Williams Syndrome Transcription Factor is critical for neural crest cell function in Xenopus laevis

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

http://www.elsevier.com/copyright

Author's personal copy

Williams Syndrome Transcription Factor is critical for neuralcrest cell function in Xenopus laevis

Chris Barnett a, Oya Yazgan a, Hui-Ching Kuo a, Sreepurna Malakar a, Trevor Thomas a,Amanda Fitzgerald a, William Harbour a, Jonathan J. Henry b, Jocelyn E. Krebs a,*

a Department of Biological Sciences, University of Alaska Anchorage, 3101 Science Circle, Anchorage, AK 99508, USAb Department of Cell and Developmental Biology, University of Illinois, 601 S. Goodwin Avenue, Urbana, IL 61801, USA

A R T I C L E I N F O

Article history:

Received 6 January 2012

Received in revised form

31 May 2012

Accepted 1 June 2012

Available online 9 June 2012

Keywords:

WSTF

Neural crest

Xenopus

Williams Syndrome

BAZ1b

Chromatin remodeler

A B S T R A C T

Williams Syndrome Transcription Factor (WSTF) is one of �25 haplodeficient genes in

patients with the complex developmental disorder Williams Syndrome (WS). WS results

in visual/spatial processing defects, cognitive impairment, unique behavioral phenotypes,

characteristic ‘‘elfin’’ facial features, low muscle tone and heart defects. WSTF exists in sev-

eral chromatin remodeling complexes and has roles in transcription, replication, and

repair. Chromatin remodeling is essential during embryogenesis, but WSTF’s role in verte-

brate development is poorly characterized. To investigate the developmental role of WSTF,

we knocked down WSTF in Xenopus laevis embryos using a morpholino that targets WSTF

mRNA. BMP4 shows markedly increased and spatially aberrant expression in WSTF-defi-

cient embryos, while SHH, MRF4, PAX2, EPHA4 and SOX2 expression are severely reduced,

coupled with defects in a number of developing embryonic structures and organs. WSTF-

deficient embryos display defects in anterior neural development. Induction of the neural

crest, measured by expression of the neural crest-specific genes SNAIL and SLUG, is unaf-

fected by WSTF depletion. However, at subsequent stages WSTF knockdown results in a

severe defect in neural crest migration and/or maintenance. Consistent with a mainte-

nance defect, WSTF knockdowns display a specific pattern of increased apoptosis at the

tailbud stage in regions corresponding to the path of cranial neural crest migration. Our

work is the first to describe a role for WSTF in proper neural crest function, and suggests

that neural crest defects resulting from WSTF haploinsufficiency may be a major contrib-

utor to the pathoembryology of WS.

� 2012 Elsevier Ireland Ltd. All rights reserved.

1. Introduction

The development of a multicellular organism is a period of

extensive transcriptional regulation, which is highly depen-

dent on chromatin remodeling. During development, special-

ized cells arise from the gradual loss of pluripotency in the

progeny of embryonic stem cells. Recent studies reveal the

importance of dynamically regulated chromatin structure in

the maintenance of pluripotency and in cell differentiation

(Delgado-Olguin and Recillas-Targa, 2011).

WSTF (Williams Syndrome Transcription Factor), encoded

by the gene WSCR9/BAZ1B, is one of about 25–30 contiguous

genes that are haplodeficient in individuals with Williams

Syndrome (WS). WS is an autosomal dominant disorder

0925-4773/$ - see front matter � 2012 Elsevier Ireland Ltd. All rights reserved.http://dx.doi.org/10.1016/j.mod.2012.06.001

* Corresponding author. Tel.: +1 907 786 1556; fax: +1 907 786 4607.E-mail addresses: [email protected] (C. Barnett), [email protected] (O. Yazgan), [email protected] (S. Malakar),

[email protected] (T. Thomas), [email protected] (A. Fitzgerald), [email protected] (W. Harbour), [email protected] (J.J. Henry), [email protected] (J.E. Krebs).

M E C H A N I S M S O F D E V E L O P M E N T 1 2 9 ( 2 0 1 2 ) 3 2 4 – 3 3 8

Avai lab le at www.sc iencedi rect .com

journal homepage: www.elsevier .com/ locate /modo


occurring in �1 in 8000 live births and is the result of a �1.5

megabase deletion on chromosome 7 (Lu et al., 1998). Individ-

uals with WS exhibit characteristic malformations of cranio-

facial, heart and neural structures, infantile hypercalcaemia,

developmental delays, and complex and distinctive cognitive

and behavioral profiles. The contributions of most of the de-

leted genes to the clinical outcomes of WS patients are not

clear, though a handful of genes have been assigned tentative

roles (reviewed in Osborne, 2010). Evidence from mouse mod-

els suggests that WSTF may play a critical role in heart and

craniofacial development, and WSTF hemizygosity may also

explain the hypercalcaemia observed in WS patients (Ashe

et al., 2008; Yoshimura et al., 2009).

WSTF is a subunit of three well-characterized ATP-

dependent chromatin remodelers: WINAC (WSTF including

the nucleosome assembly complex), WICH (WSTF-ISWI

chromatin remodeling complex) and B-WICH. WSTF is a

170 kDa protein in the BAZ/WAL family, characterized by

six sequential motifs, including motifs implicated in chro-

matin binding. WSTF has roles in DNA repair, replication,

transcriptional activation and repression, and also possesses

histone H2A kinase activity (recently reviewed in Barnett

and Krebs, 2011).

In humans, WSTF transcripts are detected in all sampled

adult tissues (heart, brain, placenta, skeletal muscle, and

ovary) and four fetal tissues (brain, lung, kidney, and liver)

in non-WS individuals (Lu et al., 1998). WSTF mRNA is de-

tected in Xenopus laevis oocytes and is ubiquitous until early

neurulation, when WSTF expression becomes confined to

the neural ectoderm and closing neural tube (Cus et al.

2006). As neural tissue continues to differentiate into the

early tadpole stage, WSTF mRNA localizes to specific neural

structures and cells including the neural tube, optic cup, ante-

rior brain, and migrating cranial neural crest cells (Cus et al.,

2006). WSTF also displays strong expression in the branchial

(pharyngeal) apparatus, a primordium for a number of organs

and facial structures, such as the thyroid, aorta, the maxillary

and mandibular bones, ligaments, and nerves as well as audi-

tory structures like the auditory tube, bones of the middle ear

and the auricles. This branchial arch expression appears to be

limited to a population of cells located deep to the branchial

arch ectoderm and is likely the contribution of cranial neural

crest cells that originate from a space just dorsal to the neural

tube; a number of these cells migrate to the branchial arches

and play a crucial role in the proper development of this

important primordial structure (Noden and Schneider, 2006).

The neural crest is a unique group of embryonic cells

found only in vertebrates (Gans and Northcutt, 1983). The

neural crest originates from the ectoderm of the neural plate

border that undergoes an epithelial-to-mesenchymal transi-

tion, giving rise to neural crest cells during development. This

transition requires the orchestrated activities of a network of

transcription factors that gradually lead to this transition (re-

viewed in Sauka-Spengler and Bronner-Fraser, 2008). Neural

crest cells possess migratory ability as well as the ability to

undergo extensive cellular reprogramming, which results in

an increase in differentiation potential. The pluripotency of

neural crest cells allows them to contribute to a number of

developing tissues, including the central and peripheral ner-

vous system, as well as many non-neural structures such as

bone, cartilage, connective tissue, skin (melanocytes), and

smooth muscle.

The migration and maintenance of the neural crest cells is

guided by morphogens, signaling molecules that are secreted

from surrounding tissues. Bone morphogenic protein 4

(Bmp4) is a key developmental morphogen, and both inhibi-

tion and activation of the BMP4 gene is necessary for proper

induction and maintenance of neural crest (Steventon et al.,

2009). Additionally, both overexpression and inhibition of

BMP4 alters facial development in chick, suggesting accurate

timing and expression of BMP4 is crucial to proper neural

crest function (Creuzet et al., 2002; Ruhin et al., 2003; Wawer-

sik et al., 2005). Sonic hedgehog (Shh) is another morphogen

that along with Bmp4 is critical for the proper patterning of

the neural tube during embryogenesis (sometimes playing

antagonistic roles) and is also important in craniofacial devel-

opment of chick, human and mouse (Briscoe et al., 1999;

Campuzano and Modolell, 1992; Owens et al., 2005; Roelink

et al., 1995). Shh acts as an anti-apoptotic signaling molecule

for neural crest cells (Ahlgren et al., 2002).

Neural crest cells migrate in specific segmented regions

between the overlying ectoderm and underlying mesoderm.

The pathways of cranial neural crest cells are highly con-

served in vertebrate development and proper axial pattern-

ing and organization of the region is critical for proper

formation and migration of cranial neural crest (reviewed

in Basch and Bronner-Fraser, 2006). Migration occurs from

the forebrain and rhombomeres of the hindbrain to regions

in the head and to the branchial arches (Noden and Schnei-

der, 2006). The contributions of neural crest cells are both

unique to and critical for the proper development of all

vertebrates.

Little is known about the role of chromatin remodeling in

the formation of the neural crest and migrating neural crest

cells. One recent study has shown that Chd7 (Chromodomain

helicase DNA-binding domain member 7), an ATP-dependent

chromatin remodeler, is essential for early neural crest for-

mation in Xenopus embryos (Bajpai et al., 2010). In humans,

heterozygous mutation of CHD7 leads to the congenital devel-

opmental disorder CHARGE Syndrome, characterized by spe-

cific craniofacial features, neural defects and malformations

in the eyes, ears and heart (Pagon et al., 1981). Within the

PBAF complex (Polybromo- and BRG1-Associated Factor-con-

taining complex), Chd7 has been shown to bind in vivo to pro-

moter-distal elements of the neural crest specifier SOX9 and

the neural crest gene Twist in human neural crest-like cells

(Bajpai et al., 2010).

