Pancreatic islet amyloidosis, �-cell apoptosis,and �-cell proliferation are determinants of isletremodeling in type-2 diabetic baboonsRodolfo Guardado-Mendozaa, Alberto M. Davallib, Alberto O. Chaveza, Gene B. Hubbardc, Edward J. Dickc,Abraham Majluf-Cruzd, Carlos E. Tene-Pereze, Lukasz Goldschmidtf, John Hartg, Carla Peregoh, Anthony G. Comuzzied,Maria Elizabeth Tejerod, Giovanna Finzii, Claudia Placidii, Stefano La Rosai, Carlo Capellai, Glenn Halffj,Amalia Gastaldellia,k, Ralph A. DeFronzoa, and Franco Follia,1
aDepartment of Medicine Diabetes Division, University of Texas Health Science Center, San Antonio, TX 78229; bSan Raffaele Scientific Institute, 20132Milan, Italy; cSouthwest Foundation for Biomedical Research and Southwest National Primate Research Center, San Antonio, TX 78227; dUnidad deInvestigacion Medica en Trombosis y Aterogenesis, HGR #1 Gabriel Mancera, D.F. Mexico; eSchool of Medicine, University of Colima, C.P. 28040 Colima,Mexico; fHoward Hughes Medical Institute, University of California, Los Angeles–Department of Energy Institute of Genomics and Proteomics, Los Angeles,CA 90095-1570; gDepartment of Biochemistry, University of Texas Health Science Centero and Department of Veterans Affairs Audie Murphy Division,Geriatric Research, Education, and Clinical Center, South Texas Veterans Health Care System, San Antonio, TX 78229; hDepartment of Molecular SciencesApplied to Biosystems, University of Milan, 20134 Milan, Italy; iDepartment of Pathology, Ospedale di Circolo, Department of Human Morphology,University of Insubria, and Centro Insubre di Biotecnologie per la Salute Umana, 21100 Varese, Italy; jDepartment of Surgery, University of Texas HealthScience Center, San Antonio, TX 78229; and kFondazione G. Monasterio and Institute of Clinical Physiology, National Research Council, 56126 Pisa, Italy
Communicated by C. Ronald Kahn, Harvard Medical School, Boston, MA, June 11, 2009 (received for review February 5, 2009)
�-Cell dysfunction is an important factor in the development ofhyperglycemia of type-2 diabetes mellitus, and pancreatic islet amy-loidosis (IA) has been postulated to be one of the main contributorsto impaired insulin secretion. The aim of this study was to evaluatethe correlation of IA with metabolic parameters and its effect on isletsof Langerhans remodeling and relative endocrine-cell volume inbaboons. We sequenced the amylin peptide, determined the fibrillo-genic propensities, and evaluated pancreatic histology, clinical andbiochemical characteristics, and endocrine cell proliferation and apo-ptosis in 150 baboons with different metabolic status. Amylin se-quence in the baboon was 92% similar to humans and showedsuperimposable fibrillogenic propensities. IA severity correlated withfasting plasma glucose (FPG) (r � 0.662, P < 0.001) and HbA1c (r �0.726, P < 0.001), as well as with free fatty acid, glucagon values,decreased homeostasis model assessment (HOMA) insulin resistance,and HOMA-B. IA severity was associated with a decreased relative�-cell volume, and increased relative �-cell volume and hyperglu-cagonemia. These results strongly support the concept that IA and�-cell apoptosis in concert with �-cell proliferation and hypertrophyare key determinants of islets of Langerhans ‘‘dysfunctional remod-eling’’ and hyperglycemia in the baboon, a nonhuman primate modelof type-2 diabetes mellitus. The most important determinants of IAwere age and FPG (R2 � 0.519, P < 0.0001), and different FPG levelswere sensitive and specific to predict IA severity. Finally, a predictivemodel for islet amyloid severity was generated with age and FPG asrequired variables.
amyloid deposits � non-human primates � resistant � islet of Langerhans �type-2 diabetes mellitus
Type-2 diabetes mellitus (T2DM) is a chronic metabolicdisorder characterized by insulin resistance in liver, muscle,
and adipose tissue, as well as progressive �-cell dysfunctionleading to hyperglycemia (1–3). Hyperglycemia and islet amy-loidosis (IA) have been implicated in the progressive loss of �cells in T2DM (4, 5). The prevalence of IA has been reported torange from 40 to 90% in T2DM individuals, and from 7% to 33%in nondiabetic controls (6–11). Islet amyloid pancreatic polypep-tide (IAPP) is the major constituent of pancreatic amyloiddeposits (12, 13). In humans, monkeys, and cats, but not in miceand rats, IAPP has an amyloidogenic-promoting region, whichresides within amino acids 20 to 29. Abnormalities in IAPPprocessing and secretion have been proposed as importantcontributors to the formation of IA (14–17). Of note, IA and�-cell apoptosis have been observed in normal human islets
transplanted into diabetic nude mice, as well as in the liver oftype-1 diabetic patients transplanted with human islets (18, 19).
IA can cause �-cell death by occupying extracellular space,thereby impairing nutrients and oxygen uptake. In addition, smallIAPP oligomers can form nonselective ion-permeable membranepores, leading to increased intracellular calcium concentrations,endoplasmic reticulum stress, and apoptosis (20–25). However, oneargument that has been raised against the pathogenic importanceof IA in T2DM is that most, but not all pancreases contain amyloiddeposits and only about 10% of patients with impaired fastingglucose have evidence of IA at postmortem (6, 7, 9, 10, 12, 13, 20).
Longitudinal studies in Macaca nigra and Macaca mulattashowed that progression to T2DM correlated with IA severity andthat IA may play a role in �-cell death (26, 27). In this study, weperformed a retrospective analysis in a large baboon (Papiohamadryas) population in which physical and clinical chemistrydata, as well as pancreatic specimens, were available. Severe IA (�50%) was not only associated with increased �-cell apoptosis anddecreased relative �-cell volume but also with �-cell replication andhypertrophy and increased relative �-cell volume. In fact, �-cellproliferation correlated with hyperglucagonemia and hyperglyce-mia, providing new insights into the pathogenesis of islet of Lang-erhans ‘‘dysfunctional remodeling,’’ and T2DM in the baboon.
ResultsSequencing and Fibrillogenic Propensity of Baboon IAPP. Amyloidprevalence and amyloid severity had a hyperbolic relationship (Fig.S1A). Sequencing of the baboon IAPP gene showed a 90% identityto human IAPP at the cDNA level and 92% identity at the proteinlevel (Fig. S1B), and the fibrillation propensities of baboon andhuman IAPP were superimposable (Fig. S1 C and D).
Author contributions: R.G.-M., A.M.D., A.O.C., G.B.H., E.J.D., C.E.T.-P., C. Perego, A.G.C.,G.F., C. Placidi, S.L.R., C.C., A.G., R.A.D., and F.F. designed research; R.G.-M., A.O.C., G.B.H.,E.J.D., C. Perego, M.E.T., G.F., C. Placidi, S.L.R., C.C., G.H., and F.F. performed research; E.J.D.,L.G., J.H., and C. Perego contributed new reagents/analytic tools; R.G.-M., A.M.D., A.O.C.,G.B.H., A.M.-C., C.E.T.-P., L.G., J.H., A.G.C., M.E.T., G.F., C. Placidi, S.L.R., C.C., A.G., and F.F.analyzed data; and R.G.-M., A.M.D., A.O.C., A.M.-C., G.F., C. Placidi, S.L.R., C.C., A.G., and F.F.wrote the paper.
The authors declare no conflict of interest.
Freely available online through the PNAS open access option.
1To whom correspondence should be addressed. E-mail: [email protected].
