARP family members,gether with YB-1 and titin, suggesting their involvement in com-on regulatory pathways. Also, increased transcriptional activity

p53 protein has been observed in muscle differentiation8,34] and several lines of evidence support the role of p53 in

doi:10.1016/j.abb.2010.06.029

350

351

352

353

354

355

356

357

358

359

360

361

362

363

364

365

366

367

368

369

370

371

372

373

374

375

376

377

378

379

380

381

382

383

384

385

386

387

388

389

390

S. Kojic et al. / Archives of Biochemistry and Biophysics xxx (2010) xxx–xxx 7

YABBI 5718 No. of Pages 9, Model 5G

10 July 2010

dg-tfgs,3t,sltl-f

det

f-2is

391-392/393-394e395ls396-397t398-399g400

401f402,403-404l-405f406s407n408P409n410

12 Cof e sehree

muscle-specific stress response. Similarly to Ankrd1/CARP anAnkrd2/Arpp, p53 is up-regulated after resistance exercise actinas mediator in biochemical cascades leading to muscle hypertrophy [12]. Mechanical stretch is able to induce p53-dependenapoptosis in myocytes and cell cycle alteration by modulation op53 regulated p21 expression in cardiac fibroblasts [35,36]. Durinheart development and mechanical stress response in adultexpression profiles of Ankrd1/CARP and p53 are parallel. The p5transcripts decrease rapidly during early postnatal developmenbecoming almost undetectable in fully differentiated myocyte[37]. On the other hand, moderate sarcomere stretching of aduventricular myocytes is associated with the activation of p53, folowed by programmed cell death shortly after the imposition othe mechanical stimulus [35]. Interaction between p53 anAnkrd1/CARP suggests that Ankrd1/CARP could act as one of thtissue specific regulators of p53 function during developmenand in stress response pathways.

In luciferase reporter assays Ankrd1/CARP has a stimulatory efect on p53-mediated transcriptional activation of the p21, Mdmand Ankrd2/Arpp promoters. The expression of the p21 gene

Fig. 5. MyoD and p53 are upstream effectors of the ANKRD1 gene expression. C2Cand 50 ng of Renilla luciferase reporter plasmids along with increasing amountsactivity was normalized against Renilla luciferase. Values are the means ± SD of t

tightly controlled by p53, through which it mediates p53-depen-dent cell cycle arrest in response to a variety of stress stimuli.The modest increase of p21 expression in vascular smooth musclecells is associated with Ankrd1/CARP overexpression [20]. Laureand colleagues [38] showed that p21 gene expression paralleledthe increase in Ankrd1/CARP expression in the denervation-in-duced and muscular dystrophy atrophy models. Expression of bothgenes was increased in case of muscle degeneration and progres-sively decreased back to control levels upon reinnervation. Our re-sults show that Ankrd1/CARP has an indirect effect on themoderate up-regulation of p21 promoter through modulation ofp53 activity. This finding is consistent with the observed moderateup-regulation of p21 expression associated with Ankrd1/CARPoverexpression and supports the role of Ankrd1/CARP in coordina-tion of the expression of genes involved in cell proliferation duringmuscle cell differentiation. Our finding that up-regulation of p21through Ankrd1/CARP is dependent on p53 activation gives anindication of the molecular mechanism underlying Ankrd1/CARPmediated control of p21 expression.

Another process in which p53 and Ankrd1/CARP might act to-gether is the promotion of tumor development. ANKRD1 is one of

411f

Please cite this article in press as: S. Kojic et al., Arch. Biochem. Biophys. (2

the genes cooperatively induced by both the TGF-b and Wnt pathways in normal murine mammary gland epithelial cells. Ankrd1CARP also displays increased expression in models of Wnt/ b-catenin-induced tumors [39]. Taking into account that p21 is one of thprimary targets of TGF-b signaling in vascular smooth muscle cel[40] and that activated p53 down-regulates b-catenin, a key component of the Wnt signaling pathway [41], one can speculate thaAnkrd1/CARP regulates downstream targets of p53 through modulation of p53 function, in both the TGF-b and Wnt signalinpathways.