A number of the clinical features of WS involve structures

that are derived from the neural crest, including craniofacial

structures, heart and neural tissue. Given this observation,

and the expression of WSTF in neural crest in X. laevis, we

sought to determine the effects of WSTF knockdown in Xeno-

pus embryos, and to particularly address the effects of WSTF

knockdown in neural crest formation. We show specific de-

fects in neural crest cell migration and/or maintenance in

WSTF knockdown Xenopus embryos and propose a model in

which misregulation of BMP4 and SHH expression in WSTF

knockdowns results in the failure of normal neural crest con-

tributions during development. Our data suggest that a num-

ber of the symptoms present in WS patients could be due to

M E C H A N I S M S O F D E V E L O P M E N T 1 2 9 ( 2 0 1 2 ) 3 2 4 – 3 3 8 325


WSTF haploinsufficiency and the downstream effects of this

multifunctional chromatin remodeler subunit.

2. Results

2.1. WSTF Morphant embryos exhibit severe defects inneural development

To determine the function of WSTF in early development,

an anti-WSTF morpholino (MO) was injected into fertilized X.

laevis eggs at the one-cell stage to inhibit the translation of

endogenous WSTF mRNA. Eggs were injected with 42 ng of

either anti-WSTF MO, or with a control MO that is the inverse

of the anti-WSTF MO sequence (INV-MO). The inverse MO-in-

jected embryos are indistinguishable from uninjected con-

trols. Anti-WTSF MO injection results in an average

reduction to �50–60% of endogenous WSTF levels, compara-

ble to the hemizygous state in WS patients (Howald et al.,

2006; Merla et al., 2006). Complete knockdown in early stages

is not achievable due to the presence of high levels of mater-

nally-deposited WSTF protein present in the developing em-

bryos. Knockdown of WSTF protein levels was confirmed by

Western blot (Supplementary Fig. 1).

WSTF knockdown embryos progress normally through the

early stages of development, at least at the gross morpholog-

ical level. However, severe abnormalities become evident

once embryos reach about stage 35, late tailbud stage

(Fig. 1A and B) (Nieuwkoop and Faber, 1967). WSTF knock-

down embryos display abnormal craniofacial development,

including a deformed cement gland, an unusually pro-

nounced indentation above the cement gland (in the region

that will develop into the olfactory organs, primary mouth

and anterior pituitary; Dickinson and Sive, 2007), and a

protruding/misshapen forehead. In addition, the developing

eyes are undersized and irregularly shaped, and the embryos

exhibit exopthalmia (protruding eyes). Finally, the WSTF

knockdown embryos show abnormal A–P axis development

and particularly strong axial curvatures. By stage 41 the

developmental abnormalities are more severe and the em-

bryos die around late tadpole stage, about stage 45. Injections

were performed in numerous independent batches of hun-

dreds of embryos, with each injection resulting in 100% pen-

etrance of this gross morphological phenotype (for example,

in a typical experiment 333/355 embryos, or 94%, injected

with anti-WSTF MO exhibit the strong WSTF phenotype,

while 22/355, or 6%, show a milder phenotype mostly charac-

terized by eye defects). Injection of the INV-MO typically re-

sulted in non-specific developmental defects in <10% of

embryos (for example, in a typical experiment 9/124, or 7%,

embryos exhibit various defects).

To obtain a more detailed understanding of the pheno-

types of the WSTF knockdown embryos, we performed histo-

logical analysis to further characterize the anterior neural

defects. Transverse sections through the anterior region of

the embryos reveal details of the defects in eye and brain

development in the WSTF knockdown embryos. Eye develop-

ment is profoundly disrupted (Fig. 1C and D). The optic cups

are generally shallow and poorly shaped, though in most

(but not all) cases the pigmented retinal epithelium is present.

The multiple layers of the neural retina completely fail to

differentiate and are typically present as a solid mass of

undifferentiated cells. The optic vesicle often retains a sub-

stantial attachment with the forebrain, without a clear optic

nerve. Furthermore, the lens is occasionally absent, or pres-

ent merely as a minimally differentiated thickening within

the surface ectoderm, though in a few cases some primary

lens fibers are detectable. The lenses invariably fail to detach

Fig. 1 – WSTF knockdowns exhibit neural defects and severely impaired eye development. A–B: Embryos (anterior to the left)

injected at the one-cell stage with either WSTF-inverse control MO (top of each panel) or WSTF MO (bottom) at stages 37 (A)

and 41 (B). The WSTF MO injected embryos exhibit reduction and malformation of neural structures, deformed eyes, and

axial defects. Asterisks indicate the pronounced concavity at the site of the presumptive primary mouth. C-F: Stained histo-

logical sections of control morpholino-injected embryos (C, E) and of WSTF knockdown embryos (D, F), all injected at the

one-cell stage. WSTF knockdowns display perturbed lens and retinal cell differentiation (D) and profound disorganization of

neural tissues (F). e: eye; cg: cement gland; l: lens; r: retina; pe: pigmented retinal epithelium; nt: neural tube; nc: notochord.

Scale bars: 1 mm (A and B) and 100 lm (C, D, E & F).

326 M E C H A N I S M S O F D E V E L O P M E N T 1 2 9 ( 2 0 1 2 ) 3 2 4 – 3 3 8


from the ectoderm, and instead remain tightly associated

with this layer. Many lenses protrude outward from the sur-

face ectoderm.

Organization of tissues within the developing brain of

WSTF knockdown embryos is greatly affected as well

(Fig. 1E and F). Neural tissue in the developing brain is poorly

formed and differentiated. There appears to be a lack of cell

proliferation and absence of a clearly defined proliferative

(ventricular) zone. In some cases it appears that there is

incomplete fusion of the neural tube. The prechordal meso-

derm and notochord are frequently malformed, possibly en-

larged in diameter and poorly differentiated.

The whole mounts and sections of embryos in which

WSTF has been globally knocked down (i.e. morpholino in-

jected at the one-cell stage) clearly show that neural develop-

ment is perturbed, and neural tissues are highly disorganized.

It also appears that the amount of neural tissue is reduced in

these embryos, at least in the anterior. This apparent reduc-

tion of neural tissue formation was confirmed by analyzing

the expression of the neural-specific marker Neural Cell

Adhesion Molecule (NCAM) by whole mount in situ hybridiza-

tion (Fig. 2; representative embryos shown from a sample of

8–10 embryos for each stage). In addition to the embryos in

which WSTF expression has been globally knocked down,

we also examined embryos that were injected with anti-

WSTF MO into one cell of an embryo at the two-cell stage of

development (Fig. 2A–C). This results in an embryo in which

the MO affects the embryo unilaterally and thus only exhibits

the knockdown phenotype on the injected side, while the

other side serves as the control. The injected side is traced

by visualizing the fluorescently tagged MO (Fig. 2A).

NCAM expression is reduced in the injected side of a uni-

laterally-injected two-cell stage embryo post-neurulation at

stage 21, particularly in the anterior region and the eye

(Fig. 2B and C). NCAM expression is also reduced in embryos

where WSTF has been globally knocked down. WSTF global-

knockdown embryos at a late tailbud stage (stage 35) show

a severe reduction of NCAM expression compared to INV-

MO injected controls, especially in the brain and branchial ar-

ches (Fig. 2D and E). These data indicate that WSTF is impor-

tant for normal neural tissue development.

2.2. BMP4, SHH and MRF4 genes are misregulated inWSTF knockdown embryos

To further investigate the effects of WSTF knockdown on

neural development, we examined two genes known to regu-

late neural proliferation and differentiation during embryonic

Fig. 2 – WSTF function is required for neural tissue formation in vivo. A: Two-cell stage embryos (dorsal view, anterior at top)

were injected with carboxyfluorescein-labeled WSTF MO unilaterally into a single blastomere; fluorescence indicates the

injected side. B-C: NCAM expression analyzed by whole mount in situ hybridization at late neurulation (stage 21; B: dorsal

view, anterior at top; C: anterior view, dorsal at top). NCAM is normally expressed in the eyes and neural ectoderm. NCAM

signal is diminished in the anterior on the WSTF MO-injected side. Asterisk denotes region of greatest loss of NCAM signal. C:

Anterior view of embryo in (B), highlighting anterior reduction of NCAM expression in the eye rudiments and neural ectoderm

on the injected side. Asterisk denotes loss of NCAM signal. D-E: NCAM expression analyzed by whole mount in situ hybridi-

zation at late tailbud stage (stage 35; side views, anterior to left). D: One-cell stage embryos were injected with WSTF-inverse

MO (INV) and display normal NCAM expression in neural ectoderm, eye (e) and branchial arches (ba). E: One-cell stage

embryos injected with WSTF MO (MO) display reduced NCAM expression at late tailbud stage. Bracket marked by asterisk

indicates loss of NCAM staining in branchial arches in WSTF-MO injected embryos (E). Scale bars: 0.5 mm (A–C) and 1 mm (D

and E).



development. Bmp4 is a signaling molecule from the TGFb/

BMP family of proteins known for neural patterning, cell dif-

ferentiation and cell death (reviewed in Hogan, 1996). The

expression domain of BMP4 is significantly expanded on the

injected side of a unilaterally-injected embryo during late

neurulation (stage 17; Fig. 3A; representative embryos shown

from a sample of �12 embryos for each stage). While normal

BMP4 expression is displayed in embryos globally injected

with inverse morpholino, in global WSTF knockdowns, BMP4

expression is markedly increased in late tailbud stage em-

bryos (stage 40; Fig. 3B), as well as in earlier tailbud embryos

(stage 37) as measured both by in situ hybridization and RT-

qPCR of whole embryos (Fig. 3E and data not shown).

