Marine Genomics xxx (2014) xxx–xxx

MARGEN-00217; No of Pages 18

Contents lists available at ScienceDirect

Marine Genomics

j ourna l homepage: www.e lsev ie r .com/ locate /margen

Variation in embryonic mortality and maternal transcript expressionamong Atlantic cod (Gadus morhua) broodstock: A functionalgenomics study

Matthew L. Rise a,⁎, Gordon W. Nash a, Jennifer R. Hall b, Marije Booman a, Tiago S. Hori a,Edward A. Trippel c, A. Kurt Gamperl a

a Department of Ocean Sciences, Memorial University of Newfoundland, St. John’s, NL, A1C 5S7, Canadab Aquatic Research Cluster, CREAIT Network, Ocean Sciences Centre, Memorial University of Newfoundland, St. John's, NL, A1C 5S7, Canadac Fisheries and Oceans Canada, St. Andrews Biological Station, St. Andrews, NB, E5B 2 L9, Canada

⁎ Corresponding author. Tel.: +1 709 864 7478; fax: +E-mail address: mrise@mun.ca (M.L. Rise).

http://dx.doi.org/10.1016/j.margen.2014.05.0041874-7787/© 2014 The Authors. Published by Elsevier B.V

Please cite this article as: Rise, M.L., et al., Vmorhua) broodstock: A functional genomics

a b s t r a c t

a r t i c l e i n f o

Article history:Received 12 March 2014Received in revised form 13 May 2014Accepted 13 May 2014Available online xxxx

Keywords:Atlantic codEggEmbryoEarly life stage mortalityMicroarrayGene expressionInterferon pathway

Early life stage mortality is an important issue for Atlantic cod aquaculture, yet the impact of the cod maternal(egg) transcriptome on egg quality and mortality during embryonic development is poorly understood. In thepresent work, we studied embryonic mortality and maternal transcript expression using eggs from 15 females.Total mortality at 7 days post-fertilization (7 dpf, segmentation stage) was used as an indice of egg quality. A20,000 probe (20 K) microarray experiment compared the 7 hours post-fertilization (7 hpf, ~2-cell stage) eggtranscriptome of the two lowest quality females (N90% mortality at 7 dpf) to that of the highest quality female(~16% mortality at 7 dpf). Forty-three microarray probes were consistently differentially expressed in both lowversus high quality egg comparisons (25 higher expressed in low quality eggs, and 18 higher expressed in highquality eggs). The microarray experiment also identified many immune-relevant genes [e.g. interferon (IFN)pathway genes ifngr1 and ifrd1)] that were highly expressed in eggs of all 3 females regardless of quality. Twelveof the 43 candidate egg quality-associated genes, and ifngr1, ifrd1 and irf7, were included in a qPCR study with 7hpf eggs from all 15 females. Then, the genes thatwere confirmed by qPCR to be greater than 2-fold differentiallyexpressed between 7 hpf eggs from the lowest and highest quality females (dcbld1, ddc, and acy3 more highlyexpressed in the 2 lowest quality females; kpna7 and hacd1more highly expressed in the highest quality female),and the 3 IFN pathway genes, were included in a second qPCR studywith unfertilized eggs.While somematernaltranscripts included in these qPCR studies were associated with extremes in egg quality, there was little correla-tion between egg quality and gene expression when all females were considered. Both dcbld1 and ddc showedgreater than 100-fold differences in transcript expression between females and were potentially influenced byfamily. The Atlantic cod ddc (dopa decarboxylase) complete cDNA was characterized, and has a 1461 bp openreading frame encoding a 486 amino acid protein that contains all eight residues of the conserved pyridoxal5’-phosphate binding site including the catalytic lysine. This study provides valuable new information and re-sources related to the Atlantic cod egg transcriptome. Some of these microarray-identified, qPCR-confirmed, At-lantic cod egg transcripts (e.g. ddc, kpna7) play important roles during embryonic development of othervertebrate species, and may have similar functions in Atlantic cod.

© 2014 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license(http://creativecommons.org/licenses/by-nc-nd/3.0/).

1. Introduction

The Atlantic cod (Gadus morhua) fishery has historically been veryimportant for several countries including Canada, Norway, andIceland. However, unpredictable and variable harvests of wild Atlanticcod resulted in all of these countries, and others (e.g. United States,Scotland), initiating cod aquaculture research and production programs

1 709 864 3220.

. This is an open access article under

ariation in embryonic mortastudy, Mar. Genomics (2014)

tomeet consumer demand for this species (Kjesbu et al., 2006; Bowmanet al., 2011). Early life stage mortality, potentially caused by low eggquality, is an important issue for Atlantic cod aquaculture (Seppolaet al., 2009; Avery et al., 2009 and references therein). Indeed, pooregg quality and high levels of mortality during embryogenesis are seri-ous issues in the aquaculture of manymarine fish species (Brooks et al.,1997). In the aquaculture industry, goodquality eggs are defined ashav-ing low mortality at fertilization, eyed stage, hatch, and first-feeding(Bromage et al., 1992; reviewed by Brooks et al., 1997). Potential influ-ences on fish egg quality and embryonic health may include over-

the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

2 M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

ripening, the bacterial colonization of eggs, exposure to pollutants andother unfavourable environmental factors, and a variety of maternalcontributions to the egg including mRNAs, proteins, and lipids (forreviews see Brooks et al., 1997; Bobe and Labbé, 2010; Swain andNayak, 2009). Maternal transcripts (mRNAs) deposited in the egg dur-ing oogenesis play important roles in early embryogenesis (before the“maternal-to-embryo transition”, which occurs at mid-blastula stagein fish, and is therefore referred to as the midblastula transition),whereas zygotic transcripts play a more pronounced role after this de-velopmental landmark (Seppola et al., 2009; Bobe and Labbé, 2010;Drivenes et al., 2012). Nonetheless, our understanding of how the fishmaternal transcriptome influences egg quality (as assessed by embry-onic mortality, percent hatch, or other indicators of developmental po-tential) is incomplete, and of great importance to aquaculture.

Functional genomics techniques have beenused to identifymaternaltranscript expression biomarkers of fish egg quality. For example,Mommens et al. (2010) used suppression subtractive hybridization(SSH) and real-time quantitative polymerase chain reaction (qPCR)to show that egg exportin 1-like transcript expression was positivelycorrelated with hatching success in Atlantic halibut (Hippoglossushippoglossus), and Bonnet et al. (2007) used DNA microarrays andqPCR to show that egg prohibitin 2 transcript abundance was negativelycorrelated with developmental potential in rainbow trout (Oncorhyn-chus mykiss). qPCR-based approaches have also identified additionaltranscript expression biomarkers of egg quality in rainbow trout.Aegerter et al. (2004) demonstrated that igf-1, igf-II, and igfr Ib transcriptlevels were significantly greater in high-quality oocytes (greater than65% survival at the eyed stage) compared with low-quality oocytes(less than 1% survival at the eyed stage). A further study by Aegerteret al. (2005) used qPCR to identify transcripts with differential expres-sion in low quality eggs (less than 30% embryonic survival) versushigh quality eggs (greater than 90% embryonic survival) in rainbowtrout; for example, tubulin β and npm2 had lower transcript expressionin low quality eggs, whereas the transcript expression of cathepsin Z andprostaglandin synthase 2was higher in low quality eggs. In Atlantic cod,Lanes et al. (2012) used qPCR to compare transcript abundance in eggsfrom wild broodstock (WB) versus eggs from farmed broodstock (FB),and reported that gsh-px had higher transcript expression in WB eggs(which had higher fertilization and hatching rates than FB), whilehsp70 transcript had greater expression in FB eggs. Further, Lanes et al.(2013) used RNA sequencing (RNAseq) to compareWB and FB fertilizedegg transcriptomes, and reported that hatching rate was significantlyhigher in WB and that genes involved in biological processes includingfructosemetabolism, fatty acidmetabolism, and oxidative phosphoryla-tion were found to be differentially expressed between groups. Otherstudies have examined maternal transcript expression in Atlantic codwithout considering egg quality. For example, Drivenes et al. (2012)used 7 K microarrays to study global transcript expression in cod oo-cytes, pooled 2-cell and blastula stage embryos (pre-midblastula transi-tion), pooled gastrula and 50% epiboly stage embryos (post-midblastulatransition), and three other developmental stages up to first-feeding.Drivenes et al. (2012) reported that only 7 transcripts were up-regulated in the pre-midblastula transition pool compared with oo-cytes, suggesting that the pooled 2-cell and blastula transcriptome andthe oocyte transcriptome were very similar. However, there was alarge group of genes (431) up-regulated in the post-midblastula transi-tion pool compared with the pre-midblastula transition pool, reflectingthe activation of the zygotic genome. Kleppe et al. (2012) built and char-acterized cDNA libraries from Atlantic cod oocytes, and 1–2 cell stageand later stage embryos, and found that mitochondrial transcriptswere abundant in the egg. Finally, qPCR has shown that immune-relevant transcripts such as interferon regulatory factor 7 (irf7) andcathelicidin are present in unfertilized Atlantic cod eggs (Seppola et al.,2009; Rise et al., 2012).

