Plant Molecular Biology 32:707-716, 1996. 707 (~ 1996 Kluwer Academic Publishers. Printed in Belgium,

A family of novel myb-related genes from the resurrection plant Craterostigma plantagineum are specifically expressed in callus and roots in response to ABA or desiccation

Gabr i e l I tu r r i aga 1,*, L u c L e y n s l , A n t o n i o Vi l legas 1, R i m a G h a r a i b e h I ,

F r a n c e s c o Sa l amin i 2 and D o r o t h e a Bar te l s 2 i lnstituto de Biotecnologfa-UNAM, Av. Universidad 2001, Col. Chamilpa, Cuernavaca Mor. 62210, Mexico

(*author for correspondence); 2Max Planck Institut fiir Ziichtungsforschung, Carl yon Linnd-weg 10, D-50829 Krln, Germany

Received 13 October 1995; accepted in revised form 18 July 1996

Key words: abscisic acid (ABA), callus, desiccation, myb genes, resurrection plant, root

Abstract

A cDNA and two genomic clones comprising highly similar genes that encode a protein with a Myb-related DNA-binding domain were isolated from the resurrection plant Craterostigma plantagineum. The structure of cpm5 and cpmlO (Craterostigma plantagineum myb) genes consists of three putative exons encoding a protein of 36.6 kDa. The cDNA of cpm7 encodes a closely related protein of 36.8 kDa. The canonical Myb domain present in transcriptional activators of yeast, animals and plants was localized in the amino terminus of deduced Cpm5, Cpm7 and Cpml0 proteins and corresponds to the two Myb repeats found in plants. The Myb domain of Cpm deduced proteins and a short stretch of amino acids adjacent to this region are closely related to a myb gene from Arabidopsis thaliana which is expressed in response to osmotic stress and ABA. The rest of the deduced protein has no similarity to other reported sequences. The myb-related genes in the Craterostigma genome comprise a small gene family of 6-8 members as estimated by hybridization with a bonafide Myb domain probe. Northern blot experiments showed specific expression of cpmlO in undifferentiated callus tissue up-modulated by ABA and expression of cpm7 mRNA in roots up-regulated by dehydration.

Introduction

In eukaryotes gene activation at the transcription- al level is mediated by DNA-binding proteins which interact with gene promoters. The interaction of posit- ive and negative transcription factors influence the pat- tern of gene expression leading to cell and tissue differ- entiation and adaptation to biotic and abiotic stresses. An extensive number of genes encoding transcriptional activators with conserved DNA-binding domains such as zinc fingers, leucine zippers, MADS, homeo and myb boxes, have been found in animals, fungi and plants [30, 45]. Except for these specific motifs, the

The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number U33915-U33917.

remaining part of the encoded protein is often variable in related genes from the same or different organisms.

In higher plants, several genes encoding transcrip- tion factors have been characterized, although only a few of them have been functionally analysed. For instance, genes belonging to the MADS-box family control flower development in Arabidopsis thaliana [64] and Antirrhinum majus [52]. The homeobox gene knotted has a role in leaf initiation in maize [60]. A protein with a zinc-binding motif, COP1, is involved in photomorphogenesis in Arabidopsis [ 10].

The Myb DNA-binding sequence is present in genes from many different organisms [36]. The Myb domain was originally characterized as the avian myel- oblastosis virus oncogene v-myb [32]. The cellular proto-oncogene c-myb is involved in differentiation of haematopoietic cells [55]. At the protein level the

708

Myb motif comprise three imperfect repeats of 51-53 amino acids [14] each containing tryptophan residues at conserved positions [1]. Within each repeat there is a helix-turn-helix (HTH)-related structure joined to another c~-helix by an unconventional turn. The struc- ture of the myb HTH motif has some degree of simil- arity to homeodomains and DNA-binding domains of bacterial repressors [43].

Several myb-like genes have been isolated from plants. In fact, the first transcription factor described from plants was the maize cl gene which encodes a Myb-related protein [46]. This gene is involved in the regulation of the anthocyanin biosynthesis in maize kernels during seed maturation by trans-activating structural genes such as c2, A1 and Bzl which encode enzymes involved in the flavonoid pathway [12]. Recently, it has been shown that in flowers a Myb- related protein controls the gene encoding phenylalan- ine ammonia-lyase, the first enzyme in the phenylpro- panoid biosynthetic pathway [50]. Another well char- acterized myb gene is Glabrous-1 from A. thaliana which is expressed in stipules and is involved in trich- ome formation [44]. Osmotic stress and ABA treatment in A. thaliana induce expression of the myb homologue Atmyb2 which seems to function as a positive regulator of genes responding to desiccation and salt stress [59]. Besides the plant myb genes mentioned above, other sequences from maize and barley [38], A. majus [27], A. thaliana [48], petunia [2], potato [3], tomato [35] and the moss Physcomitrella patens [34] have been reported as myb-related genes but their function are unknown.

We are interested in the transduction pathway triggered by water deficit in the desiccation-tolerant plant Craterostigma plantagineum [15]. This resurrec- tion plant can withstand complete dehydration for long periods and resumes its normal shape and physiology upon rehydration. Several genes induced by drought from Craterostigma have been isolated and sequenced [4, 5, 48]. As an initial step towards characterizing transcription factor genes involved in desiccation tol- erance from Craterostigma, its myb genes are being studied.

Here we describe the molecular characterization of three closely related myb genes from Craterostigma. The possible role for these genes is discussed based on their sequence similarities and expression patterns.