Strikingly, BMP4 expression is spatially misregulated. BMP4

Fig. 3 – SHH, BMP4 and MRF4 are misexpressed in WSTF knockdown embryos. A: BMP4 expression in the neural plate analyzed

by whole mount in situ hybridization at late neurulation (stage 17; dorsal view, anterior at top) in embryos injected with WSTF

morpholino at the two-cell stage. BMP4 expression is expanded beyond its normal domain on the WSTF knockdown side (left)

compared to the uninjected control side (right). B: Whole mount in situ hybridization displaying normal expression pattern of

BMP4 compared to global WSTF knockdown embryos at late tailbud stage (stage 40; side view, anterior to left). One-cell stage

embryos were injected with either WSTF MO (bottom) or WSTF-inverse MO (INV, top). Inverse MO globally injected embryos

display normal BMP4 expression in the hindbrain, developing heart, and faintly in the otic vesicle. Global WSTF knockdowns

display decreased BMP4 anterior expression as well as aberrant expression in dorsal tissues. C: Whole mount in situ hybridi-

zation displaying normal expression of pattern SHH compared to global WSTF knockdowns at late tailbud stage (stage 36–37;

side view, anterior to left). One-cell stage embryos were injected with either WSTF MO (bottom) or WSTF-inverse MO (top).

Globally injected inverse MO embryos display SHH expression in the head and notochord. Global WSTF knockdown embryos

display decreased SHH expression throughout. D: Global WSTF knockdown embryo (right) displaying cyclopia/holoprosen-

cephaly compared to globally injected inverse MO embryo (left) at stage 45 (dorsal views of heads, anterior at top). Arrows

indicate location of eye(s). One-cell stage embryos were injected with either WSTF MO or WSTF-inverse MO. E: Real time RT-

PCR results for BMP4 and SHH graphed as a percentage of normal expression. BMP4 (stage 37) is significantly over-expressed

and SHH expression (stage 15) is significantly reduced in WSTF knockdown embryos injected at the one-cell stage. Data are the

average of 3–4 independent experiments and standard errors are shown. F: MRF4 expression in a stage 15 embryo (dorsal

view, anterior at top) injected with WSTF MO at the two-cell stage. The injected side (left) displays a significant decrease in

normal MRF4 expression in the developing somites. Scale bars: 0.5 mm (A and F) and 1 mm (B–D).



exhibits reduced expression within its normal expression do-

main, specifically in anterior structures like the heart and

hindbrain (Martinez-Barbera et al., 1997). In addition, WSTF

morphants show a marked increase of BMP4 expression with-

in tissues around the dorsal midline that include notochord

and somitic mesoderm, tissues that do not normally express

BMP4 (Fig. 3B and Supplementary Fig. 2).

Shh is known for its role in midline signaling and the

splitting of bilateral eye fields, and is essential for survival

of a number of neural cell types during embryogenesis

(Chiang et al., 1996; Prykhozhij, 2010). SHH transcripts are

significantly decreased in both the anterior regions and neu-

ral tube in global WSTF knockdown embryos compared to

controls (Fig. 3C). Mutations in SHH are linked to holoprosen-

cephaly, the failure or incomplete division of the two hemi-

spheres of the forebrain, and cyclopia, the failure or

incomplete separation of the eye fields (Dubourg et al.,

2007). Consistent with the reduced SHH expression we ob-

serve, WSTF global knockdown embryos that survive well

into the tadpole stage exhibit a severe anterior phenotype

characterized by cyclopia (Fig. 3D). Misregulation of SHH (at

stage 15) and BMP4 (at stage 37) was also confirmed by real

time RT-PCR (Fig. 3E).

SHH is expressed in the notochord, a mesoderm-derived

tissue that defines the axis of all chordates (Yamada et al.,

1993). To further investigate the effect of WSTF depletion on

mesoderm development we assayed the expression of MRF4,

a marker for somites, also a mesoderm-derived tissue. Injec-

tion of anti-WSTF MO into one cell of two-cell stage embryos,

results in embryos in which only half of the embryo is af-

fected. MRF4 expression in WSTF unilateral-knockdown em-

bryos is reduced on the injected side during neurulation

(stage 15; Fig. 3F).

These results indicate that in WSTF knockdowns, both

ectoderm- and mesoderm-derived tissues show perturbed

gene expression, including overexpression and spatially aber-

rant expression of BMP4, and reduced expression of meso-

derm-derived tissue markers SHH and MRF4.

2.3. WSTF knockdown embryos exhibit perturbed PAX2,EPHA4, and SOX2 expression

While the reduced expression of NCAM and the sections

of WSTF knockdown embryos clearly indicate a reduction

in neural tissue in these embryos, we wished to further

examine the differentiation of anterior neural tissues. The

Paired box 2 (PAX2) gene encodes a Pax family transcription

factor with important roles in vertebrate organogenesis (Car-

roll and Vize, 1999; Dressler et al., 1990). PAX2 expression is

crucial for development of the midbrain hindbrain boundary

(MHB) in vertebrates, which is required for neuronal differ-

entiation and patterning of the midbrain and anterior hind-

brain (Li Song and Joyner, 2000). We examined PAX2

expression via whole mount in situ hybridization to investi-

gate midbrain and cerebellum development in our WSTF

knockdown embryos. Fertilized embryos were injected with

anti-WSTF MO at the one cell stage, resulting in global

knockdown of WSTF. WSTF knockdown embryos at tailbud

stage display an almost complete loss of PAX2 expression

within the hindbrain and a severe reduction at the MHB

when compared to controls (Fig. 4A–C; representative em-

bryos shown from a sample of 5 control and 7 knockdown

embryos). Additionally, at this stage, expression of PAX2 is

vital to the formation of the pronephros, the nascent yet

functional embryonic kidney (Heller and Brandli, 1997).

PAX2 signal is also reduced when compared to controls, par-

ticularly at the anterior end of this structure, suggesting that

normal kidney development may be perturbed in our WSTF

morphant embryos (Fig. 4A and B).

Eph receptors are a family of receptor tyrosine kinases

that bind a family of ephrin ligands involved in numerous

developmental processes. EPHA4 is expressed in a number

of tissues during Xenopus development including the fore-

brain, hindbrain, pronepheros, and the olfactory and otic

placodes (Park et al., 2004; Winning and Sargent, 1994; Xu

et al., 1995). In Xenopus, EPHA4 is involved in neural tissue

development in the forebrain and the MHB, and plays a cru-

cial role in neural crest cell migration (Smith et al., 1997; Xu

et al., 1995). We examined EPHA4 expression by whole

mount in situ hybridization to further investigate its role in

neural development in our WSTF knockdown embryos. Fer-

tilized embryos were injected with anti-WSTF MO at the

one cell stage, resulting in global knockdown of WSTF in

the developing embryos. Consistent with PAX2 expression,

knockdown embryos at the tailbud stage display a severe

reduction of EPHA4 expression within the forebrain and

MHB when compared to controls, further indicating failure

of neural tissue differentiation at this stage (Fig. 4). Normal

expression of EPHA4 in rhombomeres 3 and 5 is also reduced

in WSTF knockdown embryos (Fig. 4D–F; representative em-

bryos shown from a sample of 4 control and 8 knockdown

embryos) (Smith et al., 1997). Rhombomere formation is cru-

cial for the segmentation and proper migration of neural

crest cells (Smith et al., 1997). This reduction in EPHA4 could

result in underdeveloped rhombomeres and improper neural

crest migration in our WSTF morphant embryos. Addition-

ally, as with PAX2, expression of EPHA4 in the pronephros

may be reduced, and the pronephros is smaller and de-

formed compared to the controls (Fig. 4E).

Sox2 is a transcription factor well known for its role in

maintaining the pluripotency of embryonic stem cells (Heng

et al., 2010). In addition, Sox2 in combination with different

binding partners plays numerous roles in embryonic develop-

ment (Archer et al., 2011; Kondoh and Kamachi, 2010), includ-

ing development of the CNS and the retina and lens of the

eye. In the developing brain, Sox2 has dual roles in maintain-

ing proliferative neural stem cells as well as being required for

specific neuronal differentiation (Agathocleous et al., 2009;

Cavallaro et al., 2008; Pevny and Nicolis, 2010). As above, we

examined SOX2 expression by whole mount in situ hybridiza-

tion in our WSTF knockdown embryos. In this case, fertilized

embryos were injected with anti-WSTF MO at the two cell

stage, resulting in unilateral knockdown of WSTF in one side

of the developing embryos. Again consistent with the other

neural markers, the MO-injected side at the early tailbud

stage displays a severe reduction of SOX2 expression through-

out the brain, eye, otic vesicle, lateral line placodes, and bran-

chial arches when compared to the uninjected control side

(Fig. 4 G–J; representative embryos shown from a sample of

4–6 embryos for each stage).



2.4. WSTF is crucial for proper neural crest cell functionin vivo

WSTF mRNA expression is detected in both the migratory

neural crest as well as branchial arches during Xenopus

embryogenesis (Cus et al., 2006). This expression, and the re-

duced expression of SHH and EPHA4, genes known to play

roles in neural crest function, suggest that WSTF knockdown

might impact the neural crest. In the anterior, neural crest

cells originate from just above the neural tube and migrate

to the branchial arches, after which they serve as a critical

component for the formation of a number of subsequent

anterior structures that originate from the branchial arches.