This article contains supporting information online at www.pnas.org/cgi/content/full/0906471106/DCSupplemental.
www.pnas.org�cgi�doi�10.1073�pnas.0906471106 PNAS Early Edition � 1 of 7
MED
ICA
LSC
IEN
CES
Morphometric, Physical, and Biochemical Data. Physical and labo-ratory data are summarized in Table 1. Age, body weight infemales, fasting plasma glucose (FPG), HbA1c, free fatty acid(FFA), and glucagon progressively increased with IA. In con-trast, insulin levels did not differ significantly in the 5 groups.Morphometric data are summarized in Table S1. The baboonpopulation was divided into quintiles according to IA. Mean isletsize, relative islet volume, islet density, and relative amyloidvolume (percentage of total pancreas occupied by amyloid) wereincreased according to IA severity (P � 0.05).
�-Cell Function and Insulin Resistance. �-Cell function [homeostasismodel assessment (HOMA)-B] decreased progressively with in-creasing IA (r � �0.509, P � 0.001) (Fig. 1A) and FPG levels (r ��0.589, P � 0.001) (Fig. 1B). Insulin resistance (HOMA-IR)directly correlated with IA severity (r � 0.217, p 0.010) (Fig. 1C),and with FPG levels (r � 0.292, P � 0.001) (Fig. 1D). Of note, �-cellfunction decreased dramatically because of the additive effect ofhyperglycemia (FPG �115 mg/dL) and IA severity (Fig. 1E).
Relationship Between IA Severity, FPG Levels, and Other MetabolicParameters. Weight and FPG distribution in female and malebaboons are shown in Fig. S2. When baboons were divided intoquintiles of FPG levels, a progressive increase in both relativeamyloid volume and relative amyloid area was observed (bothP � 0.001) (Fig. 2 A and B). There was a strong positivecorrelation between FPG concentrations and IA severity (r �0.662, P � 0.001). Accordingly, the relative islet area free ofamyloid showed a linear inverse correlation with FPG levels (Fig.2C) (P � 0.001). Abnormal FPG levels were observed in the 2top quintiles of IA severity (see Table 1); however, overthyperglycemia was already present during the last 3 years of lifeonly in baboons with the greatest IA severity (Fig. 2D, and TableS2). HbA1c levels correlated positively with the relative amyloidarea (r � 0.726, P � 0.001). Fasting plasma glucagon levelsincreased in the upper 3 quintiles of FPG, and adipose tissueinsulin (fasting plasma insulin or FPI) resistance index (FFA �FPI) increased also in these groups (Fig. 2 E and F) (P � 0.05).In Fig. 2 G to L, representative pancreatic islet from baboonswith different degrees of IA are shown. In univariate analysis,age, gender, body weight at the age of 15 years, fasting plasmaFFA, insulin, and glucagon levels were all positively correlatedwith FPG levels (all P � 0.05). Multivariate analysis showed thatonly age (partial r � �0.20 P � 0.03), gender (partial r � �0.19,P � 0.03), fasting FFA (partial r � 0.40, P � 0.00013), and IA(partial r � 0.65, P � 0.0001) remained significantly correlatedwith the FPG levels, accounting for the 59% of the totalvariability. Receiver operating characteristic (ROC) analysisshowed that FPG of 90 mg/dL predicted amyloid deposits in
more than 25% of the total islet area, with a sensitivity of 74%and a specificity of 83%. For an IA �40%, the same glucoselevels had a sensitivity of 84% and a specificity of 77%. At lowerand greater levels of IA severity, different FPG levels wereequally sensitive and specific in predicting the % of IA (Fig. S3).
Relationship Between IA Severity and Physical Parameters. There wasa positive correlation between IA severity and age (r � 0.330, P �0.001), which persisted after adjusting for gender, and between IAseverity and weight at 15 years of age, but only in females (r � 0.509,P � 0.001), as females with the higher IA severity showed the higherbody weight during their entire life (Fig. S4 A and B, and see TableS2). In both sexes, relative amyloid area increased linearly with the
Table 1. Physical and laboratory data of 150 baboons divided according to the severity of islet amyloid deposition (relative amyloid area)
VariableGroup 1 IA
5.5-17% (n � 30)Group 2 IA
5.5–17% (n � 30)Group 3 IA
18–35% (n � 30)Group 4 IA
36–51% (n � 30)Group 5 IA
� 51% (n � 30) P group
Sex, (F/M) 14/16 18/12 25/5a,b 20/10 24/6a,b 0.007Age, (years) 16.2 � 0.9 19.3 � 0.8ª 19.8 � 0.9ª 19.9 � 0.9ª 21.6 � 0.6ª 0.001Wt. (F, kg) 15.7 � 0.6 16.2 � 0.8 15.8 � 0.7 18.9 � 1.2c 21.4 � 1.2a,b,c 0.001Wt. (M, kg) 30.2 � 1.9 29.2 � 1.5 29.6 � 1.4 29.8 � 2.0 30.7 � 3.6 0.993FPG, (mg/dL) 75 � 2 83 � 3 96 � 7 115 � 7a,b 187 � 21a,b,c,d 0.001FFA, (mEq/L) 0.53 � 0.1 0.66 � 0.1 0.6 � 0.1 0.55 � 0.08 1.15 � 0.28a,b,c,d 0.02Ins, (�IU/L) 18 � 4 18 � 3 39 � 17 40 � 28 34 � 11 0.724Glucagon, (pg/mL) 60 � 5 79 � 10 97 � 14 96 � 20 112 � 23a 0.023HbA1c, (%) 4.6 � 0.2 4.9 � 0.4 6.0 � 0.7 6.5 � 1.3 9.3 � 0.9a,b,c,d 0.004
FFA, free fatty acid; FPG, fasting plasma glucose; IA, islet amyloidosis.aP � 0.05 vs. Group 1.bP � 0.05 vs. Group 2.cP � 0.05 vs. Group 3.dP � 0.05 vs. Group 4.
Fig. 1. �-Cell function and insulin resistance correlated with amyloid depositsand FPG in baboons. Ln(HOMA-B) (A and B) and Ln(HOMA-IR) (C and D) aredepictedaccordingtoamyloid severity (IA)andFPGconcentration inbaboons. (E)Effect of increasing FPG concentration and worsening severity of amyloid dep-osition on �-cell function (ln HOMA B) in baboons. *, P � 0.05 vs. Group 1; †, P �0.05 vs. Group 1 and 2; ‡, P � 0.05 vs. Groups 1, 2 and 3; **, P � 0.05 vs. all groups.
2 of 7 � www.pnas.org�cgi�doi�10.1073�pnas.0906471106 Guardado-Mendoza et al.
FPG levels (Fig. S4C) (P � 0.001). At any given FPG level, theseverity of IA was slightly higher in overweight baboons, reachingstatistical significance in those with FPG between 95 and 125 mg/dL(P � 0.05) (Fig. S4D).
Relationship Between IA Severity, Endocrine Cell Replication andApoptosis, and Relative �- and �-Cell Volume. The percentage ofendocrine islet cells stained for Ki67 correlated with ln(FFA)(r � 0.480, P � 0.037), total cholesterol (r � 0.702, P � 0.001),and ln(glucagon) (r � 0.562, P � 0.015). Because of the smaller
number of baboons used for these particular experiments (n �20), results were divided into 3 groups of IA severity, IA of 0 (n �4), 1 to 50 (n � 8), and �50% (n � 8). Together with the increasein IA severity, there was a progressive, although not significant,increase in the percentage of islet cells undergoing both prolif-eration (Ki67 positive) and apoptosis (M30 positive) (Fig. 3 Aand B). The difference between proliferation and apoptosis(proliferation-apoptosis � % Ki67-positive � % M30-positive)remained relatively stable with a slight trend to apoptosis (Fig.3C), but the relation between proliferation and apoptosis(proliferation/apoptosis � % Ki67-positive/% M30-positive) wasgreater in the baboons with IA �50% (Fig. 3D) (P � 0.05).However, when the cases without IA (IA severity � 0) werecompared to those with any degree of IA (IA severity 1–50 � IAseverity �50%), proliferation rate was significantly higher in thelatter group (P � �0.05). Interestingly, we found that in baboonswith IA �50% and hyperglycemia, the marker of proliferation(Ki67) colocalized with a fraction of glucagon-positive cells (Fig. 3E, I, and M) but not with insulin-positive cells (Fig. 3 F, J, and N).This result was confirmed by triple immunofluorescence experi-ments (Fig. 3 Q and R): Ki67 staining (green) was detected in thenuclei of a fraction of glucagon-secreting cells only (blue). Con-versely, the marker of apoptosis (M30) never colocalized withglucagon-positive cells (Fig. 3 G, K, and O), and colocalizedexclusively with insulin-positive cells (Fig. 3 H, L, and P). Therelative �-cell volume decreased by �70% in IA �50% (Fig. 4A)(P � 0.001) and the relative �-cell volume increased by �50% inIA �50% and FPG �100 mg/dL (Fig. 4 B and C) (P � 0.001).Number of � cells/total islet cells, number of � cells/islet andindividual �-cell size were increased according to IA severity (Fig.4 D–F) (P � 0.05) and according to FPG (Fig. S5) (P � 0.05).