Materials and methods

Plant material

Plants ofNicotiana tabacum cv. Samsun NN and Ara- bidopsis thaliana (Landsberg ecotype) were propag- ated axenically under standard tissue culture condi- tions. Plants and callus tissue of C. plantagineum Hochst. were propagated as reported before [4]. Leaf and roots were dehydrated for 2 or 16 h and callus were treated with 100 #M ABA for 4 days or dehydrated for 2 days.

Recombinant DNA techniques

Genomic and plasmid DNA isolation, bacterial trans- formation, genomic and cDNA clone identification vere performed according to standard procedures [51]. 32p-labelled DNA fragments were obtained as described [ 13].

Isolation of genomic and cDNA clones

In order to isolate myb-related genes from C. planta- gineum a genomic library [40] was used to screen 3 x 105 plaque forming units (p.f.u.) at hybridization con- ditions of 55 °C and 4 x SSC, using as a probe a 640 bp ApaI-BamHI DNA fragment which encodes the Myb domain from the barley Hv5 cDNA clone [62]. To isol- ate cDNA clones a library was prepared with mRNA from ABA-treated callus using a ZAP cDNA synthesis kit, Uni-ZAP XR vector and Gigapack II Gold clon- ing kit (Stratagene Cloning Systems). Five clones were recovered after screening 1.5 x 105 p.f.u, at hybrid- ization conditions of 65 °C and I x SSC, using as a probe a 350 bp HincII-NarI DNA fragment encoding a gene-specific region ofcpmlO clone which lies at the 3 ~ of the myb region. In vivo excision of the BlueScript phagemids was performed according to the manufac- turer's instructions (Stratagene Cloning Systems). The clone containing the largest insert, cpm7, was selected for DNA sequencing.

DNA sequencing and computer analysis

Appropriate restriction fragments of the genom- ic clones cpm5 and cpmlO were subcloned into pBluescript II KS+ vector (Stratagene Cloning Sys- tems). After creating Exonuclease III deletions [24], subcloning internal restriction fragments or using gene-specific primers of the DNA fragments encom-

passing the entire genes, the nucleotide sequence was obtained by the dideoxy chain termination method using the Sequenase Version 2.0 DNA Sequencing kit (United States Biochemical Corporation). DNA and protein sequence comparisons were analysed with the programs FASTA and TFASTA, respectively, from the University of Wisconsin Genetics Computer Group (UWGCG) software package version 7.2 [11]. Mul- tiple alignment and a dendrogram of relationship between sequences were obtained using the PILEUP program from UWGCG software package version 7.2.

Southern and northern analysis

A 10 #g portion of genomic DNA were fraction- ated on a 0.8% agarose gel and blotted onto Hybond N + nylon membrane (Amersham Life Science) as described before [51]. The filter was hybridized with 32p-labelled probe either at 65 °C and 1 x SSC or at 55 °C and 4 × SSC conditions as indicated in the text (1 x SSC = 0.15 M NaCI and 0.015 M sodium-citrate). RNA gel blot analysis was performed as previously described using 2#g of poly(A) + mRNA [4].

Results

Isolation and sequence analysis ofmyb genes from C. plantagineum

Genomic Southern analysis was conducted to identi- fy myb-related sequences in the Craterostigma gen- ome. When using a bonafide Myb domain probe from the barley Hv5 cDNA clone [62] and 55 °C, 4x SSC as hybridization conditions, about 6 to 8 myb-related sequences seem to exist in this plant (Fig. 1A, lanes 1- 3). Thus a small multigene family of myb genes seems to be present in Craterostigma.

Based on these results, a genomic library from C. plantagineum was screened for myb-related genes using as a probe a DNA fragment encoding a Myb domain from a barley gene [62]. Two lambda clones, designated cpm5 and cpmlO (cprn for Craterostigma plantagineum myb-related genes), overlap in a 10.5 kb fragment and showed nearly identical restriction maps (Fig. 2). After digestion with BamHI, a 0.5 kb frag- ment, present in both cpm5 and cpmlO clones, was the only DNA band that hybridyzed to the probe (Fig. 2). Hence gene identity was initially deduced by DNA sequencing this 0.5 kb BamHI fragment from both genes. Sequence analysis comprised 1548 bp of cpm5

709

Figure 1. Southern blot analysis of myb-related sequences in gen- omic DNA. A. Genomic DNA of C. plantagineum was digested with the following restriction enzymes: lane 1, EcoRI; lane 2, HindlII; lane 3, EcoRl+HindlII, and hybridized at 4x SSC and 55 °C with barley Hv5 cDNA fragment containing the myb region. B. Equal amounts of DNA of C. plantagineum (lanes 1-3), A. thaliana (lanes 4 and 5) and tobacco (lanes 6 and 7) were digested with: (lanes 1, 4, 6) EcoRI, (lanes 2, 5, 7) EcoRI+SalI, (lane3) XbaI+Sail, and hybridized at 1 x SSC and 65 °C with a DNA fragment encoding a gene-specific region of cpmlO clone which lies at the 3 r end myb region• Positions of DNA molecular weight markers are indicated.

. BBx ~i

R

cprn10 (15.3 kb)

R / /

0 8 x

"'-.., "-- . .

q~

Figure 2. Molecular structure of myb-related genes cpm5 and cpmlO from C. plantagineum, Restriction map of genomic clones containing cpm5 and cmplO genes. The line represents Craterostigma DNA cloned in the BamHI site of EMBL4, left arm on the left. The black box represents the putative promoter, striped boxes represent coding region and white boxes introns. Abbreviations: B, BamHI; E, exons; I, introns; P, PstI; R, EcoRI; S, Sail; X, XbaI.