In the present study, we examined the relationship between embry-onic mortality and maternal transcript expression using fifteen females

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

from an Atlantic cod broodstock development program, the 20,000probe (20 K) Atlantic cod oligonucleotide microarray platform, andqPCR. The microarray platform used in this study, developed duringthe Atlantic Cod Genomics and Broodstock Development Project(CGP), is a good representation of the Atlantic cod transcriptome, andsuitable for a variety of functional genomics applications includingthose involving early life stages (Bowman et al., 2011; Booman et al.,2011). Since our functional genomics studies revealed that cod ddc is amaternal transcript, and ddc was recently shown to play importantroles in early development of zebrafish (Shih et al., 2013), we alsocompletely characterized the Atlantic cod ddc transcript to facilitate fu-ture research on the function of this gene and its gene products in coddevelopment.

2. Materials and methods

2.1. Fish husbandry, embryo production and sampling, and egg diameterdetermination

The adult Atlantic cod used in this study were elite broodstock fromthe CGP that were maintained at the Huntsman Marine Science Centre(St. Andrews, New Brunswick), and consisted of fifteen female codrepresenting 11 CGP families (see Fig. 1 and Supplemental Table 1 forfamily numbers) and a male representing a 12th CGP family (familyH21). The broodstock were held in 15m3 (1.25 m deep) tanks suppliedwith 100 μm filtered and recirculated seawater at 3.5 °C, and fed with acommercial pellet diet (Europa) from Skretting (St. Andrews, NB,Canada). Prior to stripping, the fish were lightly sedated using0.6 mg/L Aquacalm® (metomidate hydrochloride; Syndel LaboratoriesLtd, Qualicum Beach, BC) in their holding tanks, and transferred tosmall volume containers of seawater where they were anaesthetizedwith 50 mg/L of AquaLife TMS (tricaine methanesulfonate; Syndel Lab-oratories Ltd). To obtain eggs or sperm, light pressurewas applied to theabdomen of each fish, and gametes were collected into either 500 mLgraduated plastic beakers (eggs) or 60 mL screw-capped, plastic, speci-men collection bottles (sperm) and held on ice. The initial ejaculate/eggsample was discarded, and the external urogenital pore of males andfemales was wiped dry with paper towel to avoid seawater, urineor fecal contamination of the gametes. One female was stripped every~15 minutes, and all gamete stripping and fertilization occurred within~5 h on a single day. At 2 times, ~4.5 h apart, sperm motility wasassessed as in Garber et al. (2009) to confirm high (N70%) motility.

Unfertilized eggs were sampled as previously described (Rise et al.,2012). Briefly, from each female cod used in this study, 0.25 mL of eggswith minimal volume of ovarian fluid was added to a 1.5 mL RNase-free tube containing 5 volumes (1.25mL) of RNAlater (Ambion/Life Tech-nologies Inc., Burlington, ON) and stored overnight at 4 °C following themanufacturer’s protocol. For each female, eggs were then gently pouredinto a Petri dish containing a small volume of RNAlater, and forcepscleaned with RNase AWAY (Molecular BioProducts, San Diego, CA) andsterile transfer pipettes were used to carefully transfer 3 sets of 25 eggsto RNase-free 1.5 mL tubes. The RNAlater was then removed by pipette,and the eggs were stored at−80 °C until RNA extraction.

Controlled/timed egg fertilizations were conducted as follows. Eggswere transferred from plastic collection beakers into 1.5 L graduatedglass “fertilization beakers” by gentle pouring, and sperm (2 mL spermper 100 mL of eggs) was added using a plastic transfer pipette (note:each of the 15 females involved in the study was represented by a sep-arate 1.5 L fertilization beaker). The egg and sperm mixture was gentlystirred using the pipette, 100 mL of UV-treated filtered seawater wasadded, and themixturewas again stirred. After incubating for 1 minute,500 mL of UV-treated filtered seawater was added and the mixtureincubated for an additional 5 minutes. Each fertilization beakerwas then filled to 1.4 L with UV-treated filtered seawater, placed in awalk-in cold room at 6 °C, and left undisturbed until 7 hours post-fertilization (hpf) (~2-cell stage).

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

Fig. 1. Egg quality asmeasured by successful embryonic development. A. Total percentmortality at 1 day post-fertilization (1 dpf). B. Total percentmortality at 3 dpf. C. Total percentmor-tality at 7 dpf. D. Percent hatch (Note the break in the y axis). All 15 females included in the study, alongwith family affiliations in the broodstock program, are indicated below the graphs.Females are arranged by family; families represented by one female are on the left, and families represented by two females (B11, B33, B35, B84) are on the right. Values aremeans±1 S.E.

3M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

Prior to the distribution of eggs from each female into incubationbeakers at 7 hpf, a subsample of eggs was placed into a Petri dish andphotographed using a dissecting microscope and video camera. Theseimages were transferred into ImageJ (http://imagej.nih.gov/ij), andthe diameter of a number of eggs per female (approx. 15–30) wasmea-sured relative to a 2 mmmicrometer that was included in the image.

At 7 hpf, a sterile pipettewas used to transfer approximately 0.25mLof floating (fertilized) eggs from each fertilization beaker into each ofthree 1.5 mL RNase-free tubes. Seawater was removed by pipette, andthe samples were flash-frozen in liquid nitrogen and stored at−80 °Cuntil RNA extraction. In addition, sixty 600 mL beakers containing500 mL of UV-treated filtered seawater were each stocked with ~1000fertilized eggs (4 replicate beakers per female). Total percent fertiliza-tion (i.e. floating volume) was also determined at this time for each ofthe 1.5 L fertilization beakers. The number of eggs was determined bycollecting 200 μL of eggs using a wide bore pipette, counting the eggs,and then extrapolating to the volume required for 1000 eggs; this wasperformed twice and averaged for each female. Replicate “incubationbeakers” (4 per female) were randomly placed on the bench top of awalk-in cold room (~6 °C), whose fluorescent lights and reflectivemetal surfaces were covered with shade cloth and black garbage bagsto achieve a light intensity range of 107–179 LUX at the top of the bea-kers. Water temperature wasmaintained at 6.2–6.4 °C until 100% hatch(i.e. for 17 days). Water quality was maintained in the sixty incubationbeakers by the daily removal and counting (for survival or total mortal-ity, Fig. 1, Supplemental Table 1) of dead eggs/embryos, and the daily re-placement of 80% of the seawater volume. Dead eggs and embryos wereidentified as being negatively buoyant and opaque. Total embryonicmortality was assessed at 1 day post-fertilization (1 dpf), 3 dpf, and

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

7 dpf. These time points correspond to blastula, gastrula, and segmenta-tion periods, respectively, based on the embryonic development ofAtlantic cod held at temperatures similar to those used in the currentstudy (Hall et al., 2004; Rise et al., 2012). Our use of total mortality at7 dpf and percent hatch as indices of egg quality is similar to approachesused by other groups studying the influence of fish maternal transcriptexpression on egg quality (Aegerter et al., 2004, 2005; Bonnet et al.,2007; Mommens et al., 2010).

2.2. RNA preparation

Each pool of 25 unfertilized eggs per female was homogenized in400 μL of TRIzol Reagent (Invitrogen/Life Technologies) using a motor-ized Kontes RNase-Free Pellet Pestle Grinder (Kimble Chase, Vineland,NJ). An additional 400 μL of TRIzol Reagent was added, and each samplewas then passed through a QIAshredder (QIAGEN,Mississauga, ON) fol-lowing the manufacturer’s instructions. Two hundred μL of TRIzol wasthen added to each sample to make a total homogenate volume of ap-proximately 1mL, and the TRIzol total RNA extractionswere completedfollowing the manufacturer’s instructions.

For the 7 hpf samples, a 0.25 mL volume of flash-frozen fertilizedeggs from each female was homogenized in 2.5 mL of TRIzol using aBio-Gen PRO200 tissue homogenizer (PRO Scientific Inc., Oxford, CT).This homogenizer was equipped with a 5 mm × 150 mm generatortip, and a speed setting of 2–3 was used until no solids were visible(approx. 30 sec). The generator tip was cleaned between samples byrunning it in a 500 mL beaker of RNase-free water to remove anyretained solids, sequentially rinsing it with 0.1% SDS, 0.01% SDS,0.001% SDS and Milli-Q water, and then running the generator tip

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

4 M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

3 times (in separate 50mL conical tubes) in RNase-free water to ensurethat all SDS was removed. The homogenate samples were then passedthrough QIAshredder columns (QIAGEN) following the manufacturer’sinstructions, and centrifuged at 4 °C (12,000 ×g for 10min) to pellet in-soluble material. The TRIzol total RNA extractions were then completedfollowing the manufacturer’s protocol.

Individual total RNA samples were treated with 6.8 Kunitz units ofDNaseI (RNase-Free DNase Set, QIAGEN)with themanufacturer’s buffer(1×final concentration) at room temperature for 10min to degrade anyresidual genomic DNA. The DNase-treated RNA samples were thencolumn-purified using the RNeasy MinElute Cleanup Kit (QIAGEN) fol-lowing the manufacturer’s methods. RNA integrity was verified by 1%agarose gel electrophoresis, and RNA purity was assessed by A260/280and A260/230 NanoDrop UV spectrophotometry for both the pre-cleaned and the column-purified RNA samples.