Electron microscopy revealed amyloid deposits in both thecytoplasm of � cells and in extracellular spaces, with the latterappearing more compact (Fig. S6A). Electron microscopy im-munocytochemistry demonstrated that both intra- and extracel-lular deposits were composed of IAPP (Fig. S6 B and C). TheCongo red stain and IAPP immunohistochemistry performed inconsecutive pancreatic sections of diabetic baboons also con-firmed that the islet amyloid is composed of IAPP (Fig. S7).
Predictive Model of IA Severity. We used a multivariate andstratified matched approach to develop a predictive model ofamyloid deposition using the following variables: age, gender,overweight at 15 years, FFA, FPG, and insulin and glucagonlevels. In a stepwise analysis (Table S3), age and FPG were thebest predictors of IA severity, with an adjusted R2 of 0.535 (P �0.0001). In a second model including the 2 strongest predictorsof IA severity, age and FPG, the adjusted R2 was 0.519 (P �0.0001). This allowed us to generate the following equation topredict IA severity: Relative amyloid area � 1.118 � Age (years)� 37.57 � FPG (mg/dL) � 164.03. In a stratified analysis, therelationship between IA severity and FPG persisted after match-ing baboons by age, sex, and weight.
DiscussionSimilar to humans, baboons spontaneously develop insulin re-sistance associated with obesity and T2DM, thereby serving asa model for the study of the molecular pathogenesis of theseconditions (1–4, 28–32). The baboon genome sequencing isunderway, but given the high genetic and biologic similaritiesbetween humans and nonhuman primates, it is likely that theinfluence of the genetic background to T2DM is very similarbetween baboons and humans (28, 32–35). In this study, wedemonstrate that the amino acid sequence of baboon IAPP has92% homology with that of humans, minimal amino acid changesin the amyloidogenic portion, and almost identical predictedfibrillation propensities (see Fig. S1). To assess the role of IA inT2DM, we performed a quantitative morphometric study to
Fig. 2. FPG are associated to amyloid deposits, glucagon, and insulin resis-tance in the adipose tissue, and increases progressively during time in baboonswith more severe IA. Relationship between FPG and (A) relative amyloidvolume/pancreas; (B) relative amyloid area; (C) islet area free of amyloid; (D)glucose levels during the last 4 years of baboon’s life according to the degreeof amyloid severity at death (open circles Group 1, open diamonds Group 2,filled diamonds Group 3, open squares Group 4, and filled squares Group 5);(E) Glucagon levels; and (F) Adipose tissue insulin resistance index (fastingFFA � FPI). *, P � 0.05 vs. Group 1 and 2; **, P � 0.05 vs. G1, 2, and 3; †, P �0.05 vs. all groups; #, P � 0.05 vs. glucose 1 year before death (in the sameamyloid group); ‡, P � 0.05 vs. glucose 3 years before death (in the sameamyloid group). (G–L) Congo red staining (40�) in pancreas of baboons withdifferent levels of FPG and IA (FPG for G � 76, H � 80, I � 109, J � 199, K � 195,L � 255 mg/dL). (Bar � 50 �m.)
Guardado-Mendoza et al. PNAS Early Edition � 3 of 7
MED
ICA
LSC
IEN
CES
evaluate the relationship between IA and islet of Langerhansremodeling in a large number of baboons.
Surprisingly, IA was observed in a large number of baboonswith normal FPG levels and in most of those with impairedfasting glucose or T2DM, as defined by using the same cut-off
values used for humans (36). A positive correlation between IAand FPG has been reported in transgenic rodents and in vitro butnot in humans with T2DM (10, 37–39). In the present study, inwhich the entire spectrum of FPG was examined, we found ahighly significant correlation between IA and both FPG and
Fig. 3. IA severity is associated to �-cell apoptosis and �-cell proliferation. Percentage of endocrine islet cells in proliferation (Ki67) (A), apoptosis (M30) (B),the difference between these 2 (C), and the proliferation/apoptosis ratio (D) according to amyloid severity. *P � 0.05 vs. control group. Double-labelimmunohistochemical stains in 3 baboon pancreases with �50% of IA and hyperglycemia show that nuclear immunoreactivity of the proliferative marker Ki67does colocalize with glucagon in some � cells (arrow in E; I, and M), but not with insulin in � cells (F, J, and N). Conversely, cytoplasmic immunoreactivity for theapoptotic marker M30, which detects the caspase cleavage product of cytokeratin 18, does not colocalize with glucagon (G, K, and O), but it does with insulin(arrows in H and L; P). Ki67 and M30 are stained in brown, while hormones are stained in red. Triple immunofluorescence staining (I and J) with Ki67 (green),insulin (red), and glucagon (blue) confirming that nuclear staining of the proliferative marker Ki67 was detected in few glucagon-positive cells (blue, arrows),but not in insulin-positive � cells (red). A particular at higher magnification (2�) is shown. *, Amyloid deposits autofluorescence. (Scale bar, 10 �m.)
4 of 7 � www.pnas.org�cgi�doi�10.1073�pnas.0906471106 Guardado-Mendoza et al.
HbA1c levels. Furthermore, using ROC analysis, we showed thatFPG concentrations between 90 and 110 mg/dL have a highpredictive value for the presence of worsening IA (see Fig. S3).Thus, these data suggest that IA plays an important pathogenicrole in the development of �-cell dysfunction in baboons andhumans.
In the baboons with the most extensive IA, FPG concentra-tions increased progressively during the last 3 years of life, whilein baboons in the fourth quintile of IA severity, FPG concen-trations increased in the last year, suggesting that progressionfrom normoglycemia/little-or-no IA to hyperglycemia/extensiveIA occurs in the last 3 years (see Fig. 2D). We also found ahyperbolic relationship (r � 0.942 P � 0.001) (see Fig. S1)between IA severity and IA prevalence, as previously reportedin humans and mice (40, 41). However, in contrast to what isobserved in rodents, amyloid deposition in baboons seems tooccur in 3 phases. The first phase is marked by a large increasein amyloid prevalence (from 0 to 50%) but only a small increasein amyloid severity (from 0 to 9.5%, P � NS). In contrast,amyloid severity increases dramatically in the second phase(from 9.5% to 47.3%, P � 0.001) and a further increase inamyloid prevalence (from 50 to 95%, P � 0.001) is noted. Finally,in the third phase, amyloid severity increases further in eachindividual islet (from 47.3 � to 68.9%, P � 0.001), with negligiblechanges in amyloid prevalence (from 95 to 100%, P � NS).
Similarly to what occurs in humans, hyperglycemia was par-alleled by increased insulin resistance and decreased �-cellfunction. Moreover, hyperglycemia and IA produced an additivenegative effect on �-cell function (see Fig. 1) (1, 4, 5). Therelationship between IA severity and FPI concentrations wasthat of an inverted U-shaped curve consistent with previousreports in humans and nonhuman primates during the progres-sion from normal glucose tolerance to T2DM (1, 20, 26, 27, 42).