SNAIL and SLUG are two members of the Snail family that

function in the epithelial-to-mesenchymal transition cas-

cade. SLUG is expressed in the premigratory neural crest cells

in both chick and X. laevis (Mayor et al., 1995, 1999; Nieto et al.,

1994; Sefton et al., 1998). In Xenopus, SNAIL is expressed in

ectoderm, premigratory neural crest, and the branchial ar-

ches (Mayor et al., 1993). In many vertebrates, SNAIL and SLUG

Fig. 4 – PAX2, EPHA4, and SOX2 expression are reduced in WSTF knockdown embryos. A: PAX2 expression in the midbrain

hindbrain boundary (MHB), the otic vesicle, optic stalk and the pronephros analyzed by whole mount in situ hybridization in

control embryo at tailbud stage (Stage 33; lateral view, anterior at left) B: Tailbud stage embryo injected with WSTF morpho-

lino at the one-cell stage. PAX2 expression is reduced in all expression domains. C: Side-by-side dorsal view of control

embryo (left) with WSTF knockdown embryo (right) at tailbud stage, showing reduced expression of PAX2 in the MHB and the

otic vesicle of WSTF knockdown embryo compared to control (Stage 33; dorsal view, anterior at top). D: EPHA4 expression in

the forebrain, hindbrain, rhombomeres 3 and 5 and in the pronephros analyzed by whole mount in situ hybridization in

control embryo at tailbud stage (Stage 33; lateral view, anterior at left) E: Tailbud stage embryo injected with WSTF morpho-

lino at the one-cell stage. EPHA4 expression is reduced in all expression domains. F: Side-by-side dorsal view of control

embryo (left) with WSTF knockdown embryo (right) at tailbud stage showing reduced expression of EPHA4 in the forebrain,

hindbrain and rhombomeres 3 and 5 of WSTF knockdown embryo compared to control (stage 33; dorsal view, anterior at top).

G-J: Tailbud stage embryos injected with WSTF morpholino at the two-cell stage. G: SOX2 expression in the brain, eye, otic

vesicle, lateral line placodes and branchial arches analyzed by whole mount in situ hybridization on the uninjected side at

tailbud stage (Stage 32; lateral view, right side of embryo). H: SOX2 expression is reduced in all expression domains on the

injected side (left side of embryo). I and J: Dorsal views of two embryos injected at the two-cell stage (WSTF MO injected into

the left side in both cases). Embryo in I is at stage 28, embryo in J is stage 32. Both show reduced expression of SOX2 in all

expression domains on the injected side. STD: Standard control morpholino; MO: WSTF morpholino; os: optic stalk; br: brain;

pd: pronephric duct; hb: hindbrain; pn: pronephros, MHB: mid-hindbrain boundary; ov: otic vesicle; r3, r5: rhombomeres 3

and 5; op: olfactory placode; cp: cranial placodes [otic and lateral line]; ba: branchial arches; e: eye. Asterisks indicate areas of

reduced expression relative to controls. Scale bars: 0.5 mm (A, B, D, E, G, H), 0.1 mm (C, F, I, J).



play important and seemingly redundant roles in the initia-

tion of neural crest formation (Aybar et al., 2003). However,

in Xenopus, SNAIL appears to be an initiator of the neural crest

genetic cascade and has been shown to induce the expression

of SLUG as well as a number of other important neural crest

genes (Aybar et al., 2003).

To investigate whether neural crest cell formation is per-

turbed in WSTF knockdown embryos, expression of SNAIL

and SLUG were analyzed by whole mount in situ hybridiza-

tion in unilateral WSTF knockdown embryos (Fig. 5; repre-

sentative embryos shown from a sample of 5–6 embryos

for each stage and probe). Expression of both SNAIL and

SLUG is unaffected on the injected side of unilaterally-in-

jected embryos during early neurulation (stage 15; Fig. 5A

and E), suggesting that neural crest induction is unaffected

by WSTF depletion. In contrast, both SNAIL and SLUG

expression patterns within the branchial arches are severely

perturbed in WSTF-MO unilaterally-injected embryos later

in development (Fig. 5B and C, F and G). This suggests that

some neural crest cells either fail to successfully migrate to

the branchial arches, or are not successfully maintained fol-

lowing migration. Histological sections of the branchial ar-

ches of unilateral WSTF knockdown embryos highlight the

decreased expression of both SNAIL and SLUG on the WSTF

knockdown side (particularly in the interior structures of

the arches), and also reveal significant morphological mal-

formations of the branchial arches on the injected side

(Fig. 5D and H). These malformations include changes in

shape, size and number of branchial arches in the WSTF

MO-injected side, including the apparent loss or fusion of

Fig. 5 – WSTF knockdown embryos display proper neural crest induction, but fail to maintain normal neural crest in later

development. A–H: Two-cell stage embryos were injected with WSTF MO unilaterally into a single blastomere and analyzed

by whole mount in situ hybridization at neural groove stage (stage 15) to display expression pattern of neural crest genes

SNAIL and SLUG. Both genes are expressed at the neural crest boundary. WSTF knockdown has no effect on the stage 15

expression of neural crest genes SNAIL (A) and SLUG (E) (dorsal views, anterior at top). Identically treated embryos analyzed

by whole mount in situ hybridization at tailbud stage (stage 30; side views of heads, anterior at top) display perturbed

expression of neural crest genes SNAIL (B and C) and SLUG (F and G) on the WSTF-knockdown side (C and G). 60-lm sections

through the branchial arches of unilateral WSTF knockdown embryos (anterior at top) display diminished expression of

SNAIL (D) and SLUG (H) on the injected side, particularly in the internal structures (light blue staining). Arches are labeled in B–

D and F–H. Asterisks indicate the relative position of missing/fused arch number 3 on the sides derived from the WSTF MO-

injected blastomeres. Dashed lines in B and F indicate the plane of sectioning of D and H, respectively. Scale bars: 1 mm (A, E),

0.5 mm (B, C, F, G) and 0.1 mm (D, H).



arch number 3 in 5/6 sectioned embryos, and the sixth ani-

mal with no detectable arches on the injected side at all

(Fig. 5C and D, G and H, and data not shown). These results

strongly suggest that while neural crest induction is intact

in WSTF knockdowns, the resulting neural crest cells exhi-

bit either abnormal migration or maintenance, leading to a

cascade of morphological defects.

2.5. WSTF knockdown embryos display a specific patternof increased apoptosis

The results described above indicate failures of CNS

development and neural crest migration or survival in WSTF

knockdowns. To determine whether the net loss of neural

tissues and neural crest might be due to increased apoptosis

in these tissues in our WSTF knockdown embryos, we per-

formed a whole mount Terminal deoxynucleotidyl transfer-

ase dUTP nick end-labeling (TUNEL) assay to visualize

apoptosis in situ. Anti-WSTF MO was injected at the one cell

stage post-fertilization, resulting in global knockdown of

WSTF within developing embryos. The TUNEL assay reveals

an increase in apoptosis in specific regions of the WSTF

knockdown embryos when compared to the controls

(Fig. 6; representative embryos shown from a sample of 15

control embryos and 18 knockdown embryos at stages 31–

38). We observe increased staining at the olfactory placode

and a striking increase in regions flanking the anterior dor-

sal midline at early tailbud stage (stage 33). This aberrant

increase of apoptosis within the hindbrain is the same re-

gion where cranial neural crest cells begin their migration

to the branchial arches (Smith et al., 1997), and the mid-

hindbrain boundary is also a region that exhibits particu-

larly robust WSTF expression beginning at stage 32 (Cus

et al., 2006). A transverse section of the affected region dis-

plays punctate staining in the peripheral tissues, lateral and

ventral to the hindbrain and appears to be beneath the

overlying epidermal ectoderm (Fig. 6D). This punctate stain-

ing follows a pattern that is strikingly similar to the path of

cranial neural crest migration and may offer an explanation

for the decrease of neural crest cells present within the

branchial arches of our WSTF knockdown embryos (Smith

et al., 1997).

Fig. 6 – WSTF knockdown embryos display increased apoptosis of specific stages of development. A: TUNEL assay with a

representative control embryo at tailbud stage showing no detectable levels of apoptosis (Stage 33; lateral view, anterior at

left). B: A representative tailbud stage embryo injected with WSTF morpholino at the one-cell stage displaying a spatial

increase in apoptosis in the hindbrain, olfactory placode and lateral anterior tissues. C: Side-by-side dorsal view of control

embryo (left) with WSTF knockdown embryo (right) at tailbud stage, showing an increase in apoptosis in the hindbrain of the

WSTF knockdown embryo compared to control (Stage 33; dorsal view, anterior at top). D: Transverse section of WSTF

knockdown embryo (at a plane indicated by the dashed line in B) displays punctate staining in the peripheral tissues, lateral

and ventral from the hindbrain, beneath the overlying epidermal ectoderm (Stage 33; sectional view, anterior at top). STD:

standard control morpholino; MO: WSTF morpholino; nt: neural tube; nc: notochord. Scale bars: 0.5 mm (A and B), 0.1 mm (C

and D).



3. Discussion

We have examined the specific roles of WSTF during devel-

opment in order to better characterize the contribution of

WSTF haplodeficiency to the clinical manifestations of WS.

We show that WSTF has a crucial role in neural development

and proper neural crest cell function in X. laevis. WSTF knock-

downs display severe defects in neural development, and re-

duced expression of the neural-specific marker NCAM and

reduction of PAX2 and EPHA4 within the mid and hindbrain.