2.3. Microarray hybridization, data acquisition, and data analysis

The fertilized egg (7hpf) RNA sampleswere selected formicroarray-based global transcript expression analyses because higher quantities of

Fig. 2. Overview of 20 K microarray experimental design and results. A. Arrows represent arrayswaps. dpf: days post-fertilization. B. Microarray features associated with the two lowest-qualit7 hpf egg comparisons. C. Microarray features associated with the highest-quality female in bo

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

RNA were isolated from the 0.25 mL volumes of flash-frozen fertilizedeggs compared with the pools of 25 unfertilized eggs stabilized withRNAlater. However, both fertilized and unfertilized egg RNA sampleswere included in the qPCR studies. DNAse-treated and column-purified total RNA samples from 7 hpf eggs from females 12 and 13(highest total mortality at 7 dpf, “lowest quality”) and from female 2(lowest total mortality at 7 dpf, “highest quality”) were analyzedusing the Atlantic cod 20 K oligonucleotide microarray platform(Booman et al., 2011). Two, 4-array, direct comparison experimentswere performed, each comparing one of the two lowest quality femalesto the highest quality female, and consisting of two duplicates and twodye-swaps (Fig. 2A). For each female, three replicate total RNA sampleswere pooled before labeling. For each array, 5 μg of total RNA waslabeled with AlexaFluor 647 or AlexaFluor 555 using the InvitrogenSuperScript Direct cDNA Labeling kit according to the manufacturer’sprotocol (Invitrogen/Life Technologies). Formamide-based hybridiza-tion buffer (2× concentrated) and LNA dT blocker (Genisphere,Hatfield, PA) were added to purified, labeled cDNA, and on eachmicroarray two samples were co-hybridized using a LifterSlip (ThermoScientific, Waltham, MA). Hybridizations were performed overnight

s (with number of technical replicate arrays shown). Arrows in reverse direction are dye-y females in both of the highest quality (female 2) versus lowest quality (female 12 or 13)th of the highest quality versus lowest quality 7 hpf egg comparisons.

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

Table 1Identification and functional annotation of 25microarray features associated with the two lowest-quality females in both of the highest-quality (female 2) versus lowest-quality (female12 or 13) 7 hpf egg comparisons1.

Probe ID(accession number)2

BLASTx identification3 of informative microarray features Functional annotation4 Microarray meanfold higherexpressed5 in:

qPCR mean foldhigher expressed6

in:Best named BLASTx hit(species; accession number)3

Lengthalign.(% ID)

E-value

Female12

Female13

Female12

Female13

41406 (EY965807) 26S proteasome non-ATPase regulatorysubunit 12 (PSMD12) (Salmo salar;ACI68286)

85/90(94%)

2E-52 Cell cycle checkpoint; G1/S transition of mitotic cell cycle;S phase of mitotic cell cycle; M/G1 transition of mitoticcell cycle; Regulation of ubiquitin-protein ligase activityinvolved in mitotic cell cycle; antigen processing andpresentation of peptide antigen via MHC class I; DNAdamage response, signal transduction by p53 classmediatorresulting in cell cycle arrest; Regulation of apoptosis7

14.79 2.30 1.50 1.59

36224 (FG281535) Bromodomain, testis-specific, isoformCRA_a (Homo sapiens; EAW73106)

36/67(54%)

5E-10 Regulation of transcription, DNA-dependent 13.76 3.71 - -

42905 (ES778986) Ubiquitin carboxyl-terminal hydrolase14 (synonym: Ubiquitin-specificprocessing protease 14, USP14)(Danio rerio; AAH44553)

41/44(93%)

1E-17 Proteolysis; ubiquitin-dependent protein catabolicprocess; Synaptic transmission; Negative regulationof endopeptidase activity; regulation of chemotaxis;regulation of proteasomal protein catabolic process

5.51 2.71 0.99 0.89

46472 (ES241847) Unknown NA NA NA 5.22 4.29 - -37690 (ES787443) Ceruloplasmin (Chionodraco

rastrospinosus; CAL92184)56/81(69%)

2E-30 Copper ion transport; Cellular iron ion homeostasis;Transmembrane transport; oxidation-reduction process7

5.12 8.78 - -

40405 (FF410984) Discoidin, CUB and LCCL domaincontaining 1 (DCBLD1) (Cheloniamydas; EMP31112)

44/108(41%)

2E-15 Cell adhesion 5.03 4.09 14659.40 211.81

53034 (ES479417) Unknown NA NA NA 4.53 3.17 - -47085 (FG329447) Unknown NA NA NA 4.43 4.78 - -42324 (EX185603) Sorting nexin-10 (SNX10) (Esox lucius;

ACO13554)20/34(59%)

0.078 Transport; endosome organization; cell communication 4.31 4.57 - -

37288 (ES243471) G patch domain containing 4(GPATCH4) (Xenopus laevis;AAH97554)

26/41(63%)

3E-6 Nucleic acid binding8 4.04 3.87 - -

38779 (ES771352) Leukocyte-cell-derived chemotaxin 2(LECT2) (Lates calcarifer; ABV66068)

102/141(72%)

2E-68 Skeletal system development; chemotaxis; Negativeregulation of Wnt receptor signaling pathway

3.85 3.31 - -

47957 (FF410956) Unknown NA NA NA 3.74 2.78 - -45903 (EY970165) Unknown NA NA NA 3.20 4.86 - -50189 (FG340328) Unknown NA NA NA 3.12 3.28 - -42721 (EX173387) Transmembrane protein 147

(TMEM147) (Salmo salar; ACM08465)216/225(96%)

9E-157 Endoplasmic reticulum membrane9 3.05 5.11 1.27 1.16

50669 (EL617467) Unknown NA NA NA 2.93 3.32 - -36686 (EX180925)10 Cystathionine gamma-lyase (CTH)

(Anoplopoma fimbria; ACQ58689)87/107(81%)

9E-50 Cellular amino acidmetabolic process; cysteine biosyntheticprocess; negative regulation of cell growth7

2.91 3.00 0.99 0.87

36932 (FF410817) Aromatic-L-amino-acid-decarboxylase(synonym: Dopa decarboxylase, DDC)(Oryzias latipes; BAH37023)

30/54(56%)

2E-10 Cellular amino acid metabolic process; neurotransmittersecretion; dopamine biosynthetic process; catecholaminebiosynthetic process; serotonin biosynthetic process;synaptic transmission; circadian rhythm7

2.80 2.95 147.97 2.06

47470 (EG641628) Aspartoacylase-2 (synonym:Aminoacylase 3, ACY3) (Osmerusmordax; ACO09186)

64/111(58%)

2E-47 Metabolic process; interspecies interaction betweenorganisms

2.67 3.12 2.86 4.40

37412 (EX178462) Glycine receptor subunit beta(Heterocephalus glaber; EHB10272)

41/46(89%)

1E-19 Startle response; chloride transport; neuropeptide signalingpathway; synaptic transmission, glycinergic; acrosomereaction; nervous system development; visual perception7

2.45 2.34 - -

47542 (ES239666) Unknown NA NA NA 2.44 2.50 - -40729 (EG647267) Unknown NA NA NA 2.32 2.31 - -50629 (FF413165) Unknown NA NA NA 2.25 2.40 - -46145 (FF417194) Reverse transcriptase (CR1-3)

(Lycodichthys dearborni; ADJ80991)37/79(47%)

5E-14 NF 2.22 2.63 - -

49005 (FG274461) Unknown NA NA NA 2.11 2.24 - -

NA: not applicable; NF: no functional annotation found for putative human orthologue of Atlantic cod cDNA.1 At least 2-fold higher expression in lowest-quality females (female 12 or female 13) compared with highest-quality female (female 2). For gene lists corresponding to individual

“lowest-quality female versus highest-quality female” comparisons (i.e. female 12 versus female 2, and female 13 versus female 2), see Supplemental Tables 2–5. Genes in this list aresorted by descending “female 12 versus female 2” microarray mean fold change.

2 Probe identifier (ID) numbers are 5-digit unique identifiers for the 50mer probes on theAtlantic cod 20 Kmicroarray (Boomanet al., 2011). Informative probe sequenceswere BLASTnaligned against GenBank dbEST to identify a representative cod EST (accession number shown in brackets) for BLASTx identification.

3 The BLASTx hit with the lowest E-value and a protein name (e.g. not predicted or hypothetical) is shown if available. %ID = percent identity of amino acid residues over length ofalignment (length align.).

4 Functional annotation associated with the putative human orthologue (i.e. best Homo sapiens BLASTx hit) of Atlantic cod contig or singleton used for probe design (Booman et al.,2011). Only Biological Process Gene Ontology (GO) terms are listed in this table, except for GPATCH4 (see footnote 8) and Transmembrane protein 147 (see footnote 9). For MolecularFunction and Cellular Component GO terms associated with putative human orthologues, and GO terms associated with putative zebrafish (Danio rerio) orthologues of Atlantic codcDNAs, see Supplemental Table 7.