Using a multivariate analysis, we found that increased FFAconcentrations and the increased magnitude of IA were the mostimportant determinants of fasting hyperglycemia. Both insulinresistance and the incidence of T2DM increase with age, and inour baboon population aging was positively correlated with IA(42). Multivariate analysis identified age and FPG as the bestpredictors of IA severity, thereby allowing us to generate aequation to predict IA severity.
Amyloid deposition has been associated with �-cell apoptosis,both in vivo and in vitro (21, 23, 24, 43, 44). Surprisingly, withthe increase in the severity of IA, we found an increased rate ofboth replication and apoptosis in the islet cells (see Fig. 3 A andB). The increase in islet-cell apoptosis was limited to � cells,while the increase in islet-cell replication was exclusively perti-nent to � cells (see Fig. 3 E–R). Therefore, progressive IA isassociated not only with increased �-cell apoptosis (reducedrelative �-cell volume) but also with increased �-cell replicationand hypertrophy (increased relative �-cell volume). Althoughreduced �-cell volume, increased �-cell volume, and relative orabsolute hyperglucagonemia have been reported previously,�-cell proliferation and hypertrophy have not been reportedpreviously in nonhuman primates or in humans with T2DM, toour knowledge, and could represent a plausible biological ex-planation for hyperglucagonemia (6, 20, 45–47).
In conclusion, we propose that in the presence of a predis-posing genetic background, the combination of environmentalfactors (high-fat diet and obesity) may precipitate insulin resis-tance with an over-stimulation of � cells to over-secrete insulinto maintain normoglycemia. Concurrent with hyperinsulinemia,increased IAPP secretion and the beginning of IAPP deposition(both intracellularly and extracellularly) occurs. Whether IA isa cause or consequence of �-cell dysfunction/hyperglycemia iscontroversial, but we believe that IA plays a causative role in the�-cell dysfunction/apoptosis that is observed in T2DM in amanner that is similar to other human diseases that are associ-ated with amyloid deposits, causing dysfunction of the affectedtissue and organs (18, 20, 21, 23–25, 27, 43, 45, 48–50). In thiscontext, �-cell proliferation and hypertrophy occurs, leading toan imbalance in the �-/�-cell ratio (islet of Langerhans dysfunc-tional remodeling) and the onset of overt T2DM (Fig. 5). Furtherstudies will aim to understand the molecular mechanisms ofthese phenomena and novel treatments based on them.
Materials and MethodsMethods for sequencing of baboon IAPP, determining its predicted fibrillo-genic propensities, and immunofluorescence staining are described in SIMaterials and Methods.
Baboons. We examined retrospectively all necropsies performed in baboons overthe last 15 years (from 1994 to 2008) at the Southwest National Primate Research
Fig. 4. IA is associated with a reduction in the relative�-cell volume and an increase in the relative �-cell volumedepending on �-cell proliferation and hypertrophy. Rela-tive �- and �-cell volume (A and B) according to amyloidseverity; relative �-cell volume according to FPG (C); �-cellnumber/total islet cell number (D), absolute �-cell number/islet (E), and �-cell size (F) according to amyloid severity. *,P � 0.05 vs. control group.
Guardado-Mendoza et al. PNAS Early Edition � 5 of 7
MED
ICA
LSC
IEN
CES
Center at the Southwest Foundation for Biomedical Research at San Antonio. Allanimals had been fed standard chow diet 5038 (Purina) and received water adlibitum. All animals in this report were cared for in compliance with the Guide forthe Care of Laboratory Animals. All procedures were approved by the SFBRInstitutional Animal Care and Use Committee. The SFBR is accredited by theAssociation for Assessment and Accreditation of Laboratory Animal Care, Inter-national. Out of the 2,254 screened baboons, 150 met the following eligibilitycriteria: (i) age �8 years, (ii) availability of pancreatic tissue, and (iii) availability ofanthropometric and laboratory data. Exclusion criteria were (i) presence ofextrapancreatic amyloidosis and (ii) participation in experimental protocols thatcould theoretically affect pancreatic amyloid deposition.
Baboons were considered overweight (�21.7 and �33.6 kg in females andmales, respectively) when above the 75th percentile of a body weight distri-bution (see Fig. S2 A and B). Normal FPG values (80 � 1.2 and 79 � 1.3 mg/dLin females and males, respectively) were identified by measuring FPG in 452healthy adult baboons (see Fig. S2 C and D). The selected 150 baboons weredivided into quintiles according to the FPG and IA.
Analytical Measurements and Metabolic Parameters. FPG, HbA1c, insulin,glucagon, FFA, insulin secretion index (HOMA-�), insulin resistance index(HOMA-IR), and adipose tissue insulin resistance were measured as describedin SI Materials and Methods.
Histology and Immunohistochemistry. All of the 150 pancreases were fixed in10% neutral-buffered formalin and paraffin embedded. Sections 5-�m thick
were stained with H&E and with Congo red. For immunohistochemistry, afterendogenous peroxidase activity inhibition, 3-�m-thick sections were incu-bated with the primary antibody at 4 °C for 18 to 20 h, followed by theavidin–biotin complex procedure (51). Immunoreactions were developedusing 0.03% 3,3-diaminobenzidine tetrahydrochloride. The following anti-bodies were used: anti-insulin mouse monoclonal (clone AE9D6, BiogenexLaboratories), anti-glucagon rabbit polyclonal (Milab), anti-caspase cleavageproduct of cytokeratin 18 mouse monoclonal (clone M30, Hoffmann-LaRoche), and anti-Ki67 mouse monoclonal (clone MIB1, Dako). Colocaliza-tion studies were performed using double-label immunohistochemical stains(52). Ki67- and M30-positive cells were counted in a subgroup of 20 pancreasesthat were divided into 3 groups according to the severity of islet amyloidosisand were expressed as the percentage of positive cells over total counted isletcells (with a minimum of 500 counted cells). The observers (C. Placidi, G.F., andS.L.R.) were blind to the severity of islet amyloidosis at the time of thequantification of proliferating or apoptotic cells.
Morphometric Analysis. Morphometric analysis was performed using the Com-puter Assisted Stereology Toolbox (CAST) 2.0 system from Olympus and usingthe stereology fundamentals that allowed us to calculate the area and volumeof the different microscopic structures through the use of lines and points. Inthis way, IA was expressed as the percentage of islet area occupied by amyloiddeposits (relative amyloid area), and the relative volume of � and � cells as thepercentage of islet volume occupied by these specific endocrine cells; �-cellsize and number were also measured (see SI Materials and Methods).
Statistical Analysis. Data are presented as mean � SEM. Variables with askewed distribution were log transformed. ANOVA was used for comparisonsbetween more than 2 groups with a Bonferroni as a post hoc test. Pearson’scorrelation coefficient was used to evaluate correlations between variables.ROC analysis was used to examine the sensitivity, specificity, and predictivevalues of different glucose levels to estimate IA severity. Regression analysiswas performed to evaluate the impact of different variables on FPG and IAseverity. A P � 0.05 was considered statistically significant.
ACKNOWLEDGMENTS. We thank Iram P. Rodriguez-Sanchez for technical helpin the sequencing of IAPP, Dr. David Eisenberg (Howard Hughes Institute andUniversity of California at Los Angeles) for critical discussion, and Dr. Leslie DavidHillis for enthusiastic support and critical reading of the manuscript. This workwas supported by start-up funds from the University of Texas Health ScienceCenter (F.F.). R.G.-M. was supported by a Ralph A. DeFronzo Postdoctoral Fellow-ship from Mexican Endocrine Society/Sanofi-Aventis and the Consejo Nacional deCiencia y Tecnologia. This work is part of the PhD requirements for R.G.-M. at theUniversity of Colima, Mexico, and was partially supported by the National Insti-tutes of Health/National Center for Research Resources Grant P51 RR013986 tothe Southwest National Primate Center; the investigation was conducted in partin facilities constructed with support from the Research Facilities ImprovementProgram under Grant numbers C06 RR014578, C06 RR013556, C06 RR015456, C06RR017515 (to G.B.H., E.J.D., A.G.C.). J.H. was supported by Robert A. WelchFoundation Grant AQ-1399.