The expression of WSTF in neural crest cells has been well

characterized (Cus et al., 2006). A number of genes have been

implicated in the complex sequence of neural crest cell for-

mation and function. In Xenopus, the neural crest-specific

transcription factor SNAIL has been shown to precede SLUG

and to induce its expression, as well as the expression of a

number of other neural crest markers (Aybar et al., 2003).

We show that knockdown of WSTF does not affect the expres-

sion of either SNAIL or SLUG during the initial stages of neural

crest formation. This indicates that normal levels of WSTF are

not required for neural crest induction, but does not rule out

the possibility that some WSTF is essential for this process.

Since some WSTF (likely maternally deposited) remains in

our knockdowns, this could provide a sufficient level of WSTF

for neural crest induction. However, WSTF knockdown em-

bryos do display decreased expression of both SNAIL and

SLUG within the branchial arches at early tailbud stage, sug-

gesting WSTF is required for the normal migration and/or

maintenance of the neural crest cells.

Strikingly, WSTF knockdown results in significant misre-

gulation of two signaling molecules crucial in neural develop-

ment. The first of these is Bmp4, a mitogen required for the

proper formation of many neural structures that are also

dependent on Shh signaling. Bmp4 and Shh act in an antago-

nistic fashion to pattern and shape the developing neural

tube, vertebrate eye and brain (Bakrania et al., 2008; Hu

et al., 2004; Muller et al., 2007). BMPs, and Bmp4 in particular,

inhibit ectoderm from assuming a neural tissue fate. Bmp4

not only suppresses neural tissue formation from ectoderm,

but can also induce epidermal tissue determination (Hem-

mati-Brivanlou and Thomsen, 1995; Wilson and Hemmati-

Brivanlou, 1995).

Shh is a developmental mitogen essential for proper neu-

ral patterning (reviewed in Patten and Placzek, 2000). Shh is

believed to facilitate normal neural tissue formation by three

main processes. First, Shh is known for its role in the ventral

patterning of the neural tube (reviewed in Patten and Placzek,

2000). Second, Shh promotes cell differentiation by facilitat-

ing cell cycle exit (Agathocleous et al., 2007). Lastly, Shh is

an essential survival factor for a number of neural cells by

inhibition of the p53-dependent apoptotic pathway (Ahlgren

and Bronner-Fraser, 1999; Ahlgren et al., 2002; Prykhozhij,

2010). In addition to its role in patterning of neural tissue, a

classic example of Shh’s role in neural crest function is holo-

prosencephaly, a developmental syndrome characterized in

humans by head and facial malformations, including cyclo-

pia, resulting from haplodeficiency of SHH (reviewed in Mur-

doch and Copp, 2010). Reduced SHH results in decreased cell

proliferation in the neural tube and neural crest, as well as

smaller head size, defining a role for SHH in the survival of

cranial neural crest (Ahlgren and Bronner-Fraser, 1999; Ahl-

gren et al., 2002). We show that WSTF knockdown results in

a reduction of SHH expression, as determined by both in situ

hybridization and realtime RT-PCR at a number of develop-

mental stages. Additionally, a whole mount TUNEL assay re-

veals that WSTF knockdowns exhibit an increase in

apoptosis within the hindbrain and along a path that closely

mimics the initial route of cranial neural crest migration to

the branchial arches (Smith et al., 1997). Shh’s role in cranial

neural crest survival (Ahlgren et al., 2002) could explain our

results in which both SNAIL and SLUG expression is unaf-

fected during neural crest induction, but is then severely de-

creased later in development in our WSTF knockdowns,

consistent with a failure in maintenance/survival of neural

crest.

The increased and aberrant expression of BMP4 in our

WSTF knockdowns, along with the absence of WSTF expres-

sion within the notochord of normally developing embryos,

suggests that the effect on SHH expression is likely to be

downstream of the altered BMP4 expression. In two classic

experiments aimed to investigate the function of BMP4,

BMP4 was overexpressed in the animal hemisphere of fertil-

ized Xenopus embryos (Dale et al., 1992; Jones et al., 1996). In

these studies WSTF knockdowns display reduced expression

of specific neural markers, including loss of PAX2 in the

MHB, EPHA4 in rhombomeres 3 and 5, and SOX2 throughout

the brain, eye and lateral line placodes. WSTF knockdowns

also show reduction of the ear1y neural development and

neural ectoderm marker NCAM. These neural defects could

be due to an increase in ectodermal BMP4 expression in our

WSTF knockdowns and may result in secondary malforma-

tions of the developing mesoderm from which the SHH-pro-

ducing notochord and somites (expressing MRF4) are derived.

Whether the effect of WSTF on BMP4 or SHH is direct or

indirect remains to be determined. However, previous work

in our lab has shown that ISWI, WSTF’s binding partner in

the WICH complex, is present at the BMP4 gene during Xeno-

pus embryonic development (Dirscherl et al., 2005). In addi-

tion, ISWI knockdowns exhibit BMP4 and SHH expression

levels similar to those in WSTF morphants (Dirscherl et al.,

2005). Taken together, these results suggest a role for the

WICH complex as a transcriptional repressor of BMP4.

Pluripotent embryonic stem cells are characterized by an

abundance of dynamic euchromatin that undoubtedly re-

quires an enormous amount of input and coordination of

chromatin remodelers for proper differentiation or mainte-

nance of pluripotency (Fazzio and Panning, 2010; Serra

et al., 2007). Neural crest cells are extremely versatile progen-

itor cells that must maintain their pluripotency well into

embryonic development. WSTF expression has been detected

within a number of neural progenitor cells during Xenopus

morphogenesis (Cus et al., 2006). Our study is the first to sug-

gest that neural crest formation is initiated normally in em-

bryos with depleted WSTF levels, however, these neural

crest cells are not able to maintain their proper function or

contribute normally to the formation of the branchial arches

later in development. Here we show the misregulation of a

number of well-characterized developmental morphogens

and tissue markers and propose a mechanism in which aber-

rant BMP4 expression leads to a disruption of mesoderm



differentiation which severely affects neural crest cell migra-

tion and/or maintenance.

This effect on neural crest and mesoderm formation could

account for a number of the symptoms that occur in WS pa-

tients. Development of the branchial arches, which are highly

dependent on proper neural crest function, gives rise to many

structures that, if malformed, could explain a number of the

symptoms present in WS. WSTF deletions in mice have reca-

pitulated both the craniofacial and the heart defects seen in

WS patients, further implicating WSTF haplodeficiency in

the development of WS (Ashe et al., 2008; Yoshimura et al.,

2009). Mice that are homozygous for a WSTF mutation that re-

sults in a single amino acid change (L733R) and reduced sta-

bility of the mouse WSTF protein exhibit altered skull

shape, including a protruding forehead, shorter snout, flat-

tened nasal bone, and upward curvature of the nasal tip (Ashe

et al., 2008). This craniofacial development is strikingly simi-

lar to many of the facial features of WS patients and suggests

that WSTF deficiency may contribute to the characteristic ‘‘el-

fin’’ features seen in individuals with WS. WSTF knockout

mice (wstf–) are small, show significant heart defects and

die just days after birth. 10% of heterozygous WSTF+/– neona-

tal mice also display specific heart defects similar to those

seen in WS patients, such as altered structure, atrial and ven-

tricular septal defects, and hypertrophy of ventricles (Yoshim-

ura et al., 2009).

This result strongly correlates with the malformation of

the branchial arches in our morphant embryos, particularly

branchial arches three and four, from which a number of car-

diac structures affected in WS are derived (Hutson and Kirby,

2007; Safa and El Ghazal, 2011). This result could also explain

the infantile hypercalcaemia observed in WS patients. The

branchial apparatus contributes to development of the thy-

roid and the ultimobranchial bodies, both of which produce

calcitonin to regulate blood calcium levels (Varga et al.,

2008). Defects in these structures could contribute to the in-

creased blood calcium levels seen in WS individuals, this is

also consistent with the increased incidence of hypoplasia

of the thyroid gland in WS patients (Manley and Capecchi,

1998; Selicorni et al., 2006). Neural crest cells also contribute

to the generation of tissues of the eyes including the cornea

endothelium, stroma, and muscles of the iris (Grocott et al.,

2011; Iwao et al., 2008). Many WS individuals do exhibit ocular

defects, including small eye openings, a stellate iris pattern,

puffiness around the eyes, higher occurrence of blue pigmen-

tation, strabismus or esotropia (cross-eyes), and abnormal

extraocular muscle anatomy (Ali and Shun-Shin, 2009; Winter

et al., 1996). Although it is almost certainly independent of

neural crest, we also show that the pronephric kidney is

reduced and poorly developed in our knockdowns, with

accompanying reduced expression of PAX2, which adds to

the number of effected mesoderm derived structures in these

knockdowns. Interestingly, WS patients display a significantly

high incidence of renal and urinary abnormalities including

the presences of cysts, narrowing of the renal arteries and

hypoplasia (Biesecker et al., 1987; Pober et al., 1993; Sugayama

et al., 2004). We note that WSTF knockdowns in Xenopus result

in phenotypes that are more severe than those observed in

human WS patients or in heterozygous WSTF+/wstf- mice

(homozygous deletions in mice are lethal shortly after birth),

suggesting that redundant mechanisms may partially allevi-

ate the effects of WSTF haploinsufficiency in mammals (Ashe

et al., 2008; Yoshimura et al., 2009). Intriguingly, two other

genes contained in the WS deleted region, GTF2I and

GTF2IRD1, are also expressed in neural crest-derived tissues

and heterozygous deletions of either gene in mice results in

craniofacial defects (Enkhmandakh et al., 2009). This suggests

other genes in the region may also play a role in neural crest

function and have additive effects on the complexity of the

WS phenotype. Additional studies will be needed in order to

better comprehend the role of WSTF during vertebrate devel-

opment. This study furthers our understanding of the role of

ATP-dependent chromatin remodeling complexes during ver-

tebrate development as well as offer a better understanding of

a number of WS symptoms that may be attributable to

haplodeficiency of the WSTF gene.