5 Microarray mean fold-change was calculated as the average of the Loess normalized signal ratios between lowest-quality female 7hpf samples and highest-quality female 7hpf samplesfrom replicate microarrays. Mean fold-change values were calculated from normalized signal ratios from 3 or 4 technical replicate arrays (see Supplemental Table 6 and footnotes for details).

6 qPCRmean fold-changewas calculated as lowest-quality female (number 12 or 13) 7hpf relative quantity (RQ) divided by highest-quality female (number 2) 7hpf RQ. A dash indicates thatqPCR was not performed for that microarray-identified transcript.

7 A selection of Biological ProcessGO terms associatedwith the putative humanorthologue of this informative cod transcript is included in this table. Ifmultiple, similar GO termswere found,a representative GO term was included in this table. For the complete list of GO terms, see Supplemental Table 7.

8 Since the putative human orthologue had no associated biological process (BP) GO terms, a molecular function (MF) GO term was included in this table.9 Since the putative human orthologue had no associated BP or MF GO terms, a Cellular Component GO term was included in this table.10 Probe 36686 is represented by an EST with accession number ES769840, and this EST is located in an untranslated region with no BLASTx hits. ES769840 is 99% identical to EST with

accession number EX180925 over 349 aligned nucleotides (E-value: 6E-180), and the best named BLASTx hit for EX180925 is shown.

5M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortality and maternal transcript expression among Atlantic cod (Gadusmorhua) broodstock: A functional genomics study, Mar. Genomics (2014), http://dx.doi.org/10.1016/j.margen.2014.05.004

6 M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

(~16 hours) at 42 °C in a water bath. Detailed protocols for slide pre-hybridization, hybridization and washing are described in Boomanet al. (2011).

To obtain Tiff images containing fluorescence data, arrays werescanned at 5 μm resolution using a ScanArray Gx Plus scanner andScanExpress v4.0 (Perkin Elmer, Waltham, MA), and signal intensitydata were extracted using Imagene v7.5 (Biodiscovery, El Segundo,CA). Datawere processed using R and the Bioconductor packagemarrayas described in Booman et al. (2011). Briefly, control spots and Imagene-flagged spots were removed, data were log2-transformed and Loess-normalized per subgrid, probes with raw signal values below a medianbackground + 2× SD were removed, and duplicate probes were aver-aged, resulting in a final dataset of 20,000 probes. This microarraydataset is described in GEO series GSE54233, and individual sampledata (raw and processed) are available under GEO accession numbersGSM1310522–GSM1310529.

For each of the two 4-array experiments, a probe was considered in-formative only if the fold change between the lowest- and highest-quality femalewas larger than2 in at least 3 of the 4 arrays (SupplementalTables 2–5). A 2-fold threshold for differential expression was selected toincrease the chances of identifying useful candidate molecular bio-markers of egg quality to enter the qPCR study. A final gene list of 43 in-formative probes (25 higher expressed in both of the lowest qualityfemales, and 18 higher expressed in the highest quality female, Fig. 2,Supplemental Table 6) was manually BLAST identified by comparingthe full sequences [i.e. CGP EST contiguous sequences (contigs) or sin-gletons (Bowman et al., 2011)] that the probes represented (Boomanet al., 2011) against the nr database from NCBI using BLASTx and bychoosing the most significant (E-value b10−5) hit with an informativedescription (i.e. an associated protein name, avoiding “predicted” and“hypothetical” entries). Gene ontology (GO) annotation was added tothe gene list by choosing the most significant human and zebrafish(Danio rerio) hits (i.e. putative human and zebrafish orthologues)with UniProt entries (Supplemental Table 7). These UniProt accessionnumbers were used to query QuickGO for the associated GO BiologicalProcess (BP), Molecular Function (MF), and Cellular Component (CC)terms (Supplemental Table 7). Only GO BP terms associated with theputative human orthologues of microarray-identified cod sequencesare shown in Tables 1 and 2. The 43 informative 50-mer microarrayprobe sequenceswere also BLASTn aligned against the GenBank EST da-tabase (dbEST) to identify representative ESTs with 98-100% identitywith the probes; the GenBank accession numbers and most significant(E-value b10−5) BLASTx hits with informative descriptions for theseESTs are also shown in Tables 1 and 2.

In order to identify transcripts with relatively high expression inthe fertilized eggs of all three females included in the microarraystudy (females 2, 12, and 13) regardless of egg quality, the rawbackground-subtracted signal values were obtained for both chan-nels during the marray processing in Bioconductor. The data werenormalized using a 75th percentile normalization procedure, witha rescaling to a 75th percentile of 1500, for each channel. Probeswere considered highly expressed when both of the duplicate spotshad a normalized signal value higher than 4000 in both channelsfor all 8 arrays. Duplicate spots were then averaged to give a singlenormalized signal value per channel for each probe (SupplementalTable 8).

2.4. Real-time quantitative polymerase chain reaction (qPCR)

qPCRanalyses of transcript (mRNA)expression levelswereperformedusing SYBR Green I dye chemistry and the 7500 Fast Real Time PCR sys-tem (Applied Biosystems/Life Technologies). Transcript expression levelsof the target genes [i.e. transcripts of interest (TOI)] were normalized to39S ribosomal protein L2, mitochondrial precursor transcript levels. Thisgene was chosen as the endogenous control (i.e. normalizer) gene dueto its stable expression profile in microarray and qPCR studies (see

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

Supplemental Tables 10 and 12 for all normalizer gene CT values). Forall 15 TOIs [12 genes that were microarray-identified as differentiallyexpressed between low-quality and high-quality 7 hpf eggs, and 3 in-terferon (IFN) pathway genes)], expression levels were measured in7 hpf eggs from all 15 females. For a subset of 8 TOIs (5 microarray-identified genes that were qPCR confirmed as N2-fold differentiallyexpressed between low-quality and high-quality 7 hpf eggs, and 3 IFNpathway genes), expression was also assessed in unfertilized eggsfrom the same 15 females; two biological replicates (females) were re-moved from the unfertilized egg qPCR analysis since they had outliernormalizer CT values. Replicate beaker number 2 was used for each fe-male for gene expression analyses.

The sequences of all primer pairs used in the qPCR analyses are pre-sented in Table 3. Each primer pair was quality tested to ensure that asingle product was amplified (dissociation curve analysis) and thatthere was no primer-dimer present in the no-template control.Amplicons were electrophoretically separated on 2% agarose gels andcompared with a 1 kb plus ladder (Invitrogen/Life Technologies) to en-sure that the correct size fragment was being amplified. Amplificationefficiencies (Pfaffl, 2001) were calculated using cDNA synthesizedfrom a high quality (female 2) 7 hpf egg RNA sample and from lowquality (females 12 and 13) 7 hpf egg RNA samples. For the low qualityfemales, cDNA was synthesized (see method below) from female 12and 13 RNA samples separately and then pooled. The reported efficien-cies (Table 3) are an average of the values for high and low qualityfemales, with two exceptions: discoidin, CUB and LCCL domain containing1 (dcbld1), and aromatic-L-amino-acid decarboxylase [synonym:dopa decarboxylase (ddc)] amplification efficiencies are reported forthe low quality female pool only due to extremely low expression in fe-male 2. Standard curves were generated using either a 5-point 1:3 dilu-tion series starting with cDNA corresponding to 50 ng of input totalRNA, or a 4-point 1:3 dilution series starting with cDNA correspondingto 16.7 ng of input total RNA [see Table 3 (including footnotes) fordetails].

First-strand cDNA was synthesized in 20 μL reactions from 1 μg ofDNaseI-treated, column-purified total RNA using random primers(250 ng; Invitrogen/Life Technologies) and SuperScript II reverse tran-scriptase (200U; Invitrogen/Life Technologies) with themanufacturer’sfirst strand buffer (1× final concentration) and DTT (10 mM final con-centration) at 42 °C for 50 min. PCR amplification was performed in a13 μL reaction using 1X Power SYBR Green PCR Master Mix (AppliedBiosystems/Life Technologies), 50 nM of both the forward and reverseprimers, and cDNA corresponding to 8 ng of input total RNA. The real-time analysis program consisted of 1 cycle of 50 °C for 2 min, 1 cycleof 95 °C for 10 min and 40 cycles of 95 °C for 15 sec and 60 °Cfor 1 min, with fluorescence detection at the end of each 60 °C step.On each plate, for every sample, the target gene and endogenous controlwere tested in triplicate and a no-template control was included. The CTvalues were determined using the 7500 Software Relative Quantifica-tion Study Application (Version 2.0) (Applied Biosystems/Life Technol-ogies). The relative quantity (RQ) of each transcript was determinedusing the Pfaffl method (Pfaffl, 2001), with amplification efficiencies(Table 3) incorporated. For each TOI, the sample with the lowestnormalized expression (mRNA) level was set as the calibratorsample (i.e. assigned an RQ value = 1); transcript expression data arepresented as RQ normalized to 39S ribosomal protein L2, mitochondrialprecursor.

2.5. Correlation analysis

In order to determine if gene expression levels were related to eggquality, correlation analyses (Spearman rank tests) were performed.Total percent mortality at 7 dpf was chosen as the egg quality measure-ment in the correlation analysis of gene expression [expressed as log2-transformed relative quantity (RQ)] and egg quality.