Promoter E1 E2 E3 I I1 12 200 bp

710

and 3305 bp of cpmlO. The former sequence includes the coding region, introns and the 3'-untranslated region, whereas the latter also includes the putative promoter sequence.

Isolation of a full-length cDNA clone and protein sequence comparison

In order to deduce the intron positions in cpm5 and cpmlO genes, a cDNA clone was isolated from a library prepared with mRNA from ABA-treated callus. This tissue was chosen because it expresses the genes under study (see below). The full-length cDNA clone (cpm7) is 1277 bp long without the 18 bp poly(A) tail. It has an open reding frame of 1008 bp which encodes a protein of 335 amino acids with a molecular mass of 36.8 kDa (Fig. 3). The 51-untranslated sequence of the cDNA is 124 bp and its 3 ~ trailer sequence 145 bp long.

Comparison of cpm7 cDNA with cpm5 and cpmlO genes revealed that both genes contain three exons, of the same length (178, 130 and 694 bp) encoding a 333 amino acid protein of 36.6 kDa. The encoded products of Cpm5 and Cpm 10 are mostly identical except for 5 amino acid substitutions in the carboxy-terminal half (Fig. 3). The Cpm7-encoded protein has 14 amino acid substitutions and is two amino acids longer than Cpm5 and Cpml0. This corresponds to 98% identity among Cpm5 and Cpml0 and 96% comparing them to Cpm7. In Fig. 3 the protein sequence comparison between the encoded products of cpm genes and its closest homologueAtmyb2 is shown. The most 51 ATG codon in cpm sequences is preceded by one in-frame termination codon (TAA) 39 nucleotides upstream and thus confirms the predicted molecular weight for Cpm proteins.

The splicing sites of the two introns are identical in cpm5 and cpmlO and correspond in their positions to other plant myb genes [44, 46, 59, 62]. The sequences of both introns are different in composition but similar in length. Intron 1 is 238 bp long in cpm5 and 247 bp in cpmlO, whereas intron 2 is 75 bp in cpm5 and 95 bp in cpmlO.

To establish the identity of cpm genes, a protein comparison search was made [ ! 1 ]. In Fig. 4 a dendro- gram is shown which represents the degree of pro- tein sequence similarity based on an alignment of rep- resentative Myb domains. The sequences encoded by cpm5, cpm7 and cpmlO revealed highly similar motifs characteristic of transcription factors related to Myb oncoprotein [36]. The Myb domains were localized in the amino-terminal parts of Cpm5, Cpm7 and Cpml0

proteins (Fig. 3); they contain all the conserved amino acids, including the tryptophan residues [ 1 ], known to be essential to form the structure of the Myb domain [29]. They have the two characteristic repeats (R2 and R3) of 51-53 amino acids each [14] present in all reported plant myb genes. The Myb domains encoded by cpm5, cpm7 and cpmlO are identical and show the highest similarity to Atmyb2 (92%) from Arabidop- sis, a gene implicated in drought response [59], and 90% similarity to Am340 and Am305 from Antirrhin- um which are both expressed in flowers [27]. The carboxy-terminal parts of Cpm5, Cpm7 and Cpml0 proteins (230 amino acids), do not exhibit any similar- ities to the polypeptides encoded by other myb genes, or to other protein sequences present in databases. The only exception is a stretch of 31 amino acids adjacent to the carboxy-terminal part of the Myb domain in Atmyb2 and Cpm proteins, which exhibits 87% simil- arity between both sequences (Fig. 3). The remaining carboxy part of Cpm5, Cpm7 and Cpm 10 has a rel- atively acidic region and is rich in serine and threon- ine residues which could be phosphorylated and thus contribute to the acidic character of trans-activating domains [49, 53]. There are three potential phos- phorylation sites in Cpm7 and Cpml0 but only two in Cpm5 due to an amino acid substitution in one of the consensus sites (S/T)XX(E/D) for eukaryotic kinases [47].

The 51_upstream sequence of cpm 10 which extends 1545 bp from the assumed translation start codon, con- stitutes a putative promoter region with a consensus TATA box positioned 156 bp upstream from the first ATG (Fig. 5). A search for consensus sequences recog- nized by transcriptional activators was performed. Most relevant is the presence of three Myb-responsive elements (MybRE), two of them with the consensus 5 ~- T/CAAC(T/G)G-3 ~ [6] which are recognized by anim- al and plant Myb proteins, and another with a DNA- binding site 5'-CC(T/A)ACC-3' recently reported for a plant Myb protein [20]. There are two sequences with the consensus for the as l box 5~-TGACG-3 ' respons- ible for promoting root-specific expression [33]. Also there are five elements with the ACGT core motif of the G-box [61] and ABRE (ABA-responsive ele- ment) [37], and three CEl-like (coupling element) ele- ments [54]. Only one consensus polyadenylation site AATAAA was found in the 31 non-coding region of the cDNA and the two genomic clones.

711

Figure 3. Protein sequence comparison of cpm genes and Atmyb2. The Arabidopsis AtMyb2 deduced protein [60] is shown for comparison. Sequence identity is boxed. Shaded non-boxed amino acid residues represent charge similarities. Asterisks below amino acids denote the two Myb repeats, where each repeat end is marked by arrows. Dots below residues denote a 31 amino acid-stretch of sequence similarity outside of the Myb domain.