Our results represent the first report of the positive effect oAnkrd1/CARP on the expression of downstream targets (p21Mdm2 and Ankrd2/Arpp) mediated by up-regulation of p53 activity. There are several lines of evidence, restricted to in vitro cutured cardiomyocytes, regarding a negative regulatory role oAnkrd1/CARP in cardiac gene expression. Ankrd1/CARP interactwith YB-1 and prevents the activation of the myosin light chai2 promoter in ventricular cardiomyocytes [4]. Forced Ankrd1/CARexpression inhibits activity of atrial natriuretic factor and troponiC gene promoters in neonatal cardiomyocytes [17].

So far, little is known about the transcriptional regulation o

mouse skeletal muscle cells were transfected with 500 ng of ANKRD1(�206/+243)-LUxpression vector for MyoD (A) and p53 (B) as indicated, for 24 h. The firefly lucifera

experiments performed in triplicate. *p < 0.05 versus control sample.

412ANKRD1 gene expression in skeletal muscle cells. Blais and cowork-413ers [29] using genome-wide transcriptional binding and expression414profiling, in order to assemble a regulatory network that controls415the myogenic differentiation program in mammalian cells, discov-416ered that Ankrd1/CARP is one of the MRFs targets in C2C12 cells.417Activation of the ANKRD1 promoter driven by MyoD, as we demon-418strated by promoter-reporter assays, implicates that Ankrd1/CARP419expression in skeletal muscle cells is governed by this universal420regulator of skeletal muscle differentiation. The Ankrd2/Arpp pro-421tein, predominantly expressed in skeletal muscle, is under the con-422trol of MyoD [42]. We also demonstrate that p53 can significantly423activate the ANKRD1 promoter leading to up-regulation of Ankrd1/424CARP expression. Both binding to DNA and the transcriptional425activity of p53 notably increase during muscle differentiation de-426spite decline in its synthesis. Cooperatively with MyoD, p53 partic-427ipates in induction of muscle creatine kinase gene expression [28].428In conclusion, we report identification of the tumor suppressor429protein p53 as a new interacting partner of the cardiac-specific430MARP family member Ankrd1/CARP. Their interaction is demon-431strated both in vitro and in vivo. Ankrd1/CARP acts as a positive

010), doi:10.1016/j.abb.2010.06.029

432 cofactor for p53 by up-regulating p21, an inhibitor of the cell cycle,433 as well as promoters of Mdm2 and Ankrd2/Arpp genes. In turn p53434 up-regulates ANKRD1 promoter activity. These interactions could435 have impact on different cellular processes such as myogenic dif-436 ferentiation during embryogenesis, muscle remodeling due to var-437 ious stress triggers, apoptosis or tumorogenesis. Our results438 confirmed that Ankrd1/CARP is a downstream target of MyoD, sug-439 gesting that the MyoD signal is propagated by p53 through440 Ankrd1/CARP, regulating p21 involved in terminal withdrawal441 from the cell cycle during myogenic differentiation.

442 Acknowledgments

443 This work was supported by Collaborative Research Pro-444 gramme, ICGEB, Italy (CRP/YUG-05-01) and Ministry of Science445 and Technological Development of Serbia (Project No. 143051).446 The financial support of Telethon-Italy to G. Faulkner (Grant447 GGP04088) is gratefully acknowledged. We are grateful to Dr. D.448 Radojkovic and Prof. Dr. A. Savic for critical reading of the paper.