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

Table 2Identification and functional annotation of 18microarray features associatedwith the highest-quality female in both of the highest-quality (female 2) versus lowest-quality (female 12 or13) 7 hpf egg comparisons1.

Probe ID(accessionnumber)2

BLASTx identification3 of informative microarray features Functional annotation4 Microarray meanfold higherexpressed5 inFemale 2 comparedwith:

qPCR mean foldhigher expressed6

in Female 2compared with:

Best named BLASTx hit(species; accession number)3

Length align.(% ID)

E-value

Female12

Female13

Female12

Female13

36741 (FG321430) Cytochrome b reductase 1 (Salmosalar; ACN11464)

89/117(76%)

3E-53 Transport; cellular iron ion homeostasis; responseto iron ion; electron transport chain; oxidation-reduction process; transmembrane transport

9.10 10.10 - -

54998 (EY968116) Unknown NA NA NA 7.58 8.96 - -55480 (EY966805) Unknown NA NA NA 5.07 8.78 - -38561 (ES480265) Importin subunit alpha-8 (synonym:

Karyopherin alpha 7, KPNA7) (Pagrusmajor; BAF36663)7

185/234(79%)

4E-121 Protein import into nucleus; intracellularprotein transport; transport; Protein transport

5.03 4.95 7.57 8.72

42389 (FG317288) Steroid 5 alpha-reductase 3 (synonym:Steroid 5 alpha-reductase 3, SRD5A3)(Danio rerio; AAI33965)

80/141(57%)

1E-41 Dolichol-linked oligosaccharide biosyntheticprocess; lipid metabolic process; androgen bio-synthetic process; steroid metabolic process;polyprenol catabolic process; dolichol metabolicprocess; oxidation-reduction process

5.02 4.57 1.18 1.20

37842 (EG639245) Myosin heavy chain (Gasterosteusaculeatus; AAS19756)

196/217(90%)

4E-132 Response to reactive oxygen species; regulationof heart rate; ATP catabolic process; muscle con-traction; adult heart development; ventricularcardiac muscle tissue morphogenesis8

4.67 21.40 - -

53189 (EC911206) Unknown NA NA NA 4.48 4.24 - -48795 (CO542035) Importin subunit alpha-8 (synonym:

Karyopherin alpha 7, KPNA7) (Pagrusmajor; BAF36663)7

117/167(70%)

3E-66 Protein import into nucleus; intracellularprotein transport; transport; protein transport

3.95 3.89 - -

46529 (FF409776) Unknown NA NA NA 3.51 4.81 - -36659 (ES470021) Protein cornichon homolog (CNIH)

(Salmo salar; ACM08616)136/143(95%)

3E-71 Transport; signal transduction; vesicle-mediated transport; intracellular signaltransduction; immune response

3.47 4.78 0.70 0.73

53719 (EG639568) Unknown NA NA NA 3.25 3.25 - -46379 (ES481134) Trafficking protein particle complex

subunit 3 (TRAPPC3, BET3) (Salmosalar; ACM08764)

88/115(77%)

2E-51 Transport; ER toGolgi vesicle-mediated transport;vesicle-mediated transport

3.25 3.28 0.87 0.97

47432 (EG644959) Unknown NA NA NA 3.21 4.41 - -39361 (FF408647) Acyl-CoA synthetase family member

4 (Ophiophagus hannah; ETE59025)34/66 (52%) 4E-18 Lipid metabolic process; fatty acid metabolic

process; metabolic process2.63 5.51 - -

41562 (ES783298) 3-hydroxyacyl-CoA dehydratase 1(HACD1) (Myotis brandtii;EPQ01740)

43/50 (86%) 9E-22 Protein dephosphorylation; fatty acidbiosynthetic process; signal transduction;multicellular organismal development; lipidbiosynthetic process; peptidyl-tyrosinedephosphorylation

2.61 3.48 2.11 2.51

48352 (FF408453) Unknown NA NA NA 2.61 3.48 - -48202 (FF406548) Unknown NA NA NA 2.28 2.63 - -55293 (FG279875) Unknown NA NA NA 2.10 6.04

NA: Not applicable.1 At least two-fold higher expression in highest-quality female (female 2) comparedwith lowest-quality females (females 12 and 13). For gene lists corresponding to individual “lowest

quality female versus highest-quality female” comparisons (i.e. female 12 versus female 2, and female 13 versus female 2), see Supplemental Tables 2–5. Genes in this list were sorted bydescending “female 2 versus female 12” microarray mean fold change.

2 Probe identifier (ID) numbers are 5-digit unique identifiers for the 50mer probes on theAtlantic cod 20 Kmicroarray (Boomanet al., 2011). Informative probe sequenceswere BLASTnaligned against GenBank dbEST to identify a representative cod EST (accession number shown in brackets) for BLASTx identification.

3 The BLASTx hit with the lowest E-value and a protein name (e.g. not predicted or hypothetical) is shown if available. %ID = percent identity of amino acid residues over length ofalignment (length align.).

4 Functional annotation associatedwith the putative human orthologue (i.e. best Homo sapiens BLASTx hit) of Atlantic cod EST contig or singleton used for probe design (Booman et al.,2011). Only Biological Process Gene Ontology (GO) terms are listed in this table. For Molecular Function and Cellular Component GO terms associated with putative human orthologues,and GO terms associated with putative zebrafish (Danio rerio) orthologues of Atlantic cod cDNAs, see Supplemental Table 7.

5 Microarray mean fold-change was calculated as the average of the Loess normalized signal ratios between highest-quality female 7hpf samples and lowest-quality female 7hpf samplesfrom replicate microarrays. Mean fold-change values were calculated from normalized signal ratios from 3 or 4 technical replicate arrays (see Supplemental Table 6 and footnotes for details).

6 qPCRmean fold-changewas calculated as highest-quality female (number 2) 7hpf relative quantity (RQ) divided by lowest-quality female (number 12 or 13) 7hpf RQ. A dash indicates thatqPCR was not performed for that microarray-identified transcript.

7 BLASTx alignment of ESTs representing probes 38561 and 48795 against GenBank’s non-redundant (nr) amino acid sequence database revealed that their translations aligned against dif-ferent, non-overlapping regions of KPNA7 (data not shown), and therefore, that they may represent the same gene.

8 A selection of Biological Process GO terms associated with the putative human orthologue of this informative cod transcript is included in this table. For the complete list of GO terms, seeSupplemental Table 7.

7M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

2.6. ddc: full-length cDNA cloning, sequencing, and phylogenetic analysis

The sequences of all primers used in cDNA cloning and their applica-tion are presented in Supplemental Table 9. A partial cDNA for ddcwasavailable based upon sequence data gathered in conjunction with the

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

Atlantic Cod Genomics and Broodstock Development Project (Contignumber: all_v2.0.3872.C1; 20 K microarray probe identifier number36932) (Bowman et al., 2011; Booman et al., 2011). RNA ligase-mediated rapid amplification of 5’ and 3’ cDNA ends (RLM-RACE) wasperformed to obtain the remaining ddc cDNA sequence. A commercial

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

Table 3Primers used in qPCR studies.

Gene name Primer name Nucleotide sequence (5’-3’) Efficiency (%)1 Amplicon size (bp)

Ubiquitin carboxyl-terminal hydrolase 14 (synonym: ubiquitin-specificprocessing protease 14, usp14)

42905-1f CTCCCTTCTCAGCAAACTGG 103 10442905-1r GCGTGACTTGTACGAGACCAT

Aspartoacylase-2 (synonym: aminoacylase 3, acy3) 47470-1f GTTTGCCGTTCTCTGGGATA 113 13047470-1r ACATGAAGACTGGGGTGGAG

Discoidin, cub and lccl domain containing 1 (dcbld1) 40405-2f ATGGCTGTGGGCATACAAAG 111 10240405-2r GAAGCCTCCACGTACTCGTC

26S proteasome non-ATPase regulatory subunit 12 (psmd12) 41406-2f AGTTCCTCTCCTCCCTGGTG 111 12841406-2r GTTGAGCTTGTGGGACCAGT

Aromatic-L-amino-acid-decarboxylase (synonym: dopa decarboxylase, ddc) 36932-2f GACAGCTCGGTGATGTGCT 91 8636932-2r CGTATTGTTCTGCGCTTCGT

Cystathionine gamma-lyase (cth) 36686-2f ACATCAAGGGCCAGCTAGAG 106 10536686-2r CCGGGTGTTCTGCTAGACTT

Transmembrane protein 147 (tmem147) 42721-2f AGCCCACTGCACTTGTAGGT 102 11342721-2f CGAGCTCAGGGTGCTGTAAT

3-hydroxyacyl-CoA dehydratase 1 (hacd1) 41562-1f GGGGAGGTCATTGTTGAGAA 96 14741562-1r ATGCTGGTAGAGGTGGTTGG

Importin subunit alpha-8 (synonym: karyopherin alpha 7, kpna7) 38561-2f AACTCCACGAAGCGAGAGAG 110 10338561-2r GAATTCGCGGATGTCAAGTT

Trafficking protein particle complex subunit 3 (trappc3) 46379-2f TCTAGGCAGTCCAACCGAAC 117 9346379-2r CTTACACAGCTGGGTCACCA