Analysis o f m y b genes in the Craterostigma genome and in other plants

To determine the copy number of cpmlO-like genes, a genomic Southern blot was hybridized at 65 °C and 1 x SSC using as a probe the 3 ~ end region ofcpmlO which excludes the myb domain. As shown in Fig. 1B (lanes 1-3), there are 1-2 bands that hybridized to this gene- specific probe. The result suggests that cpmlO-related genes are present in one or two copies in the Crater- ostigma genome. The same probe and hybridization conditions were used to detect the possible presence of related sequences to cpmlO in the genome of Arabidop- sis and tobacco (Fig. 1 B, lanes 4-7) . No hybridization signal was observed thus suggesting that there are no closely related genes to cpmlO in these two species.

Expression pattern o f c p m genes in Craterostigma

We wanted to investigate whether cpm genes were induced by desiccation or ABA in Craterostigma. For this purpose, an RNA gel blot was hybridized to the

cpm7 probe. The cpm7 mRNA was only detected in desiccated roots (Fig. 6A, lane 7). No signal was detected in untreated roots or in other tissues ana- lysed (Fig. 6A, lanes 1-6). This observation indicates that cpm7 is induced by desiccation in a tissue-specific manner. The observed mRNA is detected as a single band of around 1.3 kb long which is consistent with the length of the cDNA (1295 bp). The filter was hybrid- ized with a desiccation-related probe pcC 11-24 [4] from C. plantagineum to confirm that all samples were correct (Fig. 6B, lanes 1-7).

The expression pattern of the cpmlO gene was determined using a gene-specific probe containing the carboxy-terminal half of cpmlO without the Myb domain. A single transcript is detected in callus tissue as shown in Fig. 6C (lanes 4-6). The mRNA band is present in untreated, dried and ABA-treated cal- lus tissue although in this latter is more intense. No expression was found in fully hydrated, ABA-treated or dehydrated leaves. Therefore, cpmlO transcript is up-regulated by ABA in undifferentiated callus tissue. The desiccation-responsive cDNA clone pcC 27-45 [4,

712

i..m- Hv 1 ~ U-Am308

~ ~--Am330

Zml

Hv33

ZmP1

q ZmC1

Pp2

Am315

Ph2

Phl

Am306

Ph3

AtGL1

~ Arn340

Am305

: : 2 '0 MoMyb

ChiMyB

DmMyb

AtMYB1

YBasl

Figure 4. Comparisons of amino acid sequences among Myb pro- teins. Dendogram of relationships among Myb proteins based on sequence alignment of the two repeats of all reported plant Myb proteins and of other representative Myb proteins obtained with the PILEUP program from UWGCG software package version 7.2. [ 11 ]. Protein sequences included in this comparison are from yeast, YBas 1 [59]; mouse, MoMyb [18]; human, HuMybA and HuMybB [42]; chicken, ChiMyb [32]; fruitfly, DmMyb [31]; Arabidopsis, AtMYB1 [56], AtGL1 [44]; AtMYB2 [60]; moss, Pp2 [34]; Antir- rhinum, Am315, Am306, Am308, Am330, Am305, Am340 [27]; petunia, Phi, Ph2, Ph3 [2]; maize, Zml , Zm38, ZmPI, ZmC1 [38]; barley, Hvl,Hv5, Hv33 [38, 63] and Craterostigma, Cpm5/7/10.

TTTTCGTTTTTCTTTTCGATAAATACAAAATATATGGCTAGGATAGGATACAGTTCCTTA 60

ACTATTCATGATATTAATCTTATYAAATT'IATATTATTCTCTA~TATTTCTGATA0'G 120

ACGT

TGTTAAGCTTGATGAACTGGGTTGAGTGGCAAATAGGTGATGTGATATACATGTCCATAT 180

GTAAAGGCACAAACAGGGTCATGACTGCACAAGTAGTGACAGATAGAAAAGAATTTCGAT 240

CTCACAACAAAG@~AAACATATATACATATATATAAATAGAAGAAATTGGGACACGTAGA 300

ACGT

ATTTTTTGCCTCATTGTGCATATAG'I'CTTGATTTGCTTTTC~ATCAAGTTCCCCCTGG 360

CEI

GGAGTATGTGTAAGGAACATATTCTTGTAATTAAATATGCAAATTTCTATATAAGAACTA 420

ACAGCATTCAqMTGCCATAAATCCTTTGTGAGCTTTTGCTAGGTTAATCCACTACTGATT 48C

GAACGCAATAGGAGAAGCGAGATCOATATAGATGAATATTAGATAGGATCACTTTATTAG 54t

ATATAATAATATTAATGATTGCAAGAATATATTCTGCTAAqTTTAAAAACTTTCCGTGCA 600

AGTATATATGCAATGACGTTATCGAGTTTCTAGATAC~¢CAATTTTTATCAAGGCGA 660

asl MybRE

TCACATAAGCTTGATCACC~TCACAATTCATTATTCATCACTTAGGCAACTCTTTTTTATG 720 ACGT MybRE

T~CTCAAT'PA'PTCATATTTATCACGACYTAOGATAAATTGTTAACA~AA'fTGTAGGAAAC 780

as]

