Post on 06-Mar-2023
The Dissertation Committee for Jennifer Andrea Mertz Certifies that this is
the approved version of the following dissertation:
Identification and Characterization of the T-Cell-Specific
Enhancer of Type B Leukemogenic Virus
Committee:
Jaquelin P. Dudley, Supervisor
Henry R. Bose, Jr.
Jon M. Huibregtse
David G. Johnson
Philip W. Tucker
Identification and Characterization of the T-Cell-Specific
Enhancer of Type B Leukemogenic Virus
by
Jennifer Andrea Mertz, B.S.
Dissertation
Presented to the Faculty of the Graduate School of
The University of Texas at Austin
in Partial Fulfillment
of the Requirements
for the Degree of
Doctor of Philosophy
The University of Texas at Austin
December, 2003
v
Acknowledgements
I would like to thank my adviser, Dr. Jaquelin Dudley, for providing me
the opportunity to work in her laboratory and for her constant support and
encouragement. I would also like to thank the members of my dissertation
committee, Drs. Henry Bose, Jon Huibregtse, David Johnson and Philip Tucker
for their helpful comments and suggestions.
The members of the Bose, Payne and Gottlieb lab have been wonderful
colleagues and provided reagents, protocols, advice and friendship. I would
especially like to thank Andy Liss and Robert Sims for making graduate school a
more enjoyable experience.
I would not have been able to accomplish the things described in this
dissertation without the members of the Dudley lab, both past and present. Mary
Lozano has been indispensable in keeping the lab running smoothly. Melissa
Mann, Dana Broussard, Quan Zhu, Jinqi Liu, Farah Mustafa, Urmila Maitra,
Sanchita Bhadra, Jin Seo, Lakshmi Rajan, Hong Cui and Rachel Misquitta have
all been wonderful coworkers and provided support and friendship that are greatly
appreciated. I would like to especially thank Dana Broussard and Melissa Mann
for their friendship and many discussions of scientific schemes and hypotheses.
I would finally like to thank my parents, for providing me the
opportunities to succeed in my academic endeavors and for always supporting me
throughout my entire education.
vi
Identification and Characterization of the T-Cell-Specific
Enhancer of Type B Leukemogenic Virus
Publication No._____________
Jennifer Andrea Mertz, Ph.D.
The University of Texas at Austin, 2003
Supervisor: Jaquelin P. Dudley
Mouse mammary tumor virus (MMTV) is a retrovirus that causes
mammary adenocarcinomas and T-cell lymphomas. T-cell lymphomas induced
by MMTV have additional proviral integrations that invariably have alterations in
the long terminal repeats (LTRs). Type B leukemogenic virus (TBLV) is a
thymotropic strain of MMTV that induces rapidly appearing T-cell tumors in
mice. TBLV is highly related to MMTV except that TBLV LTRs have a deletion
of negative regulatory elements and a multimerization of sequences flanking the
deletion.
In this study, the multimerized sequences from the TBLV LTR were
identified as a novel T-cell-specific enhancer that can act on the TBLV promoter
as well as thymidine kinase and c-myc promoters. Substitution mutagenesis of the
enhancer identified a critical region that contains binding sites for RUNX1, NF-
κB and two unknown factors, NF-A and NF-B. RUNX1, NF-A and NF-B all
positively regulate TBLV enhancer activity. However, the role of NF-κB in
enhancer function is unclear since it does not appear to contribute to the activity
vii
of the TBLV LTR in T cells. Additionally, expression of NF-κB antagonizes the
positive effect of RUNX1 expression on the TBLV LTR in non-T cells. NF-A
appears to be the major contributor to enhancer function and is a lymphoid-
restricted factor. The TBLV enhancer also contains functional glucocorticoid
receptor (GR) binding sites; however GR binding is not necessary for enhancer
activity in T cells. A c-Myb binding site overlaps the GR binding site and
expression of c-Myb in non-T cells activates transcription from the LTR.
Characterization of TBLV enhancers in proviruses integrated near c-myc
revealed that the number of enhancer elements varied, but the most clonal tumors
had proviruses containing four enhancer elements. Reporter gene assays showed
that LTRs containing four enhancer elements were less effective at activating
transcription from either the TBLV or c-myc promoters. In vivo passage of tumor
cells in immunocompetent mice revealed a selection for proviral integrations near
c-myc with four enhancer elements. Since c-myc overexpression often leads to
apoptosis, these results suggested that selection for clonal growth occurred in
tumor cells that had modest c-myc overexpression after TBLV insertion to prevent
apoptosis.
viii
Table of Contents
List of Tables .......................................................................................................... xi
List of Figures........................................................................................................ xii
1. Introduction ......................................................................................................... 1
1.1 Mouse mammary tumor virus .................................................................. 1
1.1.1 History.......................................................................................... 1
1.1.2 MMTV classification.................................................................... 1
1.1.3 MMTV genome and virion structure............................................ 2
1.1.4 Viral proteins ................................................................................ 7
1.1.5 MMTV replication...................................................................... 12
1.1.6 The MMTV life cycle................................................................. 17
1.2 Transcriptional regulation and pathogenesis .......................................... 20
1.2.1 Transcriptional regulation of MMTV......................................... 20
1.2.2 Thymotropic variants of MMTV................................................ 24
1.2.3 Mechanism of tumor induction by MMTV................................ 27
1.2.4 Transcriptional regulation by other retroviral LTRs and enhancers .................................................................................... 32
1.3 Transcription factors that regulate T-cell-specific promoters and enhancers ............................................................................................. 35
1.3.1 Transcription factor RUNX1 ...................................................... 35
1.3.2 Transcriptional co-activator ALY .............................................. 40
1.3.3 NF-κB family of transcription factors ........................................ 43
1.3.4 Transcription factor c-Myb......................................................... 51
1.4 Rationale for this study........................................................................... 58
2. Materials and methods....................................................................................... 59
2.1 Cell lines ................................................................................................. 59
2.2 Transfections .......................................................................................... 59
ix
2.3 Nuclear extract preparation .................................................................... 61
2.4 Whole cell lysate preparation................................................................. 63
2.5 Reporter gene analysis............................................................................ 63
2.6 FACS analysis ........................................................................................ 64
2.7 Preparation of oligonucleotide probes .................................................... 65
2.8 EMSA..................................................................................................... 65
2.9 Plasmids.................................................................................................. 66
2.10 Preparation of plasmid DNA................................................................ 72
2.11 PCR analysis of tumor DNA................................................................ 74
2.12 Purification of ALY from Jurkat T cells .............................................. 75
2.13 SDS-PAGE and staining....................................................................... 76
2.14 Western blot analysis............................................................................ 77
2.15 UV DNA-protein crosslinking ............................................................. 77
3. Results ............................................................................................................... 78
3.1 Identification of a T-cell-specific enhancer in the TBLV LTR.............. 78
3.1.1 Unique cis-acting elements in the TBLV LTR confer T-cell-specific transcriptional activity................................................... 78
3.1.2 Determination of the TBLV triplication as a T-cell specific enhancer...................................................................................... 83
3.1.3 Determination of optimal numbers of 62 bp elements for enhancer activity in T cells ......................................................... 86
3.2 Characterization of TBLV enhancer-binding factors............................. 87
3.2.1 Mutagenesis of the TBLV enhancer ........................................... 87
3.2.1.2 Substitution mutations ............................................................. 90
3.2.2 Characterization of factors affected by the 548 and 556 mutations in the TBLV enhancer ............................................... 95
3.2.3 Characterization of factors affected by the 586 mutation in the TBLV enhancer .................................................................. 126
3.3 Effect of the TBLV LTR on c-myc activation...................................... 133
3.3.1 Characterization of TBLV enhancer elements in proviruses integrated near the c-myc gene. ................................................ 133
x
3.3.2 Selection for TBLV enhancer repeats during tumor passage ... 137
3.3.3 Construction of a genomic c-myc reporter gene vector ............ 140
3.3.4 Effect of enhancer repeats on c-myc promoter activity............ 143
3.3.5 The TBLV LTR confers glucocorticoid responsiveness to the c-myc promoters by enhancer activation.................................. 149
3.3.6 Contribution of point mutations in TBLV enhancer repeats to enhancement of c-myc promoters ............................................. 149
4. Discussion........................................................................................................ 153
4.1 Identification of a T-cell-specific enhancer in the TBLV LTR........... 153
4.1.1 Enhancer function of the TBLV LTR on c-myc promoters...... 154
4.1.2 Optimal number of enhancer elements for transcription in T cells ........................................................................................... 156
4.1.3 Significance of naturally-occurring point mutations in TBLV enhancers near c-myc promoters .............................................. 158
4.2 Evidence for modulation of c-myc overexpression by the TBLV enhancer............................................................................................. 159
4.3 Transcription factors binding to a critical region of the TBLV enhancer............................................................................................. 162
4.3.1 RUNX1 binding to the TBLV enhancer................................... 162
4.3.2 Importance of NF-A and NF-B for enhancer activity .............. 164
4.3.3 ALY enhancement of RUNX1 activity on the TBLV enhancer.................................................................................... 165
4.3.4 NF-κB binding to the TBLV enhancer..................................... 165
4.3.5 HMG and hnRNP roles in transcriptional regulation............... 166
4.4 Contribution of GR and c-Myb to TBLV enhancer function............... 168
4.5 Mechanism of retroviral enhancers active in T cells ............................ 169
Appendix A ......................................................................................................... 176
Appendix B.......................................................................................................... 179
References ........................................................................................................... 180
Vita .................................................................................................................... 226
xi
List of Tables
Table 2.1. Conditions for transfections using a BTX ECM600
electroporator ................................................................................. 62
Table 2.2. Plasmids provided by colleagues for studies of TBLV
enhancer .......................................................................................... 67
Table 3.1. Activities of MMTV and TBLV-LTR reporter gene
constructs in non-T-cell lines......................................................... 81
Table 3.2. Results of mass spectrophotometry analyses of affinity
purified proteins ........................................................................... 106
Table 3.3. Analysis of the enhancer elements in TBLV LTRs near the c-
myc gene ......................................................................................... 134
xii
List of Figures
Fig. 1.1. MMTV proviral structure and transcripts........................................... 4
Fig. 1.2. Generalized illustration of a retroviral partic le. ................................. 6
Fig. 1.3. Synthesis of proviral DNA by reverse transcriptase. ....................... 13
Fig. 1.4. Proviral integration into the host genome. ....................................... 15
Fig. 1.5. Life cycle of milk-borne MMTV virus. ........................................... 19
Fig. 1.6. Diagram of transcriptional control regions and transcription
factor binding sites within the MMTV LTR. ................................... 21
Fig. 1.7. Diagram comparing the MMTV and TBLV LTR structures. .......... 26
Fig. 1.8. Strategy for detection of integrated TBLV proviruses. .................... 30
Fig. 1.9. Locations of TBLV proviruses within the c-myc locus of virally-
induced lymphomas. ......................................................................... 31
Fig. 1.10. LTR enhancer structure of selected retroviruses. ............................. 34
Fig. 1.11. Diagram of the major splice variants of RUNX1. ............................ 36
Fig. 1.12. The Rel/NF-κB family of proteins. .................................................. 46
Fig. 1.13. Functional domains of the c-Myb protein. ....................................... 53
Fig. 3.1. Reporter gene constructs used in transient transfection assays. ....... 79
Fig. 3.2. Transcriptional activity of various TBLV LTRs in T cell lines. ...... 82
Fig. 3.3. Structures of plasmids containing the TBLV triplication in the
pRL-TK vector. ................................................................................ 84
Fig. 3.4. Activity of the TBLV LTR triplication on a heterologous TK
promoter in T cells............................................................................ 85
xiii
Fig. 3.5. Activity of the TBLV LTR triplication on a heterologous
promoter in XC rat fibroblast cells. .................................................. 86
Fig. 3.6. Enhancer activity of TBLV LTRs with different numbers of
enhancer repeats. .............................................................................. 88
Fig. 3.7. Activity of 5’ deletion enhancer mutants in transient transfection
assays of Jurkat T cells. .................................................................... 89
Fig. 3.8. Diagram of the TBLV LTR and positions of enhancer
substitution mutations....................................................................... 91
Fig. 3.9. Reporter gene activity of mutant enhancers in transient assays in
Jurkat (yellow) or RL? 1 (pink) T cells. ........................................... 93
Fig. 3.10. TRANSFAC search results for the TBLV enhancer element. ......... 94
Fig. 3.11. Comparison of the RUNX1 consensus sequence to that from
TBLV, MuLVs, and the T-cell receptor alpha chain (TCR ). ......... 96
Fig. 3.12. Supershift experiments show RUNX-specific binding to the
TBLV enhancer element................................................................... 97
Fig. 3.13. Identification of factors affected by the 548 and 556 TBLV
enhancer mutations. .......................................................................... 99
Fig. 3.14. Cell type specificity of factor binding to the 556WT probe........... 101
Fig. 3.15. Overexpression of RUNX1B in transient transfection assays using
HC11 cells. ..................................................................................... 103
Fig. 3.16. Overexpression of RUNX1B in transient transfection assays using
A20 murine B cells. ........................................................................ 104
xiv
Fig. 3.17. Flow-chart of steps taken to purify proteins that bind to the
TBLV enhancer at the critical region defined above (548-556
region)............................................................................................. 105
Fig. 3.18. Comparison of two methods to identify TBLV enhancer binding
proteins. .......................................................................................... 108
Fig. 3.19. Co-expression of RUNX1B and ALY in HC11 mammary
epithelial cells cooperatively activates the TBLV LTR. ................ 109
Fig. 3.20. Cooperation of ALY and RUNX1 in EL4b murine T cells............ 110
Fig. 3.21. Competition of the HIV LTR enhancer for proteins binding to
the 556WT TBLV enhancer sequence. .......................................... 112
Fig. 3.22. Oligonucleotide competition with NF-κB and NFAT consensus
binding sites. ................................................................................... 114
Fig. 3.23. Overexpression of NF-κB subunits differentially activates TBLV
LTR activity in transient transfection of HC11 cells...................... 116
Fig. 3.24. Overexpression of NF-κB2 with MMTV or TBLV LTR reporter
vectors............................................................................................. 117
Fig. 3.25. Effect of overexpression of RUNX1 and NF-κB2 on TBLV LTR
activity in HC11 mammary epithelial cells.................................... 120
Fig. 3.26. Effect of NF-κB and RUNX1B on TBLV enhancer in A20
murine B cells. ................................................................................ 122
Fig. 3.27. Oligonucleotide competition analysis of TBLV enhancer
complexes using 2 bp mutations..................................................... 123
Fig. 3.28. Effect of TBLV enhancer mutations in Jurkat T cells.................... 125
xv
Fig. 3.29. Activity of the GR binding site mutant 586M in transient
transfections of XC rat cells. .......................................................... 127
Fig. 3.30. Activity of the GR binding site mutant in transient transfection
assays of Jurkat T cells grown in the absence of exogenous
steroid hormones. ........................................................................... 129
Fig. 3.31. The 586 mutation in the TBLV enhancer abolishes the c-Myb
binding site. .................................................................................... 130
Fig. 3.32. RUNX1 and c-Myb cooperative to activate the TBLV LTR in
HC11 cells. ..................................................................................... 131
Fig. 3.33. PCR analysis of primary tumor DNAs to determine the number
of 62-bp repeats in the TBLV LTR enhancer................................. 136
Fig. 3.34. PCR analysis of primary and passage tumor DNAs to determine
the number of 62-bp element in the TBLV LTR enhancer. ........... 139
Fig. 3.35. Semi-quantitative PCR analysis to determine the relative
abundance of TBLV integrations near c-myc after tumor passage.141
Fig. 3.36. Strategy for detection of TBLV enhancer effects on c-myc
transcription. ................................................................................... 142
Fig. 3.37. Transcriptional activity of the c-myc reporter plasmids containing
TBLV LTRs with three-repeat enhancers in Jurkat T cells............ 144
Fig. 3.38. Transcriptional activity of the c-myc reporter plasmids containing
TBLV LTRs with three-repeat enhancers in RL? 1 cells. .............. 145
Fig. 3.39. Activity of the c-myc reporter plasmid after transient
transfections in XC fibroblast cells. ............................................... 146
xvi
Fig. 3.40. Comparison of the enhancer activity of LTRs containing three-
or four-element enhancers on the c-myc promoters. ...................... 147
Fig. 3.41. Comparison of TBLV LTR insertions with different numbers of
enhancer elements in transient transfections of Jurkat T cells. ...... 148
Fig. 3.42. Activity of the c-myc reporter plasmids after DEX induction of
transiently transfected XC fibroblast cells. .................................... 150
Fig. 3.43. Naturally occurring point mutations in enhancer elements do not
alter transcription from the TBLV LTR. ........................................ 151
Fig. 3.44. Comparison of the effect of TBLV LTR with or without
enhancer point mutations on c-myc promoter activity in Jurkat
cells. ................................................................................................ 152
Fig. 4.1. Diagram of TBLV enhancer-binding factors and activity of
corresponding substitution mutations. ............................................ 170
Fig. 4.2. Schematic representation of factors binding to the TBLV
enhancer and other retroviral enhancers active in T cells. ............. 173
Fig. 4.3. Phylogenetic analysis of retroviral enhancers active in lymphoid
cells. ................................................................................................ 174
1
1. Introduction
1.1 MOUSE MAMMARY TUMOR VIRUS
1.1.1 History
Mouse mammary tumor virus (MMTV) was first reported in 1933 by
Jackson Memorial Laboratory as an extra-chromosomal influence on the etiology
of mammary gland tumors in inbred laboratory mice (172). Later, Bittner showed
that this extra-chromosomal factor was transmitted from mothers to offspring via
maternal milk (31). He further stated that there are three co-factors for the
generation of mammary tumors in mice: inherited susceptibility, hormonal
influences associated with pregnancy and the extra-chromosomal factor
transmitted through the maternal milk (32). This factor later was identified as B–
type viral particles in the milk, that then were renamed as mouse mammary tumor
viruses.
1.1.2 MMTV classification
MMTV is a member of the family Retroviridae. This family of viruses is
divided into seven genera according to the Universal System of Virus Taxonomy
as approved by the International Committee on Virus Taxonomy (322). These
genera are: alpharetroviruses (e.g., avian leukosis virus), betaretroviruses (e.g.,
MMTV), gammaretroviruses (e.g., murine leukemia virus), deltaretroviruses (e.g.,
bovine leukemia virus), epsilonretroviruses (e.g., walleye dermal sarcoma virus),
2
lentiviruses (e.g., human immunodeficiency virus 1) and spumaviruses, (e.g.,
human spumavirus). Other members of the betaretrovirus group include
Jaagsietkte sheep retrovirus (109,304) as well as endogenous retroviruses found in
a variety of species, such as human endogenous retrovirus K (HERV-K) (395).
MMTVs that are stably integrated into the host genome and are transmitted
via the germline are referred to as endogenous proviruses (99). Many endogenous
proviruses (≥30) have been identified and characterized and are denoted as Mtv
and an Arabic number (e.g., Mtv6) (67). MMTVs that are transmitted through the
maternal milk to progeny are called milk-borne or exogenous viruses (99). At
least ten exogenous MMTVs have been described for inbred mouse strains, and
they are named according to the strain of mouse that carries them (e.g,.MMTV
(C3H) or C3H MMTV) (1,265).
1.1.3 MMTV genome and virion structure
MMTV has a diploid, positive-stranded RNA genome that is
approximately 8700 nt in length. The genome of MMTV is modified on the 5’
end by the addition of a m7G5’ppp5’Gmp cap, needed for translation (30). The 3’
end of the genome has a series of approximately 200 adenine residues, the polyA
tail, which is added post-transcriptionally by cellular enzymes (356). The
structure of the DNA intermediate of the viral genome, the provirus, is shown
(Fig. 1.1). The viral genes are encoded in the following order for MMTV: gag-
pro-pol-env-sag. MMTV does not encode an oncogene and is classified as a non-
acute retrovirus due to the long latency period for tumorigenesis (7-9 months)
compared to retroviruses that encode oncogenes (days to weeks).
3
MMTV transcripts are expressed in different reading frames. Transcripts
for gag and sag are expressed in one frame; pol is expressed +1 from gag and sag,
while pro and env are expressed +2 from gag and sag. The gag gene encodes the
precursor to the internal structural proteins: matrix (MA), capsid (CA) and
nucleocapsid (NC). The pol gene specifies the precursor for reverse transcriptase
(RT) as well as integrase (IN), whereas the pro gene encodes the viral protease
(PR). The env gene specifies the precursor to the surface glycoprotein (SU) and
the transmembrane protein (TM). Superantigen (Sag) is a type II transmembrane
protein encoded by the sag gene within the U3 region of the long terminal repeat
(LTR) (317).
In the MMTV provirus, the genes are flanked on either end by an LTR.
The LTR is ca. 1332 nt in length and is derived from the unique 3’ RNA
sequences (U3), the repeat (R) sequence found on both ends of the genomic RNA
and the unique 5’ RNA sequences (U5) (94). The LTR structure is generated by
RT, which transfers from one end of the template to the other via the R sequences.
The U3 region for MMTV is the longest found in the retroviruses, with the
exception of the spumaviruses. The MMTV U3 is ca. 1200 nt and contains most
of the transcriptional regulatory control elements, including promoters and
enhancers. The R region of MMTV is the smallest reported (ca. 10 nt) for all
retroviruses (189,404). The U5 region, which is ca. 120 nt long, is the first
sequence copied into DNA by reverse transcriptase and becomes the 3’ end of the
LTR. The 3’ end of U5 contains one of the att sites [also known as inverted
repeats (IR)], which are crucial for viral integration. The MMTV IRs are located
2 bp from the 3’ end of the U5 region (5’ GCGGCA 3’) and 2 bp from the 5’ end
of the U3 region (5’ UGCCGC 3’). These sequences provide recognition sites for
the viral integrase. Two bp are missing from the proviral ends in integrated
proviruses. The primer binding (PB) site is located just downstream of the U5
4
Fig. 1.1. MMTV proviral structure and transcripts.
The LTRs are shown as boxes at either end of the provirus in green. The black ovals represent reported MMTV promoters. The open reading frames are shown in thinner blue boxes. Below the proviral diagram are the transcripts made by the virus, indicated by dashed lines with arrows. Splice donor (SD) and splice acceptor (SA) sites are also shown. Introns are shown by V-shaped structures and represent where splicing occurs. (Adapted from Mustafa et al., 2000 (275)).
gag pol envsag
SDSD SA
MMTV promoters
Sag mRNAs fromU3 promoters
Sag mRNAs fromenv promoters
230+ 7255+ 584-
pro SA
Gag-pol mRNAfrom U3 promoter
Env mRNA fromU3 promoter
5
region; this sequence is an exact complement of the 18 nt from the 3’ end of
tRNA3lys (316) and is the site for initiation of minus-stranded DNA synthesis.
The mature MMTV virion visualized by electron microscopy has an
eccentric electron-dense core, surrounded by a fine membrane- like structure. A
host cell-derived outer membrane envelope surrounds this structure. The mature
virion measures approximately 110 nm in diameter (see Fig. 1.2 for a diagram of
a generalized retroviral particle). Unlike type C virions, which assemble their
cores at the plasma membrane (77), MMTV virions assemble their core particles
in the cytoplasm, before transport to the plasma membrane (51). Immature
MMTV particles, also known as intracytoplasmic A-type particles (27,193), bud
from the host cell membrane, but do not completely mature until after budding.
These immature particles (approximately 70 nm in diameter) have 2 concentric
rings of electron-dense material (348,369,385). Once immature particles reach
the plasma membrane, they adhere to the inner surface, facilitating budding.
After budding, particles change in morphology, with the core contracting to
approximately 60 nm in diameter. The Pr34 Gag polyprotein is present in
released immature virions, and this protein is cleaved to CA and NC during post-
budding maturation.
Mature MMTV virions are composed of shells of individual Gag proteins
with MA forming the outer shell, which lies just beneath the cell-derived lipid
membrane. The MA protein interacts with this membrane via its myristylated N-
terminal portion (44,151,331). The TM protein protrudes from the lipid
membrane, while the internal portion of this protein interacts with MA through an
unknown mechanism. The external portion of TM interacts with SU. Interior to
the MA shell is the icosahedral CA shell that defines the outer layer of the virion
core. The center of the core is comprised of NC and the diploid RNA genome
and is associated with RT (~70/core) (305) and IN proteins. PR is also present
within the virions but its exact location is not well understood.
6
Fig. 1.2. Generalized illustration of a retroviral particle.
The outside of the particle is the host cell-derived envelope that is studded with SU and TM proteins. Under the lipid bilayer is the MA protein that is associated with the envelope proteins. Viral protease (PR) is contained interior to the MA proteins whereas CA proteins constitute the icosahedral capsid, the boundary of the viral core particle. The capsid contains the RNP, composed of NC and the diploid RNA, as well as RT and IN. (Figure is from http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowSection&rid=rv.figgrp.2495.)
7
1.1.4 Viral proteins
1.1.4.1 Gag proteins
Gag proteins are translated as polyprotein precursors (Pr77) that are
subsequently processed into a number of mature proteins by the viral protease
(PR) (159). The order of the proteins contained in the precursor is NH2-MA-
pp21-p3-p8-n-CA-NC-COOH, where “n” is a stretch of 17 amino acids predicted
by DNA sequence, but not identified among purified proteins and peptides (160).
The MA, CA and NC proteins are the internal structural components of virus
particles. Expression of Gag alone results in the assembly of particles resembling
immature virions that bud from the plasma membrane (382). Because proteolytic
cleavage of Gag into its mature proteins occurs late in assembly, during or after
budding, there are equimolar ratios of the three mature Gag proteins.
The MA protein (membrane-associated, matrix or p10) is myristylated co-
translationally by the host cell machinery (360). The myristate moiety is a 14-
carbon fatty acid that is added at the N-terminus of the protein, allowing it to
associate with the host cell membrane (151). This protein is the most
hydrophobic of the viral proteins and must interact with envelope proteins during
budding for successful release of virions (54,88). MA can account for as much as
10% of total virion protein (89), but is not detected at high levels in core
preparations.
CA protein (capsid or p27) contains a major homology region (MHR), a
20 amino acid stretch that is highly conserved among all retroviruses, except
spumaviruses. When this region is mutated, viral infectivity is greatly
diminished, probably due to an assembly defect (75). CA is one of the most
abundant proteins in both viral and infected cell preparations. This protein is the
8
major structural component, forming the shell around the ribonucleoprotein
complex (RNP) to generate the core (90,348).
The NC protein (nucleocapsid or p14) is a small, basic protein that is
tightly associated with the viral genome. The protein has two Cys-His motifs
(CCHC), or zinc coordinating motifs, as well as “assembly domains” necessary
for both packaging and budding of the virion particles (427). This CCHC motif is
crucial for the correct packaging of the viral genome into core particles. For this
reason, this motif may interact with the “packaging sequences” located near the 5’
end of the genome (26,222).
Several proteins of unknown function are also cleaved between MA and
CA (160). These include pp21, p3 and p8. The pp21 protein is a major viral
phosphoprotein, with at least five phosphorylation sites (286,350). It is
hydrophilic and acidic, with possible regulatory and structural roles. The p8
protein is a basic protein, while p3 is very acidic.
1.1.4.2 Pro and Pol proteins
During replication of proviruses, Gag precursor polyproteins are needed in
large numbers since they serve to generate the structural components of viral
particles. The RT, IN and PR enzymes are needed in smaller amounts since they
carry out catalytic functions. The Gag-Pro-Pol precursor (Pr160) is generated
using a strategy that bypasses the termination codon at the end of gag by a
mechanism known as ribosomal frameshifting (149). Ribosomes are able to
occasionally slip back one nucleotide (-1) to continue translating in another open
reading frame. For MMTV, production of these proteins involves two -1
frameshifts, one to generate a Gag-Pro fusion protein and an additional one
downstream to produce the full- length Gag-Pro-Pol fusion precursor protein
(171,266). These frameshifts occur relatively efficiently, with one fourth of
9
ribosomes shifting at the gag-pro junction and one tenth shifting at the pro-pol
junctions (171). Because of these frameshifts, PR, RT and IN are made at
reduced levels relative to Gag proteins.
The NC region of the gag gene and the N-terminal region of the pro gene
encode a trans-frame p30 protein (DU) that has dUTPase activity (25,191). This
coding sequence is found only in a few retroviruses, the non-primate lentiviruses
and beta- and delta-retroviruses. DU is present in retroviral virions, and degrades
deoxyuridine triphosphate (dUTP) to prevent incorporation into viral DNA, and is
dispensable during viral replication in dividing cells (392).
The pro transcript is produced using a –1 ribosomal frameshift to produce
the Gag-Pro polyprotein (Pr110 Gag-Pro). The viral protease (PR or p13) is
encoded within the C-terminus of this Gag-Pro polyprotein. PR functions late in
assembly and budding, or immediately after budding to process the immature
viral polyproteins Gag and Gag-Pol, thus causing the morphological changes
associated with maturation of viral particles and generation of infectious vir ions.
The pol transcript is produced using two –1 ribosomal frameshifts to
generate a Gag-Pro-Pol polyprotein (Pr160 Gag-Pro-Pol) which encodes RT and
IN. RT has both RNA-dependent DNA polymerase activity as well as RNAse H
activity (262). The natural primer for MMTV RT is tRNA3lys (316), and MMTV
RT processivity is enhanced in the presence of Mg2+ relative to Mn2+ (386).
The IN protein mediates the integration of proviral DNA into the host
genome (306). It recognizes the ends of the newly-formed double-stranded DNA
provirus and binds to the att sites, removes 2 nt from the 3’ end of each strand and
joins the proviral DNA ends to host DNA that have been cleaved by the viral
enzyme in a relatively random fashion. However, the randomness of integration
is still a contested subject in the field (323,359,416,431).
10
1.1.4.3 Env proteins
The env messenger RNA (mRNA) is a sub-genomic RNA that is
generated from a splice donor 5’ of the gag initiation site and a splice acceptor 5’
of the env initiation site (Fig. 1.1). This transcript encodes a signal peptide as
well as the SU (surface glycoprotein or gp52) and TM (transmembrane or gp36)
proteins. The signal peptide interacts with the cellular signal recognition particle
and then associates with the ER membrane, where translation of the transcript
causes the nascent polypeptide to extend into the ER lumen (10). The C-terminus
of the protein remains cytoplasmic. Once the leader sequence is cleaved, the
polyprotein traffics through the Golgi apparatus and is glycosylated in transit to
the plasma membrane. The SU protein has 3 N-linked glycosylation sites at amino
acids 127, 143 and 297 and is about 9% carbohydrate by weight. The TM protein
has 2 N-linked glycosylation sites at amino acids 498 and 557 (432). The Env
polyprotein is cleaved into SU and TM by a cellular protease while in the Golgi
apparatus. Even after cleavage, SU and TM associate with each other through
non-covalent interactions and can homo- and heterodimerize. The proteins are
incorporated into the budding virions at the plasma membrane, where the
cytoplasmic tail of TM remains inside the virion. Interaction between TM and
MA is maintained during budding and maturation.
Env proteins are important for adsorption of viral particles and for
penetration of the host cell membrane. These proteins are incorporated into the
host cell membrane and become part of the viral envelope during budding. Env
proteins are also the primary determinant of viral infection since they engage
specific cellular receptors. The primary MMTV receptor (MTVR1) has recently
been defined as the murine transferrin receptor 1 (mTfR1) (340), but another
lower affinity receptor (MTVR2) has been identified (135).
11
1.1.4.4 Superantigen
At least four reported sag transcripts have been reported (Fig. 1.1). Sag
transcripts can be initiated from two promoters in the 5’ U3 region and spliced to
the same splice donor used for env transcripts and a splice acceptor in the env
gene (143,266). Alternatively, sag mRNA can be initiated from an intragenic
promoter in env and spliced with a splice donor and acceptor within env
(105,254,345). An unspliced sag transcript also has been reported that initiates at
the start of the sag open reading frame (8).
Sag is a type II transmembrane protein of about 37 kDa (38,62,63)and is
required for efficient milk-borne transmission of MMTV from the gut of infected
mice to the mammary gland (2,132,133). There are five sites for N-linked
glycosylation at amino acids 79, 89, 93, 131 and 146 in the protein, at least some
of which are required for Sag transport to the cell surface (241). Cleavage by
cellular proteases results in an 18 kDa fragment that is presented on the surface of
infected B cells in association with major histocompatibility complex II protein
(MHC II) (308,429). Sag is capable of interacting with and activating entire
classes of T cells with specific T cell receptor (TCR) β chains, leading to T-cell
activation and/or proliferation (153,235). Release of cytokines allows recruitment
of B and T cells that are then infected by MMTV. The enlarged pool of infected
lymphocytes traffics through an unknown mechanism to the mammary gland
where infection of mammary epithelium ultimately leads to mammary tumors.
The prolonged activation of Sag-reactive T cells eventually leads to apoptosis (2).
12
1.1.5 MMTV replication
1.1.5.1 Entry
As mentioned previously, MMTV enters host cells via the murine
transferrin1 receptor (mTfR1), which is located on mouse chromosome 16 (340).
The SU protein appears to bind to mTfR1 on the cell surface, the viral particle is
then endocytosed. The endosome then traffics to an acidic endosome where viral
and cellular membrane fusion allows uncoating, thus releasing the viral core into
the cytoplasm.
Another potential receptor, MTVR2, has previously been mapped to
chromosome 19 by screening a cDNA expression library transfected into non-
permissive cells (135). However, this protein seems to either function as a low
affinity receptor or only allows binding of the virus to the cell. MTVR2 may
mediate low-level entry via a non-receptor-mediated pathway.
1.1.5.2 Proviral synthesis
After removal of the lipid membrane from the virus, the core is released
into the cytoplasm to initiate reverse transcription (Fig. 1.3) (128,423). A cellular
tRNAlys binds to the PB site located adjacent to the U5 region and primes RNA-
dependent DNA polymerization (316). DNA copies of the U5 and R region on
the 5’ end of the viral genome are made, and the RNase H activity of RT degrades
the viral U5 and R RNA to form minus-strand strong stop DNA. RT then
mediates the first of two template trans fers. The nascent DNA hybridizes to the
3’ R segment of viral RNA and polymerization continues. A DNA copy of the
rest of the genome proceeds after degradation of most of the RNA strand by the
RNase H activity of RT. The residual RNA or polypurine tract serves as the
13
Fig. 1.3. Synthesis of proviral DNA by reverse transcriptase.
See text for details. (Fig. from http://www.ncbi.nlm.nih.gov/books/bv.fcgi ?call=bv.View..ShowSection&rid=rv.figgrp.1063)
14
primer for the synthesis of the plus strand-strong stop DNA. RNase H removes
the remaining viral RNA and the tRNA, and the second strand transfer occurs
when the PB site of the plus strand hybridizes with the PB site of the minus
strand. Proviral DNA synthesis is completed by the extension of both DNA
strands to generate a double-stranded DNA copy of the viral genome with
identical LTRs on either end made up of U3, R and U5 regions.
1.1.5.3 Integration
After reverse transcription, the provirus exists in a specific
nucleoprotein complex known as the pre- integration complex. This complex is
composed of the proviral DNA as well as a subset of viral proteins and probably
specific cellular proteins (49,209). Integration of the provirus occurs in three
steps (Fig. 1.4). The first step occurs in the cytoplasm, with two nucleotides
removed from the 3’ ends of each strand downstream of the conserved
dinucleotide, CA, by the viral IN protein. The complex enters the nucleus, and in
the second step, the new 3’ ends are joined to the host DNA in a concerted
cleavage- ligation step. This insertion into host cell DNA is not targeted to any
specific sequences but may be influenced by the chromosomal structure and/or
binding of cellular proteins to the DNA. Favored sites of integration have been
reported for “open” chromatin and DNase-hypersensitive regions in the genome
(355,409). The free 3’ OH groups generated by the removal of the two
nucleotides attack phosphodiester bonds on opposite strands of the host DNA at
positions staggered by six bases in the 5’ direction. DNA repair fills in the gaps
15
Fig. 1.4. Proviral integration into the host genome.
In the first step, two nucleotides are removed from the 3' ends of the viral DNA following a conserved dinucleotide, CA. In the second step, the new 3' ends are joined to host target DNA in a concerted cleavage- ligation reaction. The third step requires repair to fill in the gaps in host DNA that flank the provirus, removal of the two nucleotide overhang (2(pNpN)) at the 5' ends of the viral DNA, and ligation. IN = integrase. (Fig. from http://www.fccc.edu/research/reports/current/skalka.reportframe.html)
16
flanking the viral DNA and displaces the mismatched 5’ ends. Ligation of the
strands completes integration. Integration allows for the stable maintenance of
the viral genome, provides protection against degradation, and allows for efficient
transcription of new copies of the viral RNAs.
1.1.5.4 mRNA synthesis
Viral mRNA and genomic RNA are synthesized by DNA polymerase II.
Most transcriptional initiation starts from the 5’ LTR U3/R junction and
terminates at the R/U5 junction in the 3’ LTR, although sag transcripts have been
reported to initiate from at least three sites. Sag mRNAs may initiate from a
region approximately 500 bp upstream of the U3/R junction in the 5’ LTR or from
two intragenic env promoters (105,143,254). A polyadenylation signal is located
in both LTRs, but only the 3’ LTR signal is used for modification of transcripts
(200). Cellular enzymes add 5’ caps to viral transcripts in the nucleus prior to
export (118,184).
1.1.5.5 Assembly and budding
Gag, Gag-Pro and Gag-Pro-Pol proteins assemble in the cytoplasm of the
host cell into immature virions or procapsids that are approximately 70 nm in
diameter. When these proteins assemble, NC and RT proteins are sequestered
inside the capsid along with the diploid viral genome. PR then cleaves some of
the polyproteins into their mature forms (411). Mature MA interacts with the
cytoplasmic tail of TM, initiating budding of the procapsid. Maturation is
achieved after budding from the host membrane when PR completes processing
of viral proteins, yielding infectious virions.
17
1.1.6 The MMTV life cycle
1.1.6.1 Endogenous and exogenous MMTVs
MMTV can be transmitted horizontally through the maternal milk-borne
route (exogenous viruses) or vertically through the germline (endogenous
viruses). Endogenous proviruses are the result of rare infection and integration
into germ cells (70). Inbred laboratory mice have an average of 2 to 8 endogenous
viruses (192), while outbred wild mice can have from 0 to 14 (167,176,177,325).
Most endogenous retroviruses are defective and do not make infectious viral
particles due to the accumulation of point mutations or deletions in structural
genes or promoters. However, there are some exceptions, namely, Mtv-1, -2 and -
4 (2,192). In addition, most endogenous retroviruses maintain functional sag gene
sequences (2).
1.1.6.2 Life cycle
Mothers express maximal levels of viral RNAs and have very high levels
of MMTV viral particles in their milk. Infection is transmitted in the milk to the
offspring and the virus passes through the neutral stomach into the intestine (Fig.
1.5). In the intestine, MMTV passes through M cells to the gut-associated B and
T cells (136). Infected B cells express the viral Sag in association with MHC II
on the cell surface (3,235). Sag interacts with specific Vβ chains of T cell
receptors on the surface of certain T-cell subsets (153,235), leading to activation
and expansion of bystander B and T cells, which are infected to create a large
pool of infected cells (230). Both B and T cells are necessary for MMTV
transmission since knockout mice lacking either cell type are resistant to infection
via the milk-borne route (28,134). This infected cell reservoir is necessary until
18
the mouse reaches puberty when MMTV can traffic to the mammary gland and
infect actively dividing cells there. Integration of proviruses near proto-
oncogenes can lead to mammary adenocarcinomas (284).
1.1.6.3 Tissue tropism
The receptor for MMTV has been identified as mTfR1 (340), which is
ubiquitously expressed, and therefore, all cells expressing this receptor should be
susceptible to infection. However, not all cells in the host are infected with
exogenous MMTV, and other levels of control are utilized to ensure virus
replication in appropriate host cells. Each step of viral replication is subject to
cellular controls so that infection may not result in successful production of more
viral particles.
Much evidence suggests that MMTV transcription is a primary
determinant of viral cell-type specific expression. Studies examining the
transcription of endogenous MMTVs in mice from different genetic backgrounds
showed that the highest levels of expression are in lactating mammary gland.
High levels of transcription are detectable in non- lactating mammary gland as
well as salivary and prostate glands. Lower expression is also observed in
lymphoid tissues, lungs, kidney, brain, pancreas, stomach, bladder, uterus, testes
and seminal vesicles (152,166). A number of mice transgenic for genes driven by
the MMTV LTR also have been derived to determine the tissue tropism of the
virus (64,337,341,368). These studies are in agreement with expression of
endogenous MMTVs, with expression primarily found in ductal epithelial cells of
mammary and salivary glands, lungs, kidneys, testes, prostate gland and lymphoid
cells. Thus, the highest MMTV expression is observed at the primary site of
tumor formation. The high expression level in mammary gland (ca. 500-fold
19
Fig. 1.5. Life cycle of milk-borne MMTV virus.
MMTV virus is transmitted to the progeny through the milk of viremic mothers. The virus travels through the stomach of the pups to the small intestine, where specialized M cells take up the virus. Viral particles then infect B cells in the gut-associated lymphoid tissue. Infected B cells express viral Sag proteins on their surface in conjunction with MHC II molecules. Sag activates and expands infected B and T cells to form a pool of infected cells. These cells traffic to the mammary gland and the virus infects mammary epithelial cells. MMTV replication and virus production is up-regulated by hormones associated with pregnancy and lactation and viral particles are transmitted to pups in the mother’s milk. After multiple pregnancies and lactations, the high frequency of viral insertions increases the likelihood of a proviral insertion near an oncogene, resulting in a mammary tumor.
20
higher than other tissues) allows for more viral integrations and increases the
likelihood of upregulation of cellular oncogenes to cause cancer.
1.2 TRANSCRIPTIONAL REGULATION AND PATHOGENES IS
1.2.1 Transcriptional regulation of MMTV
MMTV has long been considered a model system for transcriptional
regulation, especially hormone- induced RNA expression (165,232,406). The cis-
acting regulatory regions contained with the U3 region of the 5’ LTR are
responsible for the regulation of both tissue-specific and hormonally-stimulated
transcription of viral genes. In addition to the TATA box and polyadenylation
signals contained in the U3 region, a number of other control elements have also
been mapped to this region (Fig. 1.6). These include the mammary gland-specific
enhancer, the negative regulatory elements (NREs) (37,163), the hormone
responsive element (HRE) (165,232), as well as Octamer-1 (OCT-1) (45) and NF-
1 binding sites (150). Variant strains of MMTV that have a preferred tropism for
T cells and cause thymic T-cell lymphomas invariably have a deletion of the
NREs and often have a multimerization of the sequences flanking the deletion
(16,210,434).
Stewart et al. first reported mammary cell-specific transcription from the
MMTV LTR (375). The mammary gland enhancer has been mapped to the
extreme 5’ end of the U3 region, but there is some controvery about its exact
location. One group mapped the region between nt -1166 and -987 (relative to the
transcriptional start site) using transgenic mice (264) whereas transient
transfection analyses mapped the enhancer between nt -1075 and -978 (243,436).
The enhancer functions in both lactating and non- lactating mammary glands as
21
Fig. 1.6. Diagram of transcriptional control regions and transcription factor binding sites within the MMTV LTR.
Different transcription factors are shown with ovals and circles. The maximum deletion observed in thymotropic strains of MMTV is shown by a red bar above the diagram. Numbers below the LTR show the number of bases from the transcriptional start site (+1). Abbreviations: MGE (mammary gland enhancer), NRE (negative regulatory element), HRE (hormone responsive element), TFIID (transcription factor IID), GR (glucocorticoid receptor), CDP (CCAAT displacement protein), SATB1 (special AT-rich binding protein 1).
T-cell-specific LTR deletions
-1166 -978 -645 -264 -190 -80 +1
NRE HRE
MP4, MP5 NF1, AP2, F5, F12, MGF, MAF C/EBP, NF1
GR GR NF1OCT-1 RNAP
CDP CDP SATB1
CDP SATB1
CDP TFIID
MGE
RU3 U5
GR GR
22
well as in salivary glands. These studies also showed that the mammary cell
enhancer interacts with the HRE of the LTR to stimulate steroid hormone- induced
transcription (436). A number of factors have been identified that bind to this
enhancer region, including MP4, MP5, AP-2, F2, F3/NF1, F12, MAF and MGF
(Stat5a) (211,243,255). Many of these factors are developmentally regulated in
the mammary gland. DNA binding of MAF, MGF and MP4 are all activated by
prolactin, epidermal growth factor or trans forming growth factor (TGF) α (147).
Two regions that negatively affect transcription from the MMTV LTR
have been mapped to -645 through -471 and -365 through -264 (163). These
regions are known as the distal and proximal NREs, respectively. At least two
transcriptional repressors bind to these elements, special AT-rich binding protein
1 (SATB1) and CCAAT displacement protein (CDP) (224,447). SATB1 is
expressed most abundantly in thymus, at lower levels in brain, spleen and other
tissues, but is absent in mammary gland (87). CDP is expressed in most
undifferentiated tissues, and its expression decreases upon differentiation of
several cell types (403,405). Functional studies in transgenic mice (224) and
transfection experiments (163) in cultured cells suggest that the distal and
proximal NREs are able to work independently, but that the distal NRE is a
stronger regulator of MMTV expression than the proximal NRE. To date, 9 CDP
binding sites have been mapped in the LTR, with 8 located in the NRE region and
one just downstream of the mammary enhancer (446) (Dr. Q. Zhu, personal
communication). Two SATB1 binding site have been localized to the proximal
NRE (224).