Protein cornichon homolog (cnih) 36659-2f ATGAGTGGGCCTGGACTGTA 116 14736659-2r GCTCACCAGCACGTAGATCA

Steroid 5 alpha-reductase 3 (synonym: steroid 5 alpha-reductase 3, srd5a3) 42389-1f GGTGTCCTGTCCGCATTACT 109 14642389-1r AAAACTCCTGGCAGAGCTGA

Interferon-related developmental regulator 1 (ifrd1) 39429-2f TCCGAGACGTGTTTGAACTG 116 13739429-2r GAACTTGTTCCTGGCTTTGG

Interferon regulatory factor 7 (irf7) IRF7-f GGTCGTCGGAGTTCTTGGAGTT 121 102IRF7-r CCAAACGACAAGGCCAAATG

Interferon gamma receptor 1 (ifngr1) INFg_rec-f CAGCGACCATGAAACTCTGA 118 106INFg_rec-r GAGGTCGCACTGGAGGTTAG

39S ribosomal protein L2, mitochondrial precursor2 35591-2f GGCCTTTGACGAGAAAGTTG 106 14835591-2r GATGACTCCGGAGGTTTTGA

1 Values in regular font were calculated using a 5-point 1:3 dilution series starting with cDNA corresponding to 50 ng of input total RNA. Values in bold font are for the lower qualityfemale pool only, due to extremely low expression of these transcripts in the highest quality female. Values in italicized font used a 4-point 1:3 dilution series starting with cDNA corre-sponding to 16.7 ng of input total RNA. See Materials and methods for additional details.

2 Normalizer gene

8 M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

kit for RLM-RACE [GeneRacer Kit (Invitrogen/Life Technologies)] wasused, with DNaseI-treated and column-purified total RNA (5 μg) isolat-ed from 7 hpf eggs from female 12 as template. PCR amplification wasperformed using DyNAzyme EXTDNA polymerase (MJ Research). Brief-ly, 50 μL reactionswere prepared containing one-twentieth of the RACEcDNA reaction, DyNAzyme EXT DNA polymerase (1 U), the manufac-turer’s Optimized DyNAzyme EXT Buffer (1× final concentration),0.2 mM dNTPs and 0.2 μM each of forward and reverse primer. PCR cy-cling conditions were 40 cycles of [94 °C for 30 sec, 70 °C decreasing by0.3 °C per cycle (to 58.3 °C at cycle 40) for 30 sec, and finally 72 °C for2 min]. One μL of the first PCR product was then used as template in anested PCR, with PCR core reaction components and cycling conditionsas per the first PCR reaction. Amplicons were electrophoretically sepa-rated on a 1% agarose gel, excised and purified using the QIAquick GelExtraction Kit (QIAGEN), cloned into pGEM-T-Easy (Promega, Madison,WI), and transformed into Subcloning Efficiency DH5α chemically com-petent cells (Invitrogen/Life Technologies) using the manufacturers’ in-structions and standard molecular techniques. Plasmid DNA wasisolated using the QIAprep SpinMiniprep Kit (QIAGEN) with themanu-facturer’s method. Triplicate subclones were sequenced in both direc-tions using BigDye Terminator reagents (Applied Biosystems/LifeTechnologies) and the 3730 × l DNA Analyzer (Applied Biosystems/Life Technologies) at the Genomics and Proteomics Facility, MemorialUniversity. Sequence data was compiled and analyzed using VectorNTI Advance v. 11.5.1 (Invitrogen/Life Technologies).

To verify the full-length Atlantic cod ddc cDNA sequence, PCRprimerswere designed to subdivide the sequence into 3 overlapping re-gions. In addition, PCR primers were designed to amplify the entire cod-ing DNA sequence (CDS) as one fragment. PCR amplifications were

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

performedusingAdvantage cDNA PolymeraseMix (Clontech,MountainView, CA) with cDNA [from the low quality (female 12 and 13) cDNApool] that had been synthesized for primer quality testing as template.Briefly, 50 μL reactions were prepared containing cDNA (correspondingto 50ng of input total RNA), Advantage cDNApolymerase (1× final con-centration), themanufacturer’s cDNA PCR reaction buffer (1× final con-centration), 0.2 mM dNTPs, and 0.2 μM each of the forward and thereverse primer. Touchdown PCR was used with 40 cycles of [94 °C for30 sec, 65 °C decreasing by 0.3 °C per cycle (to 53.3 °C at cycle 40) for30 sec, and finally 72 °C for 1.5 min]. Amplicons were subcloned andsequenced as described above. Sequence data was extracted using Se-quence Scanner v1.0 (Life Technologies), and compiled and analyzedusing Vector NTI (Vector NTI Advance v. 11.5.1, Life Technologies).Multiple sequence alignments were performed using AlignX (VectorNTI Advance v. 11.5.1, Life Technologies) which uses the ClustalWalgorithm (Thompson et al., 1994).

For phylogenetic and molecular evolutionary analyses, alignmentswere imported in MSF format into MEGA version 5.1 (Tamura et al.,2011). Phylogenetic trees were constructed using the Neighbor-Joining (NJ) method (Saitou and Nei, 1987) with Poisson correctionand pairwise deletion. Bootstrap analysis was performed with 1000replicates.

3. Results

3.1. Percent fertilization, egg size, mortality, and hatching success

The 15 females involved in this functional genomics study camefrom 11 families in a broodstock development program. Seven families

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

9M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

were each represented by a single female, while 4 families were eachrepresented by 2 females (see female and family numbers in Fig. 1and Supplemental Table 1). Percent fertilization values ranged from38% (female 15) to 95% (female 5) (Table 4). Mean egg diameter forthe females used in this experiment ranged from 1.37 mm (female 4)to 1.56 mm (female 9), with mean egg diameters of females 2, 12 and13 (i.e. the females involved in the microarray study) being 1.51, 1.50,and 1.46 mm, respectively (Table 4). Since fertilization of the eggbatches occurred over a ~5 hour period using one male’s sperm thatwas held on ice (see Materials and Methods for details), it is importantto note that fertilization time of day did not appear to influence percentfertilization (Table 4).

The percent hatch and total mortality data (mean ± SE), based onfour replicate incubation beakers per female, are shown in Fig. 1 (seeSupplemental Table 1). Female 2 had the highest percent hatch(55.0 ± 2.2%), whereas females 12 and 13 had the lowest percenthatch by a large margin (both b1%) (Fig. 1D; Table 4). Based on thetotal mortality at 7 dpf and percent hatch data, it was determined that fe-male 2 had the highest quality eggs,while females 12 and 13had the low-est quality eggs. It is important to note that, for totalmortality andpercenthatch data, there was low variability between replicate incubationbeakers corresponding to a given female (Fig. 1; Supplemental Table 1).

3.2. Microarray analysis of transcript expression in fertilized eggs (7 hpf)

Two hundred and six and 63 microarray features were found to begreater than 2-fold higher expressed in females 12 (lowest quality)and 13 (second lowest quality), respectively, as compared with female2 (highest quality) in at least 3 out of the 4 technical replicate arrays(Fig. 2B; Supplemental Tables 2 and 3), and 25 of these microarrayfeatures were associated with fertilized egg samples from the lowest-quality females in both microarray comparisons (Fig. 2B; Table 1;Supplemental Table 6a). Of these 25 features, 14 are represented byAtlantic cod sequences with significant (E-value b 1E-5) BLASTx hits,while 11 are unknowns (Table 1). BLASTx information, as well as func-tional annotation (GO BP terms) associated with putative humanorthologues (i.e. best Homo sapiens BLASTx hits) of these microarray-identified Atlantic cod cDNA sequences, are provided in Table 1. Addi-tional functional annotations for these sequences (BP, MF, and CC GOterms associated with putative human and zebrafish orthologues ofmicroarray-identified cod sequences) are provided in SupplementalTable 7.

Sixty-five microarray features were also found to be greater than 2-fold higher expressed in female 2 as compared with female 12, whereas54microarray features were greater than 2-fold higher expressed in fe-male 2 as comparedwith female 13 (Fig. 2C; Supplemental Tables 4 and5). Eighteen of these features were associated with the highest-qualityfemale’s fertilized eggs in both microarray comparisons (Fig. 2C;Table 2; Supplemental Table 6b), with 9 represented by cod sequenceswith significant (E-value b 1E-5) BLASTx hits and 9 unknowns(Table 2). BLASTx information and GO BP terms associated with puta-tive human orthologues of these microarray-identified cod transcriptsare provided in Table 2, and additional functional annotations forthese sequences are provided in Supplemental Table 7. Note: genenames in Supplemental Tables 2–6 are from the 20 K microarray geneidentifier file, whereas gene names in Tables 1 and 2 and SupplementalTable 7 are manually BLAST annotated (see Materials and Methods fordetails), and therefore, more current.