GC'I'GTAATTTGATGTGTATGCATGAATTTCATAGAGCGTTATATGTTCCGCCTAGAATAC 840

TTCTATTAGATACGAGGTGGGGCTTCCATCTAATGACA'fATATAGATAGATTFATATCTC 900

CAAATACATCTCCAAATGTTTCTTTTGTCATTTTCTGTTACCTCAATAATATTCT'IATTA 960

C(]ACGGC~GTACATAGAGAACGTATATAGTGGAACTTCGCACCAACACGI'CCCAACTTAG 1020

ACGT CEI ACGT

TGATGAAGTCAAAAAATATCAGTCACAAGGGAA?ATAATATATATOTTTTTATATAATGA 1080

GTGAAG TAAGAAAGTCAAAGTGTCAAACT'r CAAAGCGCTCA( !TGGGT AATGAAAGA A AT A ] 200

ATAATAATATTGCTTCAAAGCTTTAAAGTGCGTGCGTGCTTTATTAGTACAT.~AAAATT 1260

TGCATA']'I'ATATAGTTAACTGAAACTGCTATqAT%'CTCATCTCTCTCTC'I'CTC~ATT

MybRE CBI

TTCAAACATCTCTGTCTCTCTC'ICCATCTCTCTATGCTCTCCCTCTCTCCATTTTCCCAT

CTATATAAAGCCCCACACTCACAATTAATCCTTCTCCTTAATAATCqATCTCATCTCCCC TATA box

ATCCATC~h2,AGCTTCCAACCCTTATAAGGCATCAGCTTTTTCTTGTCCTTTTTTATATC

TCTTAAATC TTTATAC TATTATTCAAGGAAGAAGA~ATACAGACAT(~

}4

]320

1380

1440

1500

1560

Figure 5. Promoter sequence of cpmlO gene. The nucleotide sequence of the 5'-flanking region to the putative ATG initiation codon is shown. The initiation codon (nucleotide position 1546) is in bold characters and the corresponding methionine (M) is presen- ted below the sequence. Putative TATA box and cis-acting elements including asl [33], ACGT [37, 62], MybRE [6, 20] and CEI [54] motifs are underlined. The sequence presented here is part of the sequence deposited in the GenBank database accession number U33915.

Figure 6. Northern blot hybridization analysis of cpm7 and cpmlO mRNAs. Poly (A) + RNA from C. plantagineum was extracted from the tissues indicated below, fractionated by agarose gel electro- phoresis and transferred onto a nylon membrane. (A) and (B): leaves (lanes 1-4), mature seeds (lane 5), and roots (lanes 6-7), were fully hydrated (lanes 1, 6), incubated with 100/zM ABA for 4 days (lane 4), dehydrated for 2 h (lane 2), and dehydrated for 16 h (lanes 3, 7). A. Blot probed with cpm7 cDNA. B. Blot probed with pcC 11-24 cDNA. C, D and E. leaves (lanes 1-3) and callus tissue (lanes (4-6), were fully hydrated (lanes 1, 4); incubated with 100 #M ABA for 4 days (lanes 2, 5); and dehydrated for 2 days (lanes 3, 6). C. Blot probed with a DNA fragment encoding a gene-specific region of cpmlO clone which lies at the 3 t of the myb region. D. Blot probed with pcC 27-45 cDNA. E. Blot probed with the ribosomal pTA71 gene [ 16].

48] from Craterostigma was used as a positive control probe for hybridization of mRNA isolated from all the conditions described (Fig. 6D, lanes 1-6). Equal load- ings of mRNA were controlled by rehybridizing the filter with the ribosomal genepTA71 [16] as shown in Fig. 6E (lanes 1-6).

Discussion

Craterostigma plantagineum myb genes

We are interested in the characterization of molecu- lar components involved in the transduction pathway of drought stress in the resurrection plant Cratero- stigma plantagineum. Our goal is to identify regulatory genes controlling expression of desiccation-responsive

713

genes in Craterostigma. Desiccation or ABA treatment induce high levels of transcripts encoded by a vari- ety of genes in Craterostigma [4, 40]. Many deduced sequences revealed strong similarities to different members of the Lea (late embryogenesis-abundant) protein group which are expressed in embryos during seed maturation [7].

In this work we describe the isolation and sequence of two genomic clones and one cDNA clone from the resurrection plant C. plantagineum which com- prise novel sequences of myb-related genes. The three clones, cpm5, cpm7 and cpmlO, are similar but not identical, suggesting that they are members of a closely related gene family. In addition, there seems to be about 6-8 myb-related genes in Craterostigma (Fig. 1A).

The deduced amino acid sequence of Cpm5, Cpm7 and Cpm 10 proteins has the canonical two-repeat motif (R2 and R3) present in the Myb DNA-binding domain from plant genes. In man, mouse, Drosophila and yeasts the Myb domain consists of the three repeats R1, R2 and R3 [41, 18, 31, 58]. So far, only one Myb repeat (R3) was found in mybStl from potato [3] and REB1 gene from yeast [28]. After deletion of RI, the animal c-Myb protein was still able to bind DNA but this was hampered when R2 was removed [25]. Yet, it has been shown that REB 1 and MybStl pro- teins bind DNA. Although we have not yet determined the DNA-binding properties of Cpm proteins, all avail- able evidence suggests that they interact with DNA tar- gets. In fact, there are three Myb-responsive elements (MybRE) in the cpmlO promoter region, suggesting a possible auto-regulatory mechanism. Five MybRE were further found in the promoter of the CDeT 11-24 gene from C. plantagineum which encodes a Lea-like protein (R. Velasco and D. Bartels, unpublished data). Future experiments will allow to test the potential of Cpm proteins to trans-activate these MybRE targets.

In all myb-related genes, each consensus repeat has 51-53 amino acids [14] forming a helix-turn-helix- related motif with some degree of similarity to bacteri- al repressors and homeodomains [43]. In each repeat, there are three conserved tryptophan residues, every 18-19 amino acids [1], which also play a key role in promoting secondary structure thus rendering a func- tional Myb domain [29]. In plants, the first tryptophan of R3 is substituted by phenylalanine or isoleucine. This latter amino acid is present in cl, P1, Am305, Am340, Atmyb2, and cpm genes.