Glucocorticoid receptor (GR) has been shown to have at least six binding
sites upstream of the transcriptional start site of the MMTV LTR (encompassed
within -299 to -70) (112), although the HRE, originally designated from -190 to -
80, contains four GR binding sites (99,399). Glucocorticoids enter cells passively
23
and bind to receptors located in the cytoplasm (330). GR is held in the cytoplasm
by association with heat shock protein 90 (Hsp90) (164). Upon binding of the
glucocorticoid to its receptor, Hsp90 dissociates and the glucocorticoid/GR
complex translocates into the nucleus where it binds the HRE to upregulate
transcription up to 100-fold. This element is very important to the MMTV life
cycle since during pregnancy and lactation, GR is able to translocate to the
nucleus and upregulate MMTV transcription dramatically. This increases the
production of viral particles that are present in the maternal milk and, therefore,
increases the likelihood of transmitting the virus to progeny.
GR binding to the MMTV LTR of integrated proviruses also induces
chromatin remodeling around the HRE. This remodeling allows for other
transcription factors to bind to sites that were previously inaccessible, which
allows for higher transcription from the LTR (84). In the absence of hormones,
the NF1, OCT-1 and TBP sites adjacent to the HRE are masked by chromatin
(208). However, GR binding to the HRE recruits an ATP-dependent remodeling
complex known as SWI-SNF or BRG1-BAF that then remodels the chromatin in
the vicinity (although this is somewhat controversial, Dr. Cathy Smith, personal
communication) (117,273). Recent data show that GR is not associated in vivo
with the MMTV HRE, suggesting that MMTV uses a “hit and run” mechanism to
deliver the chromatin remodeling complex to the correct area on the promoter,
followed by rapid dissociation. This phenomenon has been elegantly shown using
photobleaching experiments in living cells (242). This “hit and run” mechanism
causes the temporary displacement of the linker histone H1 as well as the
remodeling of the core histones to allow access of transcription factors to the
DNA. The MMTV promoter is then in an open conformation, without altering
the nucleosomal positioning over the LTR. NF1 and the transcription initiation
complex subsequently bind and mediate transcription (7,84). Recently, it has been
determined that NF1 has a role in both transcription and chromatin remodeling,
24
based on studies using both transient and stable expression experiments (150).
NF1 participates in both the stabilization of the transient association between GR
and the HRE as well as the recruitment of the remodeling complex to the MMTV
promoter in vivo.
1.2.2 Thymotropic variants of MMTV
MMTV primarily causes mammary adenocarcinomas, but also induces
thymic T-cell lymphomas in mice harboring (GR and DBA/2) (210,252) or
lacking (BALB/c and C57BL/6 [B6]) (98) exogenous virus. As early as 1964,
Stuck et al. reported that ML (mammary leukemia) antigen was expressed in
DBA/2 mouse lymphoid leukemias as well as MMTV-induced mammary tumors
(379). Electron microscopy experiments in the 1970s also showed
intracytoplasmic A particles, the immature virions of MMTV, in mouse
lymphomas (50,401).
Newly-acquired proviruses in these lymphomas were investigated in a
number of strains of mice, including GR (251-253), DBA/2 (210,435), BALB/c
(98,163) and C57BL/6 (98,163,197). In most cases, these newly integrated
proviruses had site-specific rearrangements in the U3 region of the LTR,
including an invariant deletion and, often, a direct repeat element. The U3
deletion always truncates the sag open reading frame and, in some cases, deletes
the 5’ portion of the GRE (197,210,253). Further characterization has shown that
the rearranged LTRs from GR and DBA/2 mice have significantly elevated
transcriptional activity in T-cell lines compared to MMTV LTR activity
(388,435). However, most of the lymphomas that were analyzed failed to
produce any infectious viral particles due to failure of the viral polyproteins to
mature in virions (287,402). Because of this, early studies were unable to show
directly that this variant of MMTV was responsible for inducing T-cell
25
lymphomas in mice. However, in 1971, Ball and McCarter demonstrated that
carcinogen- induced thymomas from CFW/D mice produced a thymotropic type B
retrovirus, originally called DMBA-LV (dimethylbenz(α)anthracene
leukemogenic virus) and later, type B leukemogenic virus (TBLV) (17,271).
TBLV induced thymic lymphomas after a short latency (2 to 3 months) when
inoculated intrathymically into newborn mice (13,14). Mammary tumors were
not observed, presumably because mice died before mammary tumors normally
develop (83). TBLV LTRs had a deletion of the NREs as well as a triplication of
sequences flanking the deletion, similar to altered MMTV LTRs observed in other
lymphomas. The deletion spanned 443 bp, and was accompanied by triplication
of a 62 bp element that was composed of 18 bp from the 5’ flanking DNA and 44
bp from the 3’ flanking DNA (Fig. 1.7) (247). In addition to the LTR differences,
TBLV viruses also had unique gp52 and p28 proteins and unique restriction sites
compared to MMTV (14), suggeting point mutations throughout the genome.
An infectious MMTV provirus was constructed by Shackleford and
Varmus (365) in 1988, allowing tests of molecular recombinants between MMTV
and its thymotropic variants. Yanagawa et al. constructed chimeric MMTVs by
replacing the MMTV LTR in the 3’ end of the molecular clone with LTRs from
proviruses isolated from thymic lymphomas (434). Infection of mice with these
chimeric MMTVs produced only T-cell tumors, indicating that the determinants
for pathogenicity of these viruses lie within the LTRs (213,372). Also,
lymphomas were induced in both male and female mice, suggesting that
pregnancy-associated hormones were not necessary for lymphoma induction by
this virus.
Paquette and colleagues (307) generated transgenic mice using the TBLV
LTR as a promoter for either c-myc or CD4. Transgenes in these mice were
preferentially expressed in double-positive (CD4+CD8+) immature, thymic T cells
26
Fig. 1.7. Diagram comparing the MMTV and TBLV LTR structures.
The U3 region is shown in gray, with the NREs shown in pink. The sequences flanking the NREs are yellow on the 5’ flank and hatched black and white on the 3’ flank. These two flanking sequences are joined and multimerized to generate a predicted T-cell enhancer. The R region is shown as a white box and the U5 as a black box. The transcriptional start site is denoted by +1.
U3
U3
U5R
NREs
MMTV LTR
TBLV LTR
T cell enhancer
U5R
+1
+1
27
and their progenitors, whereas expression was downregulated in both single
positive (CD4+ or CD8+) mature T cells. Thus, the tissue-specific expression of
the TBLV or MMTV LTRs correlated with the type of tumor induced.
1.2.3 Mechanism of tumor induction by MMTV
1.2.3.1 Activation of proto-oncogenes in mammary tumorigenesis
MMTV has been associated not only with mammary adenocarcinomas,
but also with thymic lymphomas, and at a very low frequency, kidney (120,180)
and pituitary tumors (326,396). Since MMTV does not encode an oncogene, the
virus must rely on other mechanisms of tumorigenesis. Thus, the virus causes
insertional mutagenesis to induce cancer.
Using MMTV as a “molecular tag” (289), at least nine different loci have
been identified as common integration sites (CISs) in mammary cancer. These
integration loci can be categorized into five cellular gene families: Wingless
(Wnt) (207,288,289,336), fibroblast growth factor (Fgf) (91,228,315), Notch
(92,119,332,332,349), aromatase (92,102,349,387) and the gene encoding the p48
component of eukaryotic translation initiation factor 3 (eIF-3p48) (9,233).
Most MMTV integration sites share common characteristics. The
majority of the proviruses integrate outside of the coding region of the gene that is
affected. For this reason, the proteins produced from these loci are unmodified,
but expression levels are changed. Like other retroviruses, MMTV proviruses can
affect transcription of these genes over long distances (≥ 15 kb). Also, the gene
that is affected by the integration is not normally expressed in adult mammary
gland tissue and is often a developmentally regulated gene. Finally, the genes that
28
are common integration sites for MMTV appear to be evolutionarily conserved,
with many encoding growth factors or truncated growth factor receptors (99).
1.2.3.2 Mechanism of tumor induction in thymic lymphomagenesis
Unlike MMTV-induced mammary tumors, T-cell lymphoma induction by
MMTV has not been widely studied. However two loci, the Tblvi1 locus located
on mouse chromosome X (271) and the c-myc locus on chromosome 15 (328),
have been identified as CISs for TBLV-induced tumors. The Tblvi1 locus spans
approximately 53 kb of the X chromosome and appears to upregulate an mRNA
in this region. However, the identity of the gene(s) affected by TBLV integration
is currently unknown. A number of other thymotropic MMTV integration sites,
but not necessarily common integration sites, also have been mapped. These
include Pad4, Pad5, and Pad6, which are located on chromosomes 3, 5, and 15,
respectively (329).
c-myc as a common integration site
Previous studies have shown that a TBLV LTR-c-myc transgene is
sufficient to cause T-cell lymphomas that are CD4+CD8+ (307). This type of
tumor is similar to that induced by injection of TBLV particles intrathymically
into neonatal mice (13,14). Infection of TBLV-c-myc transgenic mice with
MuLV decreases the latency of tumor formation, suggesting that c-myc
expression is necessary but not sufficient for tumor progression (126). Integration
near c-myc has been documented for a number of other retroviruses that induce
lymphoid tumors, including Moloney and SL3-3 murine leukemia viruses, avian
leukosis virus and reticuloendothelial virus (100).
29
Based on this information, a panel of 30 TBLV-induced lymphomas was
analyzed for the presence of proviral integrations in the c-myc locus. Initial
screening by Southern blot analysis showed rearrangement of the c-myc locus in
only two tumors (328). Due to the polyclonal nature of the TBLV-induced
tumors, the number of cells with a particular integration may not be detected by
Southern analysis. Subsequently, a PCR-based screening strategy was used to
detect integrations in the c-myc locus (Fig. 1.8). This strategy used a number of
TBLV-specific and c-myc-specific primer sets to show that approximately 23% of
tumors screened had integrations in or near the c-myc coding region (Fig. 1.9)
(328). In addition, analysis of c-myc expression levels by Northern blot analysis
showed that almost all tumors screened had elevated levels of c-myc mRNA
relative to normal thymus (3 to 6-fold elevation) (328).
Not all tumors with elevated c-myc expression had integrations in the c-
myc locus detectable using this PCR-based method. This may be due to the
limitations of the PCR-based screening strategy, with detection limits of
approximately 5 kb. Integrations of other retroviruses affecting c-myc over long
distances (>300 kb) have been reported (204,400), and therefore, it is possible that
integrations outside of the region screened were responsible for elevation of c-
myc expression. Elevation of c-myc levels also may be indirect, perhaps due to
integration near another gene that regulates c-myc expression.
30
Fig. 1.8. Strategy for detection of integrated TBLV proviruses.
The forward and reverse arrows indicate the locations of the sense (+) and antisense (-) primers, respectively, used for PCRs. The positions of exons (Ex) are indicated.
31
Fig. 1.9. Locations of TBLV proviruses within the c-myc locus of virally-induced lymphomas.
The arrows indicate the approximate positions of proviral insertions and their transcriptional orientations with respect to that of c-myc. Only proviral integrations that could be confirmed by direct PCR product sequencing or by sequencing of the cloned PCR products have been included on this map. Only proviruses observed in primary TBLV-induced tumors are shown. Approximately 23% of tumors analyzed (11 of 47) had detectable integrations within the c-myc locus. The positions of some restriction enzyme sites are shown: EcoRV (RV), BamHI (B), XbaI (X), and HindIII (H). Numbers below the line indicate distance from the first base of c-myc exon 1 (Ex 1) in kilobases. The hatch marks indicate that the linear map is not to scale. The proviral insertions in tumors T16 and T17 could be detected by Southern blotting, whereas the other insertions could not. The non-translated exon 1 of c-myc is depicted as a white box, while the two coding exons (exons 2 and 3) are represented by the solid gray boxes.
RV XBB RV
RVX
-25 kb +6 +7.5 +23 kb
T16
T17
Ex 3Ex 2
c-myc Locus
0
Ex 1
T604T602
+10
T9
-3.8
T623B T15
-1
T623B
T5
T19
H
T623BT623B
HBH
T10
T700
32
1.2.4 Transcriptional regulation by other retroviral LTRs and enhancers
Retroviral enhancers are known to contribute to tissue tropism and disease
specificity (56,170,274,339). Enhancers are believed to be aggregates of
transcription factor binding sites that are known to together influence nearby
promoter activity. Most T-cell tropic murine leukemia enhancers have a Runt-
related transcription factor 1 (RUNX1) binding site, which is also present in the
feline leukemia virus enhancer (Fig. 1.10). Interestingly, the T-cell tropic HIV-1
enhancer does not contain a RUNX1 binding site. Moreover, the presence or
absence of this binding site alone does not always correlate with the pathogenicity
of the virus in which the enhancer element is contained, since the non-pathogenic
or weakly pathogenic Akv and the highly pathogenic SL3-3 both contain RUNX1
binding sites. Experiments have shown that mutation of the RUNX1 binding site
in the Moloney MuLV enhancer can change the disease specificity from T-cell
lymphomas to erythroleukemias (372). Also, the SL3-3 enhancer differs from the
Akv enhancer at several sites, including a single base in the RUNX1 binding site,
and alteration of this base in the SL3-3 enhancer significantly reduced the
leukemogenicity of the virus (236). Proviruses recovered from tumors induced by
this mutant SL3-3 virus often contained mutations that reverted the enhancer back
to the wild-type SL3-3 virus enhancer or suppressor mutations that increased the
transcriptional capacity back to wild-type levels. Other data have shown that
SL3-3 viruses containing a 3 bp transversion in the RUNX1 binding site still
induced T-cell lymphomas and that the mutation was maintained in proviruses
recovered from tumor DNA (4). These data suggest that factors other than
RUNX1 are critical for determining enhancer specificity and the type of tumor
induced.
Most of the murine leukemia viruses (and also feline leukemia virus)
enhancers also contain binding sites for the Ets transcription factors (Fig. 1.10).
33
Ets sites are located adjacent to the RUNX1 binding sites and are believed to be
important for modulating RUNX1 binding (125, 126). In addition to RUNX1 and
Ets binding sites, the SL3-3 enhancer also contains a c-Myb binding site located
between a RUNX1 binding site and the Ets binding site (Fig. 1.10). Whereas
mutation of the Ets binding site in MoMuLV enhancer has a dramatic effect on
leukemogenecity (372), the Ets binding site does not seem critical for enhancer
function in SL3-3 as it only slightly lowers the leukemogenic potential of the
virus (281). However, mutation of the c-Myb binding site in SL3-3 strongly
inhibits the pathogenicity of the virus. These data suggest that there is more than
a single combination of transcription factors that can create a T-cell-specific
enhancer.
The HIV enhancer is the smallest (27 bp) of the enhancers that have been
analyzed (Fig 1.10). This enhancer is different from other T-cell enhancer
examined since it is active in monocytes and macrophages in addition to T cells
(101,302). Comparison with other enhancers reveals two tandem binding sites for
NF-κB with adjacent Sp1 sites. Other factors shown to bind the enhancer include
Ets family members Ets-2 and PU.1, NFAT as well as AP-2 (Fig. 1.10) (311).
This combination of binding sites may result in expansion of HIV cell-type
specificity and the failure of this enhancer to induce T-cell lymphomas.
34
NF1
Ets Runx1bHLH GR
E-box c-Myb
MoMuLV (75 bp)2
FeLV (50 bp)2
Akv (99 bp)2
SL3-3 (72 bp)2
NF-kB
Sp-1
AP-2
HIV-1 (26 bp)
1
NFAT
Fig. 1.10. LTR enhancer structure of selected retroviruses.
Numbers outside the brackets indicate the number of enhancer elements commonly observed. Known transcription factor-binding sites that are shown. The numbers in parentheses refer to the length in base pairs of a single enhancer element.
35
1.3 TRANSCRIPTION FACTORS THAT REGULATE T-CELL-SPECIFIC PROMOTERS AND ENHANCERS
1.3.1 Transcription factor RUNX1
As mentioned in the previous section, RUNX1 is an important factor in
the function and specificity of T-cell-tropic viral enhancers. RUNX1 is a member
of the Runt domain (RD) family of proteins. Members of this family are
conserved transcriptional regulators, related to the Drosophila melanogaster
protein runt (178). RUNX1 is also known by many other names, including core
binding factor, α 2 subunit (CBF-α 2), Acute Myelogenous Leukemia 1 protein
(AML-1), polyomavirus enhancer binding protein 2 α B subunit (PEBP2-αB or
PEA2-αB), SL3-3 enhancer factor 1 αB subunit (SEF1-αB) or SL3/AKV core
binding factor αB subunit (S/A-CBF αB). Other members of this family include
RUNX3 (AML-2) and RUNX2 (AML-3), Drosophila Lozenge, Cs-runt in the
spider, Cupiennius salei, SpRunt in sea urchin, Xam1 in Xenopus, and runxa and
runxb in zebrafish (48,69,76,78,397).
Members of the RD family share a highly conserved runt homology
domain (rhd). This 128 amino acid domain is named for its high homology to the
Drosophila pair-rule protein, runt (178). Among mammalian runt domains, 92%
of the amino acids are identical, and 66% are identical to the Drosophila runt
protein . This domain mediates both DNA-binding activity as well as protein-
protein interactions with the binding partner for RUNX proteins, core binding
factor β (CBF-β) (415). The RUNX1 protein is expressed as a number of
alternatively spliced variants, ranging in size from approximately 27 kDa to 52
kDa. The largest isoform of the protein, RUNX1B, has a number of major
functional domains, including the runt homology domain (rhd) located near the N-
terminus of the protein (Fig. 1.11). A 33 amino acid nuclear matrix targeting
signal is located closer to the C-terminus, and this signal functions as a
36
transactivation domain as well as in targeting RUNX1 to sites of active
transcription (440). The main transactivation domain is located in the C-terminus,
whereas the extreme C-terminus specifies a WRPY motif, which mediates
interactions with the co-repressors Groucho or transducin- like enhancer of split 1
(TLE1) (215). Also present in the protein is an auto- inhibitory domain (ca. 240
amino acids) located C-terminal to the runt domain (141). These sequences are
responsible for inhibiting RUNX1 DNA binding as well as interaction with
CBFβ . The inhibition of DNA binding can be overcome by interaction with
either CBFβ or Ets-1 proteins (141).
rhdRUNX1a
RUNX1b
RUNX1B rhd WRPY
rhd WRPY
1
1
1
1
rhd WRPYRUNX∆N348
480
453
250
Fig. 1.11. Diagram of the major splice variants of RUNX1.
The runt homology domain (rhd) is denoted by a gray box. The number of amino acids in each protein are shown.
37
1.3.1.1 Gene Structure of RUNX1
The human RUNX1 gene, located on chromosome 21, covers
approximately 260 kb (214), whereas the murine homologue is located on
chromosome 16 and spans approximately 91 kb. Both genomic loci encode 8
exons, have two promoters, and three polyadenylation signals (124,260). The
RUNX1 gene has at least 12 transcripts, ranging from 2 to 8 kb that can result in
at least 4 proteins (Fig. 1.11) (260). The difference in sizes of transcripts is due to
alternative splicing and differential use of promoters and polyadenylation signals.
RUNX1B and RUNX1b are the major protein isoforms, and they are identical
except that RUNX1b has an N-terminal deletion of 27 amino acids due to
differential promoter usage (124). These proteins both possess a full- length rhd,
the C-terminal WRPY domain and the transactivation domain C-terminal to the
rhd. RUNX1A is a splice variant that lacks the transactivation domain and uses a
separate polyadenylation signal than that used for RUNX1B or RUNX1b (260).
The RUNX 1A isoform acts as a competitive inhibitor of RUNX1B or RUNX1b
(259). RUNX1∆N is an N-terminally truncated version of RUNX1B that lacks a
portion of the rhd (442). It is incapable of binding DNA or the CBFβ subunit, but
interferes with the transactivation potential of RUNX1B.
1.3.1.2 DNA binding and heterodimerization of RUNX1
The RUNX1 transcription factor is comprised of two subunits, the DNA
binding and transactivating α subunit and the non-DNA binding CBFβ subunit.
The runt domain is important for DNA binding activity of the α subunit to the
consensus TGT/cGGT as well as for dimerization of the α subunit with the β
subunit (178,248,297). In Drosophila, two proteins can heterodimerize with runt,
38
Brother and Big-brother. The β subunit proteins are unable to bind DNA
themselves, but instead stabilize the binding of runt or RUNX1 to DNA (296).
The murine homolog of RUNX1, CBFα, was first identified by a number
of groups based on its ability to bind to the enhancers of two murine viruses,
polyomavirus and murine leukemia virus (MuLV). RUNX1 was initially
described by two groups, Piette and Yaniv (318), and Satake et al. (351,433), as a
factor that binds to the α, or A, enhancer of polyomavirus. The first group named
the protein polyoma enhancer A binding factor 2 (PEA2) whereas the second
group referred to the same factor as polyoma enhancer binding protein 2
(PEBP2). CBF also was independently identified as a factor that binds to the
“core” site in MuLV enhancers (419) by a number of other groups. The first
notation of a CBF was described by Speck and Baltimore in work characterizing
the Moloney MuLV enhancer (371). Two groups working on another MuLV
enhancer, SL3-3, also identified the same factor. However, one group referred to
SL3-3 enhancer factor 1 (SEF1) (390) while the other referred to SL3-3 and AKV
core-binding factor (S/A-CBF) (34) based on the factor binding to both AKV and
SL3-3 enhancer cores. Subsequently, the current RUNX nomenclature was
established (227,240).
1.3.1.3 Function of RUNX1 in hematopoietic differentiation and
leukemia
Knockout (KO) mice for both RUNX1 and CBFβ have been described
(282,299,413,414). In mice that have RUNX1 gene disruption, heterozygous
mice appear normal compared to wild-type littermates, but homozygous knockout
mice for RUNX1 are not viable, indicating a vital role for RUNX1 in
development. Homozygous KO embryos die between days E11.5 and E12.5 with
the appearance of massive hemorrhaging within the ventricle of the central
39
nervous system and vertebral canal, the ganglia of the cranial nerves and
extending into the third and lateral ventricles as well as the pericardial space and
peritoneal cavity (299). These data suggest a role for RUNX1 in vessel
formation. During normal murine embryonic development, the major site of
hematopoiesis shifts from the yolk sac (transitory, primitive hematopoiesis) to the
fetal liver (definitive hematopoiesis) at days E11.5–E12.5. The livers of RUNX1-
deficient embryos at day E11.5 show no fetal liver–derived hematopoiesis, and
only primitive, nucleated erythrocytes were seen within vascular channels and
hepatic sinusoids. Also, peripheral blood analysis of the RUNX1-deficient
embryos at both day E11.5 and E12.5 contained only nucleated large primitive
erythrocytes, consistent with a yolk sac origin, and had no identifiable platelets.
Thus, the disruption of the RUNX1 gene results in an intrinsic defect in stem cells
or multipotential progenitors responsible for establishing definitive hematopoiesis
or a defect in the yolk sac and fetal liver microenvironment that prevents normal
in vivo development of these cells. Also, cells isolated from embryonic yolk sacs
or fetal livers of KO mice were unable to differentiate in culture into definitive
erythroid, myeloid or mixed lineage colonies under conditions where littermate
cells were able to do so. Embryonic stem cells from KO mice were also unable to
contribute to normal hematopoietic development when injected into blastocysts to
generate chimeric mice, suggesting a role in definitive hematopoiesis at either the
level of hematopoietic stem cells or another multipotential cell (299).
Disruption of the CBFβ gene in mice is also a homozygous embryonic
lethal condition indistinguishable from that of RUNX1-deficient mice
(282,413,414). These mice die around day E12.5 due to massive hemorrhaging of
the central nervous system and show no hematopoiesis in the fetal liver. These
two gene knockout studies prove that the two subunits of RUNX1 are necessary
in vivo for definitive hematopoiesis in the mouse system.
40
RUNX1 was also identified in humans based on commonly identified
t(8;21) chromosomal translocation breakpoints in acute myeloid leukemia (AML)
(261). Subsequently, RUNX1 was also identified in (q22;q22), t(12;21),
(p13;q22) and t(3;21)(q26;q22) translocations in AML and acute lymphoblastic
leukemias (226,373). The CBFβ subunit is also a target of chromosomal
rearrangements in AML, [inv(16), (p13;q22), t(16;16) and del(16)(q22)] (373).
Alterations in the RUNX1 complex account for approximately 25% of all de novo
acute leukemias. Thus, these factors are the most frequently disrupted genes in
acute human leukemias (226).
1.3.2 Transcriptional co-activator ALY
ALY is a transcriptional coactivator that interacts with RUNX proteins
and lymphoid enhancer binding factor 1 (LEF-1) on the TCR α enhancer (43).
There have been no previous reports of ALY interacting with RUNX1 or any
other factors on viral enhancers. ALY was independently cloned by a number of
groups and is known by many names, including Basic region- leucine zipper
(bZIP) Enhancing Factor (BEF) (410), RNA and Export Factor (REF) (380) and,
in yeast, Yra1p (320). The different names are indicative of the diverse activities
that have been attributed to this protein. Both the mammalian and yeast homologs
of this protein were identified in 1997. ALY was cloned in a screen to identify
factors that interact and functionally collaborate with LEF-1 (43). BEF was
identified in a search for cellular regulators of DNA-binding activity for bZIP
proteins (410). Yra1p was identified as an essential nuclear protein with RNA
annealing activity and later determined to be involved in mRNA export from the
nucleus (320,380).
41
ALY belongs to a superfamily of RNA-binding proteins that contain
ribonucleoprotein (RNP)-type RNA-binding domains (RBD) (380). In addition to
the RBD, other distinguishing features of this family include two highly
conserved motifs in the N- and C-termini (REF-N and REF-C boxes) (46).
Between the conserved motifs and the RBD are regions of variable length (N-vr
and C-vr). These family members contain elements that are similar to the
arginine-glycine-glycine (RGG) boxes in many heterogeneous RNPs (hn-RNPs).
There are three mammalian REFs (REF1-3) that differ in their variable regions
due to deletions or amino acid substitutions. The proteins are extremely
conserved, with 98% identity in the RBD and 100% identity in the conserved
boxes. REF1 (ALY) is expressed in two forms, REF1-I and REF1-II. REF1-I is
the full- length form of the protein, and REF1-II is a splice variant that lacks the
N-terminal variable region (380).
ALY is a ubiquitously expressed, nuclear protein that specifically interacts
with the activation domains of LEF-1 as well as RUNX1, both of which bind to
the TCRα enhancer (43). ALY acts by increasing the DNA-binding activity of
LEF-1 and RUNX proteins and has been shown to stimulate the activity of the
TCR α enhancer complex when reconstituted in non-T cells. In addition, down-
regulation of ALY expression by anti-sense oligonucleotides drastically reduces
TCRα enhancer activity in T cells (43). However, when artificially tethered to a
heterologous DNA-binding domain, ALY is unable to stimulate transcription,
suggesting that it acts in a context-dependent fashion to increase the
transcriptional activity of the TCR α complex. ALY is a member of the TREX
complex (transcription/export) that is specifically recruited to activated genes
during transcription (378). This complex travels the entire length of the gene with
RNA polymerase II and remains associated with the resulting mRNA throughout
its processing and export from the nucleus (212).
42
Another group isolated the human form of this protein (referred to as BEF)
in 1999 (410). BEF was identified in a search for proteins that regulate the
dimerization or stabilization of bZIP proteins. BEF recognizes the leucine zipper
motif of bZIP proteins to stimulate dimerization that then promotes DNA binding.
BEF is a novel nuclear chaperone, unlike any other family of chaperones
identified thus far, which does not require ATP for function.
The other role that has been attributed to this protein is in mRNA nuclear
export (380). Yra1p was originally identified in yeast as an essential, nuclear
RNP-motif-RNA binding protein with similarities to hnRNPs (320) and has since
been determined to interact with Mex67p (yeast homolog of tip associating
protein, TAP) and function in export of bulk polyA+ RNA from the nucleus.
Thus, REF proteins participate in multiple steps of mRNA biogenesis, including
transcription and transport.
In vitro splicing experiments with human REF has shown that it associates
with mRNAs in a splicing-dependent manner (205,445). These data suggested
that REFs interact with the cellular splicing machinery. Three pieces of evidence
support this hypothesis: co-purification of REF with spliceosomes (278), REF
localization to nuclear speckles (425,445), which are sites of enrichment of
splicing factors (256), and REF is a component of the 335 kDa complex that is
deposited by the spliceosome 20-24 nt upstream of exon-exon splice junctions
(205,206).
A current model suggests that Yra1p/REF recruits Mex67p to the mRNP
complex. Mex67p proteins associate with the nuclear pore complex, so that the
mRNPs are then transported out of the nucleus. Sub2p, the yeast homolog of
UAP56, is a DEAD box helicase involved in splicing and mRNA export which
recruits Yra1p to mRNA (377). Subsequently, Sub2p/UAP56 is displaced from
Yra1p by the binding of Mex67p, allowing transport of the mRNA through
nuclear pores. Yra1p was the first RNA-binding protein shown to bridge
43
Mex67p, an exporter protein, to intranuclear mRNA transport cargoes
(376,380,441).
1.3.3 NF-κB family of transcription factors
Although NF-κB proteins have not been implicated in regulation of T-cell-
tropic MuLV enhancers, a critical role for NF-κB has been established for the
activity of the HIV-1 enhancer in T cells for viral expression and replication
(58,198). NF-κB is a eukaryotic transcription factor that was first identified in
1986 as a nuclear factor required for immunoglobulin kappa light chain
transcription in B cells (362). NF-κB is a dimer of two members of the Rel
family of proteins, and some form of this factor exists in virtually all cell types.
The prototypical NF-κB, and the first one isolated, is a dimer of RelA and NF-
κB1 (363). In most cells that are not activated or stimulated, the NF-κB dimer is
held in the cytoplasm by an inhibitor protein, IκB (21,258,424). Upon signaling,
the IκB molecule is phosphorylated and targeted by ubiquitination for degradation
by the proteasome (42). After release from IκB, NF-κB translocates to the
nucleus where it binds to κB binding sites in a number of promoters to activate
transcription.
There are five mammalian members of the Rel/NF-κB family of proteins,
including NF-κB1 (p105/p50), NF-κB2 (p100/p52), RelA, RelB and c-Rel (Fig.
1.12) (258,366). Nuclear factor of activated T cells (NFAT) shares homology to
the Rel homology domain and is sometimes considered a member of the Rel
44
family (283). The v-rel protein, an oncogenic variant of chicken c-rel transduced
by the reticuloendotheliosis virus strain T (Rev-T), is also a Rel family member
(335). v-Rel has a C-terminal truncation and addition of Rev-T sequences on
either end compared to c-Rel (Fig. 1.12) (125). The NF-κB proteins are
evolutionarily conserved, with three members of this family found in Drosophila
melanogaster, Dorsal, Dif and Relish (103,169,374). Dorsal is a dorsal/ventral
morphogen that determines polarity in embryos by activating genes on one side of
the embryo while repressing them on the other side. Dorsal is retained in the
cytoplasm by an inhibitor protein known as Cactus. However, Dif is more similar
in function to NF-κB since its activity upregulates insect immunity genes. The
Dif protein exists as an inactive pool in the fat body of flies (which is believed to
be the fly equivalent of the liver) and is activated by infection, suggesting a role in
the primitive innate immune response. Relish is a homolog of NF-κB1 and NF-
κB2, and its activity is highly induced by bacterial infection.
All NF-κB molecules are dimers of Rel family members (123,408)and all
family members contain an N-terminal 300 amino acid Rel homology domain
(RHD), which mediates DNA binding, dimerization and interaction with IκB
(139). Additionally, all Rel proteins have a nuclear localization signal (NLS)
contained within the RHD. The two Re l family members that make up a dimer
each possess half of a DNA-binding site. Since different members can dimerize
with each other, this allows for slight variations in the binding preferences of
these dimers to the κB site, although the consensus site for NF-κB is 5’
GGGYNNCCY3’ (196). In addition to the differences in binding site preference,
45
the transactivating potential of different NF-κB molecules also can vary
considerably (195). This is due to the presence or absence of a variable C-
terminal transactivation domain in the protein monomers. Most dimers are
transcriptionally active, such as NF-κB1/RelA, NF-κB1/c-Rel, RelA/RelA, and
RelA/c-Rel (41,145,146,181). RelA, RelB and c-Rel all contain potent
transactivation domains. However, homodimers of NF-κB1 or NF-κB2 have
largely been reported to be repressors as they lack a strong C-terminal
transactivation domain (41,181,319). There is evidence that translocation of NF-
κB to the nucleus is necessary but not sufficient for transcriptional activation by
these proteins. In support of this, it has been shown that RelA is phosphorylated
in both a constitutive and an inducible manner (6,412,444). This phosphorylation
enhances DNA binding and provides additional interaction sites for CREB-
binding protein (CBP/p300) (443). Unphosphorylated RelA has been reported to
have a conformation in which the C-terminus interacts with the RHD to interfere
with DNA binding and, therefore, transcriptional activity of the factor (6). NF-
κB1 and NF-κB2 are proteins that are processed from larger precursor proteins,
p105 and p100, respectively. These proteins contain ankyrin repeats in their C-
terminal portions that act to retain these proteins in the cytoplasm. Ankyrin
repeats are protein-protein interaction motifs that are found in all IκB molecules
(361). The exact mechanism and regulation of the processing of NF-κB1 and NF-
κB2 to produce the mature, transcriptionally active forms is not completely
resolved. These NF-κB proteins are ubiquitinated, which can target them for
degradation by the proteasome, yet this degradation is reported to be partial,
46
Fig. 1.12. The Rel/NF-κB family of proteins.
Structures of the members of mammalian NF-κB/Rel family of transcription factors. The positions of the Rel homology domain (RHD), containing the DNA binding domain (DBD) and nuclear localization signal (NLS) are shown. Also depicted are the glycine rich repeats (GRR) and ankyrin repeats found in NF-κB1 and NF-κB2.
c-Rel
v-Rel
RelA
RelB
NF-κB1(p105)
NF-κB1(p50)
NF-κB2(p100)
NF-κB2(p52)
RHD
DBD NLS
GRR Ankyrin repeats
47
leaving the N-terminal portion while removing the inhibitory ankyrin repeats.
Conflicting reports suggest that processing is constitutive or regulated by an
activating signal and may be co-translational or post-translational
(157,219,229,383). The mechanism appears to be somewhat clearer for NF-κB2
than for NF-κB1, with evidence that CD40 signaling can stimulate the ubiquitin-
dependent degradation of the C-terminal domains of the p100 protein (72). There
is also evidence that the glycine-rich region found in these proteins is necessary
for mediating this proteasome-dependent partial degradation (221,301) and that
p100 can serve as an IκB and as a specific heterodimeric partner with RelB (220).
Thus, when p100 is processed, the resulting heterodimer of NF-κB2/RelB can
translocate to the nucleus.
There are also several members of the IκB family of proteins as well.
This family includes IκB α, β , γ, and ε, Bcl-3, and the Drosophila protein, Cactus
(123,223). All members function by interacting with NF-κB proteins to sequester
them in the cytoplasm of unactivated cells by masking their NLS. Family
members all have multiple ankyrin repeats that mediate their interactions with
other proteins, and there is a correlation between the number of ankyrin repeats
and the specificity of the NF-κB dimer with which IκB protein pairs. The first
family member cloned and characterized was IκB α (81,148). This protein is 37
kDa in mass and, like other family members, contains three major domains (173).
The N-terminal domain is phosphorylated in response to signaling, which targets
it for degradation. The central region contains the ankyrin repeats whereas the C-
terminal region contains PEST sequences that are involved in the basal turnover
48
of the protein. The IκB proteins mediate the rapid induction of NF-κB activity by
allowing its translocation to the nucleus to bind κB sites in target promoters.
Most IκB proteins are autoregulated since an increase in NF-κB activity leads to
increased IκB transcription due to the presence of κB sites in IκB promoters (61).
This ensures that the NF-κB activation is short- lived.
IκB α and β are the proteins that are responsible for retaining the majority
of NF-κB1/RelA and NF-κB1/c-rel dimers in the cytoplasm. However, IκB β
differs from IκB α by its failure to be upregulated by NF-κB activity; levels of
IκB β remain low until after the transient upregulation of NF-κB activity (389).
The IκB γ protein is an alternatively spliced product of the NF-κB1 precursor,
which is only detected in lymphoid cells and plays a more limited role in
inhibiting NF-κB (168). The Bcl-3 protein was identified by cloning of a t(14;19)
chromosomal breakpoint from a B-cell chronic lymphocytic leukemia (298).
Unlike other IκB family members, Bcl-3 is a nuclear protein that binds NF-κB1
and NF-κB2 .Bcl-3 may function to remove the NF-κB1 or NF-κB2 from κB
sites, thus allowing transcriptional activating forms of NF-κB to bind (114,115).
Alternatively, Bcl-3 may bind to κB sites with NF-κB1 or NF-κB2 and facilitate
transcriptional activation (36,114).
NF-κB proteins regulate a large number of genes that are involved in the
innate and adaptive immune responses. These genes encode cytokines (IL-2, IL-
1, IL-6, IL-12, TNFα, LTα and β , GM-CSF), chemokines (IL-8, MIP1α, MCP1,
RANTES, eotaxin), adhesion molecules (ICAM, VCAM, E-selectin), acute phase
proteins (SAA), inducible effector enzymes (iNOS, COX-2), anti-microbial
49
peptides (β-defensins), MHC proteins, costimulatory molecules (B7.1), and
regulators of apoptosis and proliferation (c-IAP-1, c-IAP-2, A1 (Bfl1), Bcl-XL,
Fas ligand, c-myc and cyclin D1) (12,183,303). In mature B cells, plasma cells,
macrophages, and some neurons, NF-κB is constitutively active in the nucleus
(179,225,363). Thus, NF-κB may have a role in maintaining the differentiated
state of these cells. Moreover, it is clear that NF-κB has a major role in the
regulation of the host immune response to a number of different external signals.
NF-κB has also been determined to have a critical role in HIV-1 expression since
the HIV enhancer contains tandem NF-κB sites that are critical for proviral gene
expression in response to cellular stimuli (276).
1.3.3.1 NF-κB knockout mice studies
Knockout (KO) studies have been performed with most Rel family
members to determine the contributions of individual proteins or protein
combinations to development or immune responses. The phenotypes vary
considerably from greater susceptibility to bacterial infection (NF-κB1 KO) or
developmental lethality (RelA KO).
The NF-κB1 KO mice develop normally and have normal levels of B cells
as well as a normal ratio of κ and λ light chains (364). Interestingly, B cells from
these mice do not differentiate in response to LPS, but antibody crosslinkage of
surface IgM does induce NF-κB activity and proliferation of these B cells. These
50
mice have a greater susceptibility to bacterial infections and enhanced resistance
to viral infection, presumably due to upregulation of IFN β .
Gene disruption of c-Rel results in normal murine development (190).
The major phenotype of these mice is that the responses of B and T cells to
mitogens are decreased dramatically. IL-2, IL-3, IL-12, IFN γ and GM-CSF
production are also decreased, and the level of RelA protein detected in the
nucleus is increased. The increase in nuclear RelA levels may be an attempt at
compensation, but is not effective as the mice still have defects in lymphocyte
activation.
Knockout of RelA gene expression is developmentally lethal, with
embryos dying at day E16 due from high levels of apoptosis in the liver (23,93).
Examination of NF-κB1/RelA double KO mice gave, not surprisingly, embryonic
lethality, with death due to massive apoptosis (161). These mice do not survive
past embryonic day 12, in contrast to RelA KO mice, which survive to day E16.
Further analyses of these embryos suggested that expression of RelA is required
for the formation of secondary lymphoid organs.
Disruption of RelB gene expression is not lethal; however mice are only
healthy for approximately ten days (47,417). At this time, they develop thymic
atrophy, splenomegaly, bone marrow hyperplasia, abnormal immune response
and sometimes death. Lymphoid development is normal in these mice.
RelB/NF-κB1 double KO mice have an exaggerated phenotype, with death by
four weeks of age (418). These data and the reduced ability to mount a delayed
51
type hypersensitivity response suggest that RelB may be crucial for T-cell-
mediated immunity.
IκB α KO mice have no developmental defects, but die within nine days
of birth due to degeneration of spleen and thymus (22,187). These mice are born
severely runted and have skin abnormalities. NF-κB activity is greatly increased
in hematopoietic organs, and this constitutive activity is believed to be the cause
of neonatal lethality.
1.3.4 Transcription factor c-Myb
As mentioned previously, c-Myb binding is crucial for enhancer activity
of SL3-3 in cooperation with RUNX1 binding (281,437). There are three
members of the family of Myb proteins: A-Myb, B-Myb and c-Myb. All
members of this family are nuclear proteins that function as transcriptional
transactivators. The protein structure reveals three functional domains, an N-
terminal DNA-binding domain, a central transactivation domain and a C-terminal
regulatory domain (343) (shown for c-Myb in Fig. 1.13). The N-terminal domain
contains 3 imperfect tandem repeats of 50-52 amino acids each, termed R1, R2
and R3. The R1 repeat is dispensable for DNA binding, but functions to stabilize
the complex formed between the DNA and the R2R3 repeats (162). Part of R2
and all of R3 are required for DNA binding (291,293-295). In the case of A- and
c-Myb, the C-terminal domain acts as a negative regulator of transactivation,
whereas the B-Myb C-terminal domain is a positive regulator. Family members
52
have highly-conserved DNA-binding domains, and it appears that these proteins
bind to DNA with overlapping sequence specificities. The transactivation
potential of these proteins depends on the cell type and context of the responsive
promoter, suggesting that the Myb proteins rely on interactions with other cell-
type specific co-factors for transactivation.
The predominant c-Myb proto-oncogene is a 75 kDa (636 amino acid)
protein that is expressed in most hematopoietic tissues, but an alternatively
spliced 89 kDa protein is also expressed (97). The c-Myb protein is constitutively
expressed in immature hematopoietic cells, but in other cell types, such as mature
T cells, the expression is regulated and only detected at the G1/S phase of the cell
cycle. Expression of c-Myb at this transition point is required for T cells to
proceed with the cell cycle (121). The c-Myb proteins are short-lived since they
are rapidly degraded by the proteasome-ubiquitin pathway (29). A-Myb encodes
a 95 kDa (751 amino acid protein) expressed in male germ cells, breast epithelial
cells in pregnant mice, ovaries, developing brain and B cells in splenic germinal
centers (129). B-Myb is a 93 kDa (704 amino acid) ubiquitous protein expressed
in late G1/S following the entry of quiescent cells in to the cell cycle (344).
The c-Myb consensus binding site, also known as the Myb responsive
element (MRE), was defined as YAACKGHH (H= A, C, T and K= G, T and Y=
C, T) (422). The MRE is a bipartite binding site, composed of YAAC and
KGHH. The YAAC half-site is absolutely required for DNA binding, while the
second half-site is quite flexible and mediates the half- life of the DNA-protein
complex. Recent work has extended the MRE to 15 nt in length
53
(NNCNTAACGGTTTTT) using a yeast-based in vivo binding site selection assay
(24). As noted from this new consensus sequence, the sequences 5’ from the
AACGGT core are not well- conserved, suggesting that the sequence has minor
importance. The new consensus sequence also revealed a preference for A-T rich
sequences downstream stream of the hexamer core for optimal binding and
activation.
1 636
R1 R2 R3
DBD TAD LZ
NRD
Fig. 1.13. Functional domains of the c-Myb protein.
The DNA-binding domain (DBD) is made up of three imperfect tandem repeats (R1, R2 and R3). The transcriptional activation domain (TAD) is shown in green. The negative regulatory domain (NRD) is located in the C-terminal region of the protein and contains a leucine zipper (LZ).
c-Myb proteins play a critical role in regulating normal hematopoiesis
since antisense oligonucleotides impeded in vitro hematopoiesis dramatically
(5,122). An essential role for c-Myb in development has also been demonstrated
with the generation of KO mice, as these mice die in utero due to severe anemia
and drastic defects in all hematopoietic cell lineages except for megakaryocytes
(270). These mice appear to have a defect in the switch from primitive to
definitive hematopoiesis. Animals develop normally until embryonic day 13.5,
54
but die by day 15, coinciding perfectly with the switch in hematopoiesis. Myb
seems to block terminal differentiation of hematopoietic cells since the level of c-
Myb expression is down-regulated as stem cells develop into mature cells
(137,421) and overexpression of c-Myb prevents the differentiation of cells (394).
The major function of c-Myb may be to coordinate the proliferation and
maturation of hematopoietic cells.
Myb was originally identified as the transforming gene of the defective
avian myeloblastosis virus (AMV), which induces acute myeloid leukemia (269).
Another replication-defective retrovirus, E26, also contains a transduced Myb
gene and induces erythroid and myeloid leukemias (327). Both viruses encode
different forms of an N- and C-terminally truncated c-Myb protein. The v-
MybAMV protein is 45 kDa and contains 6 amino acids from the viral Gag protein
and 371 amino acids from the cellular c-Myb protein. The v-MybE26 protein is
considerably larger at 135 kDa and is a fusion of viral Gag, c-Myb and Ets-1
(277). Both proteins lack the full C-terminal negative regulatory domain.
c-Myb is highly conserved and present in all vertebrates and some
invertebrate species. The human c-Myb gene locus on chromosome 6 has 15
exons and spans a region of 40 kb, encoding an mRNA of 3.8 kb (231). The c-
Myb promoter does not contain the canonical TATA box, and transcription
initiates from multiple sites in a GC-rich region of the promoter (370).