449 References

450 [1] M.K. Miller, M.L. Bang, C.C. Witt, D. Labeit, C. Trombitas, K. Watanabe, H. Granzier,451 A.S. McElhinny, C.C. Gregorio, S. Labeit, J. Mol. Biol. 333 (2003) 951–964.452 [2] S. Kojic, E. Medeot, E. Guccione, H. Krmac, I. Zara, V. Martinelli, G. Valle, G.453 Faulkner, J. Mol. Biol. 339 (2004) 313–325.454 [3] I.A. Barash, M.L. Bang, L. Mathew, M.L. Greaser, J. Chen, J.R. Lieber, Am. J.455 Physiol. Cell Physiol. 293 (2007) C218–C227.456 [4] Y. Zou, S. Evans, J. Chen, H. Kuo, R.P. Harvey, K.R. Chien, Development 124457 (1997) 793–804.458 [5] H. Kuo, J. Chen, P. Ruiz-Lozano, Y. Zou, M. Nemer, K.R. Chien, Development 126459 (1999) 4223–4234.460 [6] Y. Aihara, M. Kurabayashi, Y. Saito, Y. Ohyama, T. Tanaka, S. Takeda, K. Tomaru,461 K. Sekiguchi, M. Arai, T. Nakamura, R. Nagai, Hypertension 36 (2000) 48–53.462 [7] O. Zolk, M. Frohme, A. Maurer, F. Kluxen, B. Hentsch, D. Zubakov, J.D. Hoheisel,463 I.H. Zucker, S. Pepe, T. Eschenhagen, Biochem. Biophys. Res. Commun. 293464 (2002) 1377–1382.465 [8] M. Moulik, M. Vatta, S.H. Witt, A.M. Arola, R.T. Murphy, W.J. McKenna, A.M.466 Boriek, K. Oka, S. Labeit, N.E. Bowles, T. Arimura, A. Kimura, J.A. Towbin, J. Am.467 Coll. Cardiol. 54 (2009) 325–333.468 [9] L. Duboscq-Bidot, P. Charron, V. Ruppert, L. Fauchier, A. Richter, L. Tavazzi, E.469 Arbustini, T. Wichter, B. Maisch, M. Komajda, R. Isnard, E. Villard, Eur. Heart J.470 302 (2009) 128–136.471 [10] T. Arimura, J.M. Bos, A. Sato, T. Kubo, H. Okamoto, H. Nishi, H. Harada, Y. Koga,472 M. Moulik, Y.L. Doi, J.A. Towbin, M.J. Ackerman, A. Kimura, J. Am. Coll. Cardiol.473 54 (2009) 334–342.474 [11] I.A. Barash, L. Mathew, A.F. Ryan, J. Chen, R.L. Lieber, Am. J. Physiol. Cell Physiol.475 286 (2004) 355–364.476 [12] Y.W. Chen, G.A. Nader, K.R. Baar, M.J. Fedele, E.P. Hoffman, K.A. Esser, J. Physiol.477 545 (2002) 27–41.478 [13] J.A. Carson, D. Nettleton, J.M. Reecy, FASEB J. 16 (2002) 207–209.