714

Gene expression pattern ofcpm genes

The genes isolated in this work, cpm5, cpm7 and cpmlO, have a related sequence (Fig. 3) to the Atmyb2 gene fromArabidopsis which may be involved in trans- ducing the drought stress signal mediated by ABA [59]. ABA mediates desiccation tolerance during embryo maturation in several plants [7, 8, 17, 57], in vegetative and callus tissue of Craterostigma [4, 5], and is also involved in the response to different abiotic stresses such as salt, cold and wound [8, 17]. The results presented in this work revealed that ABA and desicca- tion up-modulate transcription of specific myb genes in Craterostigma (Fig. 6). The expression of cpm7 was induced by desiccation in roots but no expression was found in leaves or seeds where several desiccation- responsive genes have been shown to be expressed [4, 7, 57]. At the whole plant level, water deficit is primar- ily sensed in roots and it has been suggested that ABA is involved in signalling drought stress from roots to shoots [65]. Because cpm7 is induced by desiccation, it is likely that its encoded product functions as a tran- scription factor interacting with genes responsive to drought stress in roots.

Transcription levels of cpmlO were similar in untreated and dried callus tissue but up-regulated by ABA. We have reported before [4, 5] that pretreat- ment with ABA is required to induce desiccation toler- ance of Craterostigma callus tissue. Under these con- ditions, several genes are induced at the transcription- al level but none of them are induced by dehydra- tion alone. Therefore, the induction of cpmlO expres- sion in callus by ABA could reflect the involvement of this gene in a transduction pathway specific for undifferentiated callus tissue. In fact, there are dif- ferent signal transduction pathways, ABA-dependent and ABA-independent, mediating the expression of drought-responsive genes [ 19, 63].

Several consensus motifs were found in the pro- moter sequence of cpmlO (Fig. 5) which may be involved in its regulation. Three consensus MybRE which have also been found in a drought-responsive gene in the ABA pathway [26], two motifs related to the as I box which has been shown to promote root-specific expression [33], five motifs with the ACGT core of the G-box which is involved in gene regulation by a variety of environmental signals and physiological cues [37, 61 ], and three CE 1-like coupling elements which have recently been shown to confer ABA responsiveness [54]. Interestingly, no consensus DNA-binding motifs such as those described above were found in the Ara-

bidopsis gene Atmyb2, which is induced by drought, salt and ABA [59].

So far there is a limited number of reports about transcriptional activator genes involved in ABA or dehydration transduction pathways. To our knowledge, besides Atmyb2, cpm7 and cpmlO are the only other myb-like transcription factor genes induced by drought stress or ABA reported up to now. For instance, the EmBP-1 encoded protein from wheat contains basic and leucine zipper domains (bZIP) and interacts with an ABRE element found in the promoter of Em gene [22]. Similarly, a cDNA clone from rice encodes a bZIP protein, OSBZ8, which interacts with G-box and ABRE motifs, is induced by ABA and dehyd- ration stress at the transcriptional level in seeds, shoots and roots [41]. The Viviparous-1 gene product (VPI) functions as a transcriptional activator of Em and C1 gene promoters in the presence of ABA during embryo development [23, 39]. VPI is not a DNA-binding pro- tein which led to suggest that it may act as a coactiv- ator that interacts with the transcription machinery via protein-protein contacts [39].

Acknowledgements

We thank Jos6 W. Ayala for technical assistance, Ra61 Noguez for help in computer work and Dr. Wolfgang Rohde for his kind gift of the Hv5 cDNA clone. This work was supported by the European Community (con- tract CI 1 *-CT92-0040) and CONACyT, Mexico (con- tract 0546-N9108).

References

1. Anton IA, Frampton J: Tryptophans in MYB proteins. Nature 336:719 (1988).

2. Avila J, Nieto C, Cafias L, Benito MJ, Paz-Ares J: Petunia hybrida gene related to the maize regulatory cl gene and to animal myb proto-oncogenes. Plant J 3:553-562 (1993).

3. Baranowskij N, Frohberg C, Prat S, Willmitzer L: A novel DNA binding protein with homology to Myb oncoproteins containing only one repeat can function as a transcriptional activator. EMBO J 13:5383-5392 (1994).

4. Bartels D, Schneider K, Terstappen G, Piatkowski D, Salamini F: Molecular cloning of abscisic acid-modulated genes which are induced during desiccation of the resurrection plant Crater- ostigma plantagineum. Planta 181: 27-34 (1990).

5. Bartels D, Schneider K, Piatkowski D, Elster R, Iturriaga G, Terstappen G, Le Tran Binh, Salamini F: Molecular analys- is of desiccation tolerance in the resurrection plant Cratero- stigma plantagineum. In: Herrmann RG, Larkins B (eds) Plant

Molecular Biology vol, 2, pp. 663-671, Plenum Press, New York (1991).

6. Biedenkapp H, Borgmeyer U, Sippel AE, Klempnauer K-H: Viral myb oncogene encodes a sequence-specific DNA-binding activity. Nature 335:835-837 (1988).

7. Bray EA: Molecular responses to water deficit. Plant Physiol 103:1035-1040 (1993).

8. Chandler PM, Robertson M: Gene expression regulated by abscisic acid and its relation to stress tolerance. Annu Rev Plant Physiol Plant Mol Biol 45:113-141 (1994).

9. Chou PY, Fasman GD: Secondary structure of proteins from their amino acid sequence. Adv Enzymol 47:45-48 (1978).

10. Deng X-W, Matsui M, Wei N, Wagner D, Chu AM, Feldman KA, Quail PH: COP1, anArabidopsis regulatory gene, encodes a protein with both a zinc-binding motif and a G homologous domain. Cell 71:791-801 (1992).