55
1.3.4.1 Cellular targets of c-Myb
A number of cellular promoters, including a number of myeloid-specific
genes (elastase, Myb-induced myeloid protein 1(mim-1) and myeloperoxidase
(MPO)) as well as T-cell-specific genes (TCRγ and δ, CD4) are functionally
activated by c-Myb binding (407). The c-Myb promoter is negatively
autoregulated in T cells (142), and c-Myb positively regulates c-myc expression
(108). The TCRγ promoter also contains a RUNX1 binding site adjacent to the c-
Myb binding site that is necessary but not sufficient for transcriptional activation.
Functional cooperation has been demonstrated between RUNX1 and c-Myb for
the enhancer contained within the TCRγ promoter (154-156). The MPO gene is
specifically expressed in myeloid cells (384,393), serving as an early marker of
both the granulocytic and monocytic lineages (113,324). Similar to the TCRγ
promoter, the MPO promoter contains two c-Myb binding sites as well as a
RUNX1 binding site. RUNX1 and c-Myb have been shown to synergistically
activate the MPO promoter (39), but they do not bind DNA cooperatively
(155,437).
1.3.4.2 c-Myb and retroviral promoters
A number of retroviral promoters have been shown to bind c-Myb
proteins, including SL3-3 MuLV (281,437), human endogenous retrovirus H (82),
human T- lymphotropic virus-1 (HTLV-1) (35,79) and human immunodeficiency
56
virus-1 (HIV-1) (65,80,312). c-Myb is highly expressed in myeloid cells and
mitogen- and/or antigen-stimulated T cells, which are the targets of infection and
replication for these viruses.
A number of c-Myb binding sites have been mapped in the HTLV-1 LTR
(35,79). In one study, six specific c-Myb binding sites were identified by DNase I
footprinting, five of which were located in the U3 region and one in the R region
of the LTR. The binding site located in the R region was unable to confer c-Myb
responsiveness to CAT reporter constructs alone. Three of the six binding sites in
the U3 region functionally bound c-Myb and transactivated reporter constructs in
transient transfection analyses with a c-Myb expression vector. These analyses
showed that c-Myb could bind the HTLV-1 LTR in the absence of the viral
protein Tax1. More recent studies have shown that Tax1 and c-Myb reciprocally
antagonize the transcriptional activity of each other by competing for a binding
site on another transcription factor, CBP (71). This antagonism may be
responsible for the upset of homeostasis in HTLV-1-infected cells that eventually
causes malignancy. Another report states that Tax1 is able to repress Myb-
mediated transcription via activation of the NF-κB pathway, leading to
sequestration of CBP by RelA (279).
At least fifteen putative c-Myb binding sites have been identified in the
HIV-1 LTR (80). Evidence of actual binding and functional significance of
binding has only been shown for one high affinity Myb binding site and at least
two low affinity Myb binding sites. The high affinity Myb binding site maps to
the modulatory portion of the U3 region in the HIV LTR. Fine mapping of the
57
low affinity Myb binding sites has not been performed, but there may be binding
sites in the U5, R and U3 regions.
c-Myb also binds to the MuLV SL3-3 enhancer (281,437). This enhancer
has two RUNX1 binding sites (named core I and core II), an Ets binding site and
a Myb site positioned between the core II and the Ets sites (Fig. 1.10). As
previously mentions, the Myb and the core I site mutations had far greater effects
on pathogenicity than did the core II or Ets site mutations (281).
Myb binding site mutations also greatly reduced the ability of the SL3-3
LTR enhancer to activate c-myc transcription when inserted upstream in the
opposite orientation of the major c-myc promoters (268). Ets binding site
mutations in the enhancer had a modest effect on c-myc gene expression (281).
Proviruses containing the mutations were not inserted near c-myc, but an
insufficient number of tumors were examined since SL3-3 normally integrates
near c-myc in approximately 15% of tumors (268).
In transient transfection experiments in which c-Myb was overexpressed to
determine the effect on SL3-3 LTR-mediated transcription, no change in
transcription levels was observed with or without c-Myb expression (437).
However, if RUNX1 was also overexpressed, transcription was higher than that
seen with RUNX1 overexpression alone. This dependence on RUNX1 for c-Myb-
mediated transactivation was not based on synergistic DNA binding since both
factors bind to the DNA independently (437). Thus, these factors stimulate
transcription synergistically following DNA binding. Also, when multimerized
RUNX1 binding sites were linked with a basal LTR promoter, the promoter was
58
inactive in T cells. However, if Ets and Myb binding sites were multimerized in
the presence of RUNX1 sites, enhancer activity in T cells was reconstituted (437).
Thus, RUNX1 alone is a poor transactivator alone, but instead serves to help
organize enhancer-binding proteins to potentiate higher transcription levels in T
cells.
1.4 RATIONALE FOR THIS STUDY
Thymotropic strains of MMTV have alterations in the LTRs that cause a
change in tissue tropism and pathogenicity of the virus from mammary
adenocarcinomas to thymic lymphomas. The thymotropic strain TBLV has a
deletion of NREs accompanied by the multimerization of sequences flanking this
deletion which has been proposed to form an enhancer (16). However, most
previous work has focused on negative regulation of MMTV rather than
regulation of the thymotropic strains. In this study, the multimerized sequences in
the TBLV LTR were characterized and defined as a T-cell specific enhancer
(247). The novel enhancer was mapped by mutagenesis and assays for function in
two T-cell lines. Critical binding sites were defined and some of the transcription
factors that bind to the TBLV enhancer were identified by reconstitution of the
activity in non-T cells. Also, TBLV proviral integrations in or near the c-myc
locus were characterized with respect to their enhancer structure (40).
59
2. Materials and methods
2.1 CELL LINES
Jurkat human T lymphoma cells (420) were obtained from American Type
Culture Collection (ATCC) (Manassas, VA) and were maintained in RPMI
medium (Gibco, Carlsbad, CA) supplemented with 7.5% fetal calf serum (FCS)
(Gibco), gentamicin sulfate (50 µg/ml), streptomycin (50 µg/ml) and penicillin
(100 U/ml). RL?1 murine T cells (353), A20 murine B cells (185), LBB.11
murine B cells (263) (obtained from Dr. Bridget Huber, Tufts University, Boston,
MA) and EL4b murine T cells (138) (obtained from Dr. James Allison, University
of California, Berkeley, CA) were maintained in RPMI medium supplemented
with 10% FCS, gentamicin sulfate (50 µg/ml), streptomycin (50 µg/ml), penicillin
(100 U/ml), and 5 × 10-5 M 2-mercaptoethanol. XC rat fibroblast cells (188) were
grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5%
FCS, gentamicin sulfate (50 µg/ml), streptomycin (50 µg/ml), and penicillin
(100 U/ml). HC11 normal murine mammary epithelial cells from BALB/c mice
(18) were obtained from Dr. Jeff Rosen (Baylor College of Medicine, Houston,
TX) and passaged in RPMI medium supplemented with 10% FCS, gentamicin
sulfate (50 µg/ml), streptomycin (50 µg/ml), penicillin (100 U/ml), insulin (0.5
µg/ml), and epidermal growth factor (0.5 µg/ml). All cells were grown in a
humidified atmosphere containing 7.5% CO2 at 37ºC.
2.2 TRANSFECTIONS
Jurkat T cells were transfected using SuperFect reagent (Qiagen, Inc.,
Valencia, CA) as specified by the manufacturer. One day prior to transfection,
cells were plated at 5 x 105 cells/ml in complete medium. Cells (2.5 x 106) were
60
plated in six-well plates in a volume of 2.5 ml of complete medium on the day of
transfection. In some cases, cells were cultured in 7.5% charcoal-stripped FCS
and/or phenol red-free RPMI. Charcoal-stripped FCS was prepared by mixing 2 g
activated charcoal (Sigma, St. Louis, MO) per 100 ml FCS, followed by a 2 h
incubation with stirring at 4ºC. The mixture was then centrifuged at 4ºC for 30
min at 72,000 x g in an SW28 rotor (Beckman Coulter, Fullerton, CA) to remove
the charcoal. Plasmids pC3H-LUC or one of the substitution mutants (2 µg) and
pRL-TK (0.25 µg) were mixed with 75 µl of RPMI medium with no additives,
and then incubated with SuperFect (10 µl) for 10 min at room temperature (RT).
The solution then was added dropwise to the cells and mixed thoroughly. Cells
were harvested 48 h after transfection and analyzed for reporter gene activity.
XC cells were plated at 4 x 105 cells/well of a 6-well plate one day prior to
transfection. The wild-type or substitution mutants in the TBLV LTR-luciferase
reporter plasmids and pRL-TK were transfected using DMRIE-C transfection
reagent (Invitrogen, Carlsbad, CA). On the day of transfection, cells were washed
twice with RPMI. Luciferase reporter (5µg) and pRL-TK (0.5 µg) plasmids were
mixed with 0.5 ml DMEM. DMRIE-C (10 µl) was mixed with 0.5 ml DMEM
and incubated at RT for 30 to 45 min. The two mixtures were then combined and
incubated for 15 min at RT before addition to cells. Transfection complexes were
incubated on the cells for 6 to 9 h before addition of 1 ml complete medium.
Cells were harvested 48 h after transfection and analyzed for reporter gene
activity.
LBB.11. B cells were transfected using a Zapper electroporation unit
(University of Wisconsin electronics lab, Madison, WI). One day prior to
transfection, cells were plated at a density of 6 x 105 cells/ml in complete
medium. On the day of transfection, the cells were counted and resuspended at a
density of 2 x 107 cells/550 µl complete medium containing the appropriate DNA.
Electroporations were carried out in a 1 cm gap cuvette placed in an ice water
61
bath. The machine was set to the minimum rise time, maximum fall time,
maximum capacitance and 2000 volts. Cells were plated in 10 ml complete
medium and harvested at 24 h for analysis of reporter gene activity.
All other electroporations were performed using a BTX ECM600
electroporator (San Diego, CA). The conditions for each cell line are detailed in
Table 2.1. One day prior to transfection, Jurkat cells were plated at 5 x 105
cells/ml while RL? 1, A20 and EL4b cells were seeded at a density of 6 x 105
cells/ml. HC11 cells were passaged to achieve 85 to 90% confluence on the day
of transfection (usually 1:3). All samples were incubated at RT for 10 min before
electroporation. Samples were plated in 5 ml of the appropriate medium in 60
mm dishes after transfection. A20 cell transfections were harvested 24 h post-
transfection and analyzed for reporter gene activity. All other cells were
harvested at 48 h post-transfection.
2.3 NUCLEAR EXTRACT PREPARATION
Small scale preparation of nuclear extracts was performed according to the
method of Olnes and Kurl (300), with some modifications. Cells from a confluent
plate (approximately 107 cells) were washed twice in PBS (137 mM NaCl, 2.68
mM KCl, 8 mM dibasic sodium phosphate, 1.76 mM monobasic potassium
phosphate, pH 7.4) and resuspended in 400 µl Buffer I (10 mM HEPES, pH 7.9,
10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM
phenylmethylsulfonyl fluoride [PMSF][Sigma] and 0.2 µg/ml pepstatin A
[Sigma]), transferred to an Eppendorf tube and incubated on ice for 15 min prior
to lysis with 0.6% (v/v) Nonidet P-40 detergent, diluted in Buffer I. The lysate
62
Table 2.1. Conditions for transfections using a BTX ECM600 electroporator
Cell
Line
Cell
density
Cuv.
Size a Vol. V µF Ohms
Post-
incub.b
Jurkat 2x107/ml 4 mm 400µl
medium 260 1050 720
10’
RT
RL? 1 5x107/ml 2 mm 200µl
medium 140 1900 72
10’
RT
A20 3.8x107/ml 4 mm 400µl
RPMI 280 975 72
10’
ice
EL4b 4x107/ml 2 mm 200µl
RPMI 125 2300 48
10’
RT
HC11 5x107/ml 2 mm 200µl
RPMI 140 1750 72
10’
RT
a Cuvette size: refers to gap size for cuvette.
b Post-incubation time: refers to time and temperature at which cells were incubated before plating them in medium.
63
was centrifuged at 200 x g for 5 min at RT and the nuclear pellet was washed with
400 µl Buffer I to remove residual detergent. After centrifugation, the pellet was
resuspended in 100 µl Buffer II (20 mM HEPES [pH 7.9], 0.4 M NaCl, 1 mM
EDTA, 1 mM EGTA, 10% glycerol, 1 mM DTT, 1 mM PMSF and 0.2 µg/ml
pepstatin A) using a wide-bore pipette tip. After centrifugation at 13,000 x g for
10 min at 4ºC, the nuclear extract supernatant was aliquoted and snap frozen in
liquid nitrogen prior to storage at -80ºC.
2.4 WHOLE CELL LYSATE PREPARATION
Whole cell lysates for electrophoretic mobility shift assays (EMSAs) were
prepared by pelleting tissue culture cells at 1500 rpm (450 x g) in an IEC CentraR
(Needham Heights, MA) for 5 min at 4ºC. Cells were washed once with Tris-
buffered saline (10 mM Tris-HCl [pH 7.4], 150 mM NaCl) prior to sonication on
ice in microextraction buffer (20 mM HEPES [pH 7.4], 450 mM NaCl, 0.2 mM
EDTA, 0.5 mM dithiothreitol, 25% glycerol) supplemented with 1.25 mM PMSF
and 0.2 µg/ml pepstatin A (Sigma). After sonication, the lysates were clarified by
centrifugation at 13,000 × g at 4°C, and protein concentrations were determined
using the Bio-Rad protein assay reagent as described by the manufacturer (Bio-
Rad, Hercules, CA). Alternatively, whole-cell extracts were prepared by washing
cells with Tris-buffered saline prior to disruption with glass beads (Sigma).
2.5 REPORTER GENE ANALYSIS
Assays were performed either using the Dual-Luciferase reporter assay
system (Promega, Madison, WI) that independently measures Renilla and firefly
luciferase activities, or measuring the firefly luciferase activity and quantitating
GFP-positive cells by fluorescence-activated cell sorter (FACS) analysis to
64
normalize for DNA uptake (367). Briefly, cells were rinsed once with phosphate-
buffered saline (PBS) and subsequently disrupted using passive lysis buffer
(Promega) followed by two to three freeze-thaw cycles in a dry ice-ethanol bath.
The lysates then were clarified by centrifugation at 13,000 × g for 5 min at 4°C.
Luciferase activity was determined according to the manufacturer's instructions
using a Turner TD-20e luminometer (Turner Designs, Inc., Sunnyvale, CA) after
assays for protein concentration. Samples were normalized for DNA uptake using
luciferase values obtained from the co-transfected pRL-TK or firefly luciferase
vectors, or using the percentage of GFP-positive cells.
2.6 FACS ANALYSIS
To assess the transfection efficiency in some experiments, cells were
collected prior to reporter gene analysis and centrifugation at 450 x g for 5 min at
4ºC in an IEC CentraR refrigerated centrifuge. Cells were washed once in PBS,
pH 7.4. Approximately 105 cells were centrifuged in Eppendorf tubes at 1000 x g
in a Beckman Coulter Microcentrifuge 18 centrifuge at RT for 5 min, washed
once in PBS, pH 7.4, and resuspended in 200 µl PBS, pH 7.4. Cells were then
transferred to 2052 Falcon polypropylene FACS tubes (Becton Dickenson,
Franklin Lakes, NJ) and analyzed for GFP using a FACSort flow cytometer and
CELLQuest software. Cell populations were selected based on forward and side
scatter, and the selected cell population was analyzed for GFP fluorescence.
Approximately 10,000 selected cells were analyzed for each sample and the
percentage of GFP-positive cells was used to normalize reporter gene data.
65
2.7 PREPARATION OF OLIGONUCLEOTIDE PROBES
Probes for EMSAs were prepared by annealing the appropriate
oligonucleotides and end labeling with Sequenase version 2.0 (Amersham
Pharmacia Biotech, Piscataway, NJ). Briefly, annealed complementary
oligonucleotides with 5’ GG overhangs were labeled using the following 10 µl
reaction: 5 µg double-stranded oligonucleotide, 10 mM DTT, 0.2mM dGTP, 25
or 50 µCi 32P dCTP (Perkin Elmer, Boston, MA), and 3.25 U Sequenase version
2.0 in Sequenase buffer. Reactions were incubated for 1 h at 37ºC. The reaction
was extracted once with buffered phenol:chloroform (1:1) and purified using a
Micro Bio-Spin P30 Tris chromatography column (Bio-Rad) followed by ethanol
precipitation. The probe was resuspended in T.E. (10:0.1) (10 mM Tris-HCl, pH
7.4 and 0.1 mM EDTA) and radioactive incorporation was measured using a
Beckman LS3801 scintillation counter.
2.8 EMSA
DNA binding reactions (10 to 20 µl) were performed on ice in a buffer
containing 20 mM HEPES (pH 7.9), 1 mM MgCl2, 0.1 mM EGTA, 0.4 mM
dithiothreitol, 200 mM KCl, 12 µg of salmon sperm DNA/ml, and 4 µg of
poly(dl-dC) (Amersham Pharmacia). Radiolabeled probe was added to each DNA
binding reaction (4 X 104 cpm) and incubated for 10 min on ice. Reactions were
analyzed using 4% non-denaturing polyacrylamide gels and 0.25X TBE running
buffer (22.3 mM Tris base, 22.3 mM boric acid, 0.5 mM EDTA) prior to
autoradiography of the dried gel.
66
2.8.1 Antibody supershift or ablation
Supershift experiments were performed with rabbit antiserum against the
RUNX1 peptide Arg- lle-Pro-Val-Asp-Ala-Ser-Thr-Ser-Arg-Arg-Phe-Thr-Pro-
Pro-Ser as described previously (248). To verify the specificity of supershift
experiments, the peptide used for antisera preparation (4 µg) was pre-incubated
with antibody before addition to EMSAs.
2.8.2 Oligonucleotide or DNA competition assays
To assess the specificity of radiolabeled probe-protein complexes formed
in EMSAs, either unlabeled oligonucleotides or PCR products were used in the
DNA binding reactions. To perform competition, a molar excess of the DNA was
added to the DNA binding reaction prior to the addition of the radiolabeled probe
and then incubated on ice for 10 min. The EMSA then proceeded as described
above.
2.9 PLASMIDS
Plasmid pRL-TK (Promega) contains the HSV TK promoter upstream of
the sea pansy (Renilla reniformis) luciferase gene. The vectors pGEMT-Easy
(Promega) and pBluescript II SK(-) (Stratagene) were obtained commercially. A
number of expression vectors were generously provided by colleagues and are
listed in Table 2.1.
67
Table 2.2. Plasmids provided by colleagues for studies of TBLV enhancer
Plasmid Protein
expressed Donor Location
pLDCMV-
NFATc NFATc
Dr. Nancy
Rice
National Cancer Institute (NCI),
Frederick, MD
pCMV-NFATp NFATp “ “
pCMV399 NF-κB1 “ “
pCMVp52 NF-κB2 “ “
pRC/CMV-hc-Rel c-Rel “ “
pcRelB RelB “ “
pCMV65IN RelA “ “
pCMV5-AML1B AML-1B
(RUNX1)
Dr. Shari
Meyers
Louisiana State University
Medical Center, Shreveport, LA
pCMV5-AML3 AML3
(RUNX2) “ “
pCDNA3.1-
FLMyb c-Myb
Dr. Linda
Wolff NCI
pMEIκB67J Dominant
negative Iκ-Bα
Dr. Nancy
Colburn NCI
pCMV-ALY ALY Dr. Rudolph
Grosschedl University of Munich, Germany
68
The plasmid pC3H-LUC previously described as pLC-LUC (37), was
modified by the destruction of the SstI site in the polylinker; this construct
contains the MMTV C3H LTR upstream of the firefly luciferase gene. Plasmid
pTBLV-LUC was engineered by replacement of the ca. 760-bp ClaI-to-SstI
fragment of the C3H MMTV LTR in pC3H-LUC with the ca. 440-bp ClaI-to-SstI
fragment of the TBLV LTR; this region of the TBLV LTR includes the triplicated
enhancer sequence as well as the 443-bp deletion of the NREs (16) (figure 1.7).
The pC3H∆NRE-LUC vector was created by digestion of pC3H-LUC with AflII,
filling the ends, digestion with StuI, and religation. The vector pC3H3R∆NRE-
LUC was made by substitution of a ca. 240-bp StuI-to-SstI fragment from the
TBLV LTR (generated by PCR using a 5' primer with a Stul site) for the ca. 531-
bp StuI-to-SstI fragment of the C3H MMTV LTR. Plasmid pC3H3R-LUC was
engineered by insertion of the StuI-to-SstI fragment of pC3H3∆RNRE-LUC into
the StuI site of the pC3H-LUC vector. The vector pTBLV-4R-LUC was prepared
by PCR amplification of a TBLV LTR containing four copies of the enhancer
element from T16 tumor DNA. The PCR product was digested with ClaI and SstI
and substituted for the corresponding region in pLC-LUC.
The pd6 parental vector for substitution mutations was prepared using a
recombinant PCR strategy (158). Using pLC-LUC as a template, two separate
PCRs were performed, one using LTR 329+ (5' CCG CAT CGA TTT TGT CCT
TCA 3') and LTR 523- (5' CGT TTT AGG CCT TTG AGG TTG AGC GTC
TCT TTC T 3') and the other using LTR 1024+ (5' CCT CAA AGG CCT AAA
ACG AGG ATG TGA GAC AAG T 3') and LTR1068- (5' CTC AGA GCT CAG
ATC AGA ACC TTT GAT 3'). (The added StuI site is shown in bold.) The
products were purified by polyacrylamide gel electrophoresis, and equimolar
amounts of the two PCRs were combined. Using LTR 329+ and LTR 1068-, the
final product was amplified, resulting in the deletion of the LTR sequence from
positions 523 to 1024 and the creation of a StuI site. Plasmid pC3H-LUC was
69
partially digested with ClaI and completely digested with SstI, and the ClaI-to-
SstI fragment from the C3H LTR was removed by gel purification using Prep-A-
Gene matrix (Bio-Rad). The TBLV PCR product also was digested with ClaI and
SstI and ligated into the digested vector to generate pd6. This clone was verified
by sequencing. The wild-type 62-bp enhancer element was cloned into the vector
pGEM-TEasy (Promega), and the resulting plasmid (pGEM-62) was used to
generate single copies of the substitution mutants by a modification of the
QuikChangeTM site-directed mutagenesis method described by Stratagene.
Briefly, the plasmid vector was mixed with complementary primers containing 6-
to 8-bp mutations (including a BglII site) in the enhancer element; each mutation
was flanked by 16 to 22 bp of the pGEM-62 sequence. After PCR using PfuTurbo
(Stratagene), a mutant enhancer plasmid with staggered nicks was generated and
the reaction was digested with DpnI, thus cleaving the methylated parental wild-
type DNA. The undigested mutant plasmids then were recovered by
transformation of Escherichia coli DH5α and screened for the presence of an
appropriate BglII site. The mutations were verified by sequencing and then
amplified by PCR using primers that had been treated with T4 polynucleotide
kinase. The PCR products then were concatemerized, and the triplicated product
was purified and cloned into the pd6 vector that had been linearized with StuI.
Clones containing the triplication in the correct orientation were verified by
sequencing.
The pRL-TK vectors containing the TBLV triplication in various locations
were cloned by digestion with either BamHI, BglII, or HindIII to linearize the
plasmid. Following digestion, blunt ends were generated by treatment of the
linear vectors with Klenow enzyme (New England Biolabs, Beverly, MA), and 5'
phosphates were removed using calf intestinal phosphatase (Roche Molecular
Biochemicals, Mannheim, Germany). The triplicated enhancer region of the
TBLV LTR was amplified by PCR using a positive-strand primer (5' AAT AGA
70
AAG AGA CTC TCA ACC TC 3'), a negative-strand primer (5' AAC CAC TTG
TCT CAC ATC CTC G 3'), and pTBLV-LUC as the template. The PCR products
were treated with T4 polynucleotide kinase prior to ligation with the vector.
Individual clones were verified by sequencing.
The vector containing the Renilla luciferase gene, pc-mycRluc, and
derivatives containing the TBLV LTR or Moloney MuLV LTR that were inserted
upstream or downstream of c-myc were constructed in several steps. The plasmid
pc-mycRluc includes c-myc exon 1, intron 1, bp 1 to 15 of exon 2, bp 61 to 897 of
exon 3, and upstream and downstream flanking regions. The Renilla luciferase
gene was inserted at the c-myc start codon and replaced all but 15 bp of exon 2
and intron 2. All PCR primers used to construct pc-mycRluc have restriction
endonuclease sites (underlined) that were engineered in the 5’ end for cloning
purposes. The Renilla luciferase gene [including the stop codon and simian virus
40 polyadenylation (SV40 polyA) signal] from pRL-TK was amplified using the
sense primer (5’ GTC GAC ATG ACT TCG AAA GTT TAT GAT CC 3’) and
the antisense primer (5’ AGA TCT TAC CAC ATT TGT AGA GG 3’) and
cloned into the pGEMT-Easy vector. Plasmid DNA from a clone containing the
PCR product was digested with SalI and BglII, and the ~1.2-kb fragment was
purified by agarose gel electrophoresis prior to ligation. Most of c-myc exon 3 (bp
61 to 897) and 4.7 kb of the downstream flanking region were amplified from
BALB/c genomic DNA using the sense primer (5’ AGA TCT CTG CCA AGA
GGT CGG AGT CGG 3’) and the antisense primer (5’ GAA TTC GCT TCT
ACT CAA CCC TTA CTC 3’) and cloned into the pGEMT-Easy vector as
described above. Plasmid DNA from a clone containing the PCR product was
digested with BglII and EcoRI, and the ca. 5.5-kb fragment was purified by
agarose gel electrophoresis. The 1.2-kb Rluc/poly(A) fragment, the 5.5-kb
fragment containing c-myc exon 3 and downstream region, and linearized
pBluescript II SK(-) vector (digested with SalI and EcoRI and treated with CIP)
71
were ligated into a 9.7-kb intermediate construct, pPB. Subsequently, ca. 5.1 kb
of DNA was amplified from BALB/c genomic DNA using the sense primer (5’
GGT ACC CGT GAC CTG ATC TCT AGC TTC TCC 3’) and the antisense
primer (5’ GTC GAC CGT CGT GGC TGT CTG CTG GAG GG 3’) and cloned
into pGEMT-Easy vector as described above. This PCR fragment includes 2.9 kb
upstream of c-myc, exon 1, intron 1, and 15 bp of exon 2. Plasmid DNA from a
clone containing the PCR product was digested with KpnI and SalI, and the ca.
5.1-kb fragment was purified by agarose gel electrophoresis. The intermediate
construct, pPB, was linearized by partial digestion with KpnI and complete
digestion with SalI, treated with CIP, and ligated to the 5.1-kb fragment to make
the parental vector, pc-mycRluc. Plasmid constructs were verified by restriction
fragment analysis and direct sequencing. The pc-mycRluc vector was modified by
digestion with an enzyme that cuts only in the 3’ flanking region (AatII and StuI)
or by linearization with an enzyme that cuts once in both the 5’ and 3’ flanking
regions (KpnI and AfeI). In addition, a unique NcoI site was generated ca. 1.5 kb
upstream of c-myc exon 1 by site-directed mutagenesis as described previously
(247) using the sense primer (5’ AAT AAA TCT AGA ACC ATG GCA CAG
AGC AAA AGA C 3’) and the antisense primer (5’ GTC TTT TGC TCT GTG
CCA TGG TTC TAG ATT TAT T 3’). Linear pc-mycRluc was dephosphorylated
and ligated to the 1.2-kb HindIII fragment of pTBLV-LUC (247), the 1.26-kb
HindIII fragment from pTBLV4R-LUC, the 1.2-kb HindIII fragment from
pTBLV-WT-LUC, or the 700 bp HindIII fragment containing the Moloney
MuLV LTR from pLX3. The Klenow fragment of DNA polymerase or T4 DNA
polymerase was used to generate blunt ends after digestion with enzymes that left
overhanging 5’ or 3’ ends. Clones containing the LTR HindIII cassettes in both
forward and reverse orientations were isolated and verified by restriction enzyme
analysis and sequencing.
72
2.10 PREPARATION OF PLASMID DNA
2.10.1 Small scale plasmid preparations
Mini-preparations of plasmid DNA from bacteria were obtained
essentially as described by Sambrook et a. (346). Cultures from bacterial colonies
were grown overnight in 2 ml of LB supplemented with the appropriate antibiotic.
The culture was transferred to an Eppendorf tube and centrifuged to pellet
bacteria. The pellet was resuspended thoroughly in 250 µl Solution I (50 mM
Tris-HCl [pH 8], 10 mM EDTA [pH 8], 50 mM glucose). Cells were then lysed
by addition of 250 µl Solution II (1% SDS, 0.2 M NaOH). After complete lysis,
350 µl Solution III (3 M potassium acetate, 2 M acetic acid) was added and mixed
thoroughly. Precipitated material was pelleted by centrifugation at 13,000 x g for
10 min in a microcentrifuge at RT. The supernatant was then transferred to a new
Eppendorf tube and 600 µl isopropanol was added to precipitate the DNA. After
mixing the solution, DNA was pelleted by centrifugation at 13,000 x g for 10 min
in a microcentrifuge at RT. The pellet was washed once with 1 ml 70% ethanol
and centrifuged for 5 min at 13,000 x g in a microcentrifuge at RT. The pellet
was then allowed to air dry for 5 min before suspension in 30 µl T.E. (10:0.1)
supplemented with 50 µg/ml RNAse A.
2.10.2 Large scale plasmid preparations
Large scale preparations of plasmid DNA was obtained using alkaline
lysis and cesium chloride gradient centrifugation. Cultures were prepared in one
of two ways. For plasmids that required chloramphenicol treatment, 25 ml of LB
supplemented with the appropriate antibiotic was inoculated with either a single
colony of the bacteria or a stab of a glycerol stock containing the plasmid of
73
interest and incubated with shaking overnight at 37ºC. Subsequently, 20 ml of the
overnight culture was added into 500 ml LB supplemented with the appropriate
antibiotic and grown until the A600 was 1 to 1.2. Chloramphenicol (dissolved in
100% ethanol) was added to the culture to a final concentration of 0.17 mg/ml and
incubated overnight with shaking at 37ºC. Alternatively, for cultures that did not
require chloramphenicol treatment, 500 ml LB supplemented with the appropriate
antibiotic was inoculated with either a single colony, a stab of a glycerol stock or
2 ml of an 8 h culture and incubated overnight at 37ºC with shaking. The culture
was pelleted by centrifugation at 6000 x g in a JA10 rotor (Beckman) for 10 min
at 4ºC. The pellet was resuspended in 8 ml cold Solution I containing 2 mg/ml
lysozyme. The bacterial cells were lysed by addition of 16 ml freshly-made
Solution II, followed by thorough mixing and inversion. After 10 min incubation
at RT, 12 ml of Solution III was added. After thorough mixing, precipitation was
allowed to reach completion by incubation on ice for 10 min. The precipitated
materials were pelleted by centrifugation for 30 min at 4ºC at 2850 x g (3800
rpm) in an IEC CentraR centrifuge. The resulting supernatant was transferred to a
new 50 ml conical tube, adjusted to 50 ml total volume with isopropanol and
mixed by inversion. The precipitation was allowed to proceed at RT for 15 min
before centrifugation for 30 min at 2850 x g in an IEC CentraR at 4ºC. The pellet
was resuspended in 3.5 ml T.E.(10:10) (10 mM Tris-HCl [pH 7.4] and 10 mM
EDTA), followed by the addition of 4.8 g CsCl. Ethidium bromide (5 mg/ml)
was added to the resulting solution (680 µl) and insoluble materials were pelleted
by centrifugation at 2850 x g for 10 min at RT. The supernatant was added to
Beckman OptisealTM ultracentrifuge tubes, and subjected to centrifugation at
50,000 rpm (250,000 x g) in an NVT65.2 ult racentrifuge rotor for 16-18 h at 20ºC
in an L7-65 Beckman ultracentrifuge. Plasmid bands were removed from the
gradient with an 18 gauge needle and ethidium bromide was extracted from the
solution with N-butanol saturated with G-50 buffer (10 mM Tris-HCl [pH 7.4],
74
0.1 M NaCl and 2 mM EDTA). Plasmid was then ethanol precipitated and
resuspended in 2 ml T.E. (10:10). Any RNA present in the DNA solution was
removed by treatment for 30 min at 37ºC with 100 ug/ml RNAse A and 100 U/ml
RNAse T1. The solution was then treated for 30 min at 37ºC with 100 µg/ml
proteinase K and 0.5% SDS. Extraction with phenol:chloroform (1:1) removed
any protein contamination and the solution was then dialyzed against 1000
volumes T.E.(10:1) (10 mM Tris-HCl [pH 7.4] and 1 mM EDTA) with 2 changes
of the buffer. Dialyzed DNA was ethanol precipitated, washed with 70% ethanol
and resuspended in T.E. (10:0.1). Quantitation of the DNA was assessed by UV
spectrophotometric analysis at an absorbance of 260 nm.
2.11 PCR ANALYSIS OF TUMOR DNA
The Expand Long-Template PCR System (Roche Molecular
Biochemicals) was used to detect TBLV integrations. Amplification conditions
for TBLV insertion sites within and flanking the c-myc gene included incubation
at 94°C, followed by 30 cycles of PCR, with one cycle consisting of 20 s at 94°C,
30 s at 57.5°C, and 4 min at 68°C. The reaction mixture was then incubated at
68°C for 8 min. Semi-quantitative PCR analysis was performed as described
above, except serial threefold dilutions of tumor DNA were used as indicated in
figure legends. DNA concentrations were determined by absorbance readings at
260 nm and were confirmed by Hoechst staining and fluorimetry. Semi-nested
PCR products were obtained in two steps. First, PCR was performed as described
above using a c-myc-specific primer and a primer specific for the TBLV LTR.
The products were purified using a Qiaquick nucleotide removal kit (Qiagen),
diluted, and then used in a second PCR with TBLV-specific LTR primers that
flank the enhancer repeat region.
75
2.12 PURIFICATION OF ALY FROM JURKAT T CELLS
Whole cell lysates were prepared from large-scale cultures of Jurkat T
cells (4 to 6 liters) grown in spinner flasks. All purification steps were carried out
at 4ºC, except as noted. Cells were pelleted by centrifugation at 450 x g in a JA10
rotor using a Beckman Avanti JE centrifuge for 15 min. Cells were washed once
with PBS, pH 7.4, and centrifuged again for 15 min. Lysates were prepared as
described above using sonication and centrifuged at 39,000 x g in a JA20 rotor for
30 min to pellet cell debris. The resulting supernatant was then loaded onto a 1.5
cm X 50 cm BIO-RAD glass column containing Sephacryl S200-HR resin that
had been previously equilibrated with TM + 0.1M KCl buffer (50 mM Tris-HCl,
[pH 7.9], 100 mM KCl, 12.5 mM MgCl2, 1 mM EDTA, 10% glycerol) containing
2 mM DTT, 0.1 mM PMSF and 0.4 ug/ml pepstatin A. After the sample had
entered the column, the resin was washed with the TM + 0.1 M KCl buffer and 1
ml fractions were collected after the void volume had been eluted. Samples were
analyzed for DNA binding proteins using a TBLV enhancer probe (556WT26)
and EMSA as described above. Samples containing NF-A and NF-B binding
activity were pooled and heat-treated. For NF-A-containing samples, the pooled
fractions were treated at 40ºC for 10 min. For NF-B-containing samples, the
pooled fractions were treated at 45ºC for 10 min. After heat-treatment,
precipitated proteins were pelleted by centrifugation at 13,000 x g for 10 min.
Heat-treated samples were then loaded onto a double-stranded DNA-cellulose
column that had been equilibrated with N100 buffer (0.1 M NaCl, 5 mM MgCl2,
0.1 mM EDTA, 20 mM HEPES [pH 7.9], 0.05% Brij-35, 20% glycerol, 1 mM
DTT, 0.5 mM PMSF, 0.2 ug/ml pepstatin A). After the sample had entered the
resin, the column was washed with N100 buffer until flow-through fractions
absorbance (A280) readings returned to background levels. Bound proteins were
eluted by E250 buffer (20 mM HEPES [pH 7.9], 250 mM ammonium sulfate, 5
76
mM MgCl2, 0.1 mM EDTA, 0.05% Brij-35, 20% glycerol, 1 mM DTT, 0.5 mM
PMSF and 0.2 ug/ml pepstatin A) and 1 ml fractions were collected until A280
readings again reached background levels. Protein-containing fractions were
analysed for NF-A and NF-B binding activity by EMSA. Those fractions
containing NF-A or NF-B activity were pooled and these proteins were affinity
purified using magnetic beads conjugated to a 556WT oligonucleotide
concatamer. Bound proteins were washed extensively with EMSA binding buffer
containing poly (dAdT) as a non-specific competitor. Proteins were eluted with
EMSA binding buffer containing 2M NaCl and dialyzed against EMSA binding
buffer prior to SDS-PAGE. Eluted protein bands were then analyzed by MALDI-
MS and MS/MS by Dr. Ryuji Kobayashi (M.D. Anderson Cancer Center,
Houston, TX).
2.13 SDS-PAGE AND STAINING
Proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) as described by Sambrook et al. (346). Gels were
then stained by either Coomassie Brilliant Blue or silver nitrate solution. For
Coomassie staining, gels were incubated in fixing solution (50% (v/v) methanol,
10% (v/v) acetic acid, 40% (v/v) water) for two h with agitation at RT. After
fixation, gels were stained with Coomassie staining solution (50% (v/v) methanol,
0.05% (v/v) Coomassie brilliant blue R-250, 10% (v/v) acetic acid, 40% (v/v)
water) for 1 h. Gels were then incubated in destaining solution (5% (v/v)
methanol, 7% (v/v) acetic acid, 88% (v/v) water) with changes of the solution
until the minimal background was achieved. Gels were silver stained using Bio-
Rad Silver Stain Plus kit (Bio-Rad) as described by the manufacturer. Gels were
scanned or photographed and dried using a gel dryer at 55ºC for 2-3 h on
Whatman filter paper.
77
2.14 WESTERN BLOT ANALYSIS
After resolution by SDS-PAGE, proteins were transferred to nitrocellulose
(NC) membranes (Schleicher & Schuell, Keene, N.H.) in Western transfer buffer
(39 mM glycine, 48 mM Tris base, 1% SDS, 20% (v/v) methanol) overnight at
150 mA at 4ºC. NC membranes were then blocked by incubation for 1 h at RT
with shaking in TBST (20 mM Tris [pH 7.6], 137 mM NaCl, 0.1% Tween 20)
containing 5% nonfat milk. Primary antibody was then diluted in TBST
containing 1% nonfat milk and the NC membrane was then incubated in primary
antibody for 1 h with shaking at RT. Blots were washed three times for 10 min
each in TBST. Horseradish peroxidase (HRP)-conjugated secondary antibody
was diluted in TBST containing 1% nonfat milk and added to the blot. After a 30
to 60 min incubation at RT with shaking in secondary antibody, the blot was once
again washed three times for 10 min each in TBST. Antibody binding was
detected by Western Lightning enhanced chemiluminescent (ECL) reagent
(Perkin Elmer) as described by the manufacturer.
2.15 UV DNA-PROTEIN CROSSLINKING
To determine the sizes of proteins that bound the 556WT probe, DNA
binding reactions were performed as described previously, but were crosslinked
for 30 to 60 min at 120 mJ/cm2 on ice in a Fisher Scientific UV crosslinker
(Pittsburgh, PA). After crosslinking, samples were resolved on a 10% SDS-
PAGE gel prior to drying and exposure to X-ray film.
78
3. Results
3.1 IDENTIFICATION OF A T-CELL-SPECIFIC ENHANCER IN THE TBLV LTR
3.1.1 Unique cis-acting elements in the TBLV LTR confer T-cell-specific transcriptional activity
Previous experiments using TBLV LTR reporter genes in transgenic mice
suggested that TBLV has a unique transcriptional control region that is
preferentially active in CD4+ CD8+ T cells (307). Examination of the TBLV LTR
sequence shows that there is a deletion of 443 bp of the U3 region and triplication
of 62 bp flanking the deletion relative to the MMTV LTR (Fig. 1.7) (16). Our lab
has previously reported the presence of several NREs within the MMTV LTR that
inhibit transcription in lymphoid tissues (37,163). Therefore, the contributions of
the NREs and the triplication to TBLV-mediated transcription were determined.
The transcriptional activity of the wild-type C3H MMTV LTR (pC3H-LUC) was
compared with that of an LTR containing an NRE deletion between the StuI and
AflII sites (pC3H∆NRE-LUC), an LTR with an insertion of the triplicated region
from TBLV into the StuI site (pC3H3R-LUC), or a C3H LTR containing either a
substitution of the TBLV LTR region between the ClaI and SstI sites (pTBLV-
LUC) or between the StuI and SstI sites (pC3H3R∆NRE-LUC) (Fig. 3.1).
Transient transfections of these constructs into Jurkat T cells showed that
elimination of the NREs between the C3H MMTV StuI and AflII sites
(pC3H∆NRE-LUC) elevated reporter gene expression threefold compared to
pC3H-LUC (Fig. 3.2A). Inclusion of the TBLV triplication in the NRE-minus
LTR (either pTBLV-LUC or pC3H3R∆NRE-LUC) increased expression
approximately 700- to 800-fold over that observed with pC3H-LUC, whereas the
79
Fig. 3.1. Reporter gene constructs used in transient transfection assays.
The positions of relevant restriction enzyme sites within the U3 region that were used for cloning are shown. The pC3H∆NRE-LUC construct was prepared by removing the StuI-to-AflII fragment from the C3H-LUC vector. The pC3H3R-LUC vector was prepared by insertion of the StuI-to-SstI fragment from TBLV LTR into the StuI site of pC3H-LUC. The construct pTBLV-LUC was prepared by substituting the ClaI-to-SstI fragment of TBLV for the ClaI-to-SstI fragment of pC3H-LUC. The construct pC3H3R∆NRE-LUC was made by substitution of a StuI-to-SstI fragment from the TBLV LTR for the StuI-to-SstI fragment of pC3H-LUC.
Rluciferase
U5
ClaI
U3
pC3H3R-LUC
AflII SstI
U3
pC3H∆NRE-LUCluciferaseluciferaseU5R
U3 RU5
pC3H-LUC
U3
SstIClaI
pTBLV-LUC or
pC3H3R∆NRE-LUC
luciferaseluciferase
StuI AflII
ClaI SstI
luciferaseluciferase
ClaI SstI
RU5
NREs
NREs
80
triplication alone (pC3H3R-LUC) elevated expression approximately 250-fold
above the activity of the C3H MMTV LTR. These assays revealed that the
combined effects of the deletion and triplication were sufficient to account for the
differences in the transcriptional activities of the MMTV and TBLV LTRs in
Jurkat cells.
Transient transfections with MMTV and TBLV LTR constructs also were
performed in RL? 1 T cells and other cell types. Results for RL? 1 cells (CD4+
CD8+) were similar to those obtained with Jurkat cells except that the basal
activity of the MMTV promoter was not detectable in RL?1 cells (probably due
to lower transfection efficiencies) (Fig. 3.2B). In contrast to results obtained with
T-cell lines, there was little difference in the transcriptional activity of the C3H
MMTV LTR relative to the TBLV LTR in HC11 mouse mammary cells, XC rat
fibroblasts, or LBB.11 mouse B cells (Table 3.1). Together, these experiments
showed that loss of the NREs and acquisition of the triplicated region allowed
higher transcriptional activity of the MMTV LTR in T cells but not other cell
types, including B cells.
81
Table 3.1. Activities of MMTV and TBLV-LTR reporter gene constructs in non-T-cell lines
Cell Line LTR Promoter Relative luciferase
activitya
C3H MMTV 1.0 ±0.1 HC11 mammary epithelial cells
TBLV 0.5±.01
C3H MMTV 1.0±0.2 XC rat fibroblast cells
TBLV 1.0±0.1
C3H MMTV 1.0±0.1 LBB.11 B cells
TBLV 1.8±0.3
a Luciferase activity in light units/100 µg of protein extract was determined. Values for
pTBLV-LUC then were calculated relative to a value of 1.0 for pC3H-LUC.
82
Fig. 3.2. Transcriptional activity of various TBLV LTRs in T cell lines.
(A) Activities of reporter gene constructs in Jurkat cells. LUC activity is given in light units/100 µg of protein normalized for DNA uptake as measured by cotransfection with the pRL-TK plasmid. LUC activity is reported relative to that of pC3H-LUC, assigned a value of 1; standard deviations from the means of triplicate assays are shown. (B) Activities of reporter gene constructs in RL? 1 cells. Luciferase activity is reported relative to pC3H∆NRE-LUC (assigned a value of 1) since the activity of pC3H-LUC was not detected in these assays.
0
200
400
600
800
1000R
elat
ive
LU
C v
alu
e
pC3H-LUC pC3H∆NRE-LUC
pC3H3R-LUC
pC3H3R∆NRE-LUC
pTBLV-LUC
pC3H-LUC pC3H∆NRE-LUC
pC3H3R-LUC
pC3H3R∆NRE-LUC
pTBLV-LUC
1 3
256
779 675
A
pC3H-LUC pC3H∆NRE-LUC
pC3H3R-LUC
pC3H3R∆NRE-LUC
pTBLV-LUC
0
50
100
150
Rel
ativ
e LU
C v
alue
LTR-Reporter Constructs
0 120
66
82
B
0
200
400
600
800
1000R
elat
ive
LU
C v
alu
e
pC3H-LUC pC3H∆NRE-LUC
pC3H3R-LUC
pC3H3R∆NRE-LUC
pTBLV-LUC
pC3H-LUC pC3H∆NRE-LUC
pC3H3R-LUC
pC3H3R∆NRE-LUC
pTBLV-LUC
1 3
256
779 675
A
pC3H-LUC pC3H∆NRE-LUC
pC3H3R-LUC
pC3H3R∆NRE-LUC
pTBLV-LUC
0
50
100
150
Rel
ativ
e LU
C v
alue
LTR-Reporter Constructs
0 120
66
82
B
83
3.1.2 Determination of the TBLV triplication as a T-cell specific enhancer
Because the TBLV triplication is reminiscent of other retroviral enhancer
regions that have been shown to be important for viral disease specificity
(56,86,213,339), the TBLV LTR triplication was tested to determine if it could act
as an enhancer on a heterologous promoter. To do this, the entire triplicated
region (three copies of the 62 bp element) was amplified using PCR and inserted
in both orientations at three positions, one upstream and two downstream, relative
to the HSV TK promoter in the pRL-TK reporter gene plasmid (Fig. 3.3). The
resulting constructs then were used in transient transfections of Jurkat T cells.