4. Materials and methods

4.1. Generation of Xenopus embryos

Female Xenopus were induced to ovulate by injection of

600 ll of human chorionic gonadotropin (1000 USP units/ml,

Intervet, Millsboro, DE) into the dorsal lymph sac. Testes were

obtained by surgical excision from a male frog euthanized in

0.06% benzocaine for 45 min. Eggs were squeezed from in-

duced females 12–18 h after induction of ovulation. Freshly

laid eggs were immediately exposed to dispersed Xenopus tes-

tis in 0.1X Marc’s modified Ringer’s (MMR) (standard protocols

as per Sive et al., 2007). Fertilized embryos were then stripped

of jelly coat by exposure to 2% L-cysteine for 3–5 min.

All husbandry and handling of adult X. laevis was per-

formed in compliance with our approved IACUC #181339–4.

4.2. Microinjection of morpholino oligonucleotides

Single-stranded oligonucleotides (morpholinos) were gen-

erated by Gene Tools (Philomath, Oregon). These morpholinos

are complementary to the 5 0 untranslated region of WSTF

messenger RNA upstream of the translation start site, and

are labeled with 3 0-carboxyfluorescein dye. As a negative con-

trol for injection, an inverse sequence or a standard control

morpholino was used. The corresponding morpholino

sequences are: WSTF-MO: 5 0GCTTCTCGTGGGATGATAGTCCC

GC3 0, inverse control MO (INV-MO): 5 0CGCCCTGATAGTAGGGT

GCTCTTCG3 0, standard control MO (STD-MO): 5 0CCTCTTACC

TCAGTTACAATTTATA3 0 (all MOs have a 3 0 carboxyfluorescein

label).

Xenopus embryos were obtained and dejellied as described

in Section 4.1 and transferred to mesh bottom Petri dishes

filled with 6% Ficoll in 0.1X MMR solution. 5 nL of a 1 mM mor-

pholino solution was injected into either 1 or 2 cell stage

dividing embryos (42 ng of morpholino per cell, resulting in

either global, or unilateral WSTF morphant embryos) with

glass needles made using a Flaming/Brown micropipette pull-

er (Sutter Instruments, Novato, CA) and a KITE-L micromanip-

ulator (World Precision Instruments, Sarasota, Florida).

Morpholino was delivered to embryos by applying 30 ms

bursts of 8 psi to needles using a MPPI-2 pressure injector

(Applied Scientific Instrumentation, Eugene, OR). After



injections, embryos were transferred to 0.1X MMR. At �17 or

32 h post-fertilization, gross morphology of the embryos

was observed and photographed. Within 24 h post fertiliza-

tion, injected embryos were identified by fluorescence illumi-

nation of injected morpholinos and uninjected embryos were

discarded. Embryos were collected at specified times and used

for either total RNA or protein extractions or were fixed in

MEMFA (0.1 M Mops pH 7.5, 2 mM EGTA, 1 mM MgSO4, 3.7%

formaldehyde) for in situ hybridization or sectioning.

4.3. In situ hybridization and TUNEL assay

DNA templates were linearized with restriction enzymes,

and digoxigenin-labeled sense and antisense RNA probes

were transcribed in vitro from templates using Ambion Mega-

script in vitro transcription kits (Megascript T7TM, Megascript

Sp6TM, Applied Biosystems/Ambion, Austin, Texas). The proto-

col was altered in the following ways: all Megascript dNTPs

were diluted to 10 lM concentrations and half of the

suggested RNA polymerase concentration was used.

Xenopus embryos were generated as described in Sec-

tion 4.1. Embryos were collected at indicated stages and fixed

in MEMFA according to Sive et al. (2007). Whole mount em-

bryos were then hybridized with in situ hybridization probes

according to Sive et al. (2007); however, for some probes the

RNaseA step was omitted. BM purple (Roche, Mannheim Ger-

many) or NBT/BCIP (Promega, Madison, Wisconsin) were used

as the substrate for the alkaline phosphatase conjugated to

an anti-digoxigenin antibody (Roche, Mannheim Germany).

For the TUNEL assays, albino embryos were collected at

indicated stages and fixed in MEMFA for two hours. A whole

mount TUNEL procedure from the Harland Lab was followed

(detailed in Hensey and Gautier, 1998). Briefly, embryos were

bleached for 1 h under light and washed in PBS. Terminal

ends were labeled with Digoxygenin-dUTP (Roche, Mannheim

Germany) using Terminal Deoxynucleotidyl Transferase (TdT)

(Invitrogen, Carlsbad, California) overnight at room tempera-

ture. The reaction was stopped with 65 �C washes in PBS con-

taining 1 mM EDTA. Anti-digoxygenin AP antibody incubation

was done in MAB (100 mM Maleic acid, 150 mM NaCl) contain-

ing 2% BMB blocking reagent (Roche, Mannheim Germany)

overnight at 4 �C. Following extensive washes in MAB, the col-

or reaction was performed using NBT/BCIP (Harland, 1991).

4.4. Histology

Embryos were fixed in MEMFA and stored at �20 �C in 100%

methanol. Embryos were gradually rehydrated by incubating

in 1X PBS containing 75%, 50%, 25% methanol and in 1X PBS

for 5 min each. They were then embedded in 15% gelatin

(Bloom �300, Sigma–Aldrich, St. Louis, Missouri) in PBS

(135 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4,

pH 7.2) and fixed in 10% neutral buffered formalin (3.7% form-

aldehyde) (BDH, West Chester, PA) for 36–48 h at 4 �C. The gel-

atin blocks were rinsed in PBS and 60 lm sections were cut

using a Leica VT1000P vibratome (Richmond, Illinois).

Other fixed embryos were dehydrated though a graded ser-

ies of ethanol and xylene washes, embedded in Paraplast Plus

(Oxford Labware, St Louis, MO) and serially sectioned at a

thickness of 7 lm. Sections were collected on albumin-subbed

slides (Mayer’s fixative) (Humason, 1972). Sections were

stained using Ehrlich’s hematoxylin and counterstained in

Eosin following the protocols of Humason (1972). Coverslips

were applied using Permount (Fisher Scientific, Pittsburgh,

PA). Color images were captured using a Spot digital camera

(Diagnostic Instruments, Inc., Sterling Heights, MI).

4.5. Total RNA extraction and RT-qPCR analysis

Total RNA samples were isolated from injected embryos at

various times post fertilization. Ten whole embryos were

homogenized in 200 ll Trizol reagent (Invitrogen, Carlsbad,

California) using a mortar and pestle and the RNA was iso-

lated following manufacturer’s recommendations. RNA pel-

lets were re-suspended in 100 ll RNase-free water. Turbo

DNase (Ambion, Austin, Texas) was used to remove any geno-

mic DNA contamination in the RNA preparations. cDNA gen-

eration and qPCR were performed using the one-step SYBR�Green Quantitative RT-PCR Kit (Sigma–Aldrich, St. Louis, Mis-

souri) in a Smart Cycler (Cepheid, Sunnyvale, California)

system.

4.6. Total protein extraction and Western blot analysis

10–20 embryos were collected and homogenized via mor-

tar and pestle in Laemmli sample buffer. Homogenate was

heated at 95 �C for 5 min, centrifuged at 13,000 rpm for

1 min and the supernatant was stored at �80 �C. Total protein

extracts were separated by 10% SDS polyacrylamide gel elec-

trophoresis, blotted onto a nitrocellulose membrane (What-

man, Dassel, Germany) and blocked in Odyssey blocking

buffer (Licor, Lincoln, Nebraska). The membrane was probed

with the primary antibody in Odyssey blocking buffer at room

temperature overnight. Primary antibody against Xenopus

WSTF was generously provided by Dr. Paul Wade (NIEHS). A

b-actin monoclonal antibody (Abcam ab8224, Cambridge,

Massachusetts) was used for a loading control. IR-dye conju-

gated (800CW) goat anti-mouse secondary antibodies (Licor,

Lincoln, Nebraska) were used for secondary antibodies. The

Odyssey infrared imager (Licor, Lincoln, Nebraska) was used

to visualize the probed membranes.

Acknowledgements

Template DNAs for SLUG and SNAIL were generously provided

by Peter Walentek in Dr. Martin Blum’s laboratory (University

Hohenheim, Stuttgart, Germany). BMP4 and SHH DNA tem-

plates were generously provided by Dr. Richard Harland (Uni-

versity of California, Berkley), and fully transcribed MRF4

probe was provided by Dr. Tim Hinterburger (University of

Alaska Anchorage). The NCAM and SOX2 RNA probes were

developed at the Cold Spring Harbor course on Developmen-

tal Biology of Xenopus. Primary antibody against Xenopus

WSTF was generously provided by Dr. Paul Wade (NIEHS).

This work was supported by NIH EY016029 and Whitehall

Foundation 2007-08-79 to JEK, and NIH EY09844 to JJH. CB

was also supported by NIH P20RR016466.

This paper is dedicated to the memory of Dr. Marietta

Dunaway (1952-2011).



Appendix A. Supplementary data

Supplementary data associated with this article can be

found, in the online version, at http://dx.doi.org/10.1016/

j.mod.2012.06.001.

R E F E R E N C E S

Agathocleous, M., Iordanova, I., Willardsen, M.I., Xue, X.Y., Vetter,M.L., Harris, W.A., Moore, K.B., 2009. A directional Wnt/beta-catenin-Sox2-proneural pathway regulates the transition fromproliferation to differentiation in the Xenopus retina.Development 136, 3289–3299.