11. Devereux J, Haeberli P, Smithies 0: A comprehensive set of sequence analysis programmes for the VAX. Nucl Acids Res 12:387-395 (1984).

12. Dooner HK, Robbins TP, Jorgensen RA: Genetic and develop- mental control of anthocyanin biosynthesis. Annu Rev Genet 25:173-199 (1991).

13, Feinberg AP, Vogelstein B: A technique for radiolabelling DNA restriction endonuclease fragments to high specific activ- ity. Anal Biochem 132:6-13 (1983).

14. Frampton J, Leutz A, Gobson T J, Graf T: DNA-binding domain ancestry. Nature 342:134 (1989).

15. Gaff DF: Desiccation-tolerant flowering plants in Southern Africa. Science 174:1033-1034 (1971).

16. Geflach WL, Bedbrook JR: Cloning and characterization of ribosomal RNA genes from wheat and barley. Nucl Acids Res 7:1869-1885 (1979).

17. Giraudat J, Parcy F, Bertauche N, Gosti F, Leung J, Morris P-C, Buovier-Durand M, Vartanian N: Current advances in abscisic acid action and signalling. Plant Mol Biol 26: 1557- 1577 (1994).

18. Gonda TJ, Gough NM, Dunn AR, de Blaguiere J: Nucleotide sequence of cDNA clones of murine myb proto-oncogene. EMBO J 4:2003-2008 (1985).

19. Gosti F, Bertauche N, Vartanian N, Giraudat J: Abscisic acid- dependent and -independent regulation of gene expression by progressive drought in Arabidopsis thaliana. Mol Gen Genet 246:10-18 (1995).

20. Grotewold E, Athma P, Peterson T: Alternative spliced products of the maize P gene encode proteins with homology to the DNA-binding domain of MYB-like transcription factors. Proc Natl Acad Sci USA 88:4587-4591 (1991).

21. Grotewold E, Drummond B J, Bowen B, Peterson T: The myb- homologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a flavonoid biosyn- thetic gene subset. Cell 76:543-553 (1994).

22. Guiltinan MJ, Marcotte WR Jr, Quatrano RS: A plant leu- cine zipper protein that recognizes an abscisic acid response element. Science 250:267-271 (1990).

23. Hattori T, Vasil V, Rosenkrans L, Hannah LC, McCarty DR, Vasil IK: The Viviparous-1 gene and abscisic acid activate the cl regulatory gene for anthocyanin biosynthesis during seed maturation in maize. Genes Devel 6:609-618 (1992).

24. Henikoff S: Unidirectional digestion with exonuclease III cre- ated targeted breakpoints for DNA sequencing. Gene 28:351- 359 (1984).

25. Howe KM, Reakes CFL, Watson ILl: Characterization of the sequence-specific interaction of mouse c-myb protein with DNA. EMBO J 9:161-169 (1990).

7 1 5

26. Iwasaki T, Yamaguchi-Shinozaki K, Shinozaki K: Identifica- tion ofa cis-regulatory region ofa gene in Arabidopsis thaliana whose induction by dehydration is mediated by abscisic acid and requires protein synthesis. Mol Gen Genet 247:391-398 (1995).

27. Jackson D, Culianez-Macia F, Prescott AG, Roberts K, Martin C: Expression patterns of myb genes from Antirrhinum flowers. Plant Cell 3:115-125 (1991).

28. Ju Q, Morrow BE, Warner JR: REB l, a yeast DNA-binding protein with many targets, is essential for cell growth and bears some resemblance to the oncogene myb. Mol Cell Biol 10:5226-5234 (1990).

29. Kanei-Ishii C, Sarai A, Sawasaki T, Nakagoshi H, He D-N, Ogata K, Nishimura Y, Ishii S: The tryptophan cluster: a hypo- thetical structure of the DNA-binding domain of the myb pro- tooncogene product. J Biol Chem 265: 19990-19995 (1990).

30. Katagiri F, Chua N-H: Plant transcription factors: present knowledge and future challenges. Trends Genet 8 : 2 2 - 2 7 (1992).

31. Katzen AL, Kornberg TB, Bishop JM: Isolation of the proto- oncogene c-myb from D. melanogaster. Cell 4 1 : 4 4 9 - 4 5 6 (1985).

32. Klempnauer K-H, Gonda TJ, Bishop JM: Nucleotide sequence of the retroviral leukemia gene v-myb and its cellular progenitor c-myb: the architecture of a transduced oncogene. Cell 31: 453-463 (1982).

33. Lam E, Benfey PN, Gilmartin PM, Fang R-X, Chua N-H: Site-specific mutations alter in vitro factor binding and change promoter expression pattern in transgenic plants. Proc Natl Acad Sci USA 86:7890-7894 (1989).

34. Leech MJ, Kammerer W, Cove DJ, Martin C, Wang TL: Expression of myb-related genes in the moss, Physcomitrella patens. Plant J 3:51-61 (1993).

35. Lin Q, Hamilton WDO, Merryweather A: Cloning and ini- tial characterization of 14 myb-related cDNAs from tomato (Lycopersicon esculentum cv. Ailsa Craig). Plant Mol Biol 30: 1009-1020 (1996).

36. Liischer B, Eisenman RN: New light on myc and myb. Part II. Myb. Genes Devel 4:2235-2241 (1990).

37. Marcotte WR Jr, Russell SH, Quatrano RS: Abscisic acid- responsive sequences from the Em gene of wheat. Plant Cell 1:969-976 (1989).