Insertions of the TBLV LTR triplication upstream or downstream of the promoter
showed 9- to 89-fold elevation of Renilla luciferase expression from the TK
promoter and expression was relatively orientation independent (Fig. 3.4A). The
highest level of expression was observed when the triplication was downstream of
the reporter gene in the sense orientation. These results were consistent with the
ability of the TBLV LTR triplication to act as a transcriptional enhancer
(20,116,201,267).
To determine if the LTR enhancer activity was cell type dependent, the
pRL-TK plasmids containing the TBLV triplication were used for transient
transfections in a second T-cell line, RL? 1. Such experiments showed
orientation- independent enhancement of TK promoter activity (Fig. 3.4B). The
same constructs were also used in transient transfection assays in XC rat
fibroblast cells (Fig. 3.5). In these experiments, the TBLV triplication did not
enhance transcription from the TK promoter; instead, the presence of the
triplication inhibited (up to five-fold) transcriptional activity of the promoter.
Similarly, no enhancement was observed when transient transfections were
performed with HC11 mammary cells (data not shown). Together with previous
84
results, these experiments suggest that the TBLV enhancer is active only in
specific cell types, particularly T cells.
Fig. 3.3. Structures of plasmids containing the TBLV triplication in the pRL-TK vector.
The transcriptional orientations of the Renilla luciferase (R-LUC) and ampicillin resistance (Ampr) genes are shown by arrows above the plasmid construct. The TBLV triplication was inserted in three positions within the TK promoter- luciferase vector at the BglII, HindIII, and BamHI sites. The forward (F) and reverse (R) orientations of the triplication inserts are shown by arrows below the plasmid construct.
BglII HindIII BamHI
HSV-TK promoter R-LUCSV40 Late
PolyA Ampr
FR
FR
FR
85
Fig. 3.4. Activity of the TBLV LTR triplication on a heterologous TK promoter in T cells.
(A) Transient transfections in Jurkat human T cells with plasmids diagrammed in Fig. 3.3. (B) Transient transfections in RL? 1 mouse T cells. Standard deviations from the means of triplicate assays are shown. Luciferase activity is reported as described in the legend to Fig. 3.2 except that values are relative to that for the pRL-TK plasmid without the TBLV enhancer (assigned a value of 1). DNA uptake was normalized using the activity of the co-transfected pTBLV-LUC plasmid.
020406080
100120
TK Bam-F Bam-R Bgl-F Bgl-R Hind-F Hind-R
Rel
ativ
e R
-LU
C v
alu
e
020406080
100120140160180
TK Bam-F Bam-R Bgl-F Bgl-R Hind-F Hind-R
Construct
Rel
ativ
e R
-LU
C v
alu
eA
B
86
Fig. 3.5. Activity of the TBLV LTR triplication on a heterologous promoter in XC rat fibroblast cells.
Renilla luciferase activity is reported as described in Fig. 3.4.
3.1.3 Determination of optimal numbers of 62 bp elements for enhancer activity in T cells
To determine how many 62 bp enhancer elements gave the optimal
transcriptional activity in the context of the TBLV LTR, a series of luciferase
reporter plasmids were constructed in the pd6 vector. This vector, based on the
structure of the TBLV LTR, has an NRE deletion accompanied by deletion of the
flanking sequences that generate the enhancer elements. In addition, a StuI site
was substituted for the deleted sequences. Reporter plasmids were constructed
StuI digestion of pd6 followed by ligation to 1 to 4 copies of the wild-type 62 bp
TBLV enhancer element. Constructs with the correct number of repeats in the
forward orientation were verified by DNA sequencing. These plasmids were then
00.20.40.60.8
11.2
TK Bam-F Bam-R Bgl-RBgl-F Hind-F Hind-R
Construct
Rel
ativ
e R
-LU
C v
alue
87
transiently transfected into Jurkat human T cells and analyzed for reporter gene
activity. The optimal number of TBLV enhancer elements in CD4+ Jurkat cells
was determined to be three (Fig. 3.6A). Since TBLV induces tumors in immature
thymocytes (307), these constructs were also tested in the RL? 1 CD4+ CD8+ cell
line (Fig. 3.6B). Results showed that two- and three-repeat enhancers gave
greater expression than those with one or four repeats. Therefore, these
experiments indicated that the TBLV enhancers with four repeats of the 62 bp
element were less effective in promoting TBLV transcription in mature or
immature transformed T cells than enhancers with two or three copies of this
sequence.
3.2 CHARACTERIZATION OF TBLV ENHANCER-BINDING FACTORS
3.2.1 Mutagenesis of the TBLV enhancer
3.2.1.1 Deletion mutations
To analyze the contribution of specific enhancer sequences, deletions of
the 62 bp element were constructed. One construct lacks the first 15 bp of the
repeat element (pTBLV47-LUC), which is derived from the 5’ flanking sequence,
and another construct lacks a potential RUNX1 binding site in addition to the first
15 bp (pTBLV47∆RUNX-LUC). These mutant repeat elements were triplicated
and inserted into the StuI site in the reconstituted TBLV LTR (pd6). Transient
transfection analyses were performed in Jurkat T cells and analyzed for reporter
gene expression levels. The pTBLV47-LUC construct only had 4% of the
reporter gene expression of wild-type pTBLV-LUC (Fig. 3.7). The larger
88
0
50
100
150
200
250
300
350
pC3H-LUC
0R 1R 2R 3R 4R
LTR-Reporter Constructs
0
1
2
3
4
1R 2R 3R 4R
LTR-Reporter Constructs
Rel
ativ
e LU
C V
alue
A B
Rel
ativ
e L
UC
Val
ue
Fig. 3.6. Enhancer activity of TBLV LTRs with different numbers of enhancer repeats.
(A)Transient transfection assays with luciferase reporter plasmids containing TBLV LTRs with different numbers of enhancer repeats (from zero [0R] to four [4R]) in Jurkat T cells. (B) Transient transfection assays with luciferase reporter plasmids containing TBLV LTRs with different numbers of enhancer repeats in RL? 1 T cells. Relative luciferase activity was determined after normalization for DNA uptake by cotransfection with the pRL-TK plasmid. Luciferase activity was determined in Jurkat cells relative to the activity of the C3H LTR-luciferase reporter plasmid that contains the NREs (pC3H-LUC). For transfections of RL? 1 cells, luciferase activity was determined relative to the activity of the pTBLV-1R-LUC plasmid, since pC3H-LUC activity was undetectable in these cells. The C3H LTR-luciferase reporter was engineered to delete the NREs including the sequences that constitute the 62-bp repeat (pd6 or 0R) or retain one, two, three, or four copies of the repeat (1R, 2R, 3R, and 4R, respectively). There was no difference between the values obtained for the engineered pTBLV-3R-luciferase plasmid and a reporter plasmid containing the naturally occurring alteration from the TBLV LTR (pTBLV-LUC) (data not shown). The means of triplicate assays (± standard deviations) are shown.
89
Fig. 3.7. Activity of 5’ deletion enhancer mutants in transient transfection assays of Jurkat T cells.
The sequences of the elements contained in the constructs tested are shown above. Luciferase activity was determined as described in the legend to Fig. 3.2. Means of triplicate assays with standard deviations are shown.
WT: cagttgaagaacaggtgcggttcccaaggcttaagtaagtttatggttacaaactgttcttaTBLV47: tgcggttcccaaggcttaagtaagtttatggttacaaactgttctta
TBLV47dRUNX1: tcccaaggcttaagtaagtttatggttacaaactgttctta
RUNX1
0200400600800
10001200
pC3H-LUC pTBLV-LUC pTBLV47-LUC
pTBLV47-dRUNX1
-LUC
DNA transfected
Rel
ativ
e LU
C v
alue
90
deletion in pTBLV47∆RUNX1-LUC, further reduced expression, with only 1.2%
of wild-type levels. This suggests that the joining of the two flanking DNA
sequences juxtaposes binding sites for transcription factors that are able to
cooperate and form an enhancer. However, it is also possible that these deletions
resulted in a change in the spacing or architecture of the LTR that artificially
changed reporter gene levels.
3.2.1.2 Substitution mutations
To determine the specific sequences required for T-cell enhancer activity,
a reporter gene construct was prepared that replicated the TBLV LTR changes in
the context of the C3H MMTV LTR. A 62-bp enhancer monomer from the TBLV
LTR was synthesized, triplicated, and inserted into the StuI site of the pd6 vector
to generate pTBLV-WT-LUC. Transient transfections comparing the
transcriptional activities of pTBLV-WT-LUC and pTBLV-LUC revealed no
significant differences (Fig. 3.43). Subsequently, 6- to 8-bp substitution mutations
containing a BglII site were introduced by site-directed mutagenesis across the
length of the enhancer monomer. These mutant elements were triplicated and
inserted into the StuI site as indicated for pTBLV-WT-LUC (Fig. 3.8).
Transient transfection experiments were performed in two different T-cell
lines (Jurkat and RL?1) to compare the reporter gene activity of the wild-type
construct to that of the mutants. In Jurkat cells, the 540, 564, and 572 mutations
reduced transcriptional activity less than twofold, whereas the mutations at
positions 548, 578, and 594 suppressed enhancer activity approximately two- to
three-fold (Fig. 3.9). On the other hand, mutations at positions 556 and
586 affected reporter gene expression 20-fold or more. Interestingly, results from
91
Fig. 3.8. Diagram of the TBLV LTR and positions of enhancer substitution mutations.
The reporter gene plasmid used as the backbone for preparation of the substitution mutations (pd6) was prepared as described in Materials and Methods. After the NREs were removed and replaced with a StuI site, triplicated regions containing the wild-type (WT) or mutant (M) sequences were inserted.
WT cagttgaagaacaggtgcggttcccaaggcttaagtaagtttatggttacaaactgttctta
540M acagatct------------------------------------------------------
548M --------t-gatctc----------------------------------------------
556M ----------------taa-a--t--------------------------------------
564M ------------------------at--atc-------------------------------
572M ----------------------------------a-ct------------------------
578M --------------------------------------tgag--ct----------------
586M ----------------------------------------------gagatcta--------
594M ------------------------------------------------------gagatc-t
StuI
505 bp deletionU3 RU5
insert triplication
92
the CD4+ Jurkat line were not identical to those from RL? 1 cells (CD4+ CD8+).
In RL?1 cells, mutations at positions 540, 572, and 578 had wild-type activity,
the 564, 586, and 594 mutations had less than a 2-fold effect on promoter
function, and mutation at position 548 gave a 10- to 20-fold loss of reporter gene
activity assayed in this cell type (Fig. 3.9). Since the mutation at 556 decreased
reporter gene activity at least 20-fold in both CD4+ and CD4+ CD8+ T cells, these
results suggested that the 556 mutation compromised one or more transcription
factor binding sites that are critical for the T-cell enhancer activity of the TBLV
LTR. Neither the 548 nor 556 mutations compromised LTR reporter gene activity
in HC11 mammary cells (data not shown), suggesting that the effect of these
mutations is cell type specific.
The TRANSFAC software program (428) was also used to identify
putative transcription factor binding sites within the enhancer. Potential binding
sites for RUNX1 (AML-1) and GR were observed. Interestingly, the 556
mutation overlapped the RUNX1 site, whereas the 586 mutation overlapped the
GR site (Fig. 3.10).
93
Fig. 3.9. Reporter gene activity of mutant enhancers in transient assays in Jurkat (yellow) or RL? 1 (pink) T cells.
Mean values of triplicate assays with standard deviations are shown. Luciferase activity was determined as described in the legend to Fig. 3.2 except that values are relative to that of the pTBLV-WT-LUC vector (assigned a value of 100).
0
50
100
150
200
WT54
0M54
8M55
6M56
4M57
2M57
8M58
6M59
4M
Rel
ativ
e L
UC
val
ue
Jurkat (CD4+)
RL1 (CD4+ CD8+)
LTR-Reporter Constructs
94
Database: TRANSFAC MATRIX TABLE, Rel.3.3 06-01-1998 Query: TBLV 62 (62 bases) Taxonomy: Vertebrate Threshold: 85.0 point TFMATRIX entries with High-scoring: 1 CAGTTGAAGA ACAGGTGCGG TTCCCAAGGC TTAAGTAAGT TTATGGTTAC entry score ----- M00205 GR 95.0 ------> M00271 RUNX1 92.0 -------> M00100 CdxA 91.0 ------------> M00001 MyoD 90.7 ------- M00192 GR 88.6 <------- M00040 CRE-BP 87.9 -------> M00101 CdxA 87.1 -------> M00040 CRE-BP 86.7 ------> M00240 Nkx-2. 86.0 <------------ M00087 Ik-2 85.5 <------- M00148 SRY 85.5 51 AAACTGTTCT TA entry score -----------> M00205 GR 95.0 ------------> M00192 GR 88.6 Total 11 high-scoring sites found. Max score: 95.0 point, Min score: 85.5 point
Fig. 3.10. TRANSFAC search results for the TBLV enhancer element.
Parameters were set to look only in vertebrate databases at the default threshold of 85. Predicted binding sites and their respective scores are shown on the right.
95
3.2.2 Characterization of factors affected by the 548 and 556 mutations in the TBLV enhancer
3.2.2.1 RUNX1 binding to the TBLV enhancer
Critical sequences for TBLV enhancer function occur within the 556
mutation, and the TRANSFAC software program (428) identified a putative
RUNX1 binding site spanning this mutation. The TBLV RUNX1 sequence
closely matched a consensus RUNX1 site (244) as well as a high-affinity RUNX1
site in the MuLV LTR described by Thornell et al. (391) (Fig. 3.11). To
determine if this TBLV region contains a RUNX1 binding site, a 26-bp
oligonucleotide based on the wild-type TBLV LTR (556WT) sequence was
synthesized. The oligonucleotide was end- labeled and used in a gel shift assay
with whole-cell extracts from Jurkat T cells (Fig. 3.12, lanes 1 to 6). As a control,
a labeled oligonucleotide containing a consensus RUNX1 binding site was also
used (lanes 7 to 12) (19). Results of this experiment showed that the TBLV LTR
probe bound at least two complexes with mobilities similar to those obtained with
the RUNX1 probe (compare lanes 2 and 8). Only the slower-migrating complex
was specific, as judged by competion with homologous oligonucleotide, and it
contained RUNX1 as confirmed by supershifts for RUNX1 (lane 4; supershifted
band co-migrates with NF-A) (248). This supershift was abolished by pre-
incubation of the reaction with the peptide used to generate the antibody (lane 5).
At least two other complexes that were not observed with the RUNX1 probe
(named NF-A and NF-B) also appeared to be specific, as judged by competition
with homologous oligonucleotide (lane 6). The NF-A complex was resolved into
at least three bands in later experiments (see Fig. 3.22).
96
Fig. 3.11. Comparison of the RUNX1 consensus sequence to that from TBLV, MuLVs, and the T-cell receptor alpha chain (TCR ).
Transient transfection experiments in RL? 1 (CD4+CD8+) T cells showed
that two adjacent mutations starting at positions 548 and 556 resulted in dramatic
reductions in TBLV enhancer activity (Fig. 3.9). Comparisons of the mutations to
the consensus sequence indicated that the RUNX1 binding site spanned these two
mutations. However, the effect of the 548 mutation was more dramatic in RL? 1
cells than in Jurkat (CD4+) T cells. To determine if the effect of both mutations in
T cells was due to a decrease in RUNX1 binding to the TBLV enhancer, gel shift
assays were performed with Jurkat cell extracts to measure competition of various
oligonucleotides for RUNX1 binding to the 556WT oligonucleotide from the
TBLV enhancer (Fig. 3.13A). Oligonucleotides containing a known RUNX1
binding site (Fig. 3.13B, lanes 3 and 4) or the TBLV LTR oligonucleotides
548WT and 556WT (lanes 5, 6, 9, and 10) competed for RUNX1 binding. The
548M oligonucleotide also showed competition, suggesting that this mutation did
not significantly affect RUNX1 binding (lanes 7 and 8). As expected from
previous results, the RUNX1-specific oligonucleotide did not compete for binding
of NF-A and NF-B (lanes 3 and 4, see arrows). The NF-A complex was competed
NYGYGGTNN RUNX 1 Consensus
GTGCGGTTC TBLV
TTGCGGTTT/A RUNX 1 High Affinity
CTGTGGTAA Moloney MLV
ATGTGGCTT TCR α
97
RUNX1
Jurkat WCE
Rabbit IgG
RUNX1 Ab
RUNX1 peptide
556WT oligo
+
-
-
-
+
+
-
+
+
-
+
-
+
-
-
+
+
-
-
-
+
-
-
-
-
-
-
-
-
-
RUNX1 supershift
TBLV Enhancer Probe RUNX1 probe+
-
-
-
+
+
-
+
+
-
+
-
+
-
-
+
+
-
-
-
+
-
-
-
-
-
-
-
-
-
NF-A
NF-B
1 2 3 54 6 7 8 9 121110
* *
Fig. 3.12. Supershift experiments show RUNX-specific binding to the TBLV enhancer element.
The TBLV enhancer probe (556WT) was used for EMSA with whole-cell Jurkat extracts in lanes 1 to 6, whereas a known RUNX1 binding site probe was used in lanes 7 to 12. Probe sequences are shown in Fig. 3.13A. The NF-A complex (arrow) and the RUNX1 supershifted complex (asterisk) migrate similarly on the gel. Normal rabbit immunoglobulin G (IgG) was used as a negative control in lanes 3 and 9.
98
with the 548WT and 556WT oligonucleotides but showed poor competition with
the 556M oligonucleotide, whereas the 548M sequence did not compete for this
complex. These results suggested that the NF-A binding site spans the 548 and
556 mutations. The NF-B complex was competed with 548WT, 556WT, and
548M sequences, but competition with the 556M oligonucleotide was minimal
(lanes 11 and 12). These assays suggested that the 556 mutation, but not the
548 mutation, affected binding of RUNX1, NF-A and NF-B binding. Together,
these experiments suggest that there are at least three complexes (NF-A, RUNX1,
and NF-B) that bind to the TBLV LTR in close proximity (within 16 bp) to
control enhancer activity. None of these complexes was competed by
oligonucleotides containing consensus binding sites for c-Myb, c-Ets-1, or Ets
family members (data not shown).
The cell- type-specific distribution of these complexes also was determined
using gel shift assays with the 556WT probe. As anticipated from previously
published data (246,261,352), RUNX1 complexes were abundant as measured
using cellular extracts from Jurkat and RL? 1 cells (Fig. 3.14A, lanes 4, 5, 8, and
9). Small amounts of RUNX1 also were detectable in mammary cell extracts, but
a more abundant (and also unknown) complex, migrated slightly slower than that
determined to contain RUNX1 by supershift experiments (Fig. 3.14A lanes 2 and
3; Fig. 3.14B). Neither NMuMg mammary epithelial nor LBB.11 B-cell extracts
had detectable RUNX1 activity by gel shift assays (Fig. 3.14A, lanes 10 and 11)
99
2 3 10 11 124 5 6 7 8 91
RUNX1 548WT 548M 556WT 556M
20X 100X 20X 100X 20X 100X 20X 100X 20X 100X
RUNX1
Competitor:
Molar excess:
-
-
NF-A
NF-B
B
Fig. 3.13. Identification of factors affected by the 548 and 556 TBLV enhancer mutations.
(A) Nucleotide sequences of probes and competitors used for gel shift assays. Dashes indicate sequence identities with the 548WT and 556WT probes. The RUNX1 binding site is over- lined. (B) Binding specificity of NF-A, RUNX1 and NF-B complexes. The 556WT probe was labeled and used for EMSA with Jurkat whole cell lysates in the presence of 20- or 100-fold molar excess of unlabeled competitor oligonucleotides. The positions of specific complexes are shown with arrows. Lane 1 has no cell extract added.
A
548 WT 5’GGT TAC AGT TGA AGA ACA GGT GCG GTT CCC AA 3’548 M --- --- --- --- -T- GAT CTC --- --- --- --556 WT G G-- --- --- --- --- --- --G GCT T 556 M G G-- --- --- TAA –A- -T- --- --- -RUNX1 G GCG –GT AT- -T- --- AAT –C-
100
or by Western blotting (for LBB.11, data not shown). The NF-B complexes were
particularly abundant in HC11 extracts, but were easily detected in extracts from
the NMuMG mouse mammary cell line, the Jurkat and RL? 1 T-cell lines, and the
LBB.11 B-cell line. Complexes of NF-A were detected using Jurkat and RL? 1
cell extracts and B-cell extracts but were undetectable or in low amounts in
mammary cell extracts, suggesting NF-A is a lymphoid-restricted complex.
3.2.2.2 RUNX1 overexpression in non-T cells
Transient transfection experiments identified a critical region of the TBLV
enhancer for optimal transcriptional activity in both Jurkat and RL?1 cells (Fig.
3.9); this region was shown to bind RUNX1 (Fig. 3.12), a transcription factor that
also binds the MuLV enhancers (439). Because the TBLV and MMTV LTRs
have equivalent transcription levels in non-T-cell lines, it was determined whether
overexpression of the transcriptionally active splice variant of RUNX1 (RUNX1B)
(250) would enhance reporter gene activity from the TBLV LTR in non-T cells.
Plasmid pTBLV-LUC was transfected into HC11 mammary cells in the presence
of increasing amounts of a RUNX1B expression vector (250) (Fig. 3.15A). Co-
transfection with the RUNX1B expression plasmid gave approximately 30-fold
enhancement of reporter gene activity relative to transfections containing a control
plasmid lacking the RUNX1B cDNA. Activity of the TBLV LTR was dependent
on the amount of RUNX1B expression vector; doubling of the RUNX1B vector
amount resulted in twice as much reporter gene expression. This effect was
specific for RUNX1B since cotransfection of a RUNX2 expression construct did
not increase transcriptional activity from the TBLV LTR (data not shown).
Moreover, overexpression of RUNX1B failed to elevate expression of a TBLV
LTR reporter
101
Fig. 3.14. Cell type specificity of factor binding to the 556WT probe.
(A) Different amounts of whole-cell extracts from HC11 mammary cells (lanes 2 and 3), Jurkat T cells (lanes 4 and 5), NMuMG mammary cells (lanes 6 and 7), RL? 1 T cells (lanes 8 and 9), and LBB.11 B cells (lanes 10 and 11) were incubated with the TBLV enhancer probe. Lanes 10 and 11 were derived from a gel different from that shown for lanes 1 to 9. Lane 1 shows a reaction with no added cell extract. The positions of NF-A, RUNX1, and NF-B complexes are shown with arrows on the left. Gel shifts using A20 B-cell extract were similar to those shown for LBB.11 (data not shown). (B) HC11 cells contain a small amount of RUNX1. HC11 extract (5 µg) was incubated with the 556WT probe in the absence of added antibody (Ab; lane 1) or in the presence of rabbit immunoglobulin G (IgG; lane 2) or antibody specific for RUNX1B (lane 3). Note that a complex that migrates slightly slower than RUNX1 (larger amounts are seen in lanes 2 and 3 [asterisk in panel A]) is not RUNX1, as judged by its failure to supershift with specific antisera. The small amount of RUNX1 in HC11 cells is more apparent after the supershift.
102
construct that contained the 556 mutation, confirming that binding to the RUNX1
binding site defined by EMSA was responsible for the RUNX1B effect (Fig.
3.15B). Overexpression of RUNX1B in A20 murine B cells elevated TBLV-LUC
reporter gene levels five-fold over basal levels when 10 ug of expression construct
was transfected, and this elevation was dependent on an intact RUNX1 binding
site since RUNX1 overexpression did not activate the 556M-LUC reporter vector
(Fig. 3.16). The level of induction by RUNX1B observed in B cells may be lower
than that observed in mammary cells because of the higher endogenous RUNX1
in B cells. These results confirm that the RUNX1B effect on the TBLV enhancer
is not cell-type dependent.
103
Fig. 3.15. Overexpression of RUNX1B in transient transfection assays using HC11 cells.
Luciferase (LUC) activity was determined as described in the legend to Fig. 3.2 except that values are relative to that for pTBLV-LUC (A) or pTBLV-556M-LUC (B) without RUNX1B cotransfection (assigned a value of 1). Means of triplicate transfections with standard deviations are shown. The RUNX1B vector contains the transcriptionally active splice variant of RUNX1 with two additional exons, 7B and 8 (250). The amount of RUNX1B expression vector used is indicated. All transfections contained 22.5 µg of total DNA.
A
0
10
20
30
40
TBLV-LUC
0
TBLV-LUC
2.5
TBLV-LUC
5
TBLV-LUC
10
LTR-Reporter Constructs
Rel
ativ
e L
UC
val
ue
0
0.5
1
1.5
556M-LUC 556M-LUC
B
Rel
ativ
e L
UC
val
ue
LTR-Reporter Constructs
RUNX1B(µg)
10 RUNX1B(µg)
0
104
Fig. 3.16. Overexpression of RUNX1B in transient transfection assays using A20 murine B cells.
Luciferase activity was determined as described in Fig. 3.2 except that values are relative to pTBLV-LUC without RUNX1B overexpression (assigned a value of 1). Means of triplicate transfections with standard deviations are shown.
3.2.2.3 Purification of TBLV enhancer-interacting proteins from
Jurkat T cells
Biochemical purification of proteins that bind to the crucial TBLV
enhancer region was employed to identify factors important for enhancer activity.
Jurkat T cells were used for protein purification since they have the highest levels
of NF-A and NF-B proteins and are amenable to growth in spinner flasks. The
purification scheme was determined empirically (diagrammed in Fig. 3.17).
0
1
2
3
4
5
6
7
TBLV-LUC 556M-LUC
DNA transfected
Rel
ativ
e L
UC
val
ue
RUNX1B (µg): 0 10 0 10
105
Fig. 3.17. Flow-chart of steps taken to purify proteins that bind to the TBLV enhancer at the critical region defined above (548-556 region).
Whole cell lysates were initially fractionated on a Sephacryl S200-HR resin
column. Fractions were then analyzed by EMSA using a 556WT oligonucleotide
probe, and fractions containing NF-A and NF-B activity were pooled and heat-
treated. Optimal heat treatment was verified empirically by determining the
temperature that precipitated the most protein without decreasing the NF-A or
NF-B DNA binding activity. After heat treatment, the soluble portion of pooled
fractions was loaded onto a double-stranded DNA-cellulose column. Bound
proteins were washed extensively and eluted. Fractions were analyzed by EMSA
and those containing NF-A or NF-B DNA-binding activity were pooled and
affinity purified. Affinity purification was performed with concatamerized
556WT probe conjugated to magnetic beads. Mass spectrophotometry of the
purified protein bands obtained from the affinity purification step was performed
by Ryuji Kobayashi at M.D. Anderson Cancer Center (Houston, TX) and the
results are shown (Table 3.2).
Whole cell lysates from Jurkat T cells
Sephacryl S200-HR column
Heat treat 45°C
dsDNA-cellulose column
Magnetic affinity bead purification
MS/Sequencing of purified proteins
Whole cell lysates from Jurkat T cells
Sephacryl S200-HR column
Heat treat 45°C
dsDNA-cellulose column
Magnetic affinity bead purification
MS/Sequencing of purified proteins
106
The purified protein of most interest was ALY, which has been shown to
interact with RUNX1 on the TCR α enhancer (43). Since RUNX1 also binds to
the TBLV enhancer, further experiments were performed to determine if ALY
contributes to TBLV enhancer activity (described below). The other proteins
identified have not been tested for their contribution to TBLV enhancer activity.
Some of the proteins identified in the mass spectrophotometry analysis, such as
keratin or bovine serum albumin (BSA), appear to be contaminants. The
identification of HMG1/2 and hnRNP A1 may be relevant as they contribute to
transcriptional activation on multiple promoters (59,106,257).
FPLC of semi-purified fractions was also performed to purify NF-B
binding activity, but no data was obtained from samples analyzed this way. Also,
a Jurkat cDNA expression library was screened using a probe that contained the
critical enhancer region (556WT concatamer), but no positive clones were
identified.
Table 3.2. Results of mass spectrophotometry analyses of affinity purified proteins
MALDI-MS: ~72 kDa BSA (66 kDa) ~30 kDa apolipoprotein A-1 (30 kDa) ~28 kDa hnRNP A1 (36 kDa) ~22 kDa keratin 1 (67 kDa) ~20 kDa no match MS/MS: Albumin (66 kDa) keratin/d(TTAGGG)n-binding protein B39 typeE hnRNP A1/A2 (36 kDa) HMG 1/ALY(BEF, REF) (23 kDa/32 kDa) HMG 2 (21 kDa)
107
3.2.2.4 Further characterization of NF-A and NF-B by UV DNA-
protein crosslinking to the TBLV enhancer
To determine the approximate sizes of proteins that bind to the critical
region of the TBLV enhancer element, standard EMSA reactions containing the
556WT probe were exposed to ultraviolet light (UV) to allow protein-DNA cross-
linking and then resolved by SDS-PAGE. Gels were then dried and exposed to
film (Fig. 3.18A). This experiment was performed in the presence or absence of
bromodeoxyuridine to determine conditions for maximal crosslinking. Three
major proteins, ranging in size from approximately 22 kDa to 72 kDa, bound to
the enhancer. Proteins that were eluted from the magnetic affinity beads were
also resolved by SDS-PAGE and stained with Coomassie brilliant blue dye (Fig
3.18B). Comparison of the crosslinked proteins and those eluted from the affinity
beads revealed a similar pattern, suggesting that both methods identified the same
proteins.
3.2.2.5 ALY enhances RUNX1-mediated activation of pTBLV-LUC
activity
To determine if ALY was capable of enhancing transcriptional activation
mediated by RUNX1, transient transfection analysis was performed with
expression vectors for RUNX1 and ALY to examine the effect on pTBLV-LUC
reporter gene levels in non-T cells. When this experiment was performed in
HC11 cells, RUNX1 alone activated reporter gene levels by approximately 4-fold
when suboptimal levels of RUNX1 expression vector were transfected into the
cells. Expression of ALY with pTBLV-LUC has no effect on reporter gene levels
(data not shown), but a combination of both RUNX1 and ALY expression vectors
elevated reporter activity approximately ten-fold (Fig. 3.19).
108
Fig. 3.18. Comparison of two methods to identify TBLV enhancer binding proteins.
(A) UV DNA-protein crosslinking of whole cell extracts and 556WT probe. Jurkat whole cell lysates (10 µg) were mixed with a labeled 556WT probe (labeled with or without bromodeoxyuridine (BrdU) as described for EMSAs. Crosslinking was performed as described in Materials and Methods. Crosslinked proteins were resolved on a 10% polyacrylamide gel containing SDS, dried and exposed to X-ray film. (B) Coomassie brilliant blue staining of affinity purified proteins that bind to the 556WT probe. Proteins eluted from 556WT affinity beads were analysed by SDS-PAGE (10% gel) and stained with Coomassie brilliant blue. The high molecular weight band has been previously identified as nucleolin.
nucleolin
BrdU - +
~28 kDa
~22 kDa
~72 kDa
~28 kDa
~22 kDa
~72 kDa
A B
109
Fig. 3.19. Co-expression of RUNX1B and ALY in HC11 mammary epithelial cells cooperatively activates the TBLV LTR.
HC11 cells were transiently transfected with pTBLV-LUC and either RUNX1B or ALY expression vector alone or in combination. Luciferase levels are given as described in Fig. 3.2 except that pTBLV-LUC expression alone is given a value of 1.
0
5
10
15
DNA transfected
Rel
ativ
e L
UC
val
ue
RUNX1 (ug):ALY (ug):
00
50
100
102
104
110
Fig. 3.20. Cooperation of ALY and RUNX1 in EL4b murine T cells.
EL4b cells were transfected with pTBLV-LUC reporter gene and either a RUNX1B expression vector (10 µg) or an ALY expression vector (10 µg) or both. Luciferase values are given as described in Fig. 3.2 except that pTBLV-LUC transfected alone was assigned a value of 1.
0
2
4
6
8
10
DNA transfected
Rel
ativ
e L
UC
val
ue
ALY (µg):RUNX1 (µg):
--
-10
10-
1010
111
Previous work had shown that there was a relatively low level of ALY in
the murine T cell line EL4, whereas there was a high level of ALY in Jurkat T
cells (43). To ensure that the cooperation of ALY and RUNX1 on the TBLV
LTR was not a cell line-dependent phenomenon, a similar co-transfection
experiment was also performed in a subclone of EL4 cells, EL4b. Transient
transfection of either an ALY or RUNX1B expression vector alone with pTBLV-
LUC elevated reporter gene expression approximately 2.5-fold (Fig. 3.20),
whereas co-expression of ALY and RUNX1 increased reporter activity six-fold.
ALY expression alone was able to elevate pTBLV-LUC luciferase levels due to
the ability to enhance activity of the endogenous levels of RUNX1. Thus, ALY
and RUNX1 cooperate on the TBLV enhancer to activate transcription.
3.2.2.6 Competition analysis of other retroviral LTR sequences for
TBLV enhancer binding proteins
TRANSFAC software analysis and our results with RUNX1 suggested that there
may be common binding sites between the TBLV LTR enhancer and other
thymotropic LTRs or enhancers. To analyze this possibility, full- length LTRs as
well as LTR fragments were amplified from Moloney murine leukemia virus
(MoMLV), Gross murine leukemia virus (GMLV) and human immunodeficiency
virus-1 (HIV-1). These PCR products were then used to compete for binding
activity to the 556WT probe in EMSAs. Neither the MoMLV nor the GMLV
LTR PCR products were able to compete for NF-A or NF-B binding to the TBLV
LTR probe (data not shown). The HIV LTR, in particular the 3’ half of the LTR,
was able to compete for part of NF-A binding activity (Fig. 3.21). Smaller
fragments of the 3’ half of the HIV LTR were then used to compete for binding
activity to define the sequences that were responsible for the competition. The
112
Fig. 3.21. Competition of the HIV LTR enhancer for proteins binding to the 556WT TBLV enhancer sequence.
PCR products or oligonucleotides for HIV LTR sequences were used in competition assays for proteins that bind to the TBLV enhancer. Jurkat whole cell lysates (10 µg) were used in binding reactions with the 556WT probe. Lane 1 contains no cell lysate. Full- length HIV LTR and the 5’and 3’ halves of the HIV LTR were used as competitors at 40-, 200- or 1000-fold molar excess (lanes 3-11). The HIV enhancer was used in oligonucleotide competitions (lanes 13 and 14) at 20- and 100-fold molar excess.
1 7 8 9 10 114 5 62 3 12 13 14
-
Jurkat WCL 10 µg Jurkat WCL 10 µgFull-lengthHIV LTR 5’ HIV LTR 3’ HIV LTR
-
HIVEnhancer
NF-A
NF-B
RUNX1
113
HIV enhancer, which is 27 bp long (Fig. 1.10), was an effective competitor.
Interestingly, the HIV enhancer oligonucleotides competed for the lower portion
of NF-A as well as NF-B binding activity. This result suggest that the HIV
enhancer shares a subset of binding proteins with the TBLV enhancer and that
NF-A complexes represent binding of at least two different factors.
Proteins that have previously been determined to bind to the HIV enhancer
include NF-κB, nuclear factor of activated T cells (NFAT), c-Ets-1, C/EBP family
members and GABP a and β (311). To determine common binding factors for the
TBLV LTR and HIV LTR enhancers, oligonucleotide competitions were first
performed. Oligonucleotides containing binding sites for either c-Ets-1 or the Ets
family of transcription factors had previously been used in competition assays in
EMSAs and had no effect on 556WT probe-protein interactions (data not shown).
However, both NFAT and NF-κB binding site oligonucleotides competed for
binding of some of the NF-A complexes (the two lower bands) and for NF-B
binding activity (Fig. 3.22). Since NFAT and NF-κB binding sites share some
sequence homology (237,239), this result is not surprising. The core binding site
for NFAT proteins is GGAAA, while the NF-κB consensus binding site is
GGGACTTTCC. Thus, the 3’ end of the NF-κB site is identical to the core
binding site for NFAT. Both NFAT and NF-κB can bind to the HIV enhancer on
two distinct, but overlapping binding sites (186). Based on these data, further
experiments were necessary to determine if either protein binds to the TBLV
enhancer and has a functional effect on transcriptional activity.
114
Fig. 3.22. Oligonucleotide competition with NF-κB and NFAT consensus binding sites.
RL?1 whole cell lysates (10 µg) were used in binding reactions with the 556WT probe. Oligonucleotide competitors were added at 20- or 100-fold molar excess. Competition with NF-κB consensus binding site oligonucleotides in lanes 3 and 4, and NFAT consensus binding site oligonucleotides in lanes 5 and 6. NF-A, RUNX1 and NF-B complexes are indicated.
1 4 5 62 3
-
RL1 WCL 10 µg
20X100X20X 100X
NF-κB NF-AT
NF-A
NF-B
RUNX1
115
3.2.2.7 Effect of NFAT expression on pTBLV-LUC activity in non-T
cells
Since consensus oligonucleotides for the NFAT binding site competed for
proteins binding to the TBLV enhancer, NFAT proteins were overexpressed in
HC11 mammary epithelial cells to determine if reporter gene activity from the
pTBLV-LUC vector would be affected. Less than a two-fold effect was observed
after NFATp or NFATc overexpression (data not shown). One interpretation is
that NFAT does not transactivate the TBLV LTR activity because it does not bind
to the DNA. Another possibility is that NFAT needs other co-factors to activate
transcription that are absent from HC11 cells.
3.2.2.8 Effect of NF-κB expression on pTBLV-LUC activity in non-T
cells
To determine whether NF-κB can bind to and activate the TBLV LTR
enhancer region in non-T cells, a series of transient transfection experiments were
performed in HC11 mammary cells with expression vectors for NF-κB subunits
and pTBLV-LUC as the reporter vector (Fig. 3.23). Expression of NF-κB1 or
NF-κB2 alone or in combination enhanced transcription from pTBLV-LUC over
background levels. Also, when NF-κB1 or NF-κB2 was co-transfected with
RelB, elevation was also observed (data not shown). RelB cannot homodimerize
and bind DNA (342), and therefore, was unable to activate transcription from
pTBLV-LUC when transfected alone (data not shown). When either NF-κB1 or
NF-κB2 was co-transfected with RelA, no elevation in luciferase levels were
observed compared to the control. Instead, overexpression of RelA alone or with
either NF-κB1 or NF-κB2 repressed reporter activity from the TBLV promoter.
116
Expression of c-rel also had no effect on transcription from pTBLV-LUC. This
result is surprising since normally, NF-κB1 and NF-κB2 are considered to be
weak transactivators or repressors when they bind DNA as homodimers (319).
However, there are also reports of transcriptional activation mediated by these
homodimers (36,357,358). These results also indicated that RelA can antagonize
the activation of the TBLV enhancer mediated by NF-κB1 or NF-κB2.
02468
1012
NF-κB15 µg
RelA5 µg
NF-κB1/RelA5 µg
c-rel5 µg
NF-κB25 µg
NF-κB2/RelA5 µg
Rel
ativ
e L
UC
val
ue
-
Fig. 3.23. Overexpression of NF-κB subunits differentially activates TBLV LTR activity in transient transfection of HC11 cells.
HC11 cells were transfected with pTBLV-LUC and expression constructs for NF-κB proteins. When two proteins were transfected, 5 µg of each expression construct was used. Luciferase levels were determined as described in Fig. 3.2 except that they are relative to pTBLV-LUC levels (assigned a value of 1).
117
3.2.2.9 Identification of an NF-κB binding site in the TBLV enhancer
Since NF-κB can activate transcription from the TBLV LTR, transient
transfection analysis was performed to identify the location of the binding site.
As the primary TBLV enhancer activity was located in the 556 region and the
HIV enhancer (which binds NF-κB) oligonucleotides competed for binding to the
556WT probe, the first transfections with HC11 cells used wild-type and 556M
Fig. 3.24. Overexpression of NF-κB2 with MMTV or TBLV LTR reporter vectors.
HC11 mammary epithelial cells were transiently transfected with C3H-LUC, pd6-LUC, TBLV-LUC, 548M-LUC or 556M-LUC reporter gene constructs in the presence or absence of 10 µg of NF-κB2 expression vector. Total levels of DNA transfected were kept constant for each transfection. Luciferase levels are given as described in Fig. 3.2. All values are relative to the C3H-LUC vector, which was assigned a value of 1.
010203040
pC3H-LUC pd6-LUC pTBLV-LUC p548M-LUC p556M-LUC
DNA transfected
Rel
ativ
e L
UC
val
ue
NF-κ B2 (ug): 0 10 0 10 0 100 10 0 10
118
TBLV-LUC constructs. As expected, overexpression of NF-κB-2 activated the
TBLV enhancer. However, mutation of the 556 region of the TBLV enhancer
had no effect on the ability of NF-κB2 to activate the TBLV LTR (Fig. 3.24).
There are at least two possibilities for this result. NF-κB may bind to a
region of the enhancer outside of the 556 mutation since the 556WT probe has
flanking sequences that are outside the region of the 556 mutation. Alternatively,
NF-κB may bind to a region of the LTR that is not specific to TBLV. To
distinguish between these possibilities, another transient transfection experiment
was performed in HC11 mammary epithelial cells. Reporter constructs for the
wild-type MMTV LTR, wild-type TBLV-LTR, the MMTV LTR without the
NREs or flanking sequence (pd6) and 548M-TBLV LTR were co-transfected with
or without an NF-κB2 expression construct. Both wild-type MMTV and TBLV
LTR expression were activated by NF-κB2 overexpression (Fig. 3.24). NF-κB2
activation of the MMTV LTR was much less than that observed with TBLV,
(approximately 4-fold, compared to approximately 22-fold for TBLV). The pd6
and 548M reporter constructs also were responsive to the expression of NF-κB2,
similar to the levels observed with the wild-type MMTV (C3H) LTR. Together,
these results suggest that there is an NF-κB binding site in the enhancer repeat of
the TBLV LTR, either upstream of, or overlapping with the RUNX1 binding site.
Since the enhancer element is present in three copies, this explains why
enhancement of the TBLV LTR constructs is greater than that seen with MMTV
reporter constructs.
TRANSFAC analysis of the MMTV LTR predicts that there are a number
of NF-κB binding sites located near the 5’ end of the U3 region. The approximate
location of the NF-κB binding site coincides with the proposed NF-A binding
site. Interestingly, there is no obvious consensus NF-κB binding site in this
119
region. However, this does not rule out NF-κB binding since this factor binds to
sites that do not fit the consensus site rules (196,292,309).
3.2.2.10 Antagonism between NF-κB and RUNX1 on the TBLV
enhancer
Since RUNX1B and NF-κB activated the TBLV LTR individually when
overexpressed in HC11 mammary epithelial cells (Fig. 3.15 and 3.23), it was also
determined whether these factors could cooperate to activate the TBLV LTR
when co-expressed in non-T cells. Transient transfection analysis revealed that
overexpression of both NF-κB and RUNX1B abolished the activation observed
with either factor alone (Fig. 3.25). To determine whether this result required
DNA binding, the experiment was repeated with wild-type TBLV-, 548M- and
556M-LUC reporter plasmids. The effect was observed with all reporter plasmids
tested, regardless of whether a mutated NF-κB binding site (548M) or a mutated
RUNX1 binding site (both 548M and 556M) was included. It should be noted
that the lower activation seen with NF-κB overexpression and the 556M-LUC
vector may result from overlap between the NF-κB binding site and the 556
mutation.
To determine the contribution of NF-κB binding to the TBLV enhancer in
T cells, a dominant negative (DN) IκB expression construct was used in transient
transfections in both RL? 1 and Jurkat T cells, as well as in A20 B cells. This DN
IκB functions to prevent the nuclear translocation of NF-κB subunits by blocking
the degradation of IκB since it is mutated at phosphorylation sites necessary for
its ubiquitination and degradation (42,398). Thus, all NF-κB proteins are
sequestered in the cytoplasm. In RL? 1 cells, when the DN IκB vector was co-
120
transfected with pTBLV-LUC, there was a 2-fold increase in reporter gene levels
compared to pTBLV-LUC alone (data not shown). However, in Jurkat T cells,
0
2
4
6
8
10
12
14
16
18
1 2 3 4 5 6 7 8 9 10 11 12
DNA transfected
LU
C/1
00 µ
g p
rote
in
TBLV-LUC 548M-LUC 556M-LUC
RUNX1 (10 µg):NF-κB2 (10µg):
--
--
--
+-
+-
+-
-+
-+
-+
++
++
++
Fig. 3.25. Effect of overexpression of RUNX1 and NF-κB2 on TBLV LTR activity in HC11 mammary epithelial cells.
HC11 cells were transfected with either pTBLV-LUC (lanes 1-4), 548M-LUC (lanes 5-8) or 556M-LUC (lanes 9-12) (4 µg for each) reporter gene vectors. These vectors were co-transfected with either a RUNX1B (10 µg) (lanes 2, 6, and 10) or NF-κB2 (10 µg) (lanes 3, 7, and 11) expression vector alone or in combination (10 µg each) (lanes 4, 8, and 12). Luciferase levels are given in relative light units/100 µg protein.