In order to identify IFN pathway and other immune-relevant tran-scripts with relatively high expression in fertilized cod eggs regardlessof quality, we screened the microarray data and identified 1511 probeswith normalized signal values higher than 4000 in both channels of all 8arrays (see Materials and Methods; Supplemental Table 8). Two IFNpathway transcripts [interferon-γ receptor 1 (ifngr1), and interferon-related developmental regulator 1 (ifrd1)] identified in this gene list(Supplemental Table 8) were included in the current qPCR studies

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

involving both fertilized and unfertilized cod egg samples to confirmthat they are maternal transcripts and to study their expression ineggs from different females. BLASTx information, and functional anno-tation (if available) associated with putative human orthologues ofAtlantic cod ifngr1 and ifrd1 and irf7 are provided in SupplementalTable 14. [Cod irf7 was included in the current qPCR studies as it waspreviously shown to be a maternal transcript (Rise et al., 2012)]. Inaddition to ifngr1 and ifrd1, many other immune-relevant transcripts[e.g. encoding double stranded RNA activated protein kinase (PKR)type 2, and several complement factors] were highly, and similarly,expressed in fertilized eggs of all 3 females included in the microarraystudy (Supplemental Table 8).

3.3. qPCR with fertilized and unfertilized egg templates

From the 25 microarray features associated with low-quality fe-males in both 7 hpf microarray comparisons (Table 1; SupplementalTable 6a), 7 genes were selected for qPCR studies involving 7 hpf fertil-ized egg samples from the 15 different females (dcbdl1, ddc, acy3,psmd12, usp14, tmem147, and cth). Only dcbld1, ddc, and acy3were con-firmed by qPCR to be N 2-fold higher expressed in fertilized eggs fromboth of the lowest quality females (12 and 13) as compared with fertil-ized eggs from the highest quality female (2) (Table 1; SupplementalTables 10 and 11). From the 18 microarray features associated withthe highest quality female in both 7 hpf microarray comparisons(Table 2; Supplemental Table 6b), 5 genes were selected for qPCR stud-ies involving 7 hpf fertilized egg samples from 15 different females(kpna7, hacd1, srd5a3, cnih, and trappc3). Only kpna7 and hacd1 wereconfirmed by qPCR to be N2-fold higher expressed in fertilized eggsfrom the highest quality female (2) compared with fertilized eggsfrom both of the lowest quality females (12 and 13) (Table 2; Supple-mental Tables 10 and 11). Based on these results, only dcbld1, ddc,acy3, kpna7, and hacd1were included in theqPCR study involvingunfer-tilized egg samples.

For the 5microarray-identified and qPCR-confirmed genes and 3 IFNpathway genes of interest (irf7, ifngr1, and ifrd1), the qPCR results forfertilized and unfertilized eggs are shown in Figs. 3 and 4, respectively.The qPCR results for the remainingmicroarray-identified genes of inter-est are shown in Supplemental Fig. 1. Total percent mortality at 7 dpf(i.e. egg quality) showed significant (p b 0.05) negative correlationwith cth transcript expression [log2 relative quantity (RQ)] in the fertil-ized egg study (Supplemental Fig. 2E) despite the fact that this gene ex-hibited the narrowest range of expression out of all genes in the study(with CT range of 1.2 cycles, and RQ values between 1 and 2.2; Supple-mental Tables 10 and 11). In contrast, no significant correlations withegg quality were found for any of the genes in the unfertilized eggstudy (Supplemental Fig. 3).

3.3.1. dcbld1 and ddc expression: high variation and potential familyinfluence

For the 13 females in this study that had detectable dcbld1 transcriptexpression in fertilized eggs, expression ranged from a relative quantity(RQ) of 1.0 (female 2) to an RQ of 14,659.4 (female 12) (Fig. 3A; Supple-mental Table 11). qPCR with unfertilized egg samples showed thatdcbld1 transcript was detectable for 9 out of 13 females where expres-sion ranged from an RQ of 1.0 (female 4) to an RQ of 917.2 (female12) (Fig. 4A; Supplemental Table 13). Interestingly, the two femaleswith the highest dcbld1 transcript expression in both fertilized (RQvalues of 13,776.8 and 14,659.4) and unfertilized eggs (RQ values of782.1 and 917.2)were both from family B35 (females 11 and 12, respec-tively) (Figures 3A and 4A; Supplemental Tables 11 and 13).

qPCR using fertilized egg samples showed that aromatic-L-amino-acid-decarboxylase (synonym: dopa decarboxylase, ddc) transcript wasdetectable for all 15 females, with expression ranging from an RQ of1.0 (female 15) to an RQ of 820.2 (female 12) (Fig. 3B; SupplementalTable 11). In contrast, qPCR with unfertilized egg samples showed that

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

Table 4Egg size, percent fertilization, total mortality, and hatch results.

Female number1 Family number Average egg diameterin mm (SE)

Fertilizationtime of day

Percent fertilization Average2 total percent mortalityat 7 dpf (SE)

Average2 percenthatch (SE)

1 B33 1.55 (0.005) 10:40 82% 77.9 (0.4) 10.6 (0.6)2 B13 1.51 (0.007) 11:00 93% 15.7 (0.5) 55.0 (2.2)3 B84 1.44 (0.008) 11:15 88% 36.0 (2.6) 38.0 (4.8)4 B27 1.37 (0.006) 11:30 56% 43.0 (0.4) 11.9 (1.4)5 H29 1.40 (0.003) 11:48 95% 36.6 (1.2) 18.7 (2.4)6 B11 1.42 (0.006) 12:10 71% 65.6 (2.0) 8.5 (1.1)7 B84 1.42 (0.004) 12:25 85% 59.3 (1.3) 8.7 (0.4)9 B34 1.56 (0.004) 13:05 91% 28.5 (1.1) 25.6 (0.9)10 B11 1.49 (0.005) 13:30 73% 38.4 (1.1) 25.9 (2.4)11 B35 1.48 (0.003) 13:45 91% 30.1 (0.9) 34.2 (0.9)12 B35 1.50 (0.004) 14:05 90% 97.4 (0.3) 0.4 (0.1)13 B33 1.46 (0.006) 14:20 66% 94.4 (0.2) 0.1 (0.1)15 B12 1.48 (0.005) 15:15 38% 75.4 (1.5) 9.5 (1.6)16 B62 1.50 (0.005) 15:30 80% 28.2 (0.6) 37.6 (2.7)17 B37 1.38 (0.005) 15:45 84% 34.4 (1.0) 13.7 (0.7)

1 Female 8 (family B13)was removed from the study due to poor egg quality. Female 14 (family B11) was removed since family B11was represented by two other females in the study.2 Average of 4 replicate incubation beakers (see Methods for details).

10 M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

ddc transcript expression ranged from an RQ of 1.0 (female 1) to an RQof 190.9 (female 11) (Fig. 4B; Supplemental Table 13) in the 11 femalesin which it was detected. As seen for dcbld1, the two females with thehighest ddc transcript expression in both fertilized eggs (RQ values of769.9 and 820.2) and unfertilized eggs (RQ values of 190.9 and 188.3),with greater than 20-fold higher ddc expression than any other female,were both from family B35 (females 11 and 12, respectively) (Figs. 3Band 4B; Supplemental Tables 11 and 13). In addition, for the other 3families each represented by 2 females (B11, B33, and B84), fertilizedegg ddc transcript expression levels for the 2 females of a givenfamily were remarkably similar (e.g. RQ of 11.37 and 11.41 for fe-males 1 and 13, respectively, in family B33) (Fig. 3B; SupplementalTable 11). However, when all females were considered, there wasno correlation of either dcbld1 or ddc transcript expression and eggquality in either fertilized or unfertilized eggs (SupplementalFigs. 2C,F and 3A,B).

3.3.2. Lowest acy3 transcript expression associated with highest qualityeggs

The acy3 transcript was detectable in the eggs from all females in-volved in the fertilized egg and unfertilized egg qPCR studies (Figs. 3Cand 4C). For both of these studies, female 2 had the lowest acy3 tran-script expression (RQ of 1.0 for both studies, versus RQ ranges of 1.9–5.7 and 1.2–3.9 for other females in the fertilized egg and unfertilizedegg studies, respectively; Supplemental Tables 11 and 13). These tran-script expression results are intriguing in light of the fact that female 2also had the lowest total mortality at both 3 and 7 dpf (Fig. 1B,C), aswell as the highest percent hatch (55.0%) of all 15 females involved inthis study by a ≥ 16% margin; hatching success for the other femalesin the study ranged from 0.1% to 38% (Fig. 1D; Supplemental Table 1).However, when all females were considered, acy3 expression and eggquality were not correlated (Supplemental Figs. 2G and 3C).