38. Marocco A, Wissenbach M, Becker D, Paz-Ares J, Saedler H, Salamini F, Rohde W: Multiple genes are transcribed in Hordeum vulgare and Zea mays that carry the DNA binding domain of the Myb oncoproteins. Mol Gen Genet 216: 183- 187 (1989).

39. McCarty DR, Hattori T, Carson CB, Vasil V, Lazar M, Vasil IK: The Viviparous-1 developmental gene of maize encodes a novel transcription activator. Cell 66:895-905 (1991 ).

40. Michel D, Salamini F, Bartels D, Dale P, Baga M, Szalay A: Analysis of a desiccation and ABA-responsive promoter isol- ated from the resurrection plant Craterostigma plantagineurn. Plant J 4 :29-40 (1993).

41. Nakagawa H, Ohmiya K, Hattori T: A rice bZIP protein, des- ignated OSBZ8, is rapidly induced by abscisic acid. Plant J 9: 217-227 (1996).

42. Nomura N, Takahashi M, Matusui M, Ishii S, Date T, Sasamoto S, Ishizaki R: Isolation of human cDNA clones of myb-related genes, A-myb and B-myb. Nucl Acids Res 16:11075-11089 (1988).

43. Ogata K, Hojo H, Aimoto S, Nakai T, Nakamura H, Sarai A, Ishii S, Nishimura Y: Solution structure of a DNA-binding unit of Myb: a helix-turn-helix related motif with conserved

7 1 6

tryptophans forming a hydrophobic core. Proc Natl Acad Sci USA 89:6428~5432 (1992).

44. Oppenheimer DG, Herman PL, Sivakumaran S, Esch J, Marks MD: A myb gene required for leaf trichome differentiation in Arabidopsis is expressed in stipules. Cell 67:483-493 (1991).

45. Pabo CO, Sauer RT: Transcription factors: structural families and principles of DNA recognition. Annu Rev Biochem 61: 1053-1095 (1992).

46. Paz-Ares J, Ghosal D, Wienand U, Peterson PA, Saedler H: The regulatory cl locus of Zea mays encodes a protein with homology to myb proto-oncogene products and with structural similarities to transcriptional activators. EMBO J 6:3553-3558 (1987).

47. Pearson RB, Kemp BE: Protein kinase phosphorylation site sequences and consensus specificity motifs: tabulations. Meth- ods Enzymol 200:62-81 (1991).

48. Piatkowski D, Schneider K, Salamini F, Bartels D: Charac- terization of five abscisic acid-responsive cDNA clones isol- ated from the desiccation-tolerant plant Craterostigma planta- gineum and their relationship to other water-stress genes. Plant Physiol 94:1682-1688 (1990).

49. Ptashne M: How eukaryotic transcriptional activators work. Nature 335:683~589 (1988).

50. Sablowski RWM, Moyano E, Culianez-Macia FA, Schuch W, Martin C, Bevan M: A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes. EMBO J 13:128-137 (1994).

51. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989).

52. Schwarz-Sommer Z, Huijser P, Nacken W, Saedler H, Sommer H: Genetic control of flower development by homeotic genes in Antirrhinum majus. Science 250:931-936 (1990).

53. Seipel K, Georgiev O, Schaffner W: Different activation domains stimulate transcription from remote ('enhancer') and proximal ('promoter') positions. EMBO J 11:4961-4968 (1992).

54. Shen Q, Ho T-HD: Functional dissection of an abscisic acid (ABA)-inducible gene reveals two independent ABA-

responsive complexes each containing a G-box and a novel cis-acting element. Plant Cell 7:295-307 (1995).

55. Shen-Ong GLC; The myb oncogene. Biochim Biophys Acta 1032:39-52 (1990).

56. Shinozaki K, Yamaguchi-Shinozaki K, Urao T, Koizumi M: Nucleotide sequence of a gene from Arabidopsis thaliana encoding a myb homologue. Plant Mol Biol 19 :493-499 (1992).

57. Skriver K, Mundy J: Gene expresssion in response to abscisic acid and osmotic stress. Plant Cell 2:503-512 (1990).

58. Tice-Baldwin K, Fink GR, Arndt KT: BAS 1 has a Myb motif and activates HIS4 transcription only in combination with BAS2. Science 246:931-935 (1989).

59. Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K: An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved Myb recognition sequence. Plant Cell 5:1529-1539 (1993).

60. Vollbrecht E, Veit B, Sinha N, Hake S: The developmental gene knotted-1 is a member of a maize homeobox gene family. Nature 350:241-243 (1991).

61. Williams ME, Foster R, Chua N-H: Sequences flanking the hexameric G-box core CACGTG affect the specificity of pro- tein binding. Plant Cell 4:485-496 (1992).

62. Wissenbach M, 1]berlacker B, Vogt F, Becker D, Salamini F, Rohde W: Myb genes from Hordeum vulgare: tissue-specific expression of chimeric Myb/GUS genes in transgenic tobacco. Plant J 4:411-422 (1993).

63. Yamaguchi-Shinozaki K, Shinozaki K: A novel cis-acting ele- ment in an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-salt stress. Plant Cell 6: 251-264 (1994).

64. Yanofsky MF, Ma H, Bowman JL, Drews GN, Feldman KA, Mayerowitz EM: The protein encoded by the Arabidop- sis homeotic gene agamous resembles transcription factors. Nature 346:35-39 (1990).

65. Zhang J, Schurr U, Davies WJ: Control of stomatal behaviour by abscisic acid which apparently originates in roots. J Exp Bot 38:1174--1181 (1987).