121
reporter gene activity did not change in the presence or absence of DN IκB
protein (data not shown). Similar results were observed after transient
transfections of A20 cells (less than a two-fold elevation in the presence of DN
IκB) (Fig. 3.26).
These data suggest that NF-κB does not contribute significantly to the
enhancer function in T cells; instead this factor seems to have a small inhibitory
effect since NF-κB sequestration in the cytoplasm gives a small increase in TBLV
enhancer activity. Thus, NF-κB may modulate the activity of the TBLV enhancer
in non-T cells. Also, when RUNX1B and DN IκB were co-expressed in A20 B
cells, the effect on reporter activity is greater than that seen with RUNX1B or DN
IκB expression alone. This suggests that NF-κB proteins may function to
modulate activity of other transcription factors in B cells (e.g., RUNX1).
3.2.2.11 Mutational analyses of NF-A and NF-B binding sites
To determine the individual contributions of NF-A, RUNX1 and NF-B on
the TBLV enhancer, another series of smaller substitution mutations were made.
Mutation of RUNX1 binding with a 3-bp substitution mutation did not affect the
binding of NF-A or NF-B. The effect of the 3-bp RUNX1 mutation was analyzed
by cloning it into the pTBLV-1R-LUC construct (containing one 62 bp enhancer
element). This mutation reduced activity to about 60% of that observed with
wild-type TBLV LTR activity, suggesting that there is another factor responsible
for enhancer activity (Fig. 3.28).
As mentioned previously, NF-A binding can be resolved into at least three
distinct complexes in EMSAs. Since the initial substitution mutations in the
TBLV enhancer element were large (6-8 bp), smaller substitution mutations 5’ of
122
the RUNX1 binding site were used to distinguish these complexes by
oligonucleotide competition in EMSAs. One mutation, M2, disrupted only the
Fig. 3.26. Effect of NF-κB and RUNX1B on TBLV enhancer in A20 murine B cells.
A20 cells were transfected with a pTBLV-LUC reporter vector either alone or with a RUNX1B expression vector (10 µg), an NF-κB2 expression vector (10 µg), or a DN IκB expression vector (10 µg). Co-transfections also were performed with NF-κB2 and RUNX1B expression vectors, or with RUNX1B and DN IκB expression vectors (10 µg each). Luciferase levels are given as described in Fig. 3.2 except that all values are relative to pTBLV-LUC levels alone (assigned a value of 1). The p value for student’s t-test of the RUNX1B overexpression sample vs. the RUNX1B and DN IκB sample is 0.06.
0
5
10152025
30
35
RUNX1BDN-IKBNF-κB2
000
+00
+0+
0+0
++0
Rel
ativ
e L
UC
val
ue
DNA transfected
123
Fig. 3.27. Oligonucleotide competition analysis of TBLV enhancer complexes using 2 bp mutations.
RL?1 whole cell lysates (10 µg) were used in binding reactions containing the 556WT probe. Oligonucleotides with 2 bp substitution mutations were added at 50- or 200- fold molar excess to binding reactions. Lane 1 contains no cell extract. The positions and base changes for each mutation are shown below the gel. The RUNX1 binding site is also denoted. The mutations for mNF-A.1, mNF-B, the double mutation (DM) and the 3-bp RUNX1 mutation are also shown. NF-A, RUNX1 and NF-B complexes are shown by brackets.
NF-A
NF-B
RUNX1
1 2 3 4 5 6 7 8 9 10 11 12
10 µg RL1 WCL
50X 200X 50X 200X50X 200X 50X 200X 50X 200XM1 M2 M3 M4 M5
RUNX1556WT g a a c a g g t g c g g t t c c c a a g g c
M1 t c - - - - - - - - - - - - - - - - - - - -M2 - - g a - - - - - - - - - - - - - - - - - -M3 - - - - t c - - - - - - - - - - - - - - - -M4 - - - - - - t c - - - - - - - - - - - - - -M5 - - - - - - - - t a - - - - - - - - - - - -
3bpmRUNX - - - - - - - - - - t a g - - - - - - - - -mNF-B - - - - - - - - - - - - - c t a g - - - - -
DM - - g a - - - - - - - - - c t a g - - - - -
mNF-BmNF-A.1
124
upper band of the NF-A complex (Fig. 3.27). The other mutations failed to
disrupt NF-A binding (M1), or affected the lower two complexes (M3 and M4),
or all three complexes and RUNX1 (M5). These competition experiments
confirm the density of binding factors in this region of the TBLV enhancer.
To determine the effect on enhancer activity, the 2-bp M2 mutation was
substituted into a reporter construct containing a single enhancer element (pmNF-
A.1-LUC) and compared with a reporter construct containing a single wild-type
enhancer element after transient transfections in Jurkat T cells. This mutation
decreased transcriptional activity from the TBLV LTR by 78% (Fig. 3.28). Thus,
the upper NF-A complex makes a major contribution to the T-cell-specific
enhancer activity of TBLV.
Based on competition assays with oligonucleotides containing either the
548 or 556 mutations (Fig. 3.13B), the NF-B binding site was predicted to overlap
or juxtapose the RUNX1 binding site. To determine the effect of NF-B on TBLV
enhancer activity, an oligonucleotide containing a 4 bp substitution mutation 3’ of
the RUNX1 binding site was determined to specifically mutate only the NF-B
binding activity, but not NF-A or RUNX1 binding activity, by EMSA (data not
shown). This mutation was transferred into the pTBLV-1R-LUC vector, resulting
in the plasmid pmNF-B-LUC. Transient transfection analysis of these plasmids
was performed in Jurkat T cells to determine the contribution of the NF-B protein
complex to TBLV enhancer activity. Mutation of the NF-B binding site reduced
reporter gene levels by approximately 40% (Fig. 3.28). Similarly, a 3-bp
mutation that affected only RUNX1 binding also decreased enhancer activity by
40%.
To determine the effect of both the NF-A.1 and NF-B complexes on
TBLV enhancer activity, a double mutant vector (pDM-LUC) was generated that
contained both the 2 bp mutation from NF-A.1 and the 4 bp mutation from NF-B.
This mutant plasmid was compared to the two single mutant and the wild-type
125
plasmids by transient transfection analysis in Jurkat T cells (Fig. 3.28). The
combined mutations lowered reporter gene levels to approximately 30% of that
observed with mNF-A.1 alone. These data suggest that the NF-A.1 complex is
the major contributor to TBLV enhancer activity.
Fig. 3.28. Effect of TBLV enhancer mutations in Jurkat T cells.
Jurkat cells were transfected with various reporter constructs to compare their activities relative to wild-type MMTV and TBLV reporter constructs. The TBLV reporter construct has only one enhancer element. Luciferase levels are expressed as described in Fig. 3.2.
0
20
40
60
80
DNA transfected
Rel
ativ
e L
UC
val
ue
pC3H-LUC
pTBLV-1R-LUC
pmNF-A.1-LUC
pmNF-B-LUC
pDM-LUC
p3bp-mRUNX
-LUC
126
3.2.3 Characterization of factors affected by the 586 mutation in the TBLV enhancer
3.2.3.1 Contribution of GR binding to TBLV enhancer activity
Transient transfection experiments showed that the 586 mutation
dramatically reduced TBLV enhancer activity in Jurkat but not RL? 1 cells (Fig.
3.9). Analysis of transcription factor binding sites in this region revealed the
presence of a glucocorticoid receptor (GR) binding site (Fig 3.10). Interestingly,
GR binding sites have been reported in the enhancers of many murine leukemia
viruses (131). To determine if the 586 mutation eliminated the GR site, transient
transfection assays were performed in XC rat cells in the presence or absence of
dexamethasone (DEX) (Fig. 3.29). As expected, the wild-type C3H MMTV LTR
showed a strong (over 60-fold) induction in the presence of glucocorticoids, as did
the reconstructed TBLV-WT-LUC plasmid. However, the 586 mutation, but not
the 556 mutation, eliminated the glucocorticoid- induced stimulation of reporter
gene expression. Since there are other HREs downstream of the enhancer, the
result is very unexpected.
GR requires the presence of hormone to allow functional receptor to
translocate into the nucleus and allow DNA binding (174). Jurkat cells appear to
have low levels of functional GR, as measured by low-level enhancement of
MMTV LTR reporter gene expression in the presence of hormones compared to
that without added hormone (data not shown). To determine if the 586 mutation
affects TBLV enhancer activity in the absence of steroid hormones, media
supplemented with hormone-depleted serum was used to perform transient
transfection assays in Jurkat cells grown without exogenous glucocorticoids (Fig.
3.30). The TBLV enhancer-containing plasmid had approximately 500-fold
127
Fig. 3.29. Activity of the GR binding site mutant 586M in transient transfections of XC rat cells.
Hormones were added as indicated 24 h after transfection using the DMRIE-C method. After an additional 24 h in the presence or absence of 10 6 M DEX, cell extracts were prepared for reporter gene assays. LUC activity was determined as described in the legend to Fig. 3.2 except that values are relative to that for pC3H-LUC in the absence of DEX (assigned a value of 1). Mean values of triplicate assays with standard deviations are shown.
0
20
40
60
80
100
120
Rel
ativ
e L
UC
val
ue
LTR-Reporter Constructs
pC3H-LUC pTBLV-WT-LUC
pTBLV-556M-LUC
pTBLV-586M-LUC
DEX - ---+ + + +
128
greater expression than the C3H MMTV LTR, and this activity was greatly
diminished by the 556 and 586 mutations. Since phenol red has mildly estrogenic
properties when present in cell culture medium (107), this experiment was
repeated with hormone-stripped serum and phenol red-free medium. A similar
result was obtained (data not shown). Based on these results, a factor other than
GR appears to regulate TBLV enhancer activity at position 586.
3.2.3.2 Identification of a c-Myb binding site in the TBLV enhancer
Since LTR enhancers from other leukemogenic retroviruses have c-Myb
binding sites (281), c-Myb consensus oligonucleotides were used to compete for
proteins that bind to the 556WT probe. No competition was observed (data not
shown). However, overexpression of the c-Myb protein in transient transfections
of HC11 cells activated TBLV LTR-driven transcription of a reporter gene.
Analysis of the 556M-LUC response to c-Myb overexpression revealed that this
mutation had no effect on TBLV-LUC activity (data not shown). These results
suggested that there was a c-Myb binding site located outside the region affected
by the 556 mutation.
TRANSFAC software predicted a c-Myb bindng site in the region
spanning the 586 mutation when the parameters for detection were less stringent.
As discussed above, the 586 mutation almost completely eliminates enhancer
activity in Jurkat T cells, and reduces enhancer activity by approximately half in
RL? 1 T cells (Fig. 3.9). To verify the existence of the predicted c-Myb binding
site,
129
Fig. 3.30. Activity of the GR binding site mutant in transient transfection assays of Jurkat T cells grown in the absence of exogenous steroid hormones.
LUC activity was determined as described in the legend to Fig. 3.2. Mean values of triplicate assays with standard deviations are shown.
0
100
200
300
400
500
600
pC3H-LUC pTBLV-WT-LUC
pTBLV-556M-LUC
pTBLV-586M-LUC
Rel
ativ
e L
UC
val
ue
LTR-Reporter Constructs
130
transient transfection of a c-Myb expression plasmid with pTBLV-LUC in HC11
cells was performed. Up to nine-fold elevation was observed with c-Myb
expression (Fig. 3.31) and this activation of the TBLV LTR was dose-dependent
(data not shown). The 586M-LUC construct did not respond to the
overexpression of c-Myb in HC11 cells (Fig. 3.31), indicating that the predicted
binding site was disrupted by the 586 mutation.
Fig. 3.31. The 586 mutation in the TBLV enhancer abolishes the c-Myb binding site.
The pTBLV-LUC and p586M-LUC reporter constructs were transiently transfected in HC11 mammary epithelial cells with or without a c-Myb expression vector (2 µg). LUC values are given as described in Fig. 3.2 except that the level for pTBLV-LUC transfected alone was assigned a value of 1.
02468
1012
pTBLV-LUCc-Myb (µg):
p586M-LUC
DNA transfected
Rel
ativ
e L
UC
val
ue
pTBLV-LUC p586M-LUC0 02 2
131
0
10
20
30
40
0 c-myb(1 ug)
RUNX1(5 ug)
c-myb (1ug)RUNX1 (5 ug)
DNA transfected
Rel
ativ
e LU
C v
alue
Fig. 3.32. RUNX1 and c-Myb cooperative to activate the TBLV LTR in HC11 cells.
HC11 cells were transiently transfected with pTBLV-LUC reporter construct and either c-myb (1 µg) or RUNX1B expression vectors (5 µg) alone or in combination. Luciferase values are given as described in Fig. 3.2, except that the value for pTBLV-LUC transfected alone was given a value of 1.
132
3.2.3.3 c-Myb and RUNX1B cooperative to activate TBLV LTR
activity in non-T cells
To determine if c-Myb and RUNX1B cooperate to activate TBLV-LUC
activity in non-T cells, HC11 cells were co-transfected with varying amounts of
the two transcription factor expression vectors and pTBLV-LUC. As anticipated,
c-Myb overexpression showed approximately 2-fold enhancement of TBLV-LUC
activity, whereas RUNX1 overexpression showed approximately 15-fold
enhancement (Fig. 3.32). However, co-transfection of both c-myb and RUNX1B
expression vectors enhanced TBLV-LUC activity approximately 30-fold. Thus,
the combined effect of these transcription factors appeared to be additive rather
than cooperative on the TBLV enhancer, similar to that observed with ALY.
133
3.3 EFFECT OF THE TBLV LTR ON C-MYC ACTIVATION
3.3.1 Characterization of TBLV enhancer elements in proviruses integrated near the c-myc gene.
Because previous experiments indicated that the nature of the retroviral
enhancer was critical for proviral oncogenicity in T cells (56,217,372), LTRs from
integrated TBLV proviruses near c-myc were characterized. PCR was performed
with tumor DNAs and primers that would flank the copy of the TBLV enhancer
closest to the c-myc proto-oncogene, and the resulting products were subjected to
sequencing analysis. Surprisingly, some of the TBLV proviruses had a different
number of enhancer elements than that previously reported for an LTR cloned
from a TBLV-induced tumor (16). In two proviruses that were integrated
approximately 0.5 and 2 kb downstream of the c-myc gene in the T16 and T17
tumors, respectively (Fig. 1.8), there were four elements within the TBLV
enhancer (Table 3.3). Interestingly, the T16 and T17 tumors were the most clonal
of the characterized tumors based on our ability to detect TBLV integrations by
Southern blotting (328). of the other proviruses from polyclonal tumors contained
two or three enhancer elements within the LTR closest to the c-myc oncogene
(Table 3.3).
To determine if our starting TBLV population was a mixture of viruses,
PCR was performed on high-molecular-weight DNA obtained from the cell line
used for virus preparation (485-10). Using LTR primers localized outside the
enhancer repeat elements, a predominant PCR product was obtained consistent
with three enhancer elements as reported by Ball et al. (16). This PCR product
was cloned, and 10 independent clones were sequenced (data not shown). All
134
Table 3.3. Analysis of the enhancer elements in TBLV LTRs near the c- myc gene
No. of LTR enhancer elementsc
TBLV-induced
tumor Proviral locationa
Proviral orientationb
5’ LTR 3’ LTR
T9 Upstream Opposite 3
T623B Upstream Opposite 3, 3d
T623B Upstream Same 2, 2, 3d
T623B Exon 1 Opposite 3
T5 Intron 1 Opposite 3
T623B Exon 3 Same 2
T16 Downstream Same 4
T604 Downstream Same 3
T17 Downstream Same 4
T602 Downstream Opposite 3 a Location of the TBLV provirus relative to the c-myc proto-oncogene. b Transcriptional orientation of the TBLV provirus relative to that of the c-myc gene. c Number of copies of the 62-bp repeat element in the TBLV LTR. d The numbers of TBLV LTR enhancer elements found in different clustered proviruses in this orientation as verified by cloning and sequencing.
135
clones had three enhancer elements, and the sequence was identical to that
previously reported (16) except that the last two elements had G residuesinstead
of A residues in a portion of the enhancer element (5’ TAA GTA GGT TTA TGG
3’). Both the G and A residues resulted in a termination codon within the sag
gene.
PCR also was performed on DNA derived from the 485-10 tumor used for
virus preparation using TBLV-specific LTR primers that flanked the enhancer
elements (Fig. 3.33). As expected, gel analysis of these PCR mixtures showed
that enhancers with three copies of the element were dominant, although fragment
sizes consistent with one- or two-repeat enhancers could be detected. Similar
analysis of DNAs from the primary tumors T5, T9, T16, and T17 also revealed
that the three-repeat enhancer is dominant in proviruses integrated into tumor
DNA. However, the four-repeat enhancer was detected in tumors T5, T16, and
T17 (Fig. 3.33); quantitation indicated that the three-repeat enhancer was three- to
seven-fold more abundant than the four-repeat enhancer in these tumors (data not
shown). Since the semiclonal tumors T16 and T17 both had TBLV proviruses
with four-repeat enhancers downstream of c-myc, as detected by Southern blotting
(328) (Fig. 1.8), these results suggested that four-repeat enhancers at particular
insertion sites near c-myc have a selective advantage over three-repeat enhancers
during tumor progression.
136
Fig. 3.33. PCR analysis of primary tumor DNAs to determine the number of 62-bp repeats in the TBLV LTR enhancer.
PCR analysis of DNA from primary (1°) TBLV-induced tumors (T5, T9, T16, and T17) using sense and antisense primers that flank the LTR enhancer repeats (LTR408+ and LTR786-). Lanes M contain molecular size markers, and lane 2 is a reaction run with no template. The tumor cell line 485-10 used for virus production is shown in lane 4. Use of DNA from uninfected BALB/c mice shows the specificity of the PCRs. The numbered arrows to the right of the gel indicate the positions of fragments with different numbers (two to four) of enhancer repeats.
234
no D
NA
BA
LB
/c
485-
10
T5
1°
T9
1°
T16
1°
T17
1°
370
bp
262
497605
bp
PCR primers:TBLV-LTR408+/TBLV-LTR786-
1 2 3 4 5 6 7 8 9
M M
137
3.3.2 Selection for TBLV enhancer repeats during tumor passage
Only a few tumors induced by TBLV have integrations near c-myc
detectable by Southern analysis. These include tumors T16 and T17, which have
integrations near c-myc that contain four enhancer elements. Thus, there appeared
to be a selective advantage for more enhancer elements in proviruses integrated
near c-myc. To test this possibility, analysis of primary and passaged tumor cell
DNA was analyzed for retention or enrichment of certain integration sites and the
number of enhancer elements in or near the c-myc locus.
To determine if there was selection for particular integration sites or
enhancer composition during tumor progression, the semiclonal tumors T16 and
T17 and the polyclonal tumors T5, T9, T10, and T623B were transplanted in
immunocompetent syngeneic mice. DNA extracted from the primary or passaged
tumors was then subjected to nested PCR. Primary PCR products obtained using
primers that would detect a TBLV LTR-c-myc junction fragment were purified,
diluted, and used for secondary PCR with primers that flanked the LTR enhancer
repeats. Gel analysis of the secondary PCRs allowed detection of a change in the
number of enhancer repeats at particular TBLV integration sites found near c-myc
after tumor passage (Fig. 3.34). Cloning and sequencing verified the identities of
fragments composed of two, three, or four copies of the 62-bp repeats. As
anticipated, PCR results generated from the semiclonal tumors T16 and T17
showed that the four-repeat enhancer was dominant using primers that detected
insertions downstream of c-myc (lanes 3 and 6). The polyclonal tumor T623B had
no detectable product in primary PCRs (data not shown), but LTRs with three-
repeat enhancers were detectable in the primary tumor after secondary PCR (lane
9). However, such insertions did not appear to be selected during tumor passage
(lanes 10 and 11). TBLV insertions containing the three-repeat enhancer were
detected predominantly in primary T623B DNA upstream and in the same
138
orientation as c-myc (lane 12). However, both passages of this primary tumor
selected for the appearance of LTRs with the four-repeat enhancer (lanes 13 and
14). Similar results were obtained using a different c-myc primer for the primary
PCRs (lanes 15 to 17).
Selection for TBLV insertions with four-repeat LTRs was not apparent at
every integration site ana lyzed. For example, insertions into the T9 site about 4
kb upstream and in the transcriptional orientation opposite that of c-myc had
predominantly three-repeat enhancers (Fig. 3.34, lanes 21 to 23). Insertions into
intron 1 in the T5 tumor predominantly had three-repeat enhancers, although two-
repeat enhancers were detectable (lanes 27 to 29). Insertions within exon 3 in
T623B also had predominantly three-repeat enhancers (lanes 30 to 32).
To determine the relative abundance of tumor cells carrying different TBLV
insertions near c-myc, semi-quantitative PCRs were performed with DNAs
derived from primary and passaged tumors. In the T9 tumor where an insertion
ca. 4 kb upstream and in the transcriptional orientation opposite that of c-myc was
detected (see Fig. 1.8 for map position), tumor cells carrying TBLV insertions
near c-myc with a three-repeat enhancer declined during tumor passage (Fig.
3.35A). Alternatively, tumor cells in T623B carrying a TBLV insertion with a
three-repeat enhancer upstream and in the transcriptional orientation opposite that
of c-myc became more abundant during in vivo passage (Fig. 3.35B). However,
in the same tumor, cells carrying a TBLV insertion with a three-repeat enhancer
upstream and in the same transcriptional orientation as the oncogene disappeared
from the population (Fig. 3.35C, compare lanes 2 to 5 with lanes 6 to 9), yet cells
having a similar insertion with a four-repeat enhancer appeared after one tumor
passage (lanes 6 to 9) and persisted after a second passage (lanes 10 to 13). The
new insertion was confirmed to be ca. 300 bp upstream of c-myc in the same
orientation by cloning and sequencing. Sequencing also indicated that this x
139
Fig. 3.34. PCR analysis of primary and passage tumor DNAs to determine the number of 62-bp element in the TBLV LTR enhancer.
Semi-nested PCR analysis of tumor DNA. Primary PCRs were performed using DNAs from unpassaged (1°) or passaged (P1 or P2) tumors and the indicated c-myc and TBLV LTR primers. The c-myc-LTR junction fragments were then purified, diluted, and used for secondary (2°) PCR with primers that flank the LTR enhancer repeats (LTR 408+ and LTR 786-). The numbered arrows to the right of the gels indicate the positions of fragments with different numbers (two to four) of enhancer repeats. The strong band at ca. 260 bp in some lanes represents one copy of the 62-bp enhancer region, and this has been confirmed by sequencing. All PCR mixtures were analyzed by agarose gel electrophoresis.
370
605497
262234
bp bpBA
LB
/c
1o P1 P2 1o P1 P2 1o P1 P2 1o P1 P2 1o P1 P2
T16 T17 T623B T623B T623B
c-myc 695+/TBLV-LTR786- c-
myc
585-
/T
BL
V-L
TR
408+
c-m
yc15
3-/
TB
LV
-LT
R40
8+
1o PCR primers:
2o PCR primers:TBLV-LTR408+/TBLV-LTR786-
BA
LB
/c
1o P1 P2
T9
1o P1 P2
T10
1o P1 P2
T5
262
497
605
234
1o P1 P2
T623B
c-m
yc58
5-/
TB
LV
-LT
R78
6-
c-m
yc58
5-/
TB
LV
-LT
R78
6-
c-m
yc69
5-/
TB
LV
-LT
R40
8+
c-m
yc28
7+/
TB
LV
-LT
R40
8+
234
1o PCR primers:
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
19 20 21 22 23 24 25 26 27 28 29 30 31 32
2o PCR primers:TBLV-LTR408+/TBLV-LTR786-
M M
M
140
insertion in tumor 623B consisted of the 5’ LTR and gag leader sequences (data
not shown).
3.3.3 Construction of a genomic c-myc reporter gene vector
To analyze the effect of integration of TBLV transcriptional control
elements in or near the c-myc locus in an in vitro system, an appropriate reporter
vector, pc-mycRluc, was constructed. To generate the vector, pc-mycRluc, a
series of steps were performed. First, PCR was used to amplify a 5.1 kb product
from BALB/c genomic DNA including 2.9 kb of sequences 5’ of c-myc gene,
exon 1, intron 1, and 15 bp of exon 2 of c-myc. Second, PCR was used to amplify
most of c-myc exon 3 (bp 61 to 897) and 4.7 kb of the downstream flanking
region from BALB/c genomic DNA. Third, the Renilla luciferase gene and SV40
polyadenylation signal from the pRL-TK plasmid were amplified by PCR and
cloned together with the other products into pBluescript II SK(-) to generate pc-
mycRluc (Fig. 3.36). This plasmid contains all of the c-myc promoters (P0 –P3)
and an in-frame substitution of the open reading frame of c-myc with the Renilla
luciferase gene, followed by an SV40 polyadenylation signal. The majority of c-
myc exon 2 was replaced with the Renilla luciferase gene at the transcription start
site to directly measure effects on oncogene transcription and to avoid potential
secondary effects of c-myc overexpression (e.g., apoptosis) (310,321). Inserts
were verified by sequencing and restriction digests of the DNA. Expression of
Renilla luciferase by pc-mycRluc was confirmed by transient transfection of the
construct in RL? 1 and Jurkat T cells (data not shown).
141
Fig. 3.35. Semi-quantitative PCR analysis to determine the relative abundance of TBLV integrations near c-myc after tumor passage.
(A) DNA (200 ng) from the primary (1°) or passaged (P1 or P2) T9 tumor was subjected to threefold serial dilutions (the amount of DNA indicated by the height of the black triangles over the lanes) and used for PCRs with an antisense primer for c-myc exon 1 (c-myc585-) and an antisense TBLV LTR primer (LTR786-). (B) DNA (70 ng) from the primary or passaged T623B tumor was subjected to 3-fold serial dilutions and used for PCRs with an antisense primer in c-myc exon 1 (c-myc585-) and an antisense primer in the TBLV LTR (LTR786-). (C) DNA (600 ng) from the primary or passaged T623B was subjected to 3-fold serial dilutions and used for PCRs with an antisense primer in c-myc exon 1 (c-myc585-) and a sense primer in the TBLV LTR (LTR408+). All PCR mixtures were analyzed by agarose gel electrophoresis.
1o P1 P2
DNAA
B
C
T9 c-myc585-/TBLV-LTR786-
9400
6600
4400
1 2 3 4 5 6 7 8 9 10 11 12 13
T623Bc-myc585-/TBLV-LTR408+1226
887
1 2 3 4 5 6 7 8 9 10 11 12 13
Mbp
T623B
2955
1226
887
1 2 3 4 5 6 7 8 9 10 11 12 13
c-myc585-/TBLV-LTR786-
142
5 60 8-2-3 1 2 3 4
AfeI AvrII AatII StuI
7
KpnI AfeI RlucNcoI
-1
TBLV LTR
U3 U5R
U5R U3
Forward
Reverse
Exon2
P0 P1
P2P3 T16 T17
Exon1 Exon3
pA
Fig. 3.36. Strategy for detection of TBLV enhancer effects on c-myc transcription.
The locations of different c-myc promoters (P0 to P3) in the pc-mycRluc vector are indicated. The stop codon following the Renilla luciferase gene should prevent expression of sequences from the third exon of c-myc. TBLV LTRs were inserted in both orientations at the restriction sites shown in cellular DNA flanking the c-myc locus. The TBLV LTR insertions at the AvrII site represent examples of the constructs that were made. The numbers below the map indicate distance (in kilobases) relative to the beginning of exon 1.
143
3.3.4 Effect of enhancer repeats on c-myc promoter activity
The pc-mycRluc vector was used for insertion of TBLV LTRs containing
three enhancer repeats in both orientations relative to the c-myc promoters at
various distances in cellular flanking DNA. Previous data suggest that expression
of c-myc promoters is relatively normal if there is an appropriate enhancer within
the construct (203). The LTR-containing constructs were transfected into
triplicate cultures of Jurkat T cells, and the luciferase activity was determined
relative to that of the parental construct lacking the TBLV LTR (Fig. 3.37).
Values were normalized for DNA uptake by cotransfection of a plasmid
expressing firefly luciferase and displayed on a map according to their position
within the c-myc locus. These experiments revealed that LTRs inserted at virtually
any location were capable of stimulating transcription of the c-myc promoters
between 2- and 160-fold, consistent with the enhancer function of the TBLV LTR.
As expected, in many instances, enhancer activity was relatively independent of
the orientation.
Transfections of LTR-containing pc-mycRluc plasmids were also
performed in RL? 1 immature T cells (Fig. 3.38). Although fewer constructs
were tested in this line, the trend for LTR enhancer activity on the c-myc promoter
was the same as that observed using Jurkat T cells, with elevation of reporter gene
activity levels ranging from 5- to 160-fold. As expected from previous results
(247), transfections of these plasmids into XC rat fibroblasts showed that the
insertion of the TBLV LTR had no effect on c-myc expression in non-T-cell lines
(Fig. 3.39). In fact, when these plasmids were transfected into XC cells,
expression from the c-myc promoters was slightly repressed when the TBLV LTR
was present.
144
Fig. 3.37. Transcriptional activity of the c-myc reporter plasmids containing TBLV LTRs with three-repeat enhancers in Jurkat T cells.
Activity of the c-myc reporter plasmid after transient transfections. Relative luciferase activity was determined after normalization for DNA uptake. Luciferase activity was determined relative to the activity of the c-myc reporter plasmid in the absence of LTR insertion. The means of triplicate assays (± standard deviations) are shown. The positions of LTR insertions are shown relative to the first exon of c-myc. The hatch marks on the x axis indicate that the graph is not drawn to scale. Results of assays with plasmids containing LTRs either in the same transcriptional orientation as the c-myc gene (pink bars) or in the transcriptional orientation opposite that of the c-myc gene (hatched pink bars) are shown. Restriction enzyme site abbreviations: B, BamHI; X, XbaI; H, HindIII.
HBB
5 60 8-2
H
Rel
ativ
e R
luc
exp
ress
ion
75
50
25
100
125
150
0
-3
H
1 2 3 4AfeI
B
AvrII AatII StuI
175
7KpnI AfeI
NcoIExI Ex3
X
= forward orientation= reverse orientation
Rluc pA
145
Fig. 3.38. Transcriptional activity of the c-myc reporter plasmids containing TBLV LTRs with three-repeat enhancers in RL? 1 cells.
Activity of the c-myc reporter plasmid after transient transfections. Results are expressed as in Fig. 3.37.
75
50
25
100
125
150
0
175
Rel
ativ
e R
luc
exp
ress
ion
HBB H H B
5 60 1 2 3 4
AfeI AvrII AatII
7AfeI
Ex1 Ex3Rluc pA
X
= forward orientation= reverse orientation
-1
146
Fig. 3.39. Activity of the c-myc reporter plasmid after transient transfections in XC fibroblast cells.
Results are expressed as in Fig. 3.37.
Because the most clonal tumors had TBLV proviruses with four-repeat
enhancers in the LTR, Jurkat T cells also were transfected with plasmids that had
four-repeat LTRs at several different locations relative to c-myc (Fig. 3.40).
Interestingly, the presence of four repeats lowered overall expression 2- to 100-
fold from c-myc promoters relative to that obtained with LTRs with three repeats.
An exception was insertion of the four-repeat LTR in the AfeI site downstream
and in the reverse orientation, a proviral insertion site that was not observed in
tumor cells (Fig. 1.8). Nevertheless, in most instances, the presence of four 62-bp
Rel
ativ
e R
Lu
cex
pre
ssio
n
0.6
0.4
0.2
0.8
1.0
0HXB
B
5 60
HH
1 2 3 4
B
AvrII7
Afe IpAEx I Ex 3Rluc
= forward orientation= reverse orientation
147
Fig. 3.40. Comparison of the enhancer activity of LTRs containing three- or four-element enhancers on the c-myc promoters.
Insertions in the same transcriptional orientation as the c-myc gene are shown as gray bars, whereas insertions in the opposite orientation are shown as white bars. Restriction enzyme site abbreviations: B, BamHI; X, XbaI; H, HindIII. (A) Transient-transfection assays in Jurkat cells using c-mycRluc plasmids containing three-repeat enhancers. These results are duplicated from Fig. 3.37 using a different scale for ease of comparison to results in panel B. (B) Transient-transfection assays in Jurkat cells using c-mycRluc plasmids containing the four-repeat enhancer. Results are reported as described in the legend to Fig. 3.37. For unknown reasons, the LTR with the four-repeat enhancer could not be cloned in the reverse orientation in the AfeI site upstream of c-myc exon 1; therefore, only the forward orientation is shown.
Rel
ativ
e R
luc
exp
ress
ion
15
10
5
20
25
30
0
Rel
ativ
e R
luc
exp
ress
ion
B
H
5 6
75
50
25
100
0H
4
AfeI
B
AatII
7
AfeI
-1
H
1 2 30
A
BpA
XB
H
5 6
H
4
AfeI
B
AatII
7
AfeI
-1
H
1 2 30
B XB
= forward= reverse
pA
ExI
ExI
Rluc
Rluc
Ex3
Ex3
148
repeats in the enhancer appeared to lower transcriptional activity from both the
TBLV and c-myc promoters (Fig. 3.6 and 3.41).
To verify that the T-cell specific enhancer elements were responsible for
the increase in Renilla luciferase gene expression in these constructs, a number of
constructs were made with a TBLV LTR that contains no enhancer elements.
This mutant LTR was cloned into pc-mycRluc at the AatII and AvrII sites located
downstream of c-myc coding sequences. Transient transfection analysis in Jurkat
T cells showed that these mutant LTRs gave no elevation of reporter gene activity
relative to that of the pc-mycRluc vector alone (Fig. 3.41), demonstrating the
specific effect of the 62-bp elements in enhancement of c-myc promoters.
Fig. 3.41. Comparison of TBLV LTR insertions with different numbers of enhancer elements in transient transfections of Jurkat T cells.
Results are given as described in Fig. 3.37.
HBB
5 60
H
Rel
ativ
e R
luc
exp
ress
ion
75
50
25
100
125
150
0H
1 2 3 4
B
AvrII AatII
175
7
X
= forward (3)= reverse (3)
200
= forward (0)= reverse (0)
Ex3Rluc pAExI
149
3.3.5 The TBLV LTR confers glucocorticoid responsiveness to the c-myc promoters by enhancer activation
To determine the ability of the TBLV LTR to confer glucocorticoid
sensitivity to the c-myc promoters, a number of pc-mycRluc constructs were
transiently transfected into XC rat fibroblast cells and then treated with 10-6 M
DEX. As expected, the presence of the TBLV LTR allowed for glucocorticoid
induction of c-myc expression (Fig. 3.42). One exception was the 5’ sense
orientation insertion of the TBLV LTR at the AfeI site, which had no effect on
Renilla luciferase levels, perhaps due to promoter interference. Thus, similar to
MMTV, expression from the TBLV LTR confers steroid responsive to
neighboring cellular genes that are targets for enhancer insertion.
3.3.6 Contribution of point mutations in TBLV enhancer repeats to enhancement of c-myc promoters
Sequence analysis of the enhancer elements from TBLV integrations in
tumor DNA revealed a point mutation in N minus 1 of the enhancer elements (e.g.
2 out of 3, 3 out of 4). Although this may be due to the infidelity of the viral
reverse transcriptase during proviral synthesis, all of the constructs used for
analysis lacked these point mutations. To determine the significance of these
point mutations for transcription initiated from the TBLV LTR, these mutations
were cloned into reporter gene vectors to better mimic actual integrations by
TBLV. No effect of these point mutations was observed on TBLV LTR-
luciferase activity using transient transfections of Jurkat T cells (Fig. 3.43). To
150
Fig. 3.42. Activity of the c-myc reporter plasmids after DEX induction of transiently transfected XC fibroblast cells.
Cells were transfected with c-mycRluc-TBLV LTR reporter plasmids and treated as indicated with 10-6 M DEX 24 h later. After an additional 24 h in the presence or absence of DEX, cell extracts were prepared for reporter gene assays. Results are expressed as in Fig. 3.37.
HBB
5 60
H
Rel
ativ
e R
luc
expr
essi
on
H
1 2 3 4
B
AvrII7
X
= forward ( -DEX)= reverse ( -DEX)
= forward (+DEX)= reverse (+DEX)
Ex3Rluc pAExI0
2
4
6
8
10
12
14
AfeI
151
Fig. 3.43. Naturally occurring point mutations in enhancer elements do not alter transcription from the TBLV LTR.
A reporter construct with three enhancer elements and two point mutations was compared to one with three wild-type enhancer elements in Jurkat T cells. Results are given in relative light units/100 µg protein.
determine whether this point mutation had any effect on the ability of the LTR to
activate transcription from c-myc promoters, these point mutations also were
transferred into several of the pc-mycRluc–TBLV LTR constructs. With one
exception, analysis of these constructs using transient transfections of Jurkat T
cells showed that LTRs with point mutations were not as efficient as wild-type
LTRs at activating the c-myc promoters in three different locations, (Fig. 3.44).
The 5’ reverse orientation insertion site at AfeI had reporter gene levels that were
moderately higher than point mutant-containing LTRs at the same site.
00.5
11.5
22.5
33.5
TBLV-LUC TBLV-WT-LUC
DNA transfected
LU
C/1
00 u
g p
rote
in
152
Fig. 3.44. Comparison of the effect of TBLV LTR with or without enhancer point mutations on c-myc promoter activity in Jurkat cells.
Results are given as described in Fig. 3.37.
HBB
5 60 8-2
HRel
ativ
e R
luc
expr
essi
on
0
-3
H
1 2 3 4AfeI
B
AvrII AatII StuI7
AfeINcoI
ExI Ex3X
= forward orientation= reverse orientation
Rluc pA
35
45
40
30
25
20
15
10
5
= WT forward orientation= WT reverse orientation
153
4. Discussion
4.1 IDENTIFICATION OF A T-CELL-SPECIFIC ENHANCER IN THE TBLV LTR
TBLV causes exclusively T-cell lymphomas in mice (13,15). The major
differences between TBLV and closely related MMTV strains that cause
mammary carcinomas are a deletion of negative elements within the LTR and
triplication of unique sequences flanking the deletion (16). In this study, it has
been shown that the TBLV LTR triplication constitutes a cell-type-specific
enhancer element (247). In support of this idea, the LTR triplication inserted
upstream of the NREs increased MMTV promoter activity approximately 250-
fold in transient reporter gene assays in Jurkat T cells (Fig. 3.2A). Interestingly,
the location of the enhancer with respect to the NREs resulted in different effects
on promoter activity. Placement of the triplication downstream of the NREs (at
the AflII site) resulted in a greater increase relative to insertion upstream of the
NREs, comparable to transcription levels seen with the native TBLV LTR (data
not shown; S. Bhadra, personal communication). This suggests that the spacing
and/or order of the transcriptional control elements are critical for proper function
since placement of the enhancer sequences closer to the transcriptional start site
negates the regulatory effect of the NREs. In addition, the triplication elevated
reporter gene expression from the heterologous TK promoter 10- to 140-fold in T
cells when inserted upstream or downstream in either orientation (Fig. 3.4). Such
properties are consistent with the action of transcriptional enhancer elements
(20,33,201). Unlike some enhancers, however, the TBLV triplication enhances
expression specifically in T cells (Fig. 3.2, 3.4 and 3.5 and Table 3.1). Even a
closely related lymphoid lineage, B cells, did not support TBLV enhancer
function. Previous experiments by Paquette et al. (307) that used the TBLV LTR
154
to drive CD4 or c-myc expression also are consistent with the T-cell-specific
enhancer activity of the TBLV triplication. However, the latter experiments did
not distinguish the transcriptional activity of the triplication from the effects of
NRE deletion.
4.1.1 Enhancer function of the TBLV LTR on c-myc promoters
Recently members of our group reported that TBLV, similar to other
retroviruses that induce leukemias, frequently integrates near the c-myc oncogene
(328). In two of the tumors, the TBLV provirus inserted downstream up to 3 kb
from the c-myc third exon in the same transcriptional orientation. Both tumors
showed elevated levels of c-myc RNA compared to that obtained from normal
murine thymus or thymic lymphomas lacking TBLV integrations. Since there
was no alteration in the size of the c-myc RNA observed in TBLV-induced
tumors, these results favor the idea that the TBLV LTR, like the MMTV LTR,
activates oncogene expression primarily through enhancer, rather than promoter,
insertion (66,182,285,328).
Proviruses integrated near c-myc generally are inserted upstream in the
opposite orientation or downstream in the same transcriptional orientation as
MMTV proviruses found near Wnt-1 or fgf-3 in virus- induced mammary
carcinomas (66,66,285,285,289,314). Previous experiments have shown that the
levels of c-myc RNA are elevated 2- to 6-fold in TBLV-induced tumors compared
to healthy mouse thymus or radiation-induced tumors (328). This level of c-myc
elevation may be an underestimate in cells with TBLV insertions near the
oncogene because of tumor heterogeneity. Nevertheless, these results are
compatible with the enhancer insertion model for TBLV-induced tumors. TBLV
proviruses were also detected in the c-myc coding region using primary tumor
155
DNA and PCR primers within the c-myc coding regions (Fig. 1.8). Thus far,
hybrid transcripts have not been detected between the TBLV LTR and c-myc
coding sequences in RNA extracted from these T-cell tumors (328), suggesting
that most cells in the population overexpress RNA from the normal c-myc
promoters (104,234).
Prior results in transgenic mice indicate that the TBLV LTR can direct
reporter gene expression preferentially in CD4+ CD8+ T cells in vivo (307). The
TBLV U3 region has a deletion of sequences shown to suppress MMTV
transcription in lymphoid tissues (37,163,224) as well as a triplication of
sequences flanking the deletion (16,247). In addition, the cell-type-specific
enhancer combined with the deletion of NREs, is sufficient to change the
pathogenicity of MMTV from mammary tumors to T-cell lymphomas (274). In
agreement with these results, the TBLV LTR has enhancer activity for the c-myc
promoters in T cells (40). Using a genomic reporter gene vector, pc-mycRluc,
with the TBLV LTR (containing three enhancer elements) inserted upstream or
downstream of c-myc, elevation of reporter gene levels from approximately 2- to
160-fold was observed when transiently transfected in T cells. As expected,
enhancement of c-myc expression by the TBLV LTR was not observed when pc-
mycRluc constructs were analyzed in XC rat fibroblast cells (Fig. 3.39) and
enhancement was eliminated after removal of the 62-bp LTR repeats (Fig. 3.41).
Thus, it appears that TBLV enhancer elements can elevate transcription from
MMTV, TK, and c-myc promoters specifically in T cells.
Insertion of TBLV LTRs near the c-myc gene also confers glucocorticoid
responsiveness on the c-myc promoters (Fig. 3.42). This is not surprising since it
is known that the HRE of MMTV can confer hormone responsiveness to
heterologous promoters (165,232,406). The significance of this observation for
TBLV biology is unclear since TBLV enhancer activity in T cells is not
dependent on steroid hormones (Fig 3.30). Furthermore, TBLV and other
156
thymotropic MMTV strains cause lymphomas in both male and female mice,
suggesting that these strains of MMTV do not rely on the pregnancy-associated
hormonal stimulation of transcription that mammotropic MMTV strains require
for tumorigenesis (252).
4.1.2 Optimal number of enhancer elements for transcription in T cells
Different numbers of enhancer elements (two to four) were found in
TBLV proviruses integrated near the c-myc gene (Table 3.1). Experiments were
performed to determine if more copies of elements correlated with greater
enhancement of neighboring promoters. When the number of enhancer elements
was varied from one to four in the TBLV LTR, the highest transcription was
observed with two or three elements in the two T-cell lines tested (Fig. 3.6).
Interestingly, an LTR containing two enhancer elements was optimal in a
CD4+CD8+ T-cell line, whereas three enhancer elements was optimal in the CD4+
line (Fig. 3.6). This result suggests that the enhancer necessary for blood-borne
transmission of TBLV (three elements) is suboptimal for transformation of
thymocytes.
TBLV LTRs detected near c-myc in T-cell lymphomas commonly had
three or four enhancer elements. Therefore, similar experiments were performed
with the pc-mycRluc vector using three or four enhancer elements (Fig. 3.40).
When LTRs with four enhancer elements were inserted in the same site instead of
those with three elements, from 2- to 100-fold reductions in transcriptional
activity from the c-myc promoters were observed. An exception to this paradigm
was insertion of the LTR with a four-repeat enhancer into the AfeI site about 1 kb
downstream and in the reverse orientation from c-myc. In this case, four-repeat
LTRs gave approximately 30-fold elevation of oncogene expression, whereas
157
three-repeat LTRs had approximately twofold elevation. However, proviruses
with four-repeat enhancers in the LTR (from the T16 and T17 tumors) were
detected only in the forward orientation downstream of c-myc. If insertions are
compared at the AfeI site downstream and in the same orientation as that of c-myc
(the site closest to that of the T16 tumor integration), LTRs with four-repeat
enhancers gave 10-fold elevation of oncogene expression compared to 20-fold for
LTRs with three repeats. More than four copies of enhancer elements were not
tested since TBLV integrations have not been identified that have more than four
copies of the element. Since one would expect that more enhancer elements
would result in higher transcriptional activity, this result suggests selection for
lower expression of c-myc (discussed in Section 4.2).
Interestingly, the number of enhancer elements present in proviruses
recovered from SL3-3-induced tumors changed depending on when the tumors
were examined. In the pre- lymphomatous stage, LTRs containing two enhancer
elements predominated, whereas the majority of proviruses recovered from
lymphomas contained three or four copies of the enhancer. These results suggest
that the optimal number of enhancer elements for replication and leukemogenesis
or progression may be different (236). Two enhancer elements may provide
optimal MuLV transcription whereas three or four elements provide optimal
enhancer activity for proto-oncogene activation. Optimal (which may or may not
be the highest) transcription levels in proviruses integrated adjacent to cellular
oncogenes may confer a growth advantage and allow cells containing these
integrations to clonally outgrow cells with proviral integrations containing two
enhancer elements. In support of this theory, five of six SL3-3 proviruses
examined with integrations near c-myc or pim-1 had three enhancer elements
(268).