1. Gastaldelli A, Ferrannini E, Miyazaki Y, Matsuda M, DeFronzo RA (2004) Beta-celldysfunction and glucose intolerance: results from the San Antonio metabolism (SAM)study. Diabetologia 47:31–39.
2. Taniguchi CM, Emanuelli B, Kahn CR (2006) Critical nodes in signalling pathways:insights into insulin action. Nat Rev Mol Cell Biol 7:85–96.
3. Biddinger SB, Kahn CR (2006) From mice to men: insights into the insulin resistancesyndromes. Annu Rev Physiol 68:123–158.
4. Weir GC, Bonner-Weir S (2004) Five stages of evolving beta-cell dysfunction duringprogression to diabetes. Diabetes 53 Suppl 3:S16–S21.
5. Federici M, et al. (2001) High glucose causes apoptosis in cultured human pancreaticislets of Langerhans: a potential role for regulation of specific Bcl family genes towardan apoptotic cell death program. Diabetes 50:1290–1301.
6. Butler AE, et al. (2003) Beta-cell deficit and increased beta-cell apoptosis in humanswith type 2 diabetes. Diabetes 52:102–110.
7. Clark A, et al. (1990) Islet amyloid polypeptide in diabetic and non-diabetic PimaIndians. Diabetologia 33:285–289.
8. Rocken C, Linke RP, Saeger W (1992) Immunohistology of islet amyloid polypeptide indiabetes mellitus: semi-quantitative studies in a post-mortem series. Virchows Arch APathol Anat Histopathol 421:339–344.
9. Sempoux C, Guiot Y, Dubois D, Moulin P, Rahier J (2001) Human type 2 diabetes:morphological evidence for abnormal beta-cell function. Diabetes 50 Suppl 1:S172–S177.
10. Zhao HL, et al. (2003) Prevalence and clinicopathological characteristics of islet amyloidin Chinese patients with type 2 diabetes. Diabetes 52:2759–2766.
11. Hoppener JW, Ahren B, Lips CJ (2000) Islet amyloid and type 2 diabetes mellitus. N EnglJ Med 343:411–419.
12. Cooper GJ, et al. (1987) Purification and characterization of a peptide from amyloid-rich pancreases of type 2 diabetic patients. Proc Natl Acad Sci USA 84:8628–8632.
13. Westermark P, Wernstedt C, O’Brien TD, Hayden DW, Johnson KH (1987) Islet amyloidin type 2 human diabetes mellitus and adult diabetic cats contains a novel putativepolypeptide hormone. Am J Pathol 127:414–417.
14. Hou X, et al. (1999) Prolonged exposure of pancreatic beta cells to raised glucoseconcentrations results in increased cellular content of islet amyloid polypeptide pre-cursors. Diabetologia 42:188–194.
15. Marzban L, et al. (2006) Impaired NH2-terminal processing of human proislet amyloidpolypeptide by the prohormone convertase PC2 leads to amyloid formation and celldeath. Diabetes 55:2192–2201.
16. Westermark P, Li ZC, Westermark GT, Leckstrom A, Steiner DF (1996) Effects of beta cellgranule components on human islet amyloid polypeptide fibril formation. FEBS Lett379:203–206.
17. Paulsson JF, Westermark GT (2005) Aberrant processing of human proislet amyloidpolypeptide results in increased amyloid formation. Diabetes 54:2117–2125.
18. Westermark GT, Westermark P, Berne C, Korsgren O (2008) Widespread amyloiddeposition in transplanted human pancreatic islets. N Engl J Med 359:977–979.
19. Davalli AM, et al. (2008) Disproportionate hyperproinsulinemia, beta-cell restrictedprohormone convertase 2 deficiency, and cell cycle inhibitors expression by humanislets transplanted into athymic nude mice: insights into nonimmune-mediated mech-anisms of delayed islet graft failure. Cell Transplant 17:1323–1336.
20. Clark A, et al. (1988) Islet amyloid, increased A-cells, reduced B-cells and exocrinefibrosis: quantitative changes in the pancreas in type 2 diabetes. Diabetes Res 9:151–159.
21. Huang CJ, et al. (2007) High expression rates of human islet amyloid polypeptideinduce endoplasmic reticulum stress mediated beta-cell apoptosis, a characteristic ofhumans with type 2 but not type 1 diabetes. Diabetes 56:2016–2027.
22. Lorenzo A, Razzaboni B, Weir GC, Yankner BA (1994) Pancreatic islet cell toxicity ofamylin associated with type-2 diabetes mellitus. Nature 368:756–760.
23. Mirzabekov TA, Lin MC, Kagan BL (1996) Pore formation by the cytotoxic islet amyloidpolypeptide amylin. J Biol Chem 271:1988–1992.
24. Ritzel RA, Meier JJ, Lin CY, Veldhuis JD, Butler PC (2007) Human islet amyloid polypep-tide oligomers disrupt cell coupling, induce apoptosis, and impair insulin secretion inisolated human islets. Diabetes 56:65–71.
25. Westermark P, Wilander E (1978) The influence of amyloid deposits on the islet volumein maturity onset diabetes mellitus. Diabetologia 15:417–421.
Fig. 5. Proposed natural history of the events leading to the progressionfrom normal glucose tolerance to T2DM in baboons.
6 of 7 � www.pnas.org�cgi�doi�10.1073�pnas.0906471106 Guardado-Mendoza et al.
26. Howard CF, Jr. (1986) Longitudinal studies on the development of diabetes in individ-ual Macaca nigra. Diabetologia 29:301–306.
27. de Koning EJ, Bodkin NL, Hansen BC, Clark A (1993) Diabetes mellitus in Macacamulatta monkeys is characterised by islet amyloidosis and reduction in beta-cellpopulation. Diabetologia 36:378–384.
28. Chavez AO, et al. (2008) Physiological and molecular determinants of insulin action inthe baboon. Diabetes 57:899–908.
29. DeFronzo RA, Bonadonna RC, Ferrannini E (1992) Pathogenesis of NIDDM. A balancedoverview. Diabetes Care 15:318–368.
30. Hubbard GB, Steele KE, Davis KJ, 3rd, Leland MM (2002) Spontaneous pancreatic isletamyloidosis in 40 baboons. J Med Primatol 31:84–90.
31. Stokes WS (1986) Spontaneous diabetes mellitus in a baboon (Papio cynocephalusanubis). Lab Anim Sci 36:529–533.
32. Comuzzie AG, et al. (2003) The baboon as a nonhuman primate model for the study ofthe genetics of obesity. Obes Res 11:75–80.
33. Gibbs RA, et al. (2007) Evolutionary and biomedical insights from the rhesus macaquegenome. Science 316:222–234.
34. Anonymous (2005) Initial sequence of the chimpanzee genome and comparison withthe human genome. Nature 437:69–87.
35. Chavez AO, et al. (2009) Predictive models of insulin resistance derived from simplemorphometric and biochemical indices related to obesity and the metabolic syndromein baboons. Cardiovasc Diabetol 8:22–30..
36. Anonymous (2008) Diagnosis and classification of diabetes mellitus. Diabetes Care 31Suppl 1:S55–S60.
37. Hayden MR, et al. (2007) Longitudinal ultrastructure study of islet amyloid in the HIPrat model of type 2 diabetes mellitus. Exp Biol Med (Maywood) 232:772–779.
38. Verchere CB, et al. (1996) Islet amyloid formation associated with hyperglycemia intransgenic mice with pancreatic beta cell expression of human islet amyloid polypep-tide. Proc Natl Acad Sci USA 93:3492–3496.