3.3.3. kpna7 and hacd1 transcript expressionTwomicroarray features (20 K probe ID numbers 38561 and 48795)

identified as importin subunit alpha-8 (synonym: karyopherin alpha 7,kpna7) were N2-fold higher expressed in fertilized eggs from the bestquality female (2) compared with fertilized eggs from both of the low-est quality females (12 and 13) (Table 2). qPCR showed that kpna7 tran-script was detectable in the eggs of all females involved in the fertilizedand unfertilized egg studies (Figs. 3D and 4D). For both fertilized andunfertilized eggs, female 10 had the lowest kpna7 transcript expression(RQ of 1.0 for both studies; Supplemental Tables 11 and 13). In fertilizedeggs, the two femaleswith the highest kpna7 transcript expressionwere

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

females 5 and 2 (RQ values of 64.1 and 27.8, respectively), while for un-fertilized eggs females 9 and 2 (RQ values of 67.8 and 41.8, respectively)had the highest kpna7 transcript expression (Supplemental Tables 11and 13). It is interesting to note that females 2, 5, and 9 all had below av-erage total mortality at 7 dpf (15.7%, 36.6%, and 28.5%, respectively,compared with an average of 50.7%) (Fig. 1C; Table 4). However, the as-sociation of high kpna7 expression and egg quality was not consistent.Some females with above average egg quality (e.g. females 3, 11, and16) had relatively low kpna7 transcript expression (Figs. 1C, 3D, and4D). Further, when all females were considered, there was no correla-tion between kpna7 transcript expression and egg quality in either fer-tilized or unfertilized eggs (Supplemental Figs. 2H and 3D).

The hacd1 transcript was detectable in the fertilized and unfertilizedegg from all females involved in the qPCR studies (Figs. 3E and 4E). Inthe fertilized egg qPCR study, females 6 and 7had the lowest hacd1 tran-script expression (RQ of 1.0), and female 6 also had the lowest hacd1 ex-pression in the unfertilized egg qPCR study (Supplemental Tables 11and 13). In both the fertilized egg and the unfertilized egg qPCR studies,the highest hacd1 transcript expression was measured for females 2, 5,and 9 (RQ values of 8.6, 8.4, and 11.0, respectively, for fertilized eggs;and RQ values of 8.2, 7.5, and 4.3, respectively, for unfertilized eggs)(Figs. 3E and 4E; Supplemental Tables 11 and 13), all of which hadbelow average total mortality at 7 dpf (Fig. 1C; Table 4). As seen withkpna7, however, the association of high hacd1 expression with higheregg quality was not consistent, with some females with above averageegg quality (e.g. females 3, 11, and 16) having relatively low hacd1 tran-script expression (Figs. 1C, 3E, and 4E). Further, therewas no correlationbetween hacd1 transcript expression and egg quality in either fertilizedor unfertilized eggs when all females were considered (SupplementalFigs. 2 L and 3E).

3.3.4. Interferon (IFN) pathway transcript expression in cod eggsTranscripts for irf7, ifngr1, and ifrd1were detectable in the fertilized

and unfertilized eggs of all females used in the qPCR studies (Figs. 3 F–Hand 4 F–H). qPCRwith fertilized eggs showed that irf7 transcript expres-sion ranged from an RQ of 1.0 (female 10) to an RQ of 26.8 (female 5),while in unfertilized eggs it ranged from an RQ of 1.0 (female 3) to46.8 (female 9) (Supplemental Tables 11 and 13). In both the fertilizedand the unfertilized egg qPCR studies, ifngr1 transcript expression waslowest for female 3 (RQ of 1.0 for both studies) and highest for female12 (RQ of 5.4 and 4.6 for fertilized and unfertilized eggs, respectively)(Supplemental Tables 11 and 13). It is interesting to note that female 12had the highest total mortality at 7 dpf (97.4%) (Fig. 1C). For both fertil-ized and unfertilized eggs, female 13 (one of the two “lowest quality

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

11M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

females”) had the highest ifrd1 transcript expression (N4-fold above thelowest expressing female) (Figs. 3H and 4H; Supplemental Tables 11and 13). There was no correlation between irf7, ifngr1, or ifrd1 transcriptexpression and eggquality in fertilizedor unfertilized eggs (SupplementalFigs. 2 M-O and 3 F-H) when all females were considered.

3.3.5. Atlantic cod ddc transcript characterization and molecularphylogenetic analysis

To allow for future research on cod ddc function in early develop-ment (e.g. gene overexpression or knockdown studies), a completeddc cDNA sequence is needed. Therefore, we characterized the Atlanticcod ddc transcript and performed molecular phylogenetic analysisto explore evolutionary relationships between DDC sequences fromvarious species. The full-length cDNA sequence for Atlantic cod ddcwas deposited in GenBank under accession number KC751533. Atlanticcod ddc is a 2527 bp cDNA that contains a 109 bp 5’ untranslated region(UTR), a 1461 bp open reading frame, and a 957 bp 3’UTR, and encodesa 486 amino acid protein (Fig. 5) which has a predicted molecular massof 54.9 kDa and an isoelectric point of 5.56. The molecular phylogenetictree arising from a multiple sequence alignment of Atlantic cod DDCwith putative orthologues from various invertebrate and vertebratespecies shows that: 1) DDC sequences from three species within the su-perorder Acanthopterygii [torafugu (Takifugu rubripes), Nile tilapia(Oreochromis niloticus) and Japanese medaka (Oryzias latipes)] share abranch, and aremore distantly related to DDC from zebrafish (superorderOstariophysi) and Atlantic cod (superorder Paracanthopterygii); 2) asexpected, these teleost fish DDC sequences are more distantly relatedto tetrapod DDC sequences; and 3) all vertebrate DDC sequencesgroup separately from the invertebrate DDC sequences in the tree(Fig. 6). The Atlantic cod DDC contains all 8 residues that compose theconserved pyridoxal 5’-phosphate binding site, including the activesite catalytic residue (i.e. pyridoxal 5’-phosphate binding lysine)(Supplemental Fig. 4), suggesting that it is a pyridoxal 5’-phosphate-dependent enzyme.

4. Discussion

The availability of molecular tests for egg quality as predictors of de-velopmental success would benefit Atlantic cod aquaculture. Therefore,we aimed to use functional genomics tools and techniques to study thecod egg transcriptome and identify candidate molecular biomarkers ofegg quality.While somematernal transcripts included in our qPCR stud-ies were associated with extremes in egg quality (e.g. acy3 expressionwas lowest in the highest quality fertilized and unfertilized eggs),there was little correlation between egg quality and transcript expres-sion when all females were considered. Further, although one gene(cth) was negatively correlated with egg quality, it had an extremelynarrow range of expression among egg batches. Thus, these data sug-gest that none of the genes studied by qPCR are suitable single bio-markers of cod egg quality.

Still, we provide new information on the cod maternal tran-scriptome, and report that several of the names of genes that werepreviously reported to be highly expressed in Atlantic cod eggs [e.g. ri-bonucleoside diphosphate reductase subunit M2, cyclin A1, claudin-likeprotein ZF-A89, ubiquitin, and calmodulin in Lanes et al. (2013);cytochrome c oxidase subunit I in Kleppe et al. (2012)] were found inour “highly expressed in eggs regardless of egg quality” gene list(Supplemental Table 8). These functional genomics studies providevaluable resources for future research on the genes and pathways in-volved in egg and early embryonic development of Atlantic cod.

While themajority of the genes selected for qPCRwith fertilized eggtemplates had microarray and qPCR data that agreed in direction ofchange, 4 of the 12 genes (33%; usp14, cth, trappc3, and cnih) hadmicro-array and qPCR fold-change values in opposite directions (Tables 1 and2). This is similar to the results of Morais et al. (2012), who found that 4out of 11 genes (36%) identified in a 16 K cod microarray experiment

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

had microarray and qPCR fold-changes in opposite directions. Asnoted by Booman et al. (2011) and Liu et al. (2013), possible explana-tions for whymicroarray and qPCR results may differ include: 1) micro-array probes and qPCR amplicons mapping to different regions of thetranscript; and 2) the influence of paralogues (gene duplicates) orother related transcripts on microarray hybridization results, but notgene-specific qPCR assays.

The remainder of the discussion is focused on the 5 microarray-identified genes that were qPCR confirmed as N2-fold differentiallyexpressed in fertilized eggs from the highest quality female versusboth of the lowest quality females (dcbld1, ddc, acy3, kpna7, andhacd1) and the 3 IFN pathway genes (irf7, ifngr1, and ifrd1) that werealso shown to be maternally expressed in cod. The known functions ofputative orthologues of these cod genes are presented, as this informa-tion may lead to new hypotheses regarding how these genes and theirgene products function in the cod egg and early embryo.

4.1. dcbld1 and ddc

Although dcbld1 and ddc transcript expression levelswere not corre-lated with egg quality (see Supplemental Figs. 2C,F and 3A,B), thesegenes were greater than 50-fold higher expressed in the poorest qualityeggs (female 12) compared with the highest quality eggs (female 2)(Supplemental Tables 11 and 13) and appeared to be influenced byfamily. These are potentially interesting results which suggest that theimportance of these genes in early cod development should be furtherinvestigated.

Apart from the functional annotations associatedwith human dcbld1[GO terms “cell adhesion” (BP) and “integral component of membrane”(CC)] (Table 1; Supplemental Table 7), there is a paucity of informationavailable on dcbld1 expression or function in any species. Therefore, it isnot possible to speculate on the potential roles that dcbld1may play incod eggs, or the consequences of the observed high variation in dcbld1expression between egg batches.

Prior to the current study, Atlantic cod ddc had not been character-ized or studied at the transcript expression level. DDC converts L-3,4-dihydroxyphenylalanine (L-Dopa) to dopamine, a neurotransmitter inthe central nervous system (CNS) (Hiruma et al., 1995). Informationon the function of ddc in fish development comes from a recent studyusing zebrafish as a model