479[14] C. Nakada, Y. Tsukamoto, A. Oka, I. Nonaka, S. Takeda, K. Sato, S. Mori, H. Ito, M.480Moriyama, Lab. Invest. 83 (2003) 711–719.481[15] C. Nakada, A. Oka, I. Nonaka, K. Sato, S. Mori, H. Ito, M. Moriyama, Pathol. Int.48253 (2003) 653–658.483[16] K. Nakamura, C. Nakada, K. Takeuchi, M. Osaki, K. Shomori, S. Kato, E. Ohama,484K. Sato, M. Fukayama, S. Mori, H. Ito, M. Moriyama, Pathobiology 70 (2002)485197–203.486[17] R. Jeyasseelan, C. Poizat, R.K. Baker, S. Abdishoo, L.B. Isterabadi, G.E. Lyons, L.487Kedes, J. Biol. Chem. 272 (1997) 22800–22808.488[18] T. Maeda, J. Sepulveda, H.H. Chen, A.F. Stewart, Gene 297 (2002) 1–9.489[19] O. Zolk, M. Marx, E. Jäckel, A. El-Armouche, T. Eschenhagen, Cardiovasc. Res. 59490(2003) 563–572.491[20] H. Kanai, T. Tanaka, Y. Aihara, S. Takeda, M. Kawabata, K. Miyazono, R. Nagai,492M. Kurabayashi, Circ. Res. 88 (2001) 30–36.493[21] E. Takimoto, T. Mizuno, F. Terasaki, M. Shimoyama, H. Honda, I. Shiojima, Y.494Hiroi, T. Oka, D. Hayashi, H. Hirai, S. Kudoh, H. Toko, K. Kawamura, R. Nagai, Y.495Yazaki, I. Komuro, Biochem. Biophys. Res. Commun. 270 (2000) 1074–1079.496[22] X.J. Han, J.K. Chae, M.J. Lee, K.R. You, B.H. Lee, D.G. Kim, J. Biol. Chem. 280497(2005) 23122–23129.498[23] M.L. Bang, R.E. Mudry, A.S. McElhinny, K. Trombitas, A.J. Geach, R. Yamasaki, H.499Sorimachi, H. Granzier, C.C. Gregorio, S. Labeit, J. Cell Biol. 153 (2001) 413–427.500[24] M. Torrado, B. Nespereira, E. López, A. Centeno, A. Castro-Beiras, A.T.501Mikhailov, J. Mol. Cell Cardiol. 38 (2005) 353–365.502[25] S.H. Witt, D. Labeit, H. Granzier, S. Labeit, C.C. Witt, J. Muscle Res. Cell Motil. 26503(2005) 401–408.504[26] C.C. Witt, S.H. Witt, S. Lerche, D. Labeit, W. Back, S. Labeit, EMBO J. 27 (2008)505350–360.506[27] M. Ashburner, C.A. Ball, J.A. Blake, D. Botstein, H. Butler, J.M. Cherry, A.P. Davis,507K. Dolinski, S.S. Dwight, J.T. Eppig, M.A. Harris, D.P. Hill, L. Issel-Tarver, A.508Kasarskis, S. Lewis, J.C. Matese, J.E. Richardson, M. Ringwald, G.M. Rubin, G.509Sherlock, Nat. Genet. 25 (2000) 25–29.510[28] Y. Tamir, E. Bengal, Oncogene 17 (1998) 347–356.511[29] A. Blais, M. Tsikitis, D. Acosta-Alvear, R. Sharan, Y. Kluger, B.D. Dynlacht, Genes.512Dev. 19 (2005) 553–569.513[30] A. Fischer, J. Klattig, B. Kneitz, H. Diez, M. Maier, B. Holtmann, C. Englert, M.514Gessler, Mol. Cell. Biol. 25 (2005) 8960–8970.515[31] C. Leimeister, A. Externbrink, B. Klamt, M. Gessler, Mech. Dev. 85 (1999) 173–516177.517[32] M. Lehti, R. Kivelä, P. Komi, J. Komulainen, H. Kainulainen, H. Kyrolainen, J.518Appl. Physiol. 106 (2009) 1419–1424.519[33] N.J. Osbaldeston, D.M. Lee, V.M. Cox, J.E. Hesketh, J.F. Morrison, G.E. Blair, D.F.520Goldspink, Biochem. J. 308 (1995) 465–471.521[34] S. Soddu, G. Blandino, R. Scardigli, S. Coen, A. Marchetti, M.G. Rizzo, G. Bossi, L.522Cimino, M. Crescenzi, A. Sacchi, J. Cell Biol. 134 (1996) 193–204.523[35] A. Leri, P.P. Claudio, Q. Li, X. Wang, K. Reiss, S. Wang, A. Malhotra, J. Kajstura, P.524Anversa, J. Clin. Invest. 101 (1998) 1326–1342.525[36] X.D. Liao, X.H. Wang, H.J. Jin, L.Y. Chen, Q. Chen, Cell Res. 14 (2004) 16–26.526[37] K.K. Kim, M.H. Soonpaa, A.I. Daud, G.Y. Koh, J.S. Kim, L.J. Field, J. Biol. Chem. 269527(1994) 22607–22613.528[38] L. Laure, L. Suel, C. Roudaut, N. Bourg, A. Ouali, M. Bartoli, I. Richard, N. Daniele,529FEBS J. 276 (2009) 669–684.530[39] E. Labbe, L. Lock, A. Letamendia, A.E. Gorska, R. Gryfe, S. Gallinger, H.L. Moses,531L. Attisano, Cancer Res. 67 (2007) 75–84.532[40] M.B. Datto, Y. Yu, X.F. Wang, J. Biol. Chem. 270 (1995) 28623–28628.533[41] E. Sadot, B. Geiger, M. Oren, A. Ben-Ze’ev, Mol. Cell Biol. 21 (2001) 6768–5346781.535[42] C. Bean, M. Salamon, A. Raffaello, S. Campanaro, A. Pallavicini, G. Lanfranchi, J.536Mol. Biol. 349 (2005) 349–366.

537

8 S. Kojic et al. / Archives of Biochemistry and Biophysics xxx (2010) xxx–xxx

YABBI 5718 No. of Pages 9, Model 5G

10 July 2010

Please cite this article in press as: S. Kojic et al., Arch. Biochem. Biophys. (2010), doi:10.1016/j.abb.2010.06.029