158
4.1.3 Significance of naturally-occurring point mutations in TBLV enhancers near c-myc promoters
Sequence analysis of TBLV LTRs from proviral integrations near c-myc
showed that there were single point mutations in N minus 1 of the enhancer
elements. Transient transfections with LTR-reporter vectors containing N minus
1 point mutations showed that these changes had no effect on transcription from
the TBLV promoter relative to those without mutations, but did have an effect on
transcription from c-myc promoters. With only one exception, LTRs containing
point mutations inserted in the pc-mycRluc vector were less efficient at elevating
transcription from the c-myc promoters than those without any mutations. The
significance of these point mutations for TBLV pathogenesis may be the same as
the selection for insertions near c-myc with four enhancer elements, i.e., decreased
oncogene expression (discussed in section 4.2). Retroviruses are known to have
high frequencies of misincorporation during reverse transcription, which could
have caused the single base changes during generation of the provirus
(68,95,333,334). A similar phenomenon has been observed in SL3-3 MuLV
proviral integrations near c-myc (268). In the case of SL3-3, variable numbers of
enhancer elements were also present with point mutations in N minus 1 of the
enhancers. The authors postulated that nucleotide misincorporation in one
enhancer element was followed by template misalignment during proviral
synthesis. These changes were presumably selected because they gave a
replicative advantage to the virus and/or a proliferative advantage to the infected
cells.
159
4.2 EVIDENCE FOR MODULATION OF C-MYC OVEREXPRESSION BY THE TBLV ENHANCER
Several types of evidence argue that there is selection for particular TBLV
insertion sites near c-myc. First, although viruses containing four-repeat LTR
enhancers appeared to be less than 10% of the injected population, both of the
most clonal tumors (as judged by Southern blotting) had proviral insertions with
four copies of the 62-bp enhancer element immediately downstream of c-myc.
Second, semi-nested PCR analysis showed that the polyclonal population of 623B
tumor cells lost proviral insertions that had three-repeat enhancers just upstream
and in the same orientation as the c-myc promoters after growth in
immunocompetent mice, consistent with selection against such insertions during
tumor passage (Fig. 3.34 and 3.35). In contrast, the same tumor showed an
apparent increase in the number of cells carrying proviruses with four-repeat
enhancers near c-myc using the same primers and PCR conditions. This insertion
was confirmed by sequencing. Thus, there appeared to be selection during
passage in mice (three of six tumors tested) for proviruses carrying four-repeat
enhancers near c-myc. Third, semi-quantitative PCR showed that there was
selection for TBLV proviruses containing a three-repeat enhancer at a position
approximately 1 kb upstream and in the opposite orientation in tumor 623B.
Interestingly, this is similar to the orientation and position of MuLV proviruses
integrated near c-myc in many murine T-cell lymphomas (73,194,218,268,290).
However, another TBLV integration with three-repeat enhancers in the LTR
located approximately 4 kb upstream and in the orientation opposite that of c-myc
appeared to decrease in the tumor population after passage (Fig. 3.36A). Such
results indicate that only particular insertions near c-myc are selected during tumor
progression.
160
What is the nature of the selection? Previous experiments have suggested
that MuLV LTR enhancers have been selected for optimal activity during T-cell
leukemogenesis (56,144,372). MuLVs containing mutations in c-Myb, Ets, or
RUNX1 binding sites that compromise enhancer activity of proviral LTRs were
shown to revert to the wild-type sequence when proviruses found in T-cell tumors
were characterized (236,439). Recent experiments indicate that proviruses with
two-repeat enhancers predominate early during infections, yet lymphomas
predominantly had proviruses with three- or four-repeat enhancers (268). Our
data suggest that TBLV proviruses that are clonally selected during lymphoma
growth frequently have insertions that activate c-myc transcription through the
LTR enhancer activity, but this activity may be modulated during tumor cell
selection. Possible mechanisms for modulation of c-myc expression include (i)
selection for tumor cells carrying TBLV insertions with suboptimal numbers of
enhancer repeats, (ii) selective growth of cells with a TBLV proviral orientation
relative to c-myc that minimizes oncogene overexpression, and (iii) selection for
increasing distance between c-myc and the TBLV provirus.
The following data support the assumption that TBLV proviruses near c-
myc may be selected for suboptimal oncogene expression. First, proviruses
located near c-myc in the most clonal tumors, T16 and T17, had four-repeat
enhancers in the LTR, rather than the three repeats observed in proviruses derived
from the tumor population used to prepare the inoculated virus. As discussed
earlier, experiments indicated that four-repeat enhancers reproducibly gave lower
transcriptional activity from the TBLV promoter than the three-repeat enhancers
in CD4+ Jurkat and CD4+ CD8+ RL? 1 T-cell lines (Fig. 3.6). Using constructs
where TBLV enhancer activity was assessed on the c-myc promoters (Fig. 3.40),
four-repeat LTRs gave up to 100-fold- lower expression than did three-repeat
LTRs. Second, the placement of LTRs relative to c-myc did not appear to be
optimal for oncogene overexpression. For example, the highest expression with
161
three-repeat LTRs was observed with insertions into the AvrII site 1.75 kb
downstream and in the orientation opposite that of c-myc. All of the proviruses
located in this region (T16, T604, and T17) were oriented in the forward
orientation (Fig. 1.8). Only the T602 tumor had a provirus that was located
downstream and in the reverse orientation and had three-enhancer repeats in the
LTR. This provirus was located approximately 2.5 kb further downstream than
insertions tested at the AvrII site, and the trend for constructs tested was a
decrease in c-myc expression in sites 3’ to AvrII. Third, semiquantitative PCR
indicated that cells carrying proviruses with three-repeat enhancers and in optimal
insertion sites for c-myc overexpression (for example, some of the T623B
insertions upstream and in the same orientation as the oncogene and the T9
insertion [Fig. 3.36A]) were diluted within the population after tumor passage. In
the case of T623B, cells carrying a solo LTR with a four-repeat enhancer quite
similar to the TBLV LTR tested at the AfeI site upstream of c-myc (Fig. 3.40)
were selected after tumor passage. Such results are consistent with selection for
suboptimal c-myc expression, since four-repeat enhancers at this position
decreased expression ca. 15-fold relative to expression with three-repeat
enhancers.
Why would there be selection against the highest levels of c-myc
expression? One explanation is that there is a threshold level of c-myc RNA that
is required to drive tumor cell growth, but above this threshold, oncogene
expression becomes cytotoxic or leads to apoptosis. Recent experiments using a
tetracycline-regulated c-myc oncogene indicate that continued proto-oncogene
expression is required for maintenance of leukemia cell growth (111). However,
several pieces of evidence also suggest that certain levels of c-myc lead to tumor
cell apoptosis. For example, in mice that express a hybrid protein that brings c-
Myc under the control of the ligand-binding domain of a modified estrogen
receptor, viability of the tumor cells was decreased in the presence of an estrogen
162
derivative (where c-myc expression was increased) (52). Moreover, other studies
have shown that upregulation of antiapoptotic genes, such as Gfi-1/pal-1 and Bcl-
2, can complement upregulation of c-myc during leukemogenesis (110,140,354).
Thus, these data lead to the intriguing hypothesis that transient increases in c-myc
levels or decreases in anti-apoptotic gene expression could be used therapeutically
to induce tumor cell destruction.
4.3 TRANSCRIPTION FACTORS BINDING TO A CRITICAL REGION OF THE TBLV ENHANCER
4.3.1 RUNX1 binding to the TBLV enhancer
Deletion mutations of the TBLV LTR suggested that the 5’ sequences of
the TBLV enhancer were critical for optimal activity (Fig. 3.7). To determine the
sequences necessary for TBLV enhancer function, substitution mutations were
engineered in a single copy of the 62-bp element that then were triplicated and
inserted into a C3H MMTV LTR lacking the NREs. The activities of these
mutant LTRs upstream of a luciferase reporter gene were tested in transient
transfection assays in two different T-cell lines (Fig. 3.9). A single substitution
mutant (556M) showed dramatic loss of enhancer function in both cell lines, and
this mutation overlapped a putative RUNX1 binding site (GTGCGGTTC)
(compare to consensus in Fig. 3.11). Several pieces of evidence confirm that
RUNX1 binding contributes to TBLV enhancer function. (i) Gel shift
experiments showed that RUNX1 DNA binding activity was detectable in whole-
cell extracts from Jurkat cells using a wild-type probe that overlapped the
556 mutation within the TBLV LTR. This complex had a molecular mass similar
163
to that detected with a known RUNX1 binding site probe. (ii) The DNA binding
activity for the TBLV LTR was confirmed to be RUNX1, as judged by supershift
experiments with specific antibody; the supershifted complex was not obtained
with antibody against RUNX3 or RUNX2 (data not shown). (iii) The RUNX1
supershift was greatly reduced by the addition of an excess of the RUNX1 peptide
used to produce the antibody. (iv) Overexpression of RUNX1B, but not RUNX2
(96), in mammary cells was sufficient to elevate TBLV LTR activity 30-fold
compared to cells without RUNX1B overexpression (Fig. 3.15 and data not
shown). Therefore, enhancer mutations, gel shift experiments, and overexpression
assays indicated that RUNX1 DNA binding activity contributes to the cell- type-
specific activity of the TBLV enhancer.
MMTV strains that induce leukemias (other than TBLV) also have been
described (98,210,251,435). Invariably these strains have an LTR deletion
spanning the NREs, and in some cases, the sequences flanking the deletion are
multimerized. The multimers encompass sequences in the LTRs of several
mammotropic MMTV proviruses (RGTGGT) that match five of six bases within a
consensus RUNX1 binding site (YGYGGT) (16,210,251,435). Lee et al. showed
that the altered LTR from the DBA/2 ML T-cell tumor was more transcriptionally
active in NIH 3T3 cells than mammotropic MMTV LTRs (210), whereas another
altered LTR from the DL-8 tumor showed enhanced activity in mammary cells
compared to LTRs derived from mammotropic MMTVs (435). However, TBLV
enhancer activity was only observed in T-cell lines. Similarly, Yanagawa et al.
(435) and Theunissen et al. (388) showed that altered MMTV enhancer elements
from DBA/2 or GR-derived leukemias could stimulate transcription in T cells
above that observed with mammotropic LTRs. As pointed out by Yanagawa et al.
(435), the region of the LTR containing a RUNX1 binding site contributes greatly
to T-cell enhancer function. Thus, RUNX1 DNA-binding activity may be
164
important for T-cell-specific enhancer activities of many leukemogenic MMTV
strains.
4.3.2 Importance of NF-A and NF-B for enhancer activity
NF-A and NF-B bind to the crucial region of the TBLV enhancer (Fig.
4.1). NF-A resolves on EMSA gels into at least three complexes and appears to
be lymphoid-specific since binding activity is only detected in T- and B-cell
extracts. Based on mutational analysis of the region 5’ of the RUNX1 site in the
TBLV enhancer (Fig. 3.27) and oligonucleotide competition with HIV-1 enhancer
sequences (Fig. 3.21), it appears that the NF-A complex is comprised of at least
two different factors. Deletion of sequences 5’ of the RUNX1 binding site
drastically reduces the activity of the enhancer in T cells (Fig. 3.7). In addition,
NF-A.1, which constitutes the lowest mobility band of the NF-A complex (Fig.
3.27), appears to be the major contributor to TBLV enhancer activity since
mutation of the NF-A.1 binding site reduces transcriptional activity in T cells by
approximately 80%, whereas either the RUNX1 or the NF-B binding site
mutation only reduced activity by ca. 40% (Fig 3.28). A sequence (CAGGTA)
related to an E-box (CACGTG) overlaps with the 5’ end of the RUNX1 binding
site in the TBLV enhancer. Since NF-A binding is affected by the 548 mutation
and appears to be present in T- and B-cell extracts, it is possible the NF-A
complex contains a lymphoid-specific E-box binding protein. NF-B binding
activity is detectable in all cell types tested thus far and is necessary for full
enhancer function, but does not appear to be the crucial factor for T-cell
specificity of the TBLV enhancer. However, the exact roles of NF-A and NF-B
in TBLV transcription will await their identification.
165
4.3.3 ALY enhancement of RUNX1 activity on the TBLV enhancer
The transcriptional co-activator ALY was identified by biochemical
purification of proteins that bind to the critical region of the TBLV enhancer.
ALY interacts with RUNX1 and LEF-1 on the TCRα enhancer to increase the
transcriptional activity of these two factors (43). ALY cannot bind DNA alone.
Instead, other transcription factors tether ALY to target DNA and activate
transcription. Expression of ALY in HC11 mammary epithelial cells had no
effect on TBLV promoter activity (data not shown). However, when RUNX1 and
ALY were co-expressed in HC11 cells, ALY enhanced RUNX1-mediated
activation of TBLV due to minimal levels of RUNX1 in these cells (Fig. 3.19).
Similar results were seen in EL4b T cells (Fig. 3.20). However, ALY expression
alone also was able to activate TBLV independent of RUNX1 overexpression due
to higher levels of endogenous RUNX1 relative to HC11 cells. It is possible that
ALY bridges RUNX1, NF-A and/or NF-B proteins on the TBLV enhancer to
allow cooperative activation. This is the first report of ALY activity on a viral
promoter. Although there have been no reports of ALY function on MuLV
enhancers, it is possible that there is also cooperation between ALY and RUNX1
on these enhancers.
4.3.4 NF-κB binding to the TBLV enhancer
The role of NF-κB binding to the TBLV enhancer is unclear. When
overexpressed in HC11 cells, the NF-κB subunits NF-κB-1 and NF-κB-2 can
activate the TBLV enhancer (Fig. 3.23). However, when co-expressed with
RUNX1, the activation seen with either protein alone is abrogated, regardless of
166
mutation of either DNA-binding site (Fig. 3.25). Furthermore, sequestration of
NF-κB proteins in the cytoplasm by a DN IκB has no significant effect on TBLV
LTR activity in T cells. Interestingly, when DN IκB is co-expressed with
RUNX1 in B cells, the RUNX1-mediated activation of the TBLV LTR is elevated
relative to that seen when RUNX1 is overexpressed alone. This suggests that NF-
κB may have a role in modulating the enhancer in non-T cells.
The identification of an NF-κB binding site in the TBLV enhancer is
novel among enhancers from murine retroviruses that cause lymphomas and
leukemias. NF-κB binds HIV-1 enhancers and cooperates with neighboring Sp1
and NFAT sites to activate transcription in T cells (175,186,313). NF-κB also
regulates transcription of a number of other viruses, including adenoviruses (426),
JC virus (238) as well as herpes viruses HSV-1 (338) and CMV (347). NF-κB
activates lymphoid-specific expression of early region 3 genes in adenovirus. The
CMV enhancer contains four κB-binding sites, but full enhancer function in
embryonic lung cells requires additional factors. JC virus requires NF-κB binding
for optimal transcriptional activity in glial cells. Thus, NF-κB can activate
transcription in lymphoid or non- lymphoid cells depending on cooperating factors
that bind different promoters. TBLV may represent a unique retroviral enhancer
element that combines components of the MuLV (c-Myb and RUNX1) and HIV-
1 (NF-κB) enhancers.
4.3.5 HMG and hnRNP roles in transcriptional regulation
Three other proteins identified by mass spectrometry of enhancer-binding
factors were HMG1, HMG2 and hnRNPA1/A2. HMG proteins are non-specific
DNA-bending proteins that enhance the affinity of other DNA-binding proteins
167
for their recognition sites. HMG proteins play a role in the architecture of the
enhanceosome (55,245). Studies using Epstein Barr virus (EBV) activator
proteins have revealed two models for how HMG1 proteins act to promote
enhanceosome assembly. The first model is based on binding of HMG1 and
ZEBRA to target gene promoters. In these studies, it was shown that HMG1
bound the promoter in a sequence-dependent manner, the HMG1 binding site was
flanked on either side by ZEBRA protein-binding sites, and HMG1 binding was
cooperative with ZEBRA binding (106). Later studies using the EBV activator
protein Rta showed that HMG1 enhanced binding of Rta to DNA, but was not
part of the nucleoprotein complex and did not stably bind DNA near the Rta
binding site (257). According to this model, HMG proteins may bend DNA to
allow the binding of Rta, but HMG binding to the promoter sequences is transient.
Therefore, HMG may act in different ways based on the promoter sequence and
interacting factors.
The hnRNP A1 protein is an RNA-binding protein usually associated with
pre-mRNA processing (11) or maintenance of telomere length (199). However,
hnRNP A1 has been implicated in binding to double-stranded DNA and
transcriptional regulation of a number of promoters, including a vitamin D-
resistant promoter (59,60), the thymidine kinase (TK) promoter (202) as well as
the APOE gene promoter (53). This protein suppresses transcription from the TK
promoter as well as both basal and induced expression from vitamin D-responsive
promoters. In contrast, hnRNPA1 activates the APOE promoter, suggesting that
the context in which this protein binds to promoters determines its effect on
transcriptional activity.
Experiments to determine the role of HMG1, HMG2 and hnRNP A1
proteins in TBLV enhancer activity have not been performed. However, there is
recent evidence that these proteins, which have not previously been associated
168
with transcriptional regulation, modulates the activity of a number of promoters
(53,59,60,106,202,257).
4.4 CONTRIBUTION OF GR AND C-M YB TO TBLV ENHANCER FUNCTION
Interestingly, like the MuLV enhancers, the TBLV 62-bp element contains
a consensus GR binding site, and this sit e mediates glucocorticoid-stimulated
transcription in XC fibroblasts (Fig. 3.29). The 586 mutation in the TBLV
enhancer spans both GR and c-Myb binding sites (Fig. 4.1). Experiments showed
that these sites were most important for function of the enhancer in Jurkat CD4+ T
cells, and not in CD4+ CD8+ cells, one of the major cell targets for TBLV-induced
leukemias (Fig. 4.1, 586 mutation) (249,272). Moreover, experiments using
hormone-stripped serum suggested that the factor in Jurkat cells that binds to the
GR element of the TBLV enhancer is not GR (Fig. 3.30). It is possible that
another factor may bind near the GR site and may be related to the basic helix-
loop-helix (bHLH) proteins SEF2 or ALF1 shown to bind the MuLV enhancers
(280,281).
Binding of c-Myb to the TBLV enhancer has been detected by EMSA
(data not shown). The contribution of c-Myb to enhancer activity has been
confirmed by overexpression in HC11 mammary epithelial cells, resulting in
activation of the TBLV LTR. RUNX1 and c-Myb co-expression in HC11 cells
resulted in additive activation of the TBLV LTR, in contrast to the antagonism
seen with the co-expression of RUNX1 and NF-κB proteins in HC11 cells.
169
4.5 MECHANISM OF RETROVIRAL ENHANCERS ACTIVE IN T CELLS
RUNX1 binding activity is crucial for the activity of the MuLV family of
enhancers, including those from the gibbon ape and feline leukemia viruses (439).
Many experiments have shown MuLV LTRs carry viral determinants of
leukemogenicity (56,85,170,213,339) in tandem repeats of 50- to 100-bp
segments of the U3 region (131). Exchange of Friend and Moloney MuLV LTR
repeat regions also switched the type of leukemia induced (57,130,170). Within
the enhancer repeat region of MuLVs that cause T-cell tumors are binding sites
for RUNX1. Some MuLVs that induce rapidly appearing T-cell leukemias (e.g.,
SL3-3) have two binding sites for RUNX1 (called cores I and II) in the 72-bp
repeat element (438,439), and therefore four RUNX1 binding sites in the
enhancer, whereas other MuLVs, such as Moloney, have a single RUNX1 binding
site in each repeat element (281). Core I of SL3-3 appears to have the strongest
affinity for binding to RUNX1 (438), and mutations within this binding site
reduce leukemogenicity in mice and transcriptional activity in T-cell lines
(216,236,438,439). An MuLV strain (SAA) that has a 1-bp mutation in core I of
each enhancer repeat (TGTGGTCAA) is weakly leukemogenic compared to SL3-
3 (containing TGTGGTTAA), and most SAA-induced lymphomas had reversions
or second-site suppressor mutations within the enhancer (236). Interestingly, there
is a general correlation between increased affinity of RUNX1 for the core I
enhancer and both transcriptional activity in T cells and leukemogenicity.
However, this correlation can be subtle. For example, the RUNX1 DNA-binding
(Runt) domain has an apparent Kd of 3.5 × 10 11 for core I of the weakly
leukemogenic Akv virus and an apparent Kd of 2.4 × 10 11 for the highly
leukemogenic SL3-3 core (216). This observation suggests that binding of factors
in addition to RUNX1 is important for MuLV leukemogenicity.
170
Fig. 4.1. Diagram of TBLV enhancer-binding factors and activity of corresponding substitution mutations.
(A) The TBLV enhancer element is comprised of 18 bp from 5’ sequences flanking the deletion (hatched box) and 44 bp from the 3’ flanking sequences (open box). Transcription factors that bind the TBLV enhancer are shown by circles and boxes. (B) Reporter gene activity of mutant enhancers in transient assays in Jurkat (yellow) or RL?1 (pink) T cells. Means of triplicate assays with standard deviations are shown. Luciferase activity was determined as described in the legend to Fig. 3.2 except that values are relative to that of the pTBLV-WT-LUC vector (assigned a value of 100). The enhancer element in panel A is aligned with the corresponding mutations in panel B to show the location of binding sites and transcriptional activity of mutants spanning these sites.
NF-Ac-myb
NF-BNF-κB
RUNX1
18 bp 44 bpALY
GR
0
50
100
150
200
WT54
0M54
8M55
6M56
4M57
2M57
8M58
6M59
4M
Rel
ativ
e L
UC
val
ue
LTR-Reporter Constructs
A
B
171
A number of other transcription factor complexes have been reported to
bind to the MuLV enhancer repeats, including Ets-1, Myb, GR, NF1, and bHLH
proteins (Fig. 4.2) (74,131,280,371). In the Moloney MuLV enhancer, the
RUNX1 binding site is flanked by Ets-1 binding sites (also called LVb and LVc)
(371,381). Intact binding sites for both Ets-1 and RUNX1 are required for
constitutive activity of the MuLV and TCR β-chain enhancers in T-cells (381).
Recent evidence suggests that interactions between Ets-1 and RUNX1 stimulate
binding to DNA (430) and that the interaction counteracts autoinhibitory
sequences in both proteins (127,141). The Myb-binding site (like core II) is
present only in the SL3-3 and Gross passage A virus (281). Mutations of the Myb
site in the SL3-3 LTR had greater effects on enhancer activity in T cells than did
mutations of the Ets site; however, other MuLVs (e.g., Moloney) that lack Myb
sites also have high transcriptional activity in T cells (281). Nevertheless, these
data indicate that RUNX1 binding in conjunction with several other proteins may
provide potent transcriptional enhancement in T cells. The evidence that RUNX1
overexpression in HC11 causes a 30-fold elevation of transcription from the
TBLV LTR (Fig. 3.15) strongly suggests that RUNX1 binding also contributes to
the activity of the novel TBLV enhancer.
The TBLV enhancer contains a novel assembly of transcription factor
binding sites, combining sites commonly found in MuLV enhancers (c-Myb, GR
and RUNX1) and in the HIV-1 enhancer (NF-κB). Similar to MuLV enhancers,
TBLV contains a GR binding site, but does not appear to require GR at this site to
activate transcription. According to Nielsen et al., bHLH E-box proteins bind to
an E-box overlapping the HRE in MuLV enhancers to activate transcription (280).
However, there have been no reports of c-Myb binding to overlapping sequences
in the region of the MuLV GR site. In data presented here, a functional c-Myb
site has been identified that overlaps with the HRE in the TBLV enhancer.
Oligonucleotide competition with consensus binding site sequences for c-Myb or
172
Ets family members do not compete for NF-A or NF-B binding activity,
suggesting that the TBLV enhancer is more divergent from the typical MuLV
enhancer structure. TBLV and some MuLVs do share a c-Myb site, but the
position of the site relative to the RUNX1 site is different between these viral
enhancers (Fig. 4.2). Furthermore, co-expression of c-Myb and RUNX1 is not
synergistic on the TBLV enhancer, while this synergism is observed on the SL3-3
enhancer. This suggests that a different mechanism of transcriptional activation is
used for each virus to achieve the T-cell enhancer effect.
In contrast to MuLVs, TBLV has an NF-κB binding site in the crucial
region of the enhancer (548-556 region) (Fig. 4.1). As mentioned previously, the
NF-κB sites in the HIV-1 enhancer play a critical role in transcriptional regulation
and replication of the virus (58,198). The role of the κB site in the TBLV
enhancer is unclear since elimination of NF-κB binding by a DN IκB has a
negligible effect on enhancer function in T cells. It is possible that the κB site,
similar to the GR site in the TBLV enhancer, overlaps with binding site(s) for
positive factors that are more abundant in T cells (i.e., NF-A), and NF-κB may
function to modulate enhancer activity in non-T cells. In support of this
hypothesis, depletion of NF-κB from the nucleus of B cells results in higher
RUNX1-mediated activation of the TBLV enhancer. However, a role for B cells
in TBLV infection has not been established (S. Bhadra, personal communication).
NF-κB may bind to the enhancer in other cell types and function to block binding
of any positive factors or may cooperate with other factors on the DNA to repress
transcription in these cells. Since the antagonistic relationship of RUNX1 and
NF-κB in HC11 mammary cells does not appear to depend on DNA binding,
further experiments are necessary to determine the nature of the interaction.
There may be a direct protein-protein between RUNX1 and NF-κB or the effect
could be mediated via some other mechanism, such as squelching of other factors.
173
Fig. 4.2. Schematic representation of factors binding to the TBLV enhancer and other retroviral enhancers active in T cells.
Numbers outside the brackets indicate the number of enhancer elements commonly observed in proviruses. Known transcription factor-binding sites are shown. The numbers in parentheses refer to the length in base pairs of a single enhancer element.
NF1
NFAEts Runx1bHLH GR
NFBE-box c-Myb
MoMuLV (75 bp)2
FeLV (50 bp)2
Akv (99 bp)2
SL3-3 (72 bp)2
TBLV (62 bp)3
NF-kB Sp-1
AP-2
HIV-1 (26 bp)1
NFAT
174
Fig. 4.3. Phylogenetic analysis of retroviral enhancers active in lymphoid cells.
This diagram was obtained using Vector NTI, version 7.0 software (Informax, Inc. Bethesda, MD).
Irrespective of the outcome of these experiments, it does not appear that NF-κB is
a positive regulator of TBLV enhancer function in T cells.
In agreement with analysis of binding sites in various retroviral enhancers
active in T cells (Fig. 4.2), sequence analysis shows that MuLV and FeLV
enhancers are the most closely related as the nucleotide level as well. Somewhat
surprisingly, the thymotropic MMTV enhancers (DL-8, DBA/2 t-MMTV and
TBLV) aligned more closely with the HIV-1 enhancer than with those from the
DBA/2 t-MMTVTBLV
DL-8HIV-1
Moloney MuLVFriend MuLV
FeLVMCF 247
AKVGross MuLVSL3-3 MuLV
175
MuLVs or FeLV (Fig. 4.3). The ability of the HIV-1 enhancer to compete for
binding of NF-B and part of NF-A complexes suggests that the HIV-1 and TBLV
enhancers share more than NF-κB binding.
In the present study of a T-cell-specific enhancer, it is interesting to note
that, similar to MuLV enhancers in which T-cell enhancer function has been
studied, there does not appear to be one T-cell-specific factor that is responsible
for the activity. Instead, the specific combination and relative abundance of
transcription factors present in T cells and the organization of binding sites on the
enhancer appears to determine the T-cell specificity of the TBLV enhancer.
Much work remains to be done to fully understand the mechanism of the TBLV
enhancer action. Identification of NF-A, NF-B and other factors that bind the
enhancer in both T and non-T cells will help elucidate the powerful and specific
action of this enhancer. Transfer of specific mutations to a molecular clone of
TBLV and subsequent infection of susceptible mice will allow understanding of
the importance of individual factors and regions of the enhancer to the tissue-
specificity of tumorigenesis, the pathogenicity of the virus and tumor latency.
The composition of the enhancer is critical for determining the ability of the virus
to activate certain oncogenes (i.e., c-myc), which can influence tumor formation
(100,268). The TBLV enhancer is a useful tool for studying cell-type-specific
transcriptional regulation and its role in the disease tropism of a model retrovirus.
176
Appendix A
List of abbreviations used:
AML-1 acute myeloid leukemia 1 AMV avian myeloblastosis virus BEF basic region- leucine zipper (bZIP) enhancing factor bHLH basic helix- loop-helix CA capsid CBF core binding factor CBP/p300 CREB-binding protein/adenovirus E1A-associated 300 kDa
protein CDP CCAAT displacement protein COX-2 cyclooxygenase-2 DBD DNA binding domain DU dUTPase Ex exon FeLV feline leukemia virus Fgf fibroblast growth factor GM-CSF granulocyte-monocyte colony stimulating factor GR glucocoricoid receptor GRR glycine-rich region HERV-K human endogenous retrovirus K HIV-1 human immunodeficiency virus 1 hnRNP heterogeneous nuclear ribonucleoprotein HRE hormone responsive element HTLV-1 human T-cell leukemia virus type 1 IκB inhibitor of κB ICAM intercellular adhesion molecule IL interleukin IN integrase iNOS inducible nitric oxide synthase IR inverted repeat KO knockout LEF-1 lymphoid enhancer binding factor 1 LT α/β lymphotoxin α and β LTR long terminal repeat LZ leucine zipper MA matrix MCP1 monocyte
177
MGE mammary gland enhancer MHC major histocompatibility complex mim-1 myb induced myeloid protein 1 MIP1α macrophage inflammatory protein α MMTV mouse mammary tumor virus MoMuLV moloney murine leukemia virus MPO myeloperoxidase MRE myb responsive element mTfR1 murine transferring receptor 1 MTVR1 MMTV receptor 1 MTVR2 MMTV receptor 2 MuLV murine leukemia virus NC nucleocapsid NF-κB nuclear factor required for immunoglobulin kappa light chain
transcription in B cells NFAT nuclear factor of activated T cells NLS nuclear localization sequence NRD negative regulatory domain NRE negative regulatory element OCT-1 octamer 1 PB primer binding site PBS phosphate buffered saline PCR polymerase chain reaction PEA2 polyomavirus enhancer activating protein 2 PEBP2αB polyomavirus enhancer binding protein 2 αB PR protease RANTES regulated upon activation normal T-cell expressed and secreted RBD RNA-binding domain RD runt domain REF RNA export factor Rev-T reticuloendotheliosis virus strain T rhd runt homology domain RHD rel homology domain RNase ribonuclease RNP ribonucleoprotein RT reverse transcriptase RUNX1 runt-related transcription factor 1 S/A-CBFαB SL3-3/Akv-core binding factor αB SA splice acceptor SAA serum amyloid A Sag superantigen SATBI special AT-rich binding protein 1
178
SD splice donor SEF-1αB SL3-3 enhancer factor 1 αB subunit SU surface protein TAD transcription activation domain TAP tip-associate protein TBLV type B leukemogenic virus TCR T cell receptor TFIID transcription factor II D TLE1 transducin- like element 1 TM transmembrane TNFα tumor necrosis factor-α VCAM vascular cellular adhesion molecule
180
References
1. Acha-Orbea, H., W. Held, G. A. Waanders, A. N. Shakhov, L.
Scarpellino, R. K. Lees, and H. R. MacDonald. 1993. Exogenous and endogenous mouse mammary tumor virus superantigens. Immunol.Rev. 131:5-25.
2. Acha-Orbea, H. and H. R. MacDonald. 1995. Superantigens of mouse mammary tumor virus. Annu.Rev.Immunol. 13:459-486.
3. Acha-Orbea, H., A. N. Shakhov, L. Scarpellino, E. Kolb, V. Muller, A. Vessaz-Shaw, R. Fuchs, K. Blochlinger, P. Rollini, J. Billotte, and . 1991. Clonal deletion of V beta 14-bearing T cells in mice transgenic for mammary tumour virus. Nature 350:207-211.
4. Amtoft, H. W., A. B. Sorensen, C. Bareil, J. Schmidt, A. Luz, and F. S. Pedersen. 1997. Stability of AML1 (core) site enhancer mutations in T lymphomas induced by attenuated SL3-3 murine leukemia virus mutants. J.Virol. 71:5080-5087.
5. Anfossi, G., A. M. Gewirtz, and B. Calabretta. 1989. An oligomer complementary to c-myb-encoded mRNA inhibits proliferation of human myeloid leukemia cell lines. Proc.Natl.Acad.Sci.U.S.A 86:3379-3383.
6. Anrather, J., V. Csizmadia, M. P. Soares, and H. Winkler. 1999. Regulation of NF-kappaB RelA phosphorylation and transcriptional activity by p21(ras) and protein kinase Czeta in primary endothelial cells. J.Biol.Chem. 274:13594-13603.
7. Archer, T. K., P. Lefebvre, R. G. Wolford, and G. L. Hager. 1992. Transcription factor loading on the MMTV promoter: a bimodal mechanism for promoter activation. Science 255:1573-1576.
8. Arroyo, J., E. Winchester, B. S. McLellan, and B. T. Huber. 1997. Shared promoter elements between a viral superantigen and the major histocompatibility complex class II-associated invariant chain. J.Virol. 71:1237-1245.
9. Asano, K., W. C. Merrick, and J. W. Hershey. 1997. The trans lation initiation factor eIF3-p48 subunit is encoded by int-6, a site of frequent
181
integration by the mouse mammary tumor virus genome. J.Biol.Chem. 272:23477-23480.
10. Austen, B. M. 1979. Predicted secondary structures of amino-terminal extension sequences of secreted proteins. FEBS Lett. 103:308-313.
11. Bai, Y., D. Lee, T. Yu, and L. A. Chasin. 1999. Control of 3' splice site choice in vivo by ASF/SF2 and hnRNP A1. Nucleic Acids Res. 27:1126-1134.
12. Baldwin, A. S., Jr. 1996. The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu.Rev.Immunol. 14:649-683.
13. Ball, J. K., L. O. Arthur, and G. A. Dekaban. 1985. The involvement of a type-B retrovirus in the induction of thymic lymphomas. Virology 140:159-172.
14. Ball, J. K. and G. A. Dekaban. 1987. Characterization of early molecular biological events associated with thymic lymphoma induction following infection with a thymotropic type-B retrovirus. Virology 161:357-365.
15. Ball, J. K., G. A. Dekaban, J. A. McCarter, and S. M. Loosmore . 1983. Molecular biological characterization of a highly leukaemogenic virus isolated from the mouse. III. Identity with mouse mammary tumour virus. J.Gen.Virol. 64 (Pt 10):2177-2190.
16. Ball, J. K., H. Diggelmann, G. A. Dekaban, G. F. Grossi, R. Semmler, P. A. Waight, and R. F. Fletcher. 1988. Alterations in the U3 region of the long terminal repeat of an infectious thymotropic type B retrovirus. J.Virol. 62:2985-2993.
17. Ball, J. K. and J. A. McCarter . 1971. Repeated demonstration of a mouse leukemia virus after treatment with chemical carcinogens. J.Natl.Cancer Inst. 46:751-762.
18. Ball, R. K., R. R. Friis, C. A. Schoenenberger, W. Doppler, and B. Groner. 1988. Prolactin regulation of beta-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J. 7:2089-2095.
19. Banerjee, C., S. W. Hiebert, J. L. Stein, J. B. Lian, and G. S. Stein. 1996. An AML-1 consensus sequence binds an osteoblast-specific
182
complex and transcriptionally activates the osteocalcin gene. Proc.Natl.Acad.Sci.U.S.A 93:4968-4973.
20. Banerji, J., S. Rusconi, and W. Schaffner. 1981. Expression of a beta-globin gene is enhanced by remote SV40 DNA sequences. Cell 27:299-308.
21. Beg, A. A. and A. S. Baldwin, Jr. 1993. The I kappa B proteins: multifunctional regulators of Rel/NF-kappa B transcription factors. Genes Dev. 7:2064-2070.
22. Beg, A. A., W. C. Sha, R. T. Bronson, and D. Baltimore . 1995. Constitutive NF-kappa B activation, enhanced granulopoiesis, and neonatal lethality in I kappa B alpha-deficient mice. Genes Dev. 9:2736-2746.
23. Beg, A. A., W. C. Sha, R. T. Bronson, S. Ghosh, and D. Baltimore . 1995. Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-kappa B. Nature 376:167-170.
24. Berge, T., S. L. Bergholtz, K. B. Andersson, and O. S. Gabrielsen. 2001. A novel yeast system for in vivo selection of recognition sequences: defining an optimal c-Myb-responsive element. Nucleic Acids Res. 29:E99.
25. Bergman, A. C., O. Bjornberg, J. Nord, P. O. Nyman, and A. M. Rosengren. 1994. The protein p30, encoded at the gag-pro junction of mouse mammary tumor virus, is a dUTPase fused with a nucleocapsid protein. Virology 204:420-424.
26. Berkowitz, R., J. Fisher, and S. P. Goff. 1996. RNA packaging. Curr.Top.Microbiol.Immunol. 214:177-218.
27. Bernhard, W. 1958. Electron microscopy of tumor cells and tumor viruses: a review. Cancer Research 18:491-509.
28. Beutner, U., E. Kraus, D. Kitamura, K. Rajewsky, and B. T. Huber. 1994. B cells are essential for murine mammary tumor virus transmission, but not for presentation of endogenous superantigens. J.Exp.Med. 179:1457-1466.
183
29. Bies, J. and L. Wolff. 1997. Oncogenic activation of c-Myb by carboxyl-terminal truncation leads to decreased proteolysis by the ubiquitin-26S proteasome pathway. Oncogene 14:203-212.
30. Bishop, J. M. 1978. Retroviruses. Annu.Rev.Biochem. 47:35-88.
31. Bittner, J. J. 1936. Some Possible Effects of Nursing on the Mammary Gland Tumor Incidence in Mice. Science 84:162.
32. Bittner, J. J. 1943. Possible relationship of the oestrogenic hormones, genetic susceptibility and milk influence in the production of mammary cancer in mice. Cancer Res. 2:710-721.
33. Blackwood, E. M. and J. T. Kadonaga. 1998. Going the distance: a current view of enhancer action. Science 281:61-63.
34. Boral, A. L., S. A. Okenquist, and J. Lenz. 1989. Identification of the SL3-3 virus enhancer core as a T- lymphoma cell-specific element. J.Virol. 63:76-84.
35. Bosselut, R., F. Lim, P. C. Romond, J. Frampton, J. Brady, and J. Ghysdael. 1992. Myb protein binds to multiple sites in the human T cell lymphotropic virus type 1 long terminal repeat and transactivates LTR-mediated expression. Virology 186:764-769.
36. Bours, V., G. Franzoso, V. Azarenko, S. Park, T. Kanno, K. Brown, and U. Siebenlist. 1993. The oncoprotein Bcl-3 directly transactivates through kappa B motifs via association with DNA-binding p50B homodimers. Cell 72:729-739.
37. Bramblett, D., C. L. Hsu, M. Lozano, K. Earnest, C. Fabritius, and J. Dudley. 1995. A redundant nuclear protein binding site contributes to negative regulation of the mouse mammary tumor virus long terminal repeat. J.Virol. 69:7868-7876.
38. Brandt-Carlson, C. and J. S. Butel. 1991. Detection and characterization of a glycoprotein encoded by the mouse mammary tumor virus long terminal repeat gene. J.Virol. 65:6051-6060.
39. Britos-Bray, M. and A. D. Friedman. 1997. Core binding factor cannot synergistically activate the myeloperoxidase proximal enhancer in immature myeloid cells without c-Myb. Mol.Cell Biol. 17:5127-5135.
184
40. Broussard, D. R., J. A. Mertz, M. Lozano, and J. P. Dudley. 2002. Selection for c-myc integration sites in polyclonal T-cell lymphomas. J.Virol. 76:2087-2099.
41. Brown, A. M., M. W. Linhoff, B. Stein, K. L. Wright, A. S. Baldwin, Jr., P. V. Basta, and J. P. Ting. 1994. Function of NF-kappa B/Rel binding sites in the major histocompatibility complex class II invariant chain promoter is dependent on cell-specific binding of different NF-kappa B/Rel subunits. Mol.Cell Biol. 14:2926-2935.
42. Brown, K., S. Gerstberger, L. Carlson, G. Franzoso, and U. Siebenlist. 1995. Control of I kappa B-alpha proteolysis by site-specific, signal-induced phosphorylation. Science 267:1485-1488.
43. Bruhn, L., A. Munnerlyn, and R. Grosschedl. 1997. ALY, a context-dependent coactivator of LEF-1 and AML-1, is required for TCRalpha enhancer function. Genes Dev. 11 :640-653.
44. Bryant, M. and L. Ratner. 1990. Myristoylation-dependent replication and assembly of human immunodeficiency virus 1. Proc.Natl.Acad.Sci.U.S.A 87:523-527.
45. Buetti, E. 1994. Stably integrated mouse mammary tumor virus long terminal repeat DNA requires the octamer motifs for basal promoter activity. Mol.Cell Biol. 14:1191-1203.
46. Burd, C. G. and G. Dreyfuss. 1994. Conserved structures and diversity of functions of RNA-binding proteins. Science 265:615-621.
47. Burkly, L., C. Hession, L. Ogata, C. Reilly, L. A. Marconi, D. Olson, R. Tizard, R. Cate, and D. Lo. 1995. Expression of relB is required for the development of thymic medulla and dendritic cells. Nature 373:531-536.
48. Burns, C. E., T. DeBlasio, Y. Zhou, J. Zhang, L. Zon, and S. D. Nimer. 2002. Isolation and characterization of runxa and runxb, zebrafish members of the runt family of transcriptional regulators. Exp.Hematol. 30:1381-1389.
49. Bushman, F. D. and M. D. Miller. 1997. Tethering human immunodeficiency virus type 1 preintegration complexes to target DNA promotes integration at nearby sites. J.Virol. 71:458-464.
185
50. Calafat, J., F. Buijs, P. C. Hageman, J. Links, J. Hilgers, and A. Hekman. 1974. Distribution of virus particles and mammary tumor virus antigens in mouse mammary tumors, transformed BALB-c mouse kidney cells, and GR ascites leukemia cells. J.Natl.Cancer Inst. 53:977-992.
51. Calafat, J. and P. Hageman. 1968. Some remarks on the morphology of virus particles of the B type and their isolation from mammary tumors. Virology 36:308-312.
52. Cameron, E. R., J. Morton, C. J. Johnston, J. Irvine, M. Bell, D. E. Onions, J. C. Neil, M. Campbell, and K. Blyth. 2000. Fas-independent apoptosis in T-cell tumours induced by the CD2-myc transgene. Cell Death.Differ. 7:80-88.
53. Campillos, M., J. R. Lamas, M. A. Garcia, M. J. Bullido, F. Valdivieso, and J. Vazquez. 2003. Specific interaction of heterogeneous nuclear ribonucleoprotein A1 with the -219T allelic form modulates APOE promoter activity. Nucleic Acids Res. 31 :3063-3070.
54. Cardiff, R. D., M. J. Puentes, L. J. Young, G. H. Smith, Y. A. Teramoto, B. W. Altrock, and T. S. Pratt. 1978. Serological and biochemical characterization of the mouse mammary tumor virus with localization of p10. Virology 85:157-167.
55. Carey, M. 1998. The enhanceosome and transcriptional synergy. Cell 92:5-8.
56. Chatis, P. A., C. A. Holland, J. W. Hartley, W. P. Rowe, and N. Hopkins . 1983. Role for the 3' end of the genome in determining disease specificity of Friend and Moloney murine leukemia viruses. Proc.Natl.Acad.Sci.U.S.A 80:4408-4411.
57. Chatis, P. A., C. A. Holland, J. E. Silver, T. N. Frederickson, N. Hopkins, and J. W. Hartley. 1984. A 3' end fragment encompassing the transcriptional enhancers of nondefective Friend virus confers erythroleukemogenicity on Moloney leukemia virus. J.Virol. 52:248-254.
58. Chen, B. K., M. B. Feinberg, and D. Baltimore . 1997. The kappaB sites in the human immunodeficiency virus type 1 long terminal repeat enhance virus replication yet are not absolutely required for viral growth. J.Virol. 71:5495-5504.
186
59. Chen, H., M. Hewison, B. Hu, and J. S. Adams . 2003. Heterogeneous nuclear ribonucleoprotein (hnRNP) binding to hormone response elements: a cause of vitamin D resistance. Proc.Natl.Acad.Sci.U.S.A 100:6109-6114.
60. Chen, H., B. Hu, E. A. Allegretto, and J. S. Adams . 2000. The vitamin D response element-binding protein. A novel dominant-negative regulator of vitamin D-directed transactivation. J.Biol.Chem. 275:35557-35564.
61. Chiao, P. J., S. Miyamoto, and I. M. Verma. 1994. Autoregulation of I kappa B alpha activity. Proc.Natl.Acad.Sci.U.S.A 91:28-32.
62. Choi, Y., J. W. Kappler, and P. Marrack. 1991. A superantigen encoded in the open reading frame of the 3' long terminal repeat of mouse mammary tumour virus. Nature 350:203-207.
63. Choi, Y., P. Marrack, and J. W. Kappler. 1992. Structural analysis of a mouse mammary tumor virus superantigen. J.Exp.Med. 175:847-852.