Agathocleous, M., Locker, M., Harris, W.A., Perron, M., 2007. Ageneral role of hedgehog in the regulation of proliferation. CellCycle 6, 156–159.

Ahlgren, S.C., Bronner-Fraser, M., 1999. Inhibition of sonichedgehog signaling in vivo results in craniofacial neural crestcell death. Curr. Biol. 9, 1304–1314.

Ahlgren, S.C., Thakur, V., Bronner-Fraser, M., 2002. Sonic hedgehogrescues cranial neural crest from cell death induced by ethanolexposure. Proc. Natl. Acad. Sci. USA 99, 10476–10481.

Ali, S.M., Shun-Shin, G.A., 2009. Abnormal extraocular muscleanatomy in a case of Williams-Beuren Syndrome. J AAPOS 13,196–197.

Archer, T.C., Jin, J., Casey, E.S., 2011. Interaction of Sox1, Sox2,Sox3 and Oct4 during primary neurogenesis. Dev. Biol. 350,429–440.

Ashe, A., Morgan, D.K., Whitelaw, N.C., Bruxner, T.J., Vickaryous,N.K., Cox, L.L., Butterfield, N.C., Wicking, C., Blewitt, M.E.,Wilkins, S.J., Anderson, G.J., Cox, T.C., Whitelaw, E., 2008. Agenome-wide screen for modifiers of transgene variegationidentifies genes with critical roles in development. GenomeBiol. 9, R182.

Aybar, M.J., Nieto, M.A., Mayor, R., 2003. Snail precedes slug in thegenetic cascade required for the specification and migration ofthe Xenopus neural crest. Development 130, 483–494.

Bajpai, R., Chen, D.A., Rada-Iglesias, A., Zhang, J., Xiong, Y., Helms,J., Chang, C.P., Zhao, Y., Swigut, T., Wysocka, J., 2010. CHD7cooperates with PBAF to control multipotent neural crestformation. Nature 463, 958–962.

Bakrania, P., Efthymiou, M., Klein, J.C., Salt, A., Bunyan, D.J., Wyatt,A., Ponting, C.P., Martin, A., Williams, S., Lindley, V., Gilmore, J.,Restori, M., Robson, A.G., Neveu, M.M., Holder, G.E., Collin, J.R.,Robinson, D.O., Farndon, P., Johansen-Berg, H., Gerrelli, D.,Ragge, N.K., 2008. Mutations in BMP4 cause eye, brain, and digitdevelopmental anomalies: overlap between the BMP4 andhedgehog signaling pathways. Am. J. Hum. Genet 82, 304–319.

Barnett, C., Krebs, J.E., 2011. WSTF does it all: a multifunctionalprotein in transcription, repair, and replication. Biochem. CellBiol. 89, 12–23.

Basch, M.L., Bronner-Fraser, M., 2006. Neural crest inducingsignals. Adv. Exp. Med. Biol. 589, 24–31.

Biesecker, L.G., Laxova, R., Friedman, A., 1987. Renal insufficiencyin Williams syndrome. Am. J. Med. Genet. 28, 131–135.

Briscoe, J., Sussel, L., Serup, P., Hartigan-O’Connor, D., Jessell, T.M.,Rubenstein, J.L., Ericson, J., 1999. Homeobox gene Nkx2.2 andspecification of neuronal identity by graded Sonic hedgehogsignalling. Nature 398, 622–627.

Campuzano, S., Modolell, J., 1992. Patterning of the Drosophilanervous system: the achaete-scute gene complex. Trends Genet.8, 202–208.

Carroll, T.J., Vize, P.D., 1999. Synergism between Pax-8 and lim-1 inembryonic kidney development. Dev. Biol. 214, 46–59.

Cavallaro, M., Mariani, J., Lancini, C., Latorre, E., Caccia, R., Gullo, F.,Valotta, M., DeBiasi, S., Spinardi, L., Ronchi, A., Wanke, E.,Brunelli, S., Favaro, R., Ottolenghi, S., Nicolis, S.K., 2008.Impaired generation of mature neurons by neural stem cellsfrom hypomorphic Sox2 mutants. Development 135, 541–557.

Chiang, C., Litingtung, Y., Lee, E., Young, K.E., Corden, J.L.,Westphal, H., Beachy, P.A., 1996. Cyclopia and defective axialpatterning in mice lacking Sonic hedgehog gene function.Nature 383, 407–413.

Creuzet, S., Couly, G., Vincent, C., Le Douarin, N.M., 2002. Negativeeffect of Hox gene expression on the development of theneural crest-derived facial skeleton. Development 129, 4301–4313.

Cus, R., Maurus, D., Kuhl, M., 2006. Cloning and developmentalexpression of WSTF during Xenopus laevis embryogenesis.Gene. Expr. Patterns 6, 340–346.

Dale, L., Howes, G., Price, B.M., Smith, J.C., 1992. Bonemorphogenetic protein 4: a ventralizing factor in early Xenopusdevelopment. Development 115, 573–585.

Delgado-Olguin, P., Recillas-Targa, F., 2011. Chromatin structure ofpluripotent stem cells and induced pluripotent stem cells.Brief Funct. Genomics 10, 37–49.

Dickinson, A., Sive, H., 2007. Positioning the extreme anterior inXenopus: cement gland, primary mouth and anterior pituitary.Semin. Cell Dev. Biol. 18, 525–533.

Dirscherl, S.S., Henry, J.J., Krebs, J.E., 2005. Neural and eye-specificdefects associated with loss of the imitation switch (ISWI)chromatin remodeler in Xenopus laevis. Mech. Dev. 122, 1157–1170.

Dressler, G.R., Deutsch, U., Chowdhury, K., Nornes, H.O., Gruss, P.,1990. Pax2, a new murine paired-box-containing gene and itsexpression in the developing excretory system. Development109, 787–795.

Dubourg, C., Bendavid, C., Pasquier, L., Henry, C., Odent, S., David,V., 2007. Holoprosencephaly. Orphanet J. Rare Dis. 2, 8.

Enkhmandakh, B., Makeyev, A.V., Erdenechimeg, L., Ruddle, F.H.,Chimge, N.O., Tussie-Luna, M.I., Roy, A.L., Bayarsaihan, D.,2009. Essential functions of the Williams-Beuren syndrome-associated TFII-I genes in embryonic development. Proc. Natl.Acad. Sci. USA 106, 181–186.

Fazzio, T.G., Panning, B., 2010. Control of embryonic stem cellidentity by nucleosome remodeling enzymes. Curr. Opin.Genet. Dev. 20, 500–504.

Gans, C., Northcutt, R.G., 1983. Neural crest and the origin ofvertebrates: a new head. Science 220, 268–273.

Grocott, T., Johnson, S., Bailey, A.P., Streit, A., 2011. Neural crestcells organize the eye via TGF-beta and canonical Wntsignalling. Nat. Commun. 2, 265.

Harland, R.M., 1991. In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36,685–695.

Heller, N., Brandli, A.W., 1997. Xenopus Pax-2 displays multiplesplice forms during embryogenesis and pronephric kidneydevelopment. Mech. Dev. 69, 83–104.

Hemmati-Brivanlou, A., Thomsen, G.H., 1995. Ventralmesodermal patterning in Xenopus embryos: expressionpatterns and activities of BMP-2 and BMP-4. Dev. Genet. 17, 78–89.

Heng, J.C., Orlov, Y.L., Ng, H.H., 2010. Transcription factors for themodulation of pluripotency and reprogramming. Cold SpringHarb Symp Quant Biol 75, 237–244.

Hensey, C., Gautier, J., 1998. Programmed cell death duringXenopus development: a spatio-temporal analysis. Dev. Biol.203, 36–48.

Hogan, B.L., 1996. Bone morphogenetic proteins in development.Curr. Opin. Genet. Dev. 6, 432–438.

Howald, C., Merla, G., Digilio, M.C., Amenta, S., Lyle, R., Deutsch,S., Choudhury, U., Bottani, A., Antonarakis, S.E., Fryssira, H.,



Dallapiccola, Reymond, A., 2006. Two high throughputtechnologies to detect segmental aneuploidies identify newWilliams-Beuren syndrome patients with atypical deletions. J.Med. Genet. 43, 266–273.

Hu, Q., Ueno, N., Behringer, R.R., 2004. Restriction of BMP4 activitydomains in the developing neural tube of the mouse embryo.EMBO Rep. 5, 734–739.

Humason, G.L., 1972. Animal Tissue Techniques. W.H. Freeman,San Francisco.

Hutson, M.R., Kirby, M.L., 2007. Model systems for the study ofheart development and disease. Cardiac neural crest andconotruncal malformations. Semin. Cell Dev. Biol. 18, 101–110.

Iwao, K., Inatani, M., Okinami, S., Tanihara, H., 2008. Fatemapping of neural crest cells during eye development using aprotein 0 promoter-driven transgenic technique. Graefes Arch.Clin. Exp. Ophthalmol. 246, 1117–1122.

Jones, C.M., Dale, L., Hogan, B.L., Wright, C.V., Smith, J.C., 1996.Bone morphogenetic protein-4 (BMP-4) acts during gastrulastages to cause ventralization of Xenopus embryos.Development 122, 1545–1554.

Kondoh, H., Kamachi, Y., 2010. SOX-partner code for cellspecification: Regulatory target selection and underlyingmolecular mechanisms. Int. J. Biochem. Cell Biol. 42, 391–399.