39. Zraika S, et al. (2007) Glucose- and time-dependence of islet amyloid formation in vitro.Biochem Biophys Res Commun 354:234–239.
40. Wang F, Hull RL, Vidal J, Cnop M, Kahn SE (2001) Islet amyloid develops diffuselythroughout the pancreas before becoming severe and replacing endocrine cells.Diabetes 50:2514–2520.
41. Westermark P (1972) Quantitative studies on amyloid in the islets of Langerhans. UpsJ Med Sci 77:91–94.
42. Martin BC, et al. (1992) Role of glucose and insulin resistance in development of type2 diabetes mellitus: results of a 25-year follow-up study. Lancet 340:925–929.
43. Matveyenko AV, Gurlo T, Daval M, Butler AE, Butler PC (2009) Successful versus failedadaptation to high-fat diet-induced insulin resistance: the role of IAPP-induced beta-cell endoplasmic reticulum stress. Diabetes 58:906–916.
44. Paulsson JF, Andersson A, Westermark P, Westermark GT (2006) Intracellular amyloid-like deposits contain unprocessed pro-islet amyloid polypeptide (proIAPP) in beta cellsof transgenic mice overexpressing the gene for human IAPP and transplanted humanislets. Diabetologia 49:1237–1246.
45. Yoon KH, et al. (2003) Selective beta-cell loss and alpha-cell expansion in patients withtype 2 diabetes mellitus in Korea. J Clin Endocrinol Metab 88:2300–2308.
46. Iki K, Pour PM (2007) Distribution of pancreatic endocrine cells including IAPP-expressing cells in non-diabetic and type 2 diabetic cases. J Histochem Cytochem55:111–118.
47. Dunning BE, Gerich JE (2007) The role of alpha-cell dysregulation in fasting andpostprandial hyperglycemia in type 2 diabetes and therapeutic implications. EndocrRev 28:253–283.
48. Janson J, Ashley RH, Harrison D, McIntyre S, Butler PC (1999) The mechanism of isletamyloid polypeptide toxicity is membrane disruption by intermediate-sized toxicamyloid particles. Diabetes 48:491–498.
49. Chiti F, Dobson CM (2006) Protein misfolding, functional amyloid, and human disease.Annu Rev Biochem 75:333–366.
50. Westermark P (2005) Aspects on human amyloid forms and their fibril polypeptides.FEBS J 272:5942–5949.
51. Hsu SM, Raine L, Fanger H (1981) Use of avidin-biotin-peroxidase complex (ABC) inimmunoperoxidase techniques: a comparison between ABC and unlabeled antibody(PAP) procedures. J Histochem Cytochem 29:577–580.
52. Lan HY, Mu W, Nikolic-Paterson DJ, Atkins RC (1995) A novel, simple, reliable, andsensitive method for multiple immunoenzyme staining: use of microwave oven heat-ing to block antibody crossreactivity and retrieve antigens. J Histochem Cytochem43:97–102.
Guardado-Mendoza et al. PNAS Early Edition � 7 of 7
MED
ICA
LSC
IEN
CES
Supporting InformationGuardado-Mendoza et al. 10.1073/pnas.0906471106SI Materials and MethodsAnalytical Measurements and Metabolic Parameters. FPG was mea-sured by the glucose oxidase method with the SYNCHRON CXSystem (Beckman Coulter, Inc), HbA1c by the HPLC method,plasma insulin concentration by RIA (Linco Research), plasmaglucagon concentration by RIA (Euro-Diagnostica AB), andFFA FFA concentration with a fluorometric method (WAKOHR Series NEFA-HR). Insulin resistance was estimated by usingthe homeostasis model assessment and insulin secretion by usingthe HOMA-� cell function, as previously described (1). Theadipose tissue insulin resistance index was also calculated as theresult of FFA � FPI.
Molecular Cloning and Sequencing of Baboon IAPP. Total RNA wasisolated from the pancreas of 3 baboons using TRIzol Reagent(Molecular Research Center). RNA was treated with RQ1DNase (Promega) for 30 min to eliminate traces of DNA. Twomicrograms of total RNA were used in a reverse transcription(RT) reaction using the MLV reverse transcriptase by Ambionand 200 ng per reaction of random primers by Invitrogen,according to manufacturer’s directions. IAPP was amplified byPCR under the following conditions: 94 °C for 5 min followed by40 cycles of 94 °C � 45”, 55 °C � 45”, and elongation step of72 °C � 45”. A final elongation step of 72 °C for 10 min wasconducted. The PCR products were analyzed in a 2% agarose gelstained with ethidium bromide. PCR reactions were digestedwith a mixture of exonuclease I and shrimp phosphatase (1:2) for30 min at 37 °C followed by denaturation at 80 °C. The sequenc-ing reaction was conducted with Big dye terminator (AppliedBiosystems) according to manufacturer’s directions. Primersused for cloning and sequencing baboon IAPP were as follows:Forward 1 TGCTGTTGGGGGTTTTATTC, Reverse 1 CCT-GAGCCCAGAAAGTCAAG, Forward 2 GCTTG-GACTCTTTTCTTGAAGC, Reverse 2 CGTTCTTAAACCT-GTGCCACT.
The primers were designed on Primers 3.0 using the predictedsequence for rhesus monkey IAPP (XM 001098290). Sequenceswere analyzed in a 3100 DNA analyzer (Applied Biosystems).The obtained data were aligned using the Sequencer v 4.0software and compared with the human sequence in BLAST(www.ncbi.nlm.nih.gov/blast) and compared with amylin se-quences of other species using ClustalW (www.Clustalw.org).
Fibrillogenic Propensities of Baboon IAPP. Fibrillogenic propensitiesof baboon and human IAPP were predicted using a structure-based algorithm originally described by Thompson et al. (2). Thisalgorithm uses the crystal structure of the fibril-forming peptideNNQQNY from the sup35 prion protein of Saccharomycescerevisiae, which makes up the cross-beta spine of amyloid-likefibrils (3). Each 6-residue peptide not containing a proline fromthe full-length sequence of IAPP is threaded onto the NNQQNYstructure backbone, and the energetic fit is evaluated using theRosetta Design program. Additionally, the quality of the steric-zipper interface is compared in terms of shape complementarityand surface area to other amyloid-like peptides reported bySawaya et al. (4). Based on these experimental amyloid-likepeptide structures, an energy threshold of �23 kcal/mol waschosen. Segments with energies equal to or below this thresholdare deemed to have high fibrillogenic propensity. The energiesof all hexameric peptides were plotted with the indicated residuebeing the first residue of the hexameric segment. Each segment
is color-coded according to its energy, which is representative offibrillogenic propensity.
Electron Microscopy. A subgroup of pancreases with IA under-went electron microscopy immunocytochemistry. Samples werefixed for 2 h at 4 °C in a mixture of 2% paraformaldehyde and0.5% glutaraldehyde in 0.05 M pH 7.3 cacodylate buffer, andembedded in London White Resin. Thin sections, after incuba-tion with ovalbumin 1% in TBS 0.05M pH 7.4 for 5 min at roomtemperature, were incubated for 24 h at 4 °C with anti-IAPPantibody (Peninsula Laboratories Inc.), then with 1:50 gold-tagged goat anti-rabbit (EY Laboratories) for 1 hour at roomtemperature, and finally counterstained with uranyl acetate andlead citrate. Specificity controls consist of omission of the firstlayer and use of tissues with or without pertinent antigens. Thinsections are examined with a Philips (Morgagni 268 D) electronmicroscope.