64. Choi, Y. W., D. Henrard, I. Lee, and S. R. Ross. 1987. The mouse mammary tumor virus long terminal repeat directs expression in epithelial and lymphoid cells of different tissues in transgenic mice. J.Virol. 61:3013-3019.
65. Churchill, M. J., R. G. Ramsay, D. I. Rhodes, and N. J. Deacon. 2001. c-Myb influences HIV type 1 gene expression and virus production. AIDS Res.Hum.Retroviruses 17 :1481-1488.
66. Clausse, N., D. Baines, R. Moore, S. Brookes, C. Dickson, and G. Peters . 1993. Activation of both Wnt-1 and Fgf-3 by insertion of mouse mammary tumor virus downstream in the reverse orientation: a reappraisal of the enhancer insertion model. Virology 194:157-165.
67. Coffin, J. M. 1984. Endogenous Viruses, p. 1162-1173. In R. Weiss, N. Teich, H. Varmus, and J. M. Coffin (ed.), RNA Tumor Viruses. Raven Press, New York.
68. Coffin, J. M., P. N. Tsichlis, C. S. Barker, S. Voynow, and H. L. Robinson. 1980. Variation in avian retrovirus genomes. Ann.N.Y.Acad.Sci. 354:410-425.
69. Coffman, J. A., C. V. Kirchhamer, M. G. Harrington, and E. H. Davidson. 1996. SpRunt-1, a new member of the runt domain family of
187
transcription factors, is a positive regulator of the aboral ectoderm-specific CyIIIA gene in sea urchin embryos. Dev.Biol. 174:43-54.
70. Cohen, J. C. and H. E. Varmus . 1979. Endogenous mammary tumour virus DNA varies among wild mice and segregates during inbreeding. Nature 278:418-423.
71. Colgin, M. A. and J. K. Nyborg . 1998. The human T-cell leukemia virus type 1 oncoprotein Tax inhibits the transcriptional activity of c-Myb through competition for the CREB binding protein. J.Virol. 72:9396-9399.
72. Coope, H. J., P. G. Atkinson, B. Huhse, M. Belich, J. Janzen, M. J. Holman, G. G. Klaus, L. H. Johnston, and S. C. Ley. 2002. CD40 regulates the processing of NF-kappaB2 p100 to p52. EMBO J. 21:5375-5385.
73. Corcoran, L. M., J. M. Adams, A. R. Dunn, and S. Cory. 1984. Murine T lymphomas in which the cellular myc oncogene has been activated by retroviral insertion. Cell 37:113-122.
74. Corneliussen, B., A. Thornell, B. Hallberg, and T. Grundstrom. 1991. Helix- loop-helix transcriptional activators bind to a sequence in glucocorticoid response elements of retrovirus enhancers. J.Virol. 65:6084-6093.
75. Craven, R. C., A. E. Leure-duPree, R. A. Weldon, Jr., and J. W. Wills. 1995. Genetic analysis of the major homology region of the Rous sarcoma virus Gag protein. J.Virol. 69:4213-4227.
76. Daga, A., C. A. Karlovich, K. Dumstrei, and U. Banerjee. 1996. Patterning of cells in the Drosophila eye by Lozenge, which shares homologous domains with AML1. Genes Dev. 10:1194-1205.
77. Dalton, A. J. 1966. An electron microscopic study of a virus- induced murine sarcoma (Moloney). Natl.Cancer Inst.Monogr 22:143-168.
78. Damen, W. G., M. Weller, and D. Tautz. 2000. Expression patterns of hairy, even-skipped, and runt in the spider Cupiennius salei imply that these genes were segmentation genes in a basal arthropod. Proc.Natl.Acad.Sci.U.S.A 97:4515-4519.
79. Dasgupta, P., C. D. Reddy, P. Saikumar, and E. P. Reddy. 1992. The cellular proto-oncogene product Myb acts as transcriptional activator of
188
the long terminal repeat of human T- lymphotropic virus type I. J.Virol. 66:270-276.
80. Dasgupta, P., P. Saikumar, C. D. Reddy, and E. P. Reddy. 1990. Myb protein binds to human immunodeficiency virus 1 long terminal repeat (LTR) sequences and transactivates LTR-mediated transcription. Proc.Natl.Acad.Sci.U.S.A 87:8090-8094.
81. Davis, N., S. Ghosh, D. L. Simmons, P. Tempst, H. C. Liou, D. Baltimore, and H. R. Bose, Jr. 1991. Rel-associated pp40: an inhibitor of the rel family of transcription factors. Science 253:1268-1271.
82. de Parseval, N., H. Alkabbani, and T. Heidmann. 1999. The long terminal repeats of the HERV-H human endogenous retrovirus contain binding sites for transcriptional regulation by the Myb protein. J.Gen.Virol. 80 ( Pt 4):841-845.
83. Dekaban, G. A. and J. K. Ball. 1984. Integration of type B retroviral DNA in virus- induced primary murine thymic lymphomas. J.Virol. 52:784-792.
84. Deroo, B. J. and T. K. Archer. 2001. Glucocorticoid receptor-mediated chromatin remodeling in vivo. Oncogene 20:3039-3046.
85. DesGroseillers, L. and P. Jolicoeur. 1984. The tandem direct repeats within the long terminal repeat of murine leukemia viruses are the primary determinant of their leukemogenic potential. J.Virol. 52:945-952.
86. DesGroseillers, L., E. Rassart, and P. Jolicoeur. 1983. Thymotropism of murine leukemia virus is conferred by its long terminal repeat. Proc.Natl.Acad.Sci.U.S.A 80:4203-4207.
87. Dickinson, L. A., T. Joh, Y. Kohwi, and T. Kohwi-Shigematsu. 1992. A tissue-specific MAR/SAR DNA-binding protein with unusual binding site recognition. Cell 70:631-645.
88. Dickson, C. and M. Atterwill. 1979. Composition, arrangement and cleavage of the mouse mammary tumor virus polyprotein precursor Pr77gag and p110gag. Cell 17:1003-1012.
89. Dickson, C. and G. Peters . 1983. Proteins encoded by mouse mammary tumour virus. Curr.Top.Microbiol.Immunol. 106:1-34.
189
90. Dickson, C. and J. J. Skehel. 1974. The polypeptide composition of mouse mammary tumor virus. Virology 58:387-395.
91. Dickson, C., R. Smith, S. Brookes, and G. Peters . 1984. Tumorigenesis by mouse mammary tumor virus: proviral activation of a cellular gene in the common integration region int-2. Cell 37:529-536.
92. Dievart, A., N. Beaulieu, and P. Jolicoeur. 1999. Involvement of Notch1 in the development of mouse mammary tumors. Oncogene 18:5973-5981.
93. Doi, T. S., T. Takahashi, O. Taguchi, T. Azuma, and Y. Obata. 1997. NF-kappa B RelA-deficient lymphocytes: normal development of T cells and B cells, impaired production of IgA and IgG1 and reduced proliferative responses. J.Exp.Med. 185:953-961.
94. Donehower, L. A., A. L. Huang, and G. L. Hager. 1981. Regulatory and coding potential of the mouse mammary tumor virus long terminal redundancy. J.Virol. 37:226-238.
95. Dougherty, J. P. and H. M. Temin. 1988. Determination of the rate of base-pair substitution and insertion mutations in retrovirus replication. J.Virol. 62:2817-2822.
96. Drissi, H., Q. Luc, R. Shakoori, L. S. Chuva De Sousa, J. Y. Choi, A. Terry, M. Hu, S. Jones, J. C. Neil, J. B. Lian, J. L. Stein, A. J. van Wijnen, and G. S. Stein. 2000. Transcriptional autoregulation of the bone related CBFA1/RUNX2 gene. J.Cell Physiol 184:341-350.
97. Dudek, H. and E. P. Reddy. 1989. Identification of two translational products for c-myb. Oncogene 4:1061-1066.
98. Dudley, J. and R. Risser. 1984. Amplification and novel locations of endogenous mouse mammary tumor virus genomes in mouse T-cell lymphomas. J.Virol. 49:92-101.
99. Dudley, J. P. 1999. Mouse mammary tumor virus, p. 965-972. In R. G. Webster and A. Granoff (ed.), Encyclopedia of Virology. Academic Press, Ltd., London.
100. Dudley, J. P., J. A. Mertz, L. Rajan, M. Lozano, and D. R. Broussard. 2002. What retroviruses teach us about the involvement of c-Myc in leukemias and lymphomas. Leukemia 16:1086-1098.
190
101. Duh, E. J., W. J. Maury, T. M. Folks, A. S. Fauci, and A. B. Rabson. 1989. Tumor necrosis factor alpha activates human immunodeficiency virus type 1 through induction of nuclear factor binding to the NF-kappa B sites in the long terminal repeat. Proc.Natl.Acad.Sci.U.S.A 86:5974-5978.
102. Durgam, V. R. and R. R. Tekmal. 1994. The nature and expression of int-5, a novel MMTV integration locus gene in carcinogen- induced mammary tumors. Cancer Lett. 87:179-186.
103. Dushay, M. S., B. Asling, and D. Hultmark. 1996. Origins of immunity: Relish, a compound Rel- like gene in the antibacterial defense of Drosophila. Proc.Natl.Acad.Sci.U.S.A 93:10343-10347.
104. Eick, D., A. Polack, E. Kofler, G. M. Lenoir, A. B. Rickinson, and G. W. Bornkamm. 1990. Expression of P0- and P3-RNA from the normal and translocated c-myc allele in Burkitt's lymphoma cells. Oncogene 5:1397-1402.
105. Elliott, J. F., B. Pohajdak, D. J. Talbot, J. Shaw, and V. Paetkau. 1988. Phorbol diester- inducible, cyclosporine-suppressible transcription from a novel promoter within the mouse mammary tumor virus env gene. J.Virol. 62:1373-1380.
106. Ellwood, K. B., Y. M. Yen, R. C. Johnson, and M. Carey. 2000. Mechanism for specificity by HMG-1 in enhanceosome assembly. Mol.Cell Biol. 20:4359-4370.
107. Ernst, M., C. Schmid, and E. R. Froesch. 1989. Phenol red mimics biological actions of estradiol: enhancement of osteoblast proliferation in vitro and of type I collagen gene expression in bone and uterus of rats in vivo. J.Steroid Biochem. 33 :907-914.
108. Evans, J. L., T. L. Moore, W. M. Kuehl, T. Bender, and J. P. Ting. 1990. Functional analysis of c-Myb protein in T- lymphocytic cell lines shows that it trans-activates the c-myc promoter. Mol.Cell Biol. 10:5747-5752.
109. Fan, H., M. Palmarini, and J. C. DeMartini. 2003. Transformation and oncogenesis by jaagsiekte sheep retrovirus. Curr.Top.Microbiol.Immunol. 275:139-177.
191
110. Fanidi, A., E. A. Harrington, and G. I. Evan. 1992. Cooperative interaction between c-myc and bcl-2 proto-oncogenes. Nature 359:554-556.
111. Felsher, D. W. and J. M. Bishop. 1999. Reversible tumorigenesis by MYC in hematopoietic lineages. Mol.Cell 4:199-207.
112. Fletcher, T. M., B. W. Ryu, C. T. Baumann, B. S. Warren, G. Fragoso, S. John, and G. L. Hager. 2000. Structure and dynamic properties of a glucocorticoid receptor- induced chromatin transition. Mol.Cell Biol. 20:6466-6475.
113. Fouret, P., R. M. du Bois, J. F. Bernaudin, H. Takahashi, V. J. Ferrans, and R. G. Crystal. 1989. Expression of the neutrophil elastase gene during human bone marrow cell differentiation. J.Exp.Med. 169:833-845.
114. Franzoso, G., V. Bours, V. Azarenko, S. Park, M. Tomita-Yamaguchi, T. Kanno, K. Brown, and U. Siebenlist. 1993. The oncoprotein Bcl-3 can facilitate NF-kappa B-mediated transactivation by removing inhibiting p50 homodimers from select kappa B sites. EMBO J. 12:3893-3901.
115. Franzoso, G., V. Bours, S. Park, M. Tomita-Yamaguchi, K. Kelly, and U. Siebenlist. 1992. The candidate oncoprotein Bcl-3 is an antagonist of p50/NF-kappa B-mediated inhibition. Nature 359:339-342.
116. Fromm, M. and P. Berg. 1982. Deletion mapping of DNA regions required for SV40 early region promoter function in vivo. J.Mol.Appl.Genet. 1:457-481.
117. Fryer, C. J. and T. K. Archer . 1998. Chromatin remodelling by the glucocorticoid receptor requires the BRG1 complex. Nature 393:88-91.
118. Furuichi, Y., A. J. Shatkin, E. Stavnezer, and J. M. Bishop. 1975. Blocked, methylated 5'-terminal sequence in avian sarcoma virus RNA. Nature 257:618-620.
119. Gallahan, D., C. Kozak, and R. Callahan. 1987. A new common integration region (int-3) for mouse mammary tumor virus on mouse chromosome 17. J.Virol. 61:218-220.
120. Garcia, M., R. Wellinger, A. Vessaz, and H. Diggelmann. 1986. A new site of integration for mouse mammary tumor virus proviral DNA
192
common to BALB/cf(C3H) mammary and kidney adenocarcinomas. EMBO J. 5:127-134.
121. Gewirtz, A. M., G. Anfossi, D. Venturelli, S. Valpreda, R. Sims, and B. Calabretta. 1989. G1/S transition in normal human T- lymphocytes requires the nuclear protein encoded by c-myb. Science 245:180-183.
122. Gewirtz, A. M. and B. Calabretta. 1988. A c-myb antisense oligodeoxynucleotide inhibits normal human hematopoiesis in vitro. Science 242:1303-1306.
123. Ghosh, S., M. J. May, and E. B. Kopp. 1998. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu.Rev.Immunol. 16:225-260.
124. Ghozi, M. C., Y. Bernstein, V. Negreanu, D. Levanon, and Y. Groner. 1996. Expression of the human acute myeloid leukemia gene AML1 is regulated by two promoter regions. Proc.Natl.Acad.Sci.U.S.A 93:1935-1940.
125. Gilmore, T. D. 1999. Multiple mutations contribute to the oncogenicity of the retroviral oncoprotein v-Rel. Oncogene 18:6925-6937.
126. Girard, L., Z. Hanna, N. Beaulieu, C. D. Hoemann, C. Simard, C. A. Kozak, and P. Jolicoeur. 1996. Frequent provirus insertional mutagenesis of Notch1 in thymomas of MMTVD/myc transgenic mice suggests a collaboration of c-myc and Notch1 for oncogenesis. Genes Dev. 10:1930-1944.
127. Goetz, T. L., T. L. Gu, N. A. Speck, and B. J. Graves. 2000. Auto-inhibition of Ets-1 is counteracted by DNA binding cooperativity with core-binding factor alpha2. Mol.Cell Biol. 20:81-90.
128. Goff, S. P. 1990. Retroviral reverse transcriptase: synthesis, structure, and function. J.Acquir.Immune.Defic.Syndr. 3:817-831.
129. Golay, J., V. Facchinetti, G. Ying, and M. Introna. 1997. The A-myb transcription factor in neoplastic and normal B cells. Leuk.Lymphoma 26:271-279.
130. Golemis, E., Y. Li, T. N. Fredrickson, J. W. Hartley, and N. Hopkins . 1989. Distinct segments within the enhancer region collaborate to specify
193
the type of leukemia induced by nondefective Friend and Moloney viruses. J.Virol. 63:328-337.
131. Golemis, E. A., N. A. Speck, and N. Hopkins . 1990. Alignment of U3 region sequences of mammalian type C viruses: identification of highly conserved motifs and implications for enhancer design. J.Virol. 64:534-542.
132. Golovkina, T. V., A. Chervonsky, J. P. Dudley, and S. R. Ross. 1992. Transgenic mouse mammary tumor virus superantigen expression prevents viral infection. Cell 69 :637-645.
133. Golovkina, T. V., J. P. Dudley, A. B. Jaffe, and S. R. Ross. 1995. Mouse mammary tumor viruses with functional superantigen genes are selected during in vivo infection. Proc.Natl.Acad.Sci.U.S.A 92:4828-4832.
134. Golovkina, T. V., J. P. Dudley, and S. R. Ross. 1998. B and T cells are required for mouse mammary tumor virus spread within the mammary gland. J.Immunol. 161:2375-2382.
135. Golovkina, T. V., J. Dzuris, H. B. van den, A. B. Jaffe, P. C. Wright, S. M. Cofer, and S. R. Ross. 1998. A novel membrane protein is a mouse mammary tumor virus receptor. J.Virol. 72:3066-3071.
136. Golovkina, T. V., M. Shlomchik, L. Hannum, and A. Chervonsky. 1999. Organogenic role of B lymphocytes in mucosal immunity. Science 286:1965-1968.
137. Gonda, T. J. and D. Metcalf. 1984. Expression of myb, myc and fos proto-oncogenes during the differentiation of a murine myeloid leukaemia. Nature 310:249-251.
138. Gorer PA. 1950. Studies in antibody response of mice to tumour inoculation. Br.J.Cancer 4:372-379.
139. Grilli, M., J. J. Chiu, and M. J. Lenardo. 1993. NF-kappa B and Rel: participants in a multiform transcriptional regulatory system. Int.Rev.Cytol. 143:1-62.
140. Grimes, H. L., C. B. Gilks, T. O. Chan, S. Porter, and P. N. Tsichlis. 1996. The Gfi-1 protooncoprotein represses Bax expression and inhibits T-cell death. Proc.Natl.Acad.Sci.U.S.A 93:14569-14573.
194
141. Gu, T. L., T. L. Goetz, B. J. Graves, and N. A. Speck. 2000. Auto-inhibition and partner proteins, core-binding factor beta (CBFbeta) and Ets-1, modulate DNA binding by CBFalpha2 (AML1). Mol.Cell Biol. 20:91-103.
142. Guerra, J., D. A. Withers, and L. M. Boxer. 1995. Myb binding sites mediate negative regulation of c-myb expression in T-cell lines. Blood 86:1873-1880.
143. Gunzburg, W. H., F. Heinemann, S. Wintersperger, T. Miethke, H. Wagner, V. Erfle, and B. Salmons . 1993. Endogenous superantigen expression controlled by a novel promoter in the MMTV long terminal repeat. Nature 364:154-158.
144. Hallberg, B., J. Schmidt, A. Luz, F. S. Pedersen, and T. Grundstrom. 1991. SL3-3 enhancer factor 1 transcriptional activators are required for tumor formation by SL3-3 murine leukemia virus. J.Virol. 65:4177-4181.
145. Hansen, S. K., P. A. Baeuerle, and F. Blasi. 1994. Purification, reconstitution, and I kappa B association of the c-Rel-p65 (RelA) complex, a strong activator of transcription. Mol.Cell Biol. 14:2593-2603.
146. Hansen, S. K., L. Guerrini, and F. Blasi. 1994. Differential DNA sequence specificity and regulation of HIV-1 enhancer activity by cRel-RelA transcription factor. J.Biol.Chem. 269:22230-22237.
147. Haraguchi, S., R. A. Good, R. W. Engelman, S. Greene, and N. K. Day. 1997. Prolactin, epidermal growth factor or transforming growth factor-alpha activate a mammary cell-specific enhancer in mouse mammary tumor virus-long terminal repeat. Mol.Cell Endocrinol. 129:145-155.
148. Haskill, S., A. A. Beg, S. M. Tompkins, J. S. Morris, A. D. Yurochko, A. Sampson-Johannes, K. Mondal, P. Ralph, and A. S. Baldwin, Jr. 1991. Characterization of an immediate-early gene induced in adherent monocytes that encodes I kappa B-like activity. Cell 65:1281-1289.
149. Hatfield, D. and S. Oroszlan. 1990. The where, what and how of ribosomal frameshifting in retroviral protein synthesis. Trends Biochem.Sci. 15:186-190.
150. Hebbar, P. B. and T. K. Archer. 2003. Nuclear factor 1 is required for both hormone-dependent chromatin remodeling and transcriptional
195
activation of the mouse mammary tumor virus promoter. Mol.Cell Biol. 23:887-898.
151. Henderson, L. E., H. C. Krutzsch, and S. Oroszlan. 1983. Myristyl amino-terminal acylation of murine retrovirus proteins: an unusual post-translational proteins modification. Proc.Natl.Acad.Sci.U.S.A 80:339-343.
152. Henrard, D. and S. R. Ross. 1988. Endogenous mouse mammary tumor virus is expressed in several organs in addition to the lactating mammary gland. J.Virol. 62:3046-3049.
153. Herman, A., J. W. Kappler, P. Marrack, and A. M. Pullen. 1991. Superantigens: mechanism of T-cell stimulation and role in immune responses. Annu.Rev.Immunol. 9:745-772.
154. Hernandez-Munain, C. and M. S. Krangel. 1994. Regulation of the T-cell receptor delta enhancer by functional cooperation between c-Myb and core-binding factors. Mol.Cell Biol. 14:473-483.
155. Hernandez-Munain, C. and M. S. Krangel. 1995. c-Myb and core-binding factor/PEBP2 display functional synergy but bind independently to adjacent sites in the T-cell receptor delta enhancer. Mol.Cell Biol. 15:3090-3099.
156. Hernandez-Munain, C. and M. S. Krangel. 2002. Distinct roles for c-Myb and core binding factor/polyoma enhancer-binding protein 2 in the assembly and function of a multiprotein complex on the TCR delta enhancer in vivo. J.Immunol. 169:4362-4369.
157. Heusch, M., L. Lin, R. Geleziunas, and W. C. Greene . 1999. The generation of nfkb2 p52: mechanism and efficiency. Oncogene 18:6201-6208.
158. Higuchi, R. 1990. Recombinant PCR, p. 177-183. In M. A. Innis, D.H.Gelfand, J.J.Sninsky, and T.J.White (ed.), PCR Protocols, a guide to methods and applications. Academic Press, Inc., San Diego, CA.
159. Hizi, A., L. E. Henderson, T. D. Copeland, R. C. Sowder, C. V. Hixson, and S. Oroszlan. 1987. Characterization of mouse mammary tumor virus gag-pro gene products and the ribosomal frameshift site by protein sequencing. Proc.Natl.Acad.Sci.U.S.A 84:7041-7045.
196
160. Hizi, A., L. E. Henderson, T. D. Copeland, R. C. Sowder, H. C. Krutzsch, and S. Oroszlan. 1989. Analysis of gag proteins from mouse mammary tumor virus. J.Virol. 63:2543-2549.
161. Horwitz, B. H., M. L. Scott, S. R. Cherry, R. T. Bronson, and D. Baltimore . 1997. Failure of lymphopoiesis after adoptive transfer of NF-kappaB-deficient fetal liver cells. Immunity. 6:765-772.
162. Howe, K. M., C. F. Reakes, and R. J. Watson. 1990. Characterization of the sequence-specific interaction of mouse c-myb protein with DNA. EMBO J. 9:161-169.
163. Hsu, C. L., C. Fabritius, and J. Dudley. 1988. Mouse mammary tumor virus proviruses in T-cell lymphomas lack a negative regulatory element in the long terminal repeat. J.Virol. 62:4644-4652.
164. Hutchison, K. A., L. C. Scherrer, M. J. Czar, L. F. Stancato, Y. H. Chow, R. Jove, and W. B. Pratt. 1993. Regulation of glucocorticoid receptor function through assembly of a receptor-heat shock protein complex. Ann.N.Y.Acad.Sci. 684:35-48.
165. Hynes, N., A. J. van Ooyen, N. Kennedy, P. Herrlich, H. Ponta, and B. Groner. 1983. Subfragments of the large terminal repeat cause glucocorticoid-responsive expression of mouse mammary tumor virus and of an adjacent gene. Proc.Natl.Acad.Sci.U.S.A 80:3637-3641.
166. Imai, S., J. Morimoto, Y. Tsubura, Y. Iwai, M. Okumoto, Y. Takamori, A. Tsubura, and J. Hilgers . 1983. Tissue and organ distribution of mammary tumor virus antigens in low and high mammary cancer strain mice. Eur.J.Cancer Clin.Oncol. 19:1011-1019.
167. Imai, S., M. Okumoto, M. Iwai, S. Haga, N. Mori, N. Miyashita, K. Moriwaki, J. Hilgers, and N. H. Sarkar. 1994. Distribution of mouse mammary tumor virus in Asian wild mice. J.Virol. 68:3437-3442.
168. Inoue, J., L. D. Kerr, A. Kakizuka, and I. M. Verma. 1992. I kappa B gamma, a 70 kd protein identical to the C-terminal half of p110 NF-kappa B: a new member of the I kappa B family. Cell 68:1109-1120.
169. Ip, Y. T., M. Reach, Y. Engstrom, L. Kadalayil, H. Cai, S. Gonzalez-Crespo, K. Tatei, and M. Levine . 1993. Dif, a dorsal-related gene that mediates an immune response in Drosophila. Cell 75:753-763.
197
170. Ishimoto, A., M. Takimoto, A. Adachi, M. Kakuyama, S. Kato, K. Kakimi, K. Fukuoka, T. Ogiu, and M. Matsuyama. 1987. Sequences responsible for erythroid and lymphoid leukemia in the long terminal repeats of Friend-mink cell focus-forming and Moloney murine leukemia viruses. J.Virol. 61:1861-1866.
171. Jacks, T., K. Townsley, H. E. Varmus, and J. Majors . 1987. Two efficient ribosomal frameshifting events are required for synthesis of mouse mammary tumor virus gag-related polyproteins. Proc.Natl.Acad.Sci.U.S.A 84:4298-4302.
172. Jackson, B. and C. C. Little. 1933. The Existence of Non-Chromosomal Influence in the Incidence of Mammary Tumors in Mice. Science 78:465-466.
173. Jaffray, E., K. M. Wood, and R. T. Hay. 1995. Domain organization of I kappa B alpha and sites of interaction with NF-kappa B p65. Mol.Cell Biol. 15:2166-2172.
174. Jensen, E. V., T. Suzuki, T. Kawashima, W. E. Stumpf, P. W. Jungblut, and E. R. DeSombre . 1968. A two-step mechanism for the interaction of estradiol with rat uterus. Proc.Natl.Acad.Sci.U.S.A 59:632-638.
175. Jones, K. A., J. T. Kadonaga, P. A. Luciw, and R. Tjian. 1986. Activation of the AIDS retrovirus promoter by the cellular transcription factor, Sp1. Science 232:755-759.
176. Jouvin-Marche, E., P. N. Marche, and P. A. Cazenave. 1992. Clonal deletion of V beta 17 T cells in mice from natural populations. Semin.Immunol. 4:305-312.
177. Jouvin-Marche, E., P. N. Marche, A. Six, C. Liebe-Gris, D. Voegtle, and P. A. Cazenave. 1993. Identification of an endogenous mammary tumor virus involved in the clonal deletion of V beta 2 T cells. Eur.J.Immunol. 23:2758-2764.
178. Kagoshima, H., K. Shigesada, M. Satake, Y. Ito, H. Miyoshi, M. Ohki, M. Pepling, and P. Gergen. 1993. The Runt domain identifies a new family of heteromeric transcriptional regulators. Trends Genet. 9:338-341.
198
179. Kaltschmidt, C., B. Kaltschmidt, H. Neumann, H. Wekerle, and P. A. Baeuerle. 1994. Constitutive NF-kappa B activity in neurons. Mol.Cell Biol. 14:3981-3992.
180. Kang, J. J., T. Schwegel, and J. E. Knepper. 1993. Sequence similarity between the long terminal repeat coding regions of mammary-tumorigenic BALB/cV and renal-tumorigenic C3H-K strains of mouse mammary tumor virus. Virology 196:303-308.
181. Kang, S. M., A. C. Tran, M. Grilli, and M. J. Lenardo. 1992. NF-kappa B subunit regulation in nontransformed CD4+ T lymphocytes. Science 256:1452-1456.
182. Kapoun, A. M. and G. M. Shackleford. 1997. Preferential activation of Fgf8 by proviral insertion in mammary tumors of Wnt1 transgenic mice. Oncogene 14:2985-2989.
183. Karin, M. and Y. Ben Neriah. 2000. Phosphorylation meets ubiquitination: the control of NF-[kappa]B activity. Annu.Rev.Immunol. 18:621-663.
184. Keith, J. and H. Fraenkel-Conrat. 1975. Identification of the 5' end of Rous sarcoma virus RNA. Proc.Natl.Acad.Sci.U.S.A 72:3347-3350.
185. Kim, K. J., C. Kanellopoulos-Langevin, R. M. Merwin, D. H. Sachs, and R. Asofsky. 1979. Establishment and characterization of BALB/c lymphoma lines with B cell properties. J.Immunol. 122:549-554.
186. Kinoshita, S., L. Su, M. Amano, L. A. Timmerman, H. Kaneshima, and G. P. Nolan. 1997. The T cell activation factor NF-ATc positively regulates HIV-1 replication and gene expression in T cells. Immunity. 6:235-244.
187. Klement, J. F., N. R. Rice, B. D. Car, S. J. Abbondanzo, G. D. Powers, P. H. Bhatt, C. H. Chen, C. A. Rosen, and C. L. Stewart. 1996. IkappaBalpha deficiency results in a sustained NF-kappaB response and severe widespread dermatitis in mice. Mol.Cell Biol. 16:2341-2349.
188. Klement, V., W. P. Rowe, J. W. Hartley, and W. E. Pugh. 1969. Mixed culture cytopathogenicity: a new test for growth of murine leukemia viruses in tissue culture. Proc.Natl.Acad.Sci.U.S.A 63:753-758.
199
189. Klemenz, R., M. Reinhardt, and H. Diggelmann. 1981. Sequence determination of the 3' end of mouse mammary tumor virus RNA. Mol.Biol.Rep. 7:123-126.
190. Kontgen, F., R. J. Grumont, A. Strasser, D. Metcalf, R. Li, D. Tarlinton, and S. Gerondakis. 1995. Mice lacking the c-rel proto-oncogene exhibit defects in lymphocyte proliferation, humoral immunity, and interleukin-2 expression. Genes Dev. 9:1965-1977.
191. Koppe, B., L. Menendez-Arias, and S. Oroszlan. 1994. Expression and purification of the mouse mammary tumor virus gag-pro transframe protein p30 and characterization of its dUTPase activity. J.Virol. 68:2313-2319.
192. Kozak, C., G. Peters, R. Pauley, V. Morris, R. Michalides, J. Dudley, M. Green, M. Davisson, O. Prakash, A. Vaidya, and . 1987. A standardized nomenclature for endogenous mouse mammary tumor viruses. J.Virol. 61:1651-1654.
193. Kuff, E. L. and K. K. Lueders . 1988. The intracisternal A-particle gene family: structure and functional aspects. Adv.Cancer Res. 51:183-276.
194. Kung, H. J., C. Boerkoel, and T. H. Carter. 1991. Retroviral mutagenesis of cellular oncogenes: a review with insights into the mechanisms of insertional activation. Curr.Top.Microbiol.Immunol. 171:1-25.
195. Kunsch, C. and C. A. Rosen. 1993. NF-kappa B subunit-specific regulation of the interleukin-8 promoter. Mol.Cell Biol. 13:6137-6146.
196. Kunsch, C., S. M. Ruben, and C. A. Rosen. 1992. Selection of optimal kappa B/Rel DNA-binding motifs: interaction of both subunits of NF-kappa B with DNA is required for transcriptional activation. Mol.Cell Biol. 12:4412-4421.
197. Kwon, B. S. and S. M. Weissman. 1984. Mouse mammary tumor virus-related sequences in mouse lymphocytes are inducible by 12-O-tetradecanoyl phorbol-13-acetate. J.Virol. 52:1000-1004.
198. Kwon, H., N. Pelletier, C. DeLuca, P. Genin, S. Cisternas, R. Lin, M. A. Wainberg, and J. Hiscott. 1998. Inducible expression of IkappaBalpha repressor mutants interferes with NF-kappaB activity and HIV-1 replication in Jurkat T cells. J.Biol.Chem. 273:7431-7440.
200
199. LaBranche, H., S. Dupuis, Y. Ben David, M. R. Bani, R. J. Wellinger, and B. Chabot. 1998. Telomere elongation by hnRNP A1 and a derivative that interacts with telomeric repeats and telomerase. Nat.Genet. 19:199-202.
200. Lai, M. M. and P. H. Duesberg . 1972. Adenylic acid-rich sequence in RNAs of Rous sarcoma virus and Rauscher mouse leukaemia virus. Nature 235:383-386.
201. Laimins, L. A., G. Khoury, C. Gorman, B. Howard, and P. Gruss. 1982. Host-specific activation of transcription by tandem repeats from simian virus 40 and Moloney murine sarcoma virus. Proc.Natl.Acad.Sci.U.S.A 79:6453-6457.
202. Lau, J. S., P. Baumeister, E. Kim, B. Roy, T. Y. Hsieh, M. Lai, and A. S. Lee. 2000. Heterogeneous nuclear ribonucleoproteins as regulators of gene expression through interactions with the human thymidine kinase promoter. J.Cell Biochem. 79:395-406.
203. Lavenu, A., S. Pournin, C. Babinet, and D. Morello. 1994. The cis-acting elements known to regulate c-myc expression ex vivo are not sufficient for correct transcription in vivo. Oncogene 9:527-536.
204. Lazo, P. A., J. S. Lee, and P. N. Tsichlis. 1990. Long-distance activation of the Myc protooncogene by provirus insertion in Mlvi-1 or Mlvi-4 in rat T-cell lymphomas. Proc.Natl.Acad.Sci.U.S.A 87:170-173.
205. Le Hir, H., E. Izaurralde, L. E. Maquat, and M. J. Moore . 2000. The spliceosome deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions. EMBO J. 19:6860-6869.
206. Le Hir, H., M. J. Moore, and L. E. Maquat. 2000. Pre-mRNA splicing alters mRNP composition: evidence for stable association of proteins at exon-exon junctions. Genes Dev. 14:1098-1108.
207. Lee, F. S., T. F. Lane, A. Kuo, G. M. Shackleford, and P. Leder. 1995. Insertional mutagenesis identifies a member of the Wnt gene family as a candidate oncogene in the mammary epithelium of int-2/Fgf-3 transgenic mice. Proc.Natl.Acad.Sci.U.S.A 92:2268-2272.
208. Lee, H. L. and T. K. Archer. 1994. Nucleosome-mediated disruption of transcription factor-chromatin initiation complexes at the mouse
201
mammary tumor virus long terminal repeat in vivo. Mol.Cell Biol. 14:32-41.
209. Lee, M. S. and R. Craigie. 1994. Protection of retroviral DNA from autointegration: involvement of a cellular factor. Proc.Natl.Acad.Sci.U.S.A 91:9823-9827.
210. Lee, W. T., O. Prakash, D. Klein, and N. H. Sarkar. 1987. Structural alterations in the long terminal repeat of an acquired mouse mammary tumor virus provirus in a T-cell leukemia of DBA/2 mice. Virology 159:39-48.
211. Lefebvre, P., D. S. Berard, M. G. Cordingley, and G. L. Hager. 1991. Two regions of the mouse mammary tumor virus long terminal repeat regulate the activity of its promoter in mammary cell lines. Mol.Cell Biol. 11:2529-2537.
212. Lei, E. P., H. Krebber, and P. A. Silver. 2001. Messenger RNAs are recruited for nuclear export during transcription. Genes Dev. 15:1771-1782.
213. Lenz, J., D. Celander, R. L. Crowther, R. Patarca, D. W. Perkins, and W. A. Haseltine . 1984. Determination of the leukaemogenicity of a murine retrovirus by sequences within the long terminal repeat. Nature 308:467-470.
214. Levanon, D., G. Glusman, T. Bangsow, E. Ben Asher, D. A. Male, N. Avidan, C. Bangsow, M. Hattori, T. D. Taylor, S. Taudien, K. Blechschmidt, N. Shimizu, A. Rosenthal, Y. Sakaki, D. Lancet, and Y. Groner. 2001. Architecture and anatomy of the genomic locus encoding the human leukemia-associated transcription factor RUNX1/AML1. Gene 262:23-33.
215. Levanon, D., R. E. Goldstein, Y. Bernstein, H. Tang, D. Goldenberg, S. Stifani, Z. Paroush, and Y. Groner. 1998. Transcriptional repression by AML1 and LEF-1 is mediated by the TLE/Groucho corepressors. Proc.Natl.Acad.Sci.U.S.A 95:11590-11595.
216. Lewis, A. F., T. Stacy, W. R. Green, L. Taddesse-Heath, J. W. Hartley, and N. A. Speck. 1999. Core-binding factor influences the disease specificity of Moloney murine leukemia virus. J.Virol. 73:5535-5547.
202
217. Li, Y., E. Golemis, J. W. Hartley, and N. Hopkins . 1987. Disease specificity of nondefective Friend and Moloney murine leukemia viruses is controlled by a small number of nucleotides. J.Virol. 61:693-700.
218. Li, Y., C. A. Holland, J. W. Hartley, and N. Hopkins . 1984. Viral integration near c-myc in 10-20% of mcf 247- induced AKR lymphomas. Proc.Natl.Acad.Sci.U.S.A 81:6808-6811.
219. Lin, L., G. N. DeMartino, and W. C. Greene . 1998. Cotranslational biogenesis of NF-kappaB p50 by the 26S proteasome. Cell 92:819-828.
220. Lin, L., G. N. DeMartino, and W. C. Greene . 2000. Cotranslational dimerization of the Rel homology domain of NF-kappaB1 generates p50-p105 heterodimers and is required for effective p50 production. EMBO J. 19:4712-4722.
221. Lin, L. and S. Ghosh. 1996. A glycine-rich region in NF-kappaB p105 functions as a processing signal for the generation of the p50 subunit. Mol.Cell Biol. 16:2248-2254.
222. Linial, M. L. and A. D. Miller. 1990. Retroviral RNA packaging: sequence requirements and implications. Curr.Top.Microbiol.Immunol. 157:125-152.
223. Liou, H. C. 2002. Regulation of the immune system by NF-kappaB and IkappaB. J.Biochem.Mol.Biol. 35:537-546.
224. Liu, J., D. Bramblett, Q. Zhu, M. Lozano, R. Kobayashi, S. R. Ross, and J. P. Dudley. 1997. The matrix attachment region-binding protein SATB1 participates in negative regulation of tissue-specific gene expression. Mol.Cell Biol. 17:5275-5287.
225. Liu, L. P., Y. F. Xia, L. Yang, J. A. DiDonato, P. E. DiCorleto, C. P. Zhong, and J. G. Geng. 2001. B lymphocytes and plasma cells express functional E-selectin by constitutive activation of NF-kappaB. Biochem.Biophys.Res.Commun. 286:281-291.
226. Look, A. T. 1997. Oncogenic transcription factors in the human acute leukemias. Science 278:1059-1064.
227. Lutterbach, B., J. J. Westendorf, B. Linggi, S. Isaac, E. Seto, and S. W. Hiebert. 2000. A mechanism of repression by acute myeloid
203
leukemia-1, the target of multiple chromosomal translocations in acute leukemia. J.Biol.Chem. 275:651-656.
228. MacArthur, C. A., D. B. Shankar, and G. M. Shackleford. 1995. Fgf-8, activated by proviral insertion, cooperates with the Wnt-1 transgene in murine mammary tumorigenesis. J.Virol. 69:2501-2507.
229. MacKichan, M. L., F. Logeat, and A. Israel. 1996. Phosphorylation of p105 PEST sequence via a redox-insensitive pathway up-regulates processing of p50 NF-kappaB. J.Biol.Chem. 271:6084-6091.
230. Maillard, I., P. Launois, I. Xenarios, J. A. Louis, H. Acha-Orbea, and H. Diggelmann. 1998. Immune response to mouse mammary tumor virus in mice lacking the alpha/beta interferon or the gamma interferon receptor. J.Virol. 72:2638-2646.
231. Majello, B., L. C. Kenyon, and R. Dalla-Favera. 1986. Human c-myb protooncogene: nucleotide sequence of cDNA and organization of the genomic locus. Proc.Natl.Acad.Sci.U.S.A 83:9636-9640.
232. Majors, J. and H. E. Varmus . 1983. A small region of the mouse mammary tumor virus long terminal repeat confers glucocorticoid hormone regulation on a linked heterologous gene. Proc.Natl.Acad.Sci.U.S.A 80:5866-5870.
233. Marchetti, A., F. Buttitta, S. Miyazaki, D. Gallahan, G. H. Smith, and R. Callahan. 1995. Int-6, a highly conserved, widely expressed gene, is mutated by mouse mammary tumor virus in mammary preneoplasia. J.Virol. 69:1932-1938.
234. Marcu, K. B., S. A. Bossone, and A. J. Patel. 1992. myc function and regulation. Annu.Rev.Biochem. 61:809-860.
235. Marrack, P., E. Kushnir, and J. Kappler. 1991. A maternally inherited superantigen encoded by a mammary tumour virus. Nature 349:524-526.
236. Martiney, M. J., L. S. Levy, and J. Lenz. 1999. Suppressor mutations within the core binding factor (CBF/AML1) binding site of a T-cell lymphomagenic retrovirus. J.Virol. 73:2143-2152.
237. Matsuda, I., E. S. Masuda, A. Tsuboi, S. Behnam, N. Arai, and K. Arai. 1994. Characterization of NF(P), the nuclear factor that interacts with the regulatory P sequence (5'-CGAAAATTTCC-3') of the human
204
interleukin-4 gene: relationship to NF-kappa B and NF-AT. Biochem.Biophys.Res.Commun. 199:439-446.
238. Mayreddy, R. P., M. Safak, M. Razmara, P. Zoltick, and K. Khalili. 1996. Transcription of the JC virus archetype late genome: importance of the kappa B and the 23-base-pair motifs in late promoter activity in glial cells. J.Virol. 70:2387-2393.
239. McCaffrey, P. G., J. Jain, C. Jamieson, R. Sen, and A. Rao. 1992. A T cell nuclear factor resembling NF-AT binds to an NF-kappa B site and to the conserved lymphokine promoter sequence "cytokine-1". J.Biol.Chem. 267:1864-1871.
240. McCarthy, T. L., C. Ji, Y. Chen, K. K. Kim, M. Imagawa, Y. Ito, and M. Centrella. 2000. Runt domain factor (Runx)-dependent effects on CCAAT/ enhancer-binding protein delta expression and activity in osteoblasts. J.Biol.Chem. 275:21746-21753.
241. McMahon, C. W., L. Y. Bogatzki, and A. M. Pullen. 1997. Mouse mammary tumor virus superantigens require N-linked glycosylation for effective presentation to T cells. Virology 228:161-170.
242. McNally, J. G., W. G. Muller, D. Walker, R. Wolford, and G. L. Hager. 2000. The glucocorticoid receptor: rapid exchange with regulatory sites in living cells. Science 287:1262-1265.
243. Mellentin-Michelotti, J., S. John, W. D. Pennie, T. Williams, and G. L. Hager. 1994. The 5' enhancer of the mouse mammary tumor virus long terminal repeat contains a functional AP-2 element. J.Biol.Chem. 269:31983-31990.
244. Melnikova, I. N., B. E. Crute, S. Wang, and N. A. Speck. 1993. Sequence specificity of the core-binding factor. J.Virol. 67:2408-2411.
245. Merika, M. and D. Thanos. 2001. Enhanceosomes. Curr.Opin.Genet.Dev. 11:205-208.
246. Merriman, H. L., A. J. van Wijnen, S. Hiebert, J. P. Bidwell, E. Fey, J. Lian, J. Stein, and G. S. Stein. 1995. The tissue-specific nuclear matrix protein, NMP-2, is a member of the AML/CBF/PEBP2/runt domain transcription factor family: interactions with the osteocalcin gene promoter. Biochemistry 34:13125-13132.
205
247. Mertz, J. A., F. Mustafa, S. Meyers, and J. P. Dudley. 2001. Type B leukemogenic virus has a T-cell-specific enhancer that binds AML-1. J.Virol. 75:2174-2184.
248. Meyers, S., J. R. Downing, and S. W. Hiebert. 1993. Identification of AML-1 and the (8;21) translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins: the runt homology domain is required for DNA binding and protein-protein interactions. Mol.Cell Biol. 13:6336-6345.
249. Meyers, S., P. D. Gottlieb, and J. P. Dudley. 1989. Lymphomas with acquired mouse mammary tumor virus proviruses resemble distinct prethymic and intrathymic phenotypes defined in vivo. J.Immunol. 142:3342-3350.
250. Meyers, S., N. Lenny, and S. W. Hiebert. 1995. The t(8;21) fusion protein interferes with AML-1B-dependent transcriptional activation. Mol.Cell Biol. 15:1974-1982.
251. Michalides, R. and E. Wagenaar. 1986. Site-specific rearrangements in the long terminal repeat of extra mouse mammary tumor proviruses in murine T-cell leukemias. Virology 154:76-84.
252. Michalides, R., E. Wagenaar, J. Hilkens, J. Hilgers, B. Groner, and N. E. Hynes. 1982. Acquisition of proviral DNA of mouse mammary tumor virus in thymic leukemia cells from GR mice. J.Virol. 43:819-829.
253. Michalides, R., E. Wagenaar, and P. Weijers . 1985. Rearrangements in the long terminal repeat of extra mouse mammary tumor proviruses in T-cell leukemias of mouse strain GR result in a novel enhancer- like structure. Mol.Cell Biol. 5:823-830.
254. Miller, C. L., R. Garne r, and V. Paetkau. 1992. An activation-dependent, T-lymphocyte-specific transcriptional activator in the mouse mammary tumor virus env gene. Mol.Cell Biol. 12:3262-3272.
255. Mink, S., E. Hartig, P. Jennewein, W. Doppler, and A. C. Cato. 1992. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor. Mol.Cell Biol. 12:4906-4918.
206
256. Misteli, T. and D. L. Spector . 1998. The cellular organization of gene expression. Curr.Opin.Cell Biol. 10:323-331.
257. Mitsouras, K., B. Wong, C. Arayata, R. C. Johnson, and M. Carey. 2002. The DNA architectural protein HMGB1 displays two distinct modes of action that promote enhanceosome assembly. Mol.Cell Biol. 22:4390-4401.
258. Miyamoto, S. and I. M. Verma. 1995. Rel/NF-kappa B/I kappa B story. Adv.Cancer Res. 66:255-292.
259. Miyamoto, T., I. L. Weissman, and K. Akashi. 2000. AML1/ETO-expressing nonleukemic stem cells in acute myelogenous leukemia with 8;21 chromosomal translocation. Proc.Natl.Acad.Sci.U.S.A 97:7521-7526.
260. Miyoshi, H., M. Ohira, K. Shimizu, K. Mitani, H. Hirai, T. Imai, K. Yokoyama, E. Soeda, and M. Ohki. 1995. Alternative splicing and genomic structure of the AML1 gene involved in acute myeloid leukemia. Nucleic Acids Res. 23:2762-2769.
261. Miyoshi, H., K. Shimizu, T. Kozu, N. Maseki, Y. Kaneko, and M. Ohki. 1991. t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AML1. Proc.Natl.Acad.Sci.U.S.A 88:10431-10434.
262. Moelling, K., D. P. Bolognesi, and H. Bauer. 1971. Polypeptides of avian RNA tumor viruses. 3. Purification and identification of a DNA synthesizing enzyme. Virology 45:298-302.
263. Mohan, N., D. Mottershead, M. Subramanyam, U. Beutner, and B. T. Huber. 1993. Production and characterization of an Mls-1-specific monoclonal antibody. J.Exp.Med. 177:351-358.
264. Mok, E., T. V. Golovkina, and S. R. Ross. 1992. A mouse mammary tumor virus mammary gland enhancer confers tissue-specific but not lactation-dependent expression in transgenic mice. J.Virol. 66:7529-7532.
265. Moore, D. H., C. A. Long, A. B. Vaidya, J. B. Sheffield, A. S. Dion, and E. Y. Lasfargues. 1979. Mammary tumor viruses. Adv.Cancer Res. 29:347-418.
266. Moore, R., M. Dixon, R. Smith, G. Peters, and C. Dickson. 1987. Complete nucleotide sequence of a milk-transmitted mouse mammary
207
tumor virus: two frameshift suppression events are required for translation of gag and pol. J.Virol. 61:480-490.
267. Moreau, P., R. Hen, B. Wasylyk, R. Everett, M. P. Gaub, and P. Chambon. 1981. The SV40 72 base repair repeat has a striking effect on gene expression both in SV40 and other chimeric recombinants. Nucleic Acids Res. 9:6047-6068.
268. Morrison, H. L., B. Soni, and J. Lenz. 1995. Long terminal repeat enhancer core sequences in proviruses adjacent to c-myc in T-cell lymphomas induced by a murine retrovirus. J.Virol. 69:446-455.
269. Moscovici, C. 1975. Leukemic transformation with avian myeloblastosis virus: present status. Curr.Top.Microbiol.Immunol. 71:79-101.
270. Mucenski, M. L., K. McLain, A. B. Kier, S. H. Swerdlow, C. M. Schreiner, T. A. Miller, D. W. Pietryga, W. J. Scott, Jr., and S. S. Potter. 1991. A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis. Cell 65:677-689.
271. Mueller, R. E., L. Baggio, C. A. Kozak, and J. K. Ball. 1992. A common integration locus in type B retrovirus- induced thymic lymphomas. Virology 191:628-637.
272. Mueller, R. E., J. K. Ball, and F. P. Chan. 1989. Characterization of cell markers in type B retroviral- induced thymic lymphomas--I. Surface antigen phenotype and karyotype in developing and primary lymphomas. Leuk.Res. 13:553-559.
273. Muller, W. G., D. Walker, G. L. Hager, and J. G. McNally. 2001. Large-scale chromatin decondensation and recondensation regulated by transcription from a natural promoter. J.Cell Biol. 154:33-48.
274. Mustafa, F., S. Bhadra, D. Johnston, M. Lozano, and J. P. Dudley. 2003. The type B leukemogenic virus truncated superantigen is dispensable for T-cell lymphomagenesis. J.Virol. 77:3866-3870.
275. Mustafa, F., M. Lozano, and J. P. Dudley. 2000. C3H mouse mammary tumor virus superantigen function requires a splice donor site in the envelope gene. J.Virol. 74:9431-9440.
208
276. Nabel, G. and D. Baltimore . 1987. An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature 326:711-713.
277. Ness, S. A. 1996. The Myb oncoprotein: regulating a regulator. Biochim.Biophys.Acta 1288:F123-F139.
278. Neubauer, G., A. King, J. Rappsilber, C. Calvio, M. Watson, P. Ajuh, J. Sleeman, A. Lamond, and M. Mann. 1998. Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nat.Genet. 20:46-50.
279. Nicot, C., R. Mahieux, C. Pise-Masison, J. Brady, A. Gessain, S. Yamaoka, and G. Franchini. 2001. Human T-cell lymphotropic virus type 1 Tax represses c-Myb-dependent transcription through activation of the NF-kappaB pathway and modulation of coactivator usage. Mol.Cell Biol. 21:7391-7402.
280. Nielsen, A. L., N. Pallisgaard, F. S. Pedersen, and P. Jorgensen. 1994. Basic helix- loop-helix proteins in murine type C retrovirus transcriptional regulation. J.Virol. 68:5638-5647.
281. Nieves, A., L. S. Levy, and J. Lenz. 1997. Importance of a c-Myb binding site for lymphomagenesis by the retrovirus SL3-3. J.Virol. 71:1213-1219.
282. Niki, M., H. Okada, H. Takano, J. Kuno, K. Tani, H. Hibino, S. Asano, Y. Ito, M. Satake, and T. Noda. 1997. Hematopoiesis in the fetal liver is impaired by targeted mutagenesis of a gene encoding a non-DNA binding subunit of the transcription factor, polyomavirus enhancer binding protein 2/core binding factor. Proc.Natl.Acad.Sci.U.S.A 94:5697-5702.
283. Nolan, G. P. 1994. NF-AT-AP-1 and Rel-bZIP: hybrid vigor and binding under the influence. Cell 77:795-798.
284. Nusse, R. 1988. The int genes in mammary tumorigenesis and in normal development. Trends Genet. 4:291-295.
285. Nusse, R. 1991. Insertional mutagenesis in mouse mammary tumorigenesis. Curr.Top.Microbiol.Immunol. 171:43-65.
286. Nusse, R., F. A. Asselbergs, M. H. Salden, R. J. Michalides, and H. Bloemendal. 1978. Translation of mouse mammary tumor virus RNA:
209
precursor polypeptides are phosphorylated during processing. Virology 91:106-115.
287. Nusse, R., P. L. van der, L. van Duijn, R. Michalides, and J. Hilgers . 1979. Impaired maturation of mouse mammary tumor virus precursor polypeptides in lymphoid leukemia cells, producing intracytoplasmic A particles and no extracellular B-type virions. J.Virol. 32:251-258.
288. Nusse, R., A. van Ooyen, D. Cox, Y. K. Fung, and H. Varmus . 1984. Mode of proviral activation of a putative mammary oncogene (int-1) on mouse chromosome 15. Nature 307:131-136.
289. Nusse, R. and H. E. Varmus . 1982. Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell 31 :99-109.
290. O'Donnell, P. V., E. Fleissner, H. Lonial, C. F. Koehne, and A. Reicin. 1985. Early clonality and high-frequency proviral integration into the c-myc locus in AKR leukemias. J.Virol. 55:500-503.
291. Oda, M., K. Furukawa, K. Ogata, A. Sarai, S. Ishii, Y. Nishimura, and H. Nakamura. 1997. Identification of indispensable residues for specific DNA-binding in the imperfect tandem repeats of c-Myb R2R3. Protein Eng 10:1407-1414.
292. Oeth, P. A., G. C. Parry, C. Kunsch, P. Nantermet, C. A. Rosen, and N. Mackman. 1994. Lipopolysaccharide induction of tissue factor gene expression in monocytic cells is mediated by binding of c-Rel/p65 heterodimers to a kappa B-like site. Mol.Cell Biol. 14:3772-3781.
293. Ogata, K., H. Hojo, S. Aimoto, T. Nakai, H. Nakamura, A. Sarai, S. Ishii, and Y. Nishimura. 1992. Solution structure of a DNA-binding unit of Myb: a helix- turn-helix-related motif with conserved tryptophans forming a hydrophobic core. Proc.Natl.Acad.Sci.U.S.A 89:6428-6432.
294. Ogata, K., S. Morikawa, H. Nakamura, H. Hojo, S. Yoshimura, R. Zhang, S. Aimoto, Y. Ametani, Z. Hirata, A. Sarai, and . 1995. Comparison of the free and DNA-complexed forms of the DNA-binding domain from c-Myb. Nat.Struct.Biol. 2:309-320.
295. Ogata, K., S. Morikawa, H. Nakamura, A. Sekikawa, T. Inoue, H. Kanai, A. Sarai, S. Ishii, and Y. Nishimura. 1994. Solution structure of
210
a specific DNA complex of the Myb DNA-binding domain with cooperative recognition helices. Cell 79:639-648.
296. Ogawa, E., M. Inuzuka, M. Maruyama, M. Satake, M. Naito-Fujimoto, Y. Ito, and K. Shigesada. 1993. Molecular cloning and characterization of PEBP2 beta, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 alpha. Virology 194:314-331.
297. Ogawa, E., M. Maruyama, H. Kagoshima, M. Inuzuka, J. Lu, M. Satake, K. Shigesada, and Y. Ito. 1993. PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene. Proc.Natl.Acad.Sci.U.S.A 90:6859-6863.
298. Ohno, H., G. Takimoto, and T. W. McKeithan. 1990. The candidate proto-oncogene bcl-3 is related to genes implicated in cell lineage determination and cell cycle control. Cell 60:991-997.
299. Okuda, T., J. van Deursen, S. W. Hiebert, G. Grosveld, and J. R. Downing. 1996. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84:321-330.
300. Olnes, M. I. and R. N. Kurl. 1994. Isolation of nuclear extracts from fragile cells: a simplified procedure applied to thymocytes. Biotechniques 17:828-829.
301. Orian, A., A. L. Schwartz, A. Israel, S. Whiteside, C. Kahana, and A. Ciechanover. 1999. Structural motifs involved in ubiquitin-mediated processing of the NF-kappaB precursor p105: roles of the glycine-rich region and a downstream ubiquitination domain. Mol.Cell Biol. 19:3664-3673.
302. Osborn, L., S. Kunkel, and G. J. Nabel. 1989. Tumor necrosis factor alpha and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor kappa B. Proc.Natl.Acad.Sci.U.S.A 86:2336-2340.
303. Pahl, H. L. 1999. Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene 18:6853-6866.
211
304. Palmarini, M. and H. Fan. 2003. Molecular biology of jaagsiekte sheep retrovirus. Curr.Top.Microbiol.Immunol. 275:81-115.
305. Panet, A., D. Baltimore, and T. Hanafusa. 1975. Quantitation of avian RNA tumor virus reverse transcriptase by radioimmunoassay. J.Virol. 16:146-152.
306. Panganiban, A. T. and H. M. Temin. 1984. The retrovirus pol gene encodes a product required for DNA integration: identification of a retrovirus int locus. Proc.Natl.Acad.Sci.U.S.A 81:7885-7889.
307. Paquette, Y., L. Doyon, A. Laperriere, Z. Hanna, J. Ball, R. P. Sekaly, and P. Jolicoeur. 1992. A viral long terminal repeat expressed in CD4+CD8+ precursors is downregulated in mature peripheral CD4-CD8+ or CD4+CD8- T cells. Mol.Cell Biol. 12 :3522-3530.
308. Park, C. G., M. Y. Jung, Y. Choi, and G. M. Winslow. 1995. Proteolytic processing is required for viral superantigen activity. J.Exp.Med. 181:1899-1904.
309. Parry, G. C. and N. Mackman. 1994. A set of inducible genes expressed by activated human monocytic and endothelial cells contain kappa B-like sites that specifically bind c-Rel-p65 heterodimers. J.Biol.Chem. 269:20823-20825.
310. Pelengaris, S., B. Rudolph, and T. Littlewood. 2000. Action of Myc in vivo - proliferation and apoptosis. Curr.Opin.Genet.Dev. 10:100-105.
311. Pereira, L. A., K. Bentley, A. Peeters, M. J. Churchill, and N. J. Deacon. 2000. A compilation of cellular transcription factor interactions with the HIV-1 LTR promoter. Nucleic Acids Res. 28:663-668.
312. Pereira, L. A., M. J. Churchill, A. G. Elefanty, T. Gouskos, P. F. Lambert, R. G. Ramsay, and N. J. Deacon. 2002. Characterization of interactions between transcription factors and a regulatory region spanning nt -320 to -281 of the HIV-1 LTR in T- lymphoid and non-T-lymphoid cells. J.Biomed.Sci. 9:68-81.
313. Perkins, N. D., N. L. Edwards, C. S. Duckett, A. B. Agranoff, R. M. Schmid, and G. J. Nabel. 1993. A cooperative interaction between NF-kappa B and Sp1 is required for HIV-1 enhancer activation. EMBO J. 12:3551-3558.
212
314. Peters, G., S. Brookes, R. Smith, and C. Dickson. 1983. Tumorigenesis by mouse mammary tumor virus: evidence for a common region for provirus integration in mammary tumors. Cell 33:369-377.
315. Peters, G., S. Brookes, R. Smith, M. Placzek, and C. Dickson. 1989. The mouse homolog of the hst/k-FGF gene is adjacent to int-2 and is activated by proviral insertion in some virally induced mammary tumors. Proc.Natl.Acad.Sci.U.S.A 86:5678-5682.
316. Peters, G. and C. Glover. 1980. tRNA's and priming of RNA-directed DNA synthesis in mouse mammary tumor virus. J.Virol. 35:31-40.
317. Peters, G., R. Smith, S. Brookes, and C. Dickson. 1982. Conservation of protein coding potential in the long terminal repeats of exogenous and endogenous mouse mammary tumor viruses. J.Virol. 42:880-888.
318. Piette, J. and M. Yaniv. 1987. Two different factors bind to the alpha-domain of the polyoma virus enhancer, one of which also interacts with the SV40 and c-fos enhancers. EMBO J. 6:1331-1337.
319. Plaksin, D., P. A. Baeuerle, and L. Eisenbach. 1993. KBF1 (p50 NF-kappa B homodimer) acts as a repressor of H-2Kb gene expression in metastatic tumor cells. J.Exp.Med. 177:1651-1662.
320. Portman, D. S., J. P. O'Connor, and G. Dreyfuss. 1997. YRA1, an essential Saccharomyces cerevisiae gene, encodes a novel nuclear protein with RNA annealing activity. RNA. 3:527-537.
321. Prendergast, G. C. 1999. Mechanisms of apoptosis by c-Myc. Oncogene 18:2967-2987.
322. Pringle, C. R. 1999. Virus taxonomy--1999. The universal system of virus taxonomy, updated to include the new proposals ratified by the International Committee on Taxonomy of Viruses during 1998. Arch.Virol. 144:421-429.
323. Pryciak, P. M. and H. E. Varmus . 1992. Nucleosomes, DNA-binding proteins, and DNA sequence modulate retroviral integration target site selection. Cell 69:769-780.
324. Pryzwansky, K. B., L. E. Martin, and J. K. Spitznagel. 1978. Immunocytochemical localization of myeloperoxidase, lactoferrin,
213
lysozyme and neutral proteases in human monocytes and neutrophilic granulocytes. J.Reticuloendothel.Soc. 24:295-310.
325. Pullen, A. M., T. Wade, P. Marrack, and J. W. Kappler. 1990. Identification of the region of T cell receptor beta chain that interacts with the self-superantigen MIs-1a. Cell 61:1365-1374.
326. Racevskis, J. and H. Beyer. 1989. Amplification of mouse mammary tumor virus genomes in non-mammary tumor cells. J.Virol. 63:456-459.
327. Radke, K., H. Beug, S. Kornfeld, and T. Graf. 1982. Transformation of both erythroid and myeloid cells by E26, an avian leukemia virus that contains the myb gene. Cell 31:643-653.
328. Rajan, L., D. Broussard, M. Lozano, C. G. Lee, C. A. Kozak, and J. P. Dudley. 2000. The c-myc locus is a common integration site in type B retrovirus- induced T-cell lymphomas. J.Virol. 74:2466-2471.
329. Rajan, L., C. A. Kozak, and J. P. Dudley. 1998. Chromosomal localization of acquired MMTV proviral integration sites in T-cell lymphomas. Mamm.Genome 9:84-85.
330. Rao, G. S. 1981. MOde of entry of steroid and thyroid hormones into cells. Mol.Cell Endocrinol. 21:97-108.
331. Rein, A., M. R. McClure, N. R. Rice, R. B. Luftig, and A. M. Schultz. 1986. Myristylation site in Pr65gag is essential for virus particle formation by Moloney murine leukemia virus. Proc.Natl.Acad.Sci.U.S.A 83:7246-7250.
332. Robbins, J., B. J. Blondel, D. Gallahan, and R. Callahan. 1992. Mouse mammary tumor gene int-3: a member of the notch gene family transforms mammary epithelial cells. J.Virol. 66:2594-2599.
333. Roberts, J. D., K. Bebenek, and T. A. Kunkel. 1988. The accuracy of reverse transcriptase from HIV-1. Science 242:1171-1173.
334. Roberts, J. D., B. D. Preston, L. A. Johnston, A. Soni, L. A. Loeb, and T. A. Kunkel. 1989. Fidelity of two retroviral reverse transcriptases during DNA-dependent DNA synthesis in vitro. Mol.Cell Biol. 9:469-476.
335. Robinson, F. R. and M. J. Twiehaus . 1974. Isolation of tha avian reticuloendothelial virus (strain T). Avian Dis. 18:278-288.
214
336. Roelink, H., E. Wagenaar, d. S. Lopes, and R. Nusse. 1990. Wnt-3, a gene activated by proviral insertion in mouse mammary tumors, is homologous to int-1/Wnt-1 and is normally expressed in mouse embryos and adult brain. Proc.Natl.Acad.Sci.U.S.A 87:4519-4523.
337. Romieu-Mourez, R., D. W. Kim, S. M. Shin, E. G. Demicco, E. Landesman-Bollag, D. C. Seldin, R. D. Cardiff, and G. E. Sonenshein. 2003. Mouse mammary tumor virus c-rel transgenic mice develop mammary tumors. Mol.Cell Biol. 23:5738-5754.
338. Rong, B. L., T. A. Libermann, K. Kogawa, S. Ghosh, L. X. Cao, D. Pavan-Langston, and E. C. Dunkel. 1992. HSV-1-inducible proteins bind to NF-kappa B-like sites in the HSV-1 genome. Virology 189:750-756.
339. Rosen, C. A., W. A. Haseltine, J. Lenz, R. Ruprecht, and M. W. Cloyd. 1985. Tissue selectivity of murine leukemia virus infection is determined by long terminal repeat sequences. J.Virol. 55:862-866.
340. Ross, S. R., J. J. Schofield, C. J. Farr, and M. Bucan. 2002. Mouse transferrin receptor 1 is the cell entry receptor for mouse mammary tumor virus. Proc.Natl.Acad.Sci.U.S.A 99:12386-12390.
341. Ross, S. R. and D. Solter. 1985. Glucocorticoid regulation of mouse mammary tumor virus sequences in transgenic mice. Proc.Natl.Acad.Sci.U.S.A 82:5880-5884.
342. Ryseck, R. P., F. Weih, D. Carrasco, and R. Bravo. 1996. RelB, a member of the Rel/NF-kappa B family of transcription factors. Braz.J.Med.Biol.Res. 29:895-903.
343. Sakura, H., C. Kanei-Ishii, T. Nagase, H. Nakagoshi, T. J. Gonda, and S. Ishii. 1989. Delineation of three functional domains of the transcriptional activator encoded by the c-myb protooncogene. Proc.Natl.Acad.Sci.U.S.A 86:5758-5762.
344. Sala, A. and R. Watson. 1999. B-Myb protein in cellular proliferation, transcription control, and cancer: latest developments. J.Cell Physiol 179:245-250.
345. Sambasivarao, D. and V. Paetkau. 1996. Interactions of a transcriptional activator in the env gene of the mouse mammary tumor virus with
215
activation-dependent, T cell-specific transacting factors. J.Biol.Chem. 271:8942-8950.
346. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Woodbury, NY.
347. Sambucetti, L. C., J. M. Cherrington, G. W. Wilkinson, and E. S. Mocarski. 1989. NF-kappa B activation of the cytomegalovirus enhancer is mediated by a viral transactivator and by T cell stimulation. EMBO J. 8:4251-4258.
348. Sarkar, N. H. and A. S. Dion. 1975. Polypeptides of the mouse mammary tumor virus. I. Characterization of two group-specific antigens. Virology 64:471-491.
349. Sarkar, N. H., S. Haga, A. F. Lehner, W. Zhao, S. Imai, and K. Moriwaki. 1994. Insertional mutation of int protooncogenes in the mammary tumors of a new strain of mice derived from the wild in China: normal- and tumor-tissue-specific expression of int-3 transcripts. Virology 203:52-62.
350. Sarkar, N. H., E. S. Whittington, J. Racevskis, and S. L. Marcus . 1978. Phosphoproteins of the murine mammary tumor virus. Virology 91:407-422.
351. Satake, M., T. Ibaraki, Y. Yamaguchi, and Y. Ito. 1989. Loss of responsiveness of an AP1-related factor, PEBP1, to 12-O-tetradecanoylphorbol-13-acetate after transformation of NIH 3T3 cells by the Ha-ras oncogene. J.Virol. 63:3669-3677.
352. Satake, M., S. Nomura, Y. Yamaguchi-Iwai, Y. Takahama, Y. Hashimoto, M. Niki, Y. Kitamura, and Y. Ito. 1995. Expression of the Runt domain-encoding PEBP2 alpha genes in T cells during thymic development. Mol.Cell Biol. 15:1662-1670.
353. Sato, H., E. A. Boyse, T. Aoki, C. Iritani, and L. J. Old. 1973. Leukemia-associated transplantation antigens related to murine leukemia virus. The X.1 system: immune response controlled by a locus linked to H-2. J.Exp.Med. 138:593-606.
216
354. Scheijen, B., J. Jonkers, D. Acton, and A. Berns . 1997. Characterization of pal-1, a common proviral insertion site in murine leukemia virus-induced lymphomas of c-myc and Pim-1 transgenic mice. J.Virol. 71:9-16.
355. Scherdin, U., K. Rhodes, and M. Breindl. 1990. Transcriptionally active genome regions are preferred targets for retrovirus integration. J.Virol. 64:907-912.
356. Schlom, J., D. Colcher, S. Spiegelman, S. Gillespie, and D. Gillespie. 1973. Quantitation of RNA tumor viruses and viruslike particles in human milk by hybridization to polyadenylic acid sequences. Science 179:696-698.
357. Schmid, R. M., N. D. Perkins, C. S. Duckett, P. C. Andrews, and G. J. Nabel. 1991. Cloning of an NF-kappa B subunit which stimulates HIV transcription in synergy with p65. Nature 352:733-736.
358. Schmitz, M. L. and P. A. Baeuerle. 1991. The p65 subunit is responsible for the strong transcription activating potential of NF-kappa B. EMBO J. 10:3805-3817.
359. Schroder, A. R., P. Shinn, H. Chen, C. Berry, J. R. Ecker, and F. Bushman. 2002. HIV-1 integration in the human genome favors active genes and local hotspots. Cell 110:521-529.
360. Schultz, A. M. and S. Oroszlan. 1983. In vivo modification of retroviral gag gene-encoded polyproteins by myristic acid. J.Virol. 46:355-361.
361. Sedgwick, S. G. and S. J. Smerdon. 1999. The ankyrin repeat: a diversity of interactions on a common structural framework. Trends Biochem.Sci. 24:311-316.
362. Sen, R. and D. Baltimore . 1986. Inducibility of kappa immunoglobulin enhancer-binding protein Nf-kappa B by a posttranslational mechanism. Cell 47:921-928.
363. Sen, R. and D. Baltimore . 1986. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46:705-716.
364. Sha, W. C., H. C. Liou, E. I. Tuomanen, and D. Baltimore . 1995. Targeted disruption of the p50 subunit of NF-kappa B leads to multifocal defects in immune responses. Cell 80:321-330.
217
365. Shackleford, G. M. and H. E. Varmus . 1988. Construction of a clonable, infectious, and tumorigenic mouse mammary tumor virus provirus and a derivative genetic vector. Proc.Natl.Acad.Sci.U.S.A 85:9655-9659.
366. Siebenlist, U., G. Franzoso, and K. Brown. 1994. Structure, regulation and function of NF-kappa B. Annu.Rev.Cell Biol. 10:405-455.
367. Sims, R. J., III, A. S. Liss, and P. D. Gottlieb. 2003. Normalization of luciferase reporter assays under conditions that alter internal controls. Biotechniques 34 :938-940.
368. Sinn, E., W. Muller, P. Pattengale, I. Tepler, R. Wallace, and P. Leder. 1987. Coexpression of MMTV/v-Ha-ras and MMTV/c-myc genes in transgenic mice: synergistic action of oncogenes in vivo. Cell 49:465-475.
369. Smith, G. H. and N. A. Wivel. 1973. Intracytoplasmic A particles: mouse mammary tumor virus nucleoprotein cores? J.Virol. 11:575-584.
370. Sobieszczuk, P. W., T. J. Gonda, and A. R. Dunn. 1989. Structure and biological activity of the transcriptional initiation sequences of the murine c-myb oncogene. Nucleic Acids Res. 17:9593-9611.
371. Speck, N. A. and D. Baltimore . 1987. Six distinct nuclear factors interact with the 75-base-pair repeat of the Moloney murine leukemia virus enhancer. Mol.Cell Biol. 7:1101-1110.
372. Speck, N. A., B. Renjifo, E. Golemis, T. N. Fredrickson, J. W. Hartley, and N. Hopkins . 1990. Mutation of the core or adjacent LVb elements of the Moloney murine leukemia virus enhancer alters disease specificity. Genes Dev. 4:233-242.
373. Speck, N. A. and S. Terryl. 1995. A new transcription factor family associated with human leukemias. Crit Rev.Eukaryot.Gene Expr. 5:337-364.
374. Steward, R. 1987. Dorsal, an embryonic polarity gene in Drosophila, is homologous to the vertebrate proto-oncogene, c-rel. Science 238:692-694.
375. Stewart, T. A., P. K. Pattengale, and P. Leder. 1984. Spontaneous mammary adenocarcinomas in transgenic mice that carry and express MTV/myc fusion genes. Cell 38:627-637.
218
376. Strasser, K. and E. Hurt. 2000. Yra1p, a conserved nuclear RNA-binding protein, interacts directly with Mex67p and is required for mRNA export. EMBO J. 19:410-420.
377. Strasser, K. and E. Hurt. 2001. Splicing factor Sub2p is required for nuclear mRNA export through its interaction with Yra1p. Nature 413:648-652.
378. Strasser, K., S. Masuda, P. Mason, J. Pfannstiel, M. Oppizzi, S. Rodriguez-Navarro, A. G. Rondon, A. Aguilera, K. Struhl, R. Reed, and E. Hurt. 2002. TREX is a conserved complex coupling transcription with messenger RNA export. Nature 417:304-308.
379. Stuck, B., A. E. Boyse, L. J. Old, and E. A. Carswell. 1964. A new antigen found in leukemias and mammary tumors of the mouse. Nature (London) 203:1033-1034.
380. Stutz, F., A. Bachi, T. Doerks, I. C. Braun, B. Seraphin, M. Wilm, P. Bork, and E. Izaurralde . 2000. REF, an evolutionary conserved family of hnRNP-like proteins, interacts with TAP/Mex67p and participates in mRNA nuclear export. RNA. 6:638-650.
381. Sun, W., B. J. Graves, and N. A. Speck. 1995. Transactivation of the Moloney murine leukemia virus and T-cell receptor beta-chain enhancers by cbf and ets requires intact binding sites for both proteins. J.Virol. 69:4941-4949.
382. Swanstrom, R. and J. W. Wills . 1997. Assembly and Processing of Viral Proteins, p. 263-334. In J. M. Coffin, S. H. Hughes, and H. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory Press, Plainview (NY).
383. Syrovets, T., M. Jendrach, A. Rohwedder, A. Schule, and T. Simmet. 2001. Plasmin- induced expression of cytokines and tissue factor in human monocytes involves AP-1 and IKKbeta-mediated NF-kappaB activation. Blood 97:3941-3950.
384. Takahashi, H., T. Nukiwa, P. Basset, and R. G. Crystal. 1988. Myelomonocytic cell lineage expression of the neutrophil elastase gene. J.Biol.Chem. 263:2543-2547.
219
385. Tanaka, H., A. Tamura, and D. Tsujimura. 1972. Properties of the intracytoplasmic A particles purified from mouse tumors. Virology 49:61-78.
386. Taube, R., S. Loya, O. Avidan, M. Perach, and A. Hizi. 1998. Reverse transcriptase of mouse mammary tumour virus: expression in bacteria, purification and biochemical characterization. Biochem.J. 329 ( Pt 3):579-587.
387. Tekmal, R. R. and V. R. Durgam. 1995. The overexpression of int-5/Aromatase, a novel MMTV integration locus gene, is responsible for D2 mammary tumor cell proliferation. Cancer Lett. 88:147-155.
388. Theunissen, H. J., M. Paardekooper, L. J. Maduro, R. J. Michalides, and R. Nusse. 1989. Phorbol ester- inducible T-cell-specific expression of variant mouse mammary tumor virus long terminal repeats. J.Virol. 63:3466-3471.
389. Thompson, J. E., R. J. Phillips, H. Erdjument-Bromage, P. Tempst, and S. Ghosh. 1995. I kappa B-beta regulates the persistent response in a biphasic activation of NF-kappa B. Cell 80:573-582.
390. Thornell, A., B. Hallberg, and T. Grundstrom. 1988. Differential protein binding in lymphocytes to a sequence in the enhancer of the mouse retrovirus SL3-3. Mol.Cell Biol. 8:1625-1637.
391. Thornell, A., B. Hallberg, and T. Grundstrom. 1991. Binding of SL3-3 enhancer factor 1 transcriptional activators to viral and chromosomal enhancer sequences. J.Virol. 65:42-50.
392. Threadgill, D. S., W. K. Steagall, M. T. Flaherty, F. J. Fuller, S. T. Perry, K. E. Rushlow, S. F. Le Grice, and S. L. Payne . 1993. Characterization of equine infectious anemia virus dUTPase: growth properties of a dUTPase-deficient mutant. J.Virol. 67:2592-2600.
393. Tobler, A., C. W. Miller, K. R. Johnson, M. E. Selsted, G. Rovera, and H. P. Koeffler. 1988. Regulation of gene expression of myeloperoxidase during myeloid differentiation. J.Cell Physiol 136:215-225.
394. Todokoro, K., R. J. Watson, H. Higo, H. Amanuma, S. Kuramochi, H. Yanagisawa, and Y. Ikawa . 1988. Down-regulation of c-myb gene expression is a prerequisite for erythropoietin- induced erythroid differentiation. Proc.Natl.Acad.Sci.U.S.A 85:8900-8904.
220
395. Tonjes, R. R., R. Lower, K. Boller, J. Denner, B. Hasenmaier, H. Kirsch, H. Konig, C. Korbmacher, C. Limbach, R. Lugert, R. C. Phelps, J. Scherer, K. Thelen, J. Lower, and R. Kurth. 1996. HERV-K: the biologically most active human endogenous retrovirus family. J.Acquir.Immune.Defic.Syndr.Hum.Retrovirol. 13 Suppl 1:S261-S267.
396. Tooze, J., S. Tooze, H. Haisma, and J. Hilgers . 1985. AtT20 pituitary tumour cells contain mouse mammary tumour virus and intracisternal A-type particles in addition to murine leukemia virus. Eur.J.Cell Biol. 39:224-231.
397. Tracey, W. D., Jr., M. E. Pepling, M. E. Horb, G. H. Thomsen, and J. P. Gergen. 1998. A Xenopus homologue of aml-1 reveals unexpected patterning mechanisms leading to the formation of embryonic blood. Development 125:1371-1380.
398. Traenckner, E. B., H. L. Pahl, T. Henkel, K. N. Schmidt, S. Wilk, and P. A. Baeuerle. 1995. Phosphorylation of human I kappa B-alpha on serines 32 and 36 controls I kappa B-alpha proteolysis and NF-kappa B activation in response to diverse stimuli. EMBO J. 14:2876-2883.
399. Truss, M., G. Chalepakis, and M. Beato. 1992. Interplay of steroid hormone receptors and transcription factors on the mouse mammary tumor virus promoter. J.Steroid Biochem.Mol.Biol. 43:365-378.
400. Tsichlis, P. N., J. S. Lee, S. E. Bear, P. A. Lazo, C. Patriotis, E. Gustafson, S. Shinton, N. A. Jenkins, N. G. Copeland, K. Huebner, and . 1990. Activation of multiple genes by provirus integration in the Mlvi-4 locus in T-cell lymphomas induced by Moloney murine leukemia virus. J.Virol. 64:2236-2244.
401. Tsujimura, D. and H. Tanaka. 1974. Quantitative studies on intracytoplasmic A particles formed in DBA-2 mouse leukemias. Cancer Res. 34:1475-1486.
402. Vaidya, A. B., C. A. Long, J. B. Sheffield, A. Tamura, and H. Tanaka. 1980. Murine mammary tumor virus deficient in the major glycoprotein: biochemical and biological studies on virions produced by a lymphoma cell line. Virology 104:279-293.
403. van Gurp, M. F., J. Pratap, M. Luong, A. Javed, H. Hoffmann, A. Giordano, J. L. Stein, E. J. Neufeld, J. B. Lian, G. S. Stein, and A. J. van Wijnen. 1999. The CCAAT displacement protein/cut homeodomain
221
protein represses osteocalcin gene transcription and forms complexes with the retinoblastoma protein-related protein p107 and cyclin A. Cancer Res. 59:5980-5988.
404. van Ooyen, A. J., R. J. Michalides, and R. Nusse. 1983. Structural analysis of a 1.7-kilobase mouse mammary tumor virus-specific RNA. J.Virol. 46:362-370.
405. van Wijnen, A. J., T. K. Choi, T. A. Owen, K. L. Wright, J. B. Lian, R. Jaenisch, J. L. Stein, and G. S. Stein. 1991. Involvement of the cell cycle-regulated nuclear factor HiNF-D in cell growth control of a human H4 histone gene during hepatic development in transgenic mice. Proc.Natl.Acad.Sci.U.S.A 88:2573-2577.
406. Varmus, H. E., G. Ringold, and K. R. Yamamoto. 1979. Regulation of mouse mammary tumor virus gene expression by glucocorticoid hormones. Monogr Endocrinol. 12:253-278.
407. Verbeek, W., A. F. Gombart, A. M. Chumakov, C. Muller, A. D. Friedman, and H. P. Koeffler. 1999. C/EBPepsilon directly interacts with the DNA binding domain of c-myb and cooperatively activates transcription of myeloid promoters. Blood 93:3327-3337.
408. Verma, I. M., J. K. Stevenson, E. M. Schwarz, D. Van Antwerp, and S. Miyamoto. 1995. Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev. 9:2723-2735.
409. Vijaya, S., D. L. Steffen, and H. L. Robinson. 1986. Acceptor sites for retroviral integrations map near DNase I-hypersensitive sites in chromatin. J.Virol. 60:683-692.
410. Virbasius, C. M., S. Wagner, and M. R. Green. 1999. A human nuclear-localized chaperone that regulates dimerization, DNA binding, and transcriptional activity of bZIP proteins. Mol.Cell 4:219-228.
411. Vogt, V. M. 1996. Proteolytic processing and particle maturation. Curr.Top.Microbiol.Immunol. 214:95-131.
412. Wang, D. and A. S. Baldwin, Jr. 1998. Activation of nuclear factor-kappaB-dependent transcription by tumor necrosis factor-alpha is mediated through phosphorylation of RelA/p65 on serine 529. J.Biol.Chem. 273:29411-29416.
222
413. Wang, Q., T. Stacy, M. Binder, M. Marin-Padilla, A. H. Sharpe, and N. A. Speck. 1996. Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc.Natl.Acad.Sci.U.S.A 93:3444-3449.
414. Wang, Q., T. Stacy, J. D. Miller, A. F. Lewis, T. L. Gu, X. Huang, J. H. Bushweller, J. C. Bories, F. W. Alt, G. Ryan, P. P. Liu, A. Wynshaw-Boris, M. Binder, M. Marin-Padilla, A. H. Sharpe, and N. A. Speck. 1996. The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo. Cell 87:697-708.
415. Wang, S., Q. Wang, B. E. Crute, I. N. Melnikova, S. R. Keller, and N. A. Speck. 1993. Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor. Mol.Cell Biol. 13:3324-3339.
416. Weidhaas, J. B., E. L. Angelichio, S. Fenner, and J. M. Coffin. 2000. Relationship between retroviral DNA integration and gene expression. J.Virol. 74:8382-8389.
417. Weih, F., D. Carrasco, S. K. Durham, D. S. Barton, C. A. Rizzo, R. P. Ryseck, S. A. Lira, and R. Bravo. 1995. Multiorgan inflammation and hematopoietic abnormalities in mice with a targeted disruption of RelB, a member of the NF-kappa B/Rel family. Cell 80:331-340.
418. Weih, F., S. K. Durham, D. S. Barton, W. C. Sha, D. Baltimore, and R. Bravo. 1997. p50-NF-kappaB complexes partially compensate for the absence of RelB: severely increased pathology in p50(-/-)relB(-/-) double-knockout mice. J.Exp.Med. 185:1359-1370.
419. Weiher, H., M. Konig, and P. Gruss. 1983. Multiple point mutations affecting the simian virus 40 enhancer. Science 219:626-631.
420. Weiss, A., R. L. Wiskocil, and J. D. Stobo. 1984. The role of T3 surface molecules in the activation of human T cells: a two-stimulus requirement for IL 2 production reflects events occurring at a pre-translational leve l. J.Immunol. 133:123-128.
421. Westin, E. H., R. C. Gallo, S. K. Arya, A. Eva, L. M. Souza, M. A. Baluda, S. A. Aaronson, and F. Wong-Staal. 1982. Differential expression of the amv gene in human hematopoietic cells. Proc.Natl.Acad.Sci.U.S.A 79:2194-2198.
223
422. Weston, K. 1992. Extension of the DNA binding consensus of the chicken c-Myb and v-Myb proteins. Nucleic Acids Res. 20:3043-3049.
423. Whitcomb, J. M. and S. H. Hughes. 1992. Retroviral reverse transcription and integration: progress and problems. Annu.Rev.Cell Biol. 8:275-306.
424. Whiteside, S. T. and A. Israel. 1997. I kappa B proteins: structure, function and regulation. Semin.Cancer Biol. 8:75-82.
425. Wichmann, I., J. R. Garcia-Lozano, N. Respaldiza, M. F. Gonzalez-Escribano, and A. Nunez-Roldan. 1999. Autoantibodies to transcriptional regulation proteins DEK and ALY in a patient with systemic lupus erythematosus. Hum.Immunol. 60:57-62.
426. Williams, J. L., J. Garcia, D. Harrich, L. Pearson, F. Wu, and R. Gaynor. 1990. Lymphoid specific gene expression of the adenovirus early region 3 promoter is mediated by NF-kappa B binding motifs. EMBO J. 9:4435-4442.
427. Wills, J. W. and R. C. Craven . 1991. Form, function, and use of retroviral gag proteins. AIDS 5:639-654.
428. Wingender, E., X. Chen, R. Hehl, H. Karas, I. Liebich, V. Matys, T. Meinhardt, M. Pruss, I. Reuter, and F. Schacherer. 2000. TRANSFAC: an integrated system for gene expression regulation. Nucleic Acids Res. 28:316-319.
429. Winslow, G. M., M. T. Scherer, J. W. Kappler, and P. Marrack. 1992. Detection and biochemical characterization of the mouse mammary tumor virus 7 superantigen (Mls-1a). Cell 71:719-730.
430. Wotton, D., J. Ghysdael, S. Wang, N. A. Speck, and M. J. Owen. 1994. Cooperative binding of Ets-1 and core binding factor to DNA. Mol.Cell Biol. 14:840-850.
431. Wu, X., Y. Li, B. Crise, and S. M. Burgess. 2003. Transcription start regions in the human genome are favored targets for MLV integration. Science 300:1749-1751.
432. Yagi, M. J., R. E. Stutzman, B. H. Robertson, and R. W. Compans . 1978. Structural components of mouse mammary tumor virus. II. Isolation and purification of virion polypeptides. J.Virol. 26:448-456.
224
433. Yamaguchi, Y., M. Satake, and Y. Ito. 1989. Two overlapping sequence motifs within the polyomavirus enhancer are independently the targets of stimulation by both the tumor promoter 12-O-tetradecanoylphorbol-13-acetate and the Ha-ras oncogene. J.Virol. 63:1040-1048.
434. Yanagawa, S., K. Kakimi, H. Tanaka, A. Murakami, Y. Nakagawa, Y. Kubo, Y. Yamada, H. Hiai, K. Kuribayashi, T. Masuda, and . 1993. Mouse mammary tumor virus with rearranged long terminal repeats causes murine lymphomas. J.Virol. 67:112-118.
435. Yanagawa, S., A. Murakami, and H. Tanaka. 1990. Extra mouse mammary tumor proviruses in DBA/2 mouse lymphomas acquire a selective advantage in lymphocytes by alteration in the U3 region of the long terminal repeat. J.Virol. 64:2474-2483.
436. Yanagawa, S., H. Tanaka, and A. Ishimoto. 1991. Identification of a novel mammary cell line-specific enhancer element in the long terminal repeat of mouse mammary tumor virus, which interacts with its hormone-responsive element. J.Virol. 65:526-531.
437. Zaiman, A. L. and J. Lenz. 1996. Transcriptional activation of a retrovirus enhancer by CBF (AML1) requires a second factor: evidence for cooperativity with c-Myb. J.Virol. 70:5618-5629.
438. Zaiman, A. L., A. F. Lewis, B. E. Crute, N. A. Speck, and J. Lenz. 1995. Transcriptional activity of core binding factor-alpha (AML1) and beta subunits on murine leukemia virus enhancer cores. J.Virol. 69:2898-2906.
439. Zaiman, A. L., A. Nieves, and J. Lenz. 1998. CBF, Myb, and Ets binding sites are important for activity of the core I element of the murine retrovirus SL3-3 in T lymphocytes. J.Virol. 72:3129-3137.
440. Zeng, C., S. McNeil, S. Pockwinse, J. Nickerson, L. Shopland, J. B. Lawrence, S. Penman, S. Hiebert, J. B. Lian, A. J. van Wijnen, J. L. Stein, and G. S. Stein. 1998. Intranuclear targeting of AML/CBFalpha regulatory factors to nuclear matrix-associated transcriptional domains. Proc.Natl.Acad.Sci.U.S.A 95:1585-1589.
441. Zenklusen, D., P. Vinciguerra, Y. Strahm, and F. Stutz. 2001. The yeast hnRNP-Like proteins Yra1p and Yra2p participate in mRNA export through interaction with Mex67p. Mol.Cell Biol. 21:4219-4232.
225
442. Zhang, Y. W., S. C. Bae, G. Huang, Y. X. Fu, J. Lu, M. Y. Ahn, Y. Kanno, T. Kanno, and Y. Ito. 1997. A novel transcript encoding an N-terminally truncated AML1/PEBP2 alphaB protein interferes with transactiva tion and blocks granulocytic differentiation of 32Dcl3 myeloid cells. Mol.Cell Biol. 17:4133-4145.
443. Zhong, H., M. J. May, E. Jimi, and S. Ghosh. 2002. The phosphorylation status of nuclear NF-kappa B determines its association with CBP/p300 or HDAC-1. Mol.Cell 9:625-636.
444. Zhong, H., H. SuYang, H. Erdjument-Bromage, P. Tempst, and S. Ghosh. 1997. The transcriptional activity of NF-kappaB is regulated by the IkappaB-associated PKAc subunit through a cyclic AMP-independent mechanism. Cell 89:413-424.
445. Zhou, Z., M. J. Luo, K. Straesser, J. Katahira, E. Hurt, and R. Reed. 2000. The protein Aly links pre-messenger-RNA splicing to nuclear export in metazoans. Nature 407:401-405.
446. Zhu, Q. and J. P. Dudley. 2002. CDP binding to multiple sites in the mouse mammary tumor virus long terminal repeat suppresses basal and glucocorticoid- induced transcription. J.Virol. 76:2168-2179.
447. Zhu, Q., K. Gregg, M. Lozano, J. Liu, and J. P. Dudley. 2000. CDP is a repressor of mouse mammary tumor virus expression in the mammary gland. J.Virol. 74:6348-6357.
226
Vita
Jennifer Andrea Mertz was born in St. Louis, MO on January 21, 1975,
the daughter of John L. and Mary A. Mertz. After attending St. Joseph’s
Academy for her high school education, she entered St. Louis University in the
fall of 1993. In May, 1997, she graduated magna cum laude with a Bachelor of
Science degree in Biology. In the fall of 1997, she entered the Microbiology
Ph.D. program at The University of Texas at Austin; joining Dr. Jaquelin
Dudley’s lab in June, 1998. She has published seven journal articles and a book
chapter.
Permanent address: 915 Warson Woods Drive
Saint Louis, MO 63122-1731
This dissertation was typed by the author.