Li Song, D., Joyner, A.L., 2000. Two Pax2/5/8-binding sites inEngrailed2 are required for proper initiation of endogenousmid-hindbrain expression. Mech. Dev. 90, 155–165.

Lu, X., Meng, X., Morris, C.A., Keating, M.T., 1998. A novel humangene, WSTF, is deleted in Williams syndrome. Genomics 54,241–249.

Manley, N.R., Capecchi, M.R., 1998. Hox group 3 paralogs regulatethe development and migration of the thymus, thyroid, andparathyroid glands. Dev. Biol. 195, 1–15.

Martinez-Barbera, J.P., Toresson, H., Da Rocha, S., Krauss, S., 1997.Cloning and expression of three members of the zebrafishBmp family: Bmp2a, Bmp2b and Bmp4. Gene 198, 53–59.

Mayor, R., Essex, L.J., Bennett, M.F., Sargent, M.G., 1993. Distinctelements of the xsna promoter are required for mesodermaland ectodermal expression. Development 119, 661–671.

Mayor, R., Morgan, R., Sargent, M.G., 1995. Induction of theprospective neural crest of Xenopus. Development 121, 767–777.

Mayor, R., Young, R., Vargas, A., 1999. Development of neural crestin Xenopus. Curr. Top. Dev. Biol. 43, 85–113.

Merla, G., Howald, C., Henrichsen, C.N., Lyle, R., Wyss, C., Zabot,M.T., Antonarakis, S.E., Reymond, A., 2006. Submicroscopicdeletion in patients with Williams-Beuren syndromeinfluences expression levels of the nonhemizygous flankinggenes. Am. J. Hum. Genet. 79, 332–341.

Muller, F., Rohrer, H., Vogel-Hopker, A., 2007. Bone morphogeneticproteins specify the retinal pigment epithelium in the chickembryo. Development 134, 3483–3493.

Murdoch, J.N., Copp, A.J., 2010. The relationship between sonicHedgehog signaling, cilia, and neural tube defects. BirthDefects Res. A Clin. Mol. Teratol. 88, 633–652.

Nieto, M.A., Sargent, M.G., Wilkinson, D.G., Cooke, J., 1994. Controlof cell behavior during vertebrate development by Slug, a zincfinger gene. Science 264, 835–839.

Nieuwkoop, P.D., Faber, J., 1967. Normal table of Xenopus laevis.North Holland Publishing Co., Amsterdam, The Netherlands.

Noden, D.M., Schneider, R.A., 2006. Neural crest cells and thecommunity of plan for craniofacial development: historicaldebates and current perspectives. Adv. Exp. Med. Biol. 589, 1–23.

Osborne, L.R., 2010. Animal models of Williams syndrome. Am. J.Med. Genet. C Semin. Med. Genet. 154C, 209–219.

Owens, S.E., Broman, K.W., Wiltshire, T., Elmore, J.B., Bradley,K.M., Smith, J.R., Southard-Smith, E.M., 2005. Genome-widelinkage identifies novel modifier loci of aganglionosis in theSox10Dom model of Hirschsprung disease. Hum. Mol. Genet.14, 1549–1558.

Pagon, R.A., Graham Jr., J.M., Zonana, J., Yong, S.L., 1981.Coloboma, congenital heart disease, and choanal atresia withmultiple anomalies: CHARGE association. J. Pediatr. 99, 223–227.

Park, E.K., Warner, N., Bong, Y.S., Stapleton, D., Maeda, R., Pawson,T., Daar, I.O., 2004. Ectopic EphA4 receptor induces prosteriorprotrusions via FGF signaling in Xenopus embryos. Mol. Biol.Cell 15, 1647–1655.

Patten, I., Placzek, M., 2000. The role of Sonic hedgehog in neuraltube patterning. Cell Mol. Life Sci. 57, 1695–1708.

Pevny, L.H., Nicolis, S.K., 2010. Sox2 roles in neural stem cells. Int.J. Biochem. Cell Biol. 42, 421–424.

Pober, B.R., Lacro, R.V., Rice, C., Mandell, V., Teele, R.L., 1993. Renalfindings in 40 individuals with Williams syndrome. Am. J. Med.Genet. 46, 271–274.

Prykhozhij, S.V., 2010. In the absence of Sonic hedgehog, p53induces apoptosis and inhibits retinal cell proliferation, cell-cycle exit and differentiation in zebrafish. PLoS ONE 5,e13549.

Roelink, H., Porter, J.A., Chiang, C., Tanabe, Y., Chang, D.T., Beachy,P.A., Jessell, T.M., 1995. Floor plate and motor neuron inductionby different concentrations of the amino-terminal cleavageproduct of sonic hedgehog autoproteolysis. Cell 81, 445–455.

Ruhin, B., Creuzet, S., Vincent, C., Benouaiche, L., Le Douarin,N.M., Couly, G., 2003. Patterning of the hyoid cartilage dependsupon signals arising from the ventral foregut endoderm. Dev.Dyn. 228, 239–246.

Safa, K., El Ghazal, R., 2011. Better late than never: diagnosis andsuccessful treatment in late adulthood of supravalvular aorticstenosis secondary to Williams-Beuren syndrome. Conn. Med.75, 21–23.

Sauka-Spengler, T., Bronner-Fraser, M., 2008. A gene regulatorynetwork orchestrates neural crest formation. Nat. Rev. Mol.Cell Biol. 9, 557–568.

Sefton, M., Sanchez, S., Nieto, M.A., 1998. Conserved anddivergent roles for members of the Snail family oftranscription factors in the chick and mouse embryo.Development 125, 3111–3121.

Selicorni, A., Fratoni, A., Pavesi, M.A., Bottigelli, M., Arnaboldi, E.,Milani, D., 2006. Thyroid anomalies in Williams syndrome:investigation of 95 patients. Am. J. Med. Genet. A 140, 1098–1101.

Serra, C., Palacios, D., Mozzetta, C., Forcales, S.V., Morantte, I.,Ripani, M., Jones, D.R., Du, K., Jhala, U.S., Simone, C., Puri, P.L.,2007. Functional interdependence at the chromatin levelbetween the MKK6/p38 and IGF1/PI3K/AKT pathways duringmuscle differentiation. Mol. Cell 28, 200–213.

Sive, H.L., Grainger, R.M. and Harland, R.M., 2007. Synthesis andpurification of digoxigenin-labeled RNA probes for in situhybridization. CSH Protoc 2007, pdb prot4778.

Smith, A., Robinson, V., Patel, K., Wilkinson, D.G., 1997. The EphA4and EphB1 receptor tyrosine kinases and ephrin-B2 ligandregulate targeted migration of branchial neural crest cells.Curr. Biol. 7, 561–570.

Steventon, B., Araya, C., Linker, C., Kuriyama, S., Mayor, R., 2009.Differential requirements of BMP and Wnt signalling duringgastrulation and neurulation define two steps in neural crestinduction. Development 136, 771–779.

Sugayama, S.M., Koch, V.H., Furusawa, E.A., Leone, C., Kim, C.A.,2004. Renal and urinary findings in 20 patients with Williams-Beuren syndrome diagnosed by fluorescence in situhybridization (FISH). Rev. Hosp. Clin. Fac. Med. Sao Paulo 59,266–272.

Varga, I., Pospisilova, V., Gmitterova, K., Galfiova, P., Polak, S.,Galbavy, S., 2008. The phylogenesis and ontogenesis of thehuman pharyngeal region focused on the thymus,parathyroid, and thyroid glands. Neuro. Endocrinol. Lett. 29,837–845.



Wawersik, S., Evola, C., Whitman, M., 2005. Conditional BMPinhibition in Xenopus reveals stage-specific roles for BMPs inneural and neural crest induction. Dev. Biol. 277, 425–442.

Wilson, P.A., Hemmati-Brivanlou, A., 1995. Induction of epidermisand inhibition of neural fate by Bmp-4. Nature 376, 331–333.

Winning, R.S., Sargent, T.D., 1994. Pagliaccio, a member of the Ephfamily of receptor tyrosine kinase genes, has localizedexpression in a subset of neural crest and neural tissues inXenopus laevis embryos. Mech. Dev. 46, 219–229.

Winter, M., Pankau, R., Amm, M., Gosch, A., Wessel, A., 1996. Thespectrum of ocular features in the Williams-Beuren syndrome.Clin. Genet. 49, 28–31.

Xu, Q., Alldus, G., Holder, N., Wilkinson, D.G., 1995. Expression oftruncated Sek-1 receptor tyrosine kinase disrupts the

segmental restriction of gene expression in the Xenopus andzebrafish hindbrain. Development 121, 4005–4016.

Yamada, T., Pfaff, S.L., Edlund, T., Jessell, T.M., 1993. Control of cellpattern in the neural tube: motor neuron induction bydiffusible factors from notochord and floor plate. Cell 73, 673–686.

Yoshimura, K., Kitagawa, H., Fujiki, R., Tanabe, M., Takezawa, S.,Takada, I., Yamaoka, I., Yonezawa, M., Kondo, T., Furutani, Y.,Yagi, H., Yoshinaga, S., Masuda, T., Fukuda, T., Yamamoto, Y.,Ebihara, K., Li, D.Y., Matsuoka, R., Takeuchi, J.K., Matsumoto,T., Kato, S., 2009. Distinct function of 2 chromatin remodelingcomplexes that share a common subunit, Williams syndrometranscription factor (WSTF). Proc. Natl. Acad. Sci. USA 106,9280–9285.


Williams Syndrome Transcription Factor is critical for neural crest cell function in Xenopus laevis

Documents

Transcript of Williams Syndrome Transcription Factor is critical for neural crest cell function in Xenopus laevis