Morphometric Analysis. Morphometric analysis was performedusing the Computer Assisted Stereology Toolbox (CAST) 2.0system from Olympus and using the stereology fundamentspreviously described on pancreatic sections randomly collectedfrom the pancreas body and tail (5, 6). The operator was blindedto the metabolic status of the baboon and the reproducibility ofthe measurements was estimated twice in 5 specimens with acoefficient of variation less than 5%. Each field was selectedrandomly using the CAST meander sampling. We analyzed 84 �39 mm2 of pancreatic tissue and 106 � 48 islets per animal. Ineach field, point counting of total pancreatic tissue, islets, andamyloid deposits was performed at the magnification of 40� tocalculate the relative volume of each component. Relative isletand amyloid volumes were calculated by using the followingformulas: (i) relative islet volume: (IP/TP) � 100, where IP �points that hit islet cells and TP � total pancreas points; (ii)relative amyloid volume: (IA/TP) � 100, where IA � points thathit amyloid deposits. Total pancreatic points averaged 9,598 �3,203 per slice per baboon. Stereology was also applied tocalculate the relative amyloid area (percentage of islet areaoccupied by amyloid deposits) by using the formula (2 � I/LT),where I � number of intersections made by the lines with respectto the structure under study for all fields per slice (4,799 � 1,601lines evaluated per slice/baboon) and LT � total line length.Relative amyloid area was calculated by superimposing a seriesof test lines (line length � 54.4 �m) in a random orientation onthe histological images and counting the intersections with thestructure of interest. These 2 measurements of IA severity(relative amyloid volume and relative amyloid area) were tightlycorrelated (r � 0.977, P � 0.0001). An additional analyzedparameter were the islet density being the number of islets perscreened tissue area expressed in mm2, mean-islet size (total areaoccupied by the islets in �m2 divided by the total number of isletsin that specific area) and amyloid prevalence (percentage ofislets with any degree of amyloid deposition). The quantificationof the relative �-cell volume/islet was done by dividing the totalpoints that hit � cells over the total number of points that hitpancreatic islets. The same method was used for quantificationof the relative �-cell volume. The relative �- and �-cell volumewas measured in 40 baboons randomly selected and with differ-ent levels of IA and FPG. Measurement of �-cell numbers andsize was done in the 20 cases used for the Ki67 and M30 staining.Counting of the � cells was performed in the glucagon stains, andat least 30 islets were randomly selected per case and analyzed
Guardado-Mendoza et al. www.pnas.org/cgi/content/short/0906471106 1 of 12
using the CAST meander sampling; �-cell size (�m2) wasestimated inserting a unique point inside the cell and severalprobe lines and marking the intersections between the bordercell and the probe lines.
Immunofluorescence Staining. Sections 3-�m thick were fixed andimmunostained as previously described (7). Briefly, after antigenretrieval by microwave heating in citrate buffer, sections wereimmunostained with the anti-Ki67 antibody (4 °C for 18–20 h),followed by incubation with biotin-conjugated anti-rabbit andFITC-conjugated streptavidin. To visualize � and � cells, sec-tions were then stained with anti-glucagon and anti-insulinantibodies (2 h at room temperature) followed by TRITC- and
CY5-conjugated secondary reagents. The following antibodieswere used: anti-insulin guinea pig monoclonal (Linco), anti-glucagon rabbit polyclonal (Milab), and anti-Ki67 mouse mono-clonal (clone MIB1, Dako). Secondary antibodies were fromJackson ImmunoResearch. Islets were imaged using a Bio-RadMRC 1024 confocal laser scanning microscope. To reduce thebleed through, confocal images were acquired sequentially, usingthe LaserSharp2000 software with a low iris diameter (1–2). Thefluorophores (FITC, TRITC, and Cy5) are all commonly usedfor triple immunostaining and the bleed-through for thesefluorophores is negligible when sequential scanning is used.Background signal caused by nonspecific binding was subtractedfrom ‘‘test’’ images.
1. Matthews DR, et al. (1985) Homeostasis model assessment: insulin resistance andbeta-cell function from fasting plasma glucose and insulin concentrations in man.Diabetologia 28:412–419.
2. Thompson MJ, et al. (2006) The 3D profile method for identifying fibril-formingsegments of proteins. Proc Natl Acad Sci USA 103:4074–4078.
3. Nelson R, et al. (2005) Structure of the cross-beta spine of amyloid-like fibrils. Nature435:773–778.
4. Sawaya MR, et al. (2007) Atomic structures of amyloid cross-beta spines reveal variedsteric zippers. Nature 447:453–457.
5. Freere RH, Weibel ER (1967) Stereologic techniques in microscopy. J Royal Microsc Soc87:25–34.
6. Mandarim-de-Lacerda CA (2003) Stereological tools in biomedical research. An AcadBras Cienc 75:469–486.
7. Federici M, et al. (2001) High glucose causes apoptosis in cultured human pancreaticislets of Langerhans: a potential role for regulation of specific Bcl family genes towardan apoptotic cell death program. Diabetes 50:1290–1301.
Guardado-Mendoza et al. www.pnas.org/cgi/content/short/0906471106 2 of 12
Fig. S1. Amyloid severity and prevalence in baboons and sequence-fibrillogenic propensities of the baboon IAPP. Relation between amyloid severity andamyloid prevalence (A), amino acid sequence of the baboon amylin peptide compared with other species (B). Fibrillogenic propensities of the baboon (C) andhuman IAPP (D) predicted with the 3-D profile method using the NNQQNY backbone. Segments with Rosetta energies of �23 kcal/mol or lower (orange-red)are predicted to have high fibrillogenic propensity.
Guardado-Mendoza et al. www.pnas.org/cgi/content/short/0906471106 3 of 12
Fig. S2. Distribution of body weight (kg) and glucose concentration (mg/dL) in adult female (A and C) and male (B and D) baboons.
Guardado-Mendoza et al. www.pnas.org/cgi/content/short/0906471106 4 of 12
Fig. S3. ROC curve, Prevalence (Prev � % of baboons with amyloid severity �25 and �40%), Sensitivity (Se), specificity (Sp), positive predictive value (PPV),negative predictive value (NPV), and likelihood ratio (LR) for different fasting plasma glucose concentrations to predict amyloid deposits in �25% (A and B) andin �40% (C and D) of islet area.
Guardado-Mendoza et al. www.pnas.org/cgi/content/short/0906471106 5 of 12
Fig. S4. Weight at 5, 10, 15, 20, and 25 years of age in male (A) and female (B) baboons according to the severity of amyloid deposition at death (open circlesGroup 1, open diamonds Group 2, filled diamonds Group 3, open squares Group 4, and filled squares Group 5). (C) Relationship between relative amyloid areaand FPG levels in females (open circles) and males (filled circles). *, P � 0.05 for comparison vs. Group 1 and 2; †, P � 0.05 for comparison vs. Groups 1, 2, and3; ‡, P � 0.05 for comparison vs. all groups. (D) Relative amyloid area according to FPG concentration in overweight (open circles) and nonoverweight (filled circles)baboons. #, P � 0.05 for comparison vs. nonoverweight group within the same glucose levels.
Guardado-Mendoza et al. www.pnas.org/cgi/content/short/0906471106 6 of 12
Fig. S5. Number of � cells/total islet cells (A); number of � cells/islet (B), and � cell size according to FPG (C). *, P � 0.05 vs. control group.
Guardado-Mendoza et al. www.pnas.org/cgi/content/short/0906471106 7 of 12
Fig. S6. Electron microscopy examination reveals abundant fibrillar deposits in the cytoplasm of a sparsely granulated � cell (�) and in the extracellular space,where they are more compact (Inset); in the same picture an � cell (�) with numerous secretory granules and lacking cytoplasmic fibrillar deposits is evident (A).In the � cell, the intracytoplasmic deposits (asterisk) show irregular borders without a membrane, are close and attached to secretory granules and are stronglypositive for IAPP, as demonstrated by immunogold staining (B). (C) A detail of extracellular amyloid deposits that are strongly IAPP-positive and are clearlyseparated from the cytoplasm of a well-granulated endocrine cell (Left) by an evident cell membrane (arrows). Details are shown in the insets.
Guardado-Mendoza et al. www.pnas.org/cgi/content/short/0906471106 8 of 12
Fig. S7. Congo red stains and IAPP immunohistochemistry performed in consecutive sections of 3 different cases of diabetic baboon pancreases. Amorphousglobules of amyloid that replace islet cells are stained in red using Congo red stain (A) and show the typical green birefringence in polarized light (B). Islet amyloidis composed of IAPP as demonstrated by immunohistochemical staining with anti-IAPP antibody (C).
Guardado-Mendoza et al. www.pnas.org/cgi/content/short/0906471106 9 of 12
Table S1. Morphometric analysis of the pancreases of 150 baboons divided according to the severity of islet amyloid deposition(relative amyloid area)
Variable
Group 1 IA� 5.5%(n � 30)
Group 2 IA5.5–17%(n � 30)
Group 3 IA18–35%(n � 30)
Group 4 IA36–51%(n � 30)
Group 5 IA� 51%(n � 30) P group
Mean islet size, �m² 8,227 � 468 9,471 � 742 9,255 � 465 11,091 � 725a 12,819 � 947a,b,c �0.001Relative islet volume, % of total
pancreas2.6 � 0.2 3.4 � 0.3 3.4 � 0.2 4.1 � 0.4a 5.4 � 0.7a,b,c,d 0.001
Islet density, islets/mm² 3.1 � 0.2 3.6 � 0.3 3.8 � 0.2 3.6 � 0.2 4.0 � 0.3a 0.013Relative amyloid volume, % of total
pancreas0.5 � 0.1 0.5 � 0.1 1.1 0.2a,b 1.8 � 0.4a,b,c 2.4 � 0.4a,b,c,d �0.001
Relative amyloid area, % of islet 2.2 � 0.3 11.0 � 0.8a 26.7 � 1.0a,b 44.8 � 0.8a,b,c 67.5 � 2.2a,b,c,d �0.001
aP � 0.05 for comparisons vs. Group 1.bP � 0.05 for comparisons vs. Group 2.cP � 0.05 for comparisons vs. Group 3.dP � 0.05 for comparisons vs. Group 4.
Guardado-Mendoza et al. www.pnas.org/cgi/content/short/0906471106 10 of 12
Table S2. Body weight during life and fasting plasma glucose during the last 4 years of life in baboons stratified according toseverity of amyloid deposition
Variable
Group 1 amyloid� 5.5%
(n � 30) �5.5%
Group 2 amyloid5.5–17%(n � 30)
Group 3 amyloid18–35%(n � 30)
Group 4 amyloid36–51%(n � 30)
Group 5 amyloid� 51%(n � 30) P group
Sex, F/M 14/16 18/12 25/5 20/10 24/6 0.007Age, years 16.2 � 0.9 19.3 � 0.8ª 19.8 � 0.9ª 19.9 � 0.9ª 21.6 � 0.6ª 0.001Weight, kgNo. of females 14 18 25 20 24
5 years of age 12.5 � 0.9 13.8 � 0.5 12.6 � 0.4 14.2 � 0.6 14.7 � 0.6a,c 0.01110 years of age 16.6 � 0.9 17.6 � 1.0 18.7 � 0.8 20.2 � 0.8a,b 20.9 � 0.5a,b,c 0.00415 years of age 17.6 � 1.0 18.5 � 0.8 19.1 � 0.6 20.9 � 0.7a,b 23.1 � 0.9a,b,c 0.00120 years of age 16.9 � 1.3 17.5 � 0.9 17.9 � 0.7 21.2 � 1.1a,b,c 23.4 � 1.0a,b,c 0.001Last weight 15.7 � 0.6 16.2 � 0.8 15.8 � 0.7 18.9 � 1.2c 21.4 � 1.3a,b,c 0.001Maximum weight 19.8 � 1.0 20.0 � 0.9 20.3 � 0.8 23.6 � 0.9a,b,c 25.7 � 0.8a,b,c 0.001Overweight at age 10(%)
1 (7.1%) 3 (16.6%) 4 (16.0%) 7 (35.0%) 10 (41.6%) a 0.03
Overweight at age 15(%)
2 (14.2%) 3 (16.6%) 6 (24.0%) 9 (45.0%) 12 (50.0%)a,b 0.02
Overweight at age 20(%)
1 (7.1%) 1 (5.5%) 2 (8.0%) 10 (50.0%)a,b,c 15 (62.5%)a,b,c 0.002
Overweight at death(%)
1 (7.1%) 1 (5.5%) 2 (8.0%) 6 (30.0%) 9 (37.5%)a,b,c 0.042
Weight, kgNo. of males 16 12 5 10 6
5 years of age 16.3 � 0.8 17.4 � 1.0 19.4 � 0.8 18.6 � 1.7 17.5 � 1.0 0.45210 years of age 30.4 � 1.1 30.0 � 0.9 32.0 � 1.2 31.0 � 1.8 31.2 � 1.1 0.91115 years of age 30.6 � 1.8 31.0 � 1.7 32.0 � 2.9 31.9 � 1.3 32.9 � 2.2 0.92620 years of age 32.5 � 2.9 28.9 � 1.7 30.4 � 2.1 28.3 � 1.2 32.5 � 3.4 0.668Last weight 30.2 � 2.0 29.2 � 1.5 29.6 � 1.4 29.8 � 2.1 30.7 � 3.6 0.993Maximum weight 33.2 � 1.9 33.5 � 1.6 33.2 � 1.8 33.8 � 1.7 35.4 � 2.6 0.968Overweight at age 10(%)
2 (12.5%) 2 (16.6%) 1 (25.0%) 2 (25.0%) 1 (16.6%) 0.67
Overweight at age 15,(%)
2 (12.5%) 2 (16.6%) 1 (25.0%) 1 (10.0%) 2 (33.3%) 0.488
Overweight at age 20,(%)
2 (12.5%) 2 (16.6%) 1 (25.0%) 0 2 (33.3%) 0.941
Overweight at death,(%)
2 (12.5%) 3 (25.0%) 1 (25.0%) 2 (25.0%) 1 (16.6%) 0.79
FPG, mg/dLAt death 75 � 2 83 � 3 96 � 7 115 � 7a,b 187 � 21a,b,c,d 0.0011 year before 87 � 6 86 � 7 77 � 4 84 � 4 168 � 29a,b,c,d 0.0012 years before 83 � 5 79 � 3 70 � 4 89 � 6 113 � 33a,b,c 0.0473 years before 81 � 5 84 � 2 85 � 11 86 � 6 84 � 10 0.989
FPG, fasting plasma glucose.aP � 0.05 for comparisons vs. Group 1.bP � 0.05 for comparisons vs. Group 2.cP � 0.05 for comparisons vs. Group 3.dP � 0.05 for comparisons vs. Group 4.
Guardado-Mendoza et al. www.pnas.org/cgi/content/short/0906471106 11 of 12
Table S3. Univariate and multivariate regression analyses for the prediction of amyloid severity (relative amyloid area, %)
Univariate analysis Multivariate analysis
r P value Partial R P value F value
Model 1Age, years 0.330 �0.001 Age, years 0.325 �0.001 18Sex (1 � F, 2 � M) �0.248 0.009 Sex (1 � F, 2 � M) 0.06 0.498 �4Overweight at 15 years (1 � yes, 2 � no) �0.268 �0.001 Overweight at 15 years (1 � yes, 2 � no) �0.17 0.054 �4FFA, mEq/L 0.269 0.001 FFA (mEq/L) �0.11 0.203 �4ln(glucose) 0.691 �0.001 ln(glucose) 0.646 �0.0001 121ln(glucagon) 0.254 0.003 ln(insulin) �0.05 0.609 �4ln(insulin) �0.090 0.290 ln(glucagon) 0.002 0.978 �4
Adjusted R2 0.535 �0.0001Model 2
Age, years 0.310 �0.001ln(glucose) 0.680 �0.001Adjusted R2 0.519 �0.001
*, ●●●
Guardado-Mendoza et al. www.pnas.org/cgi/content/short/0906471106 12 of 12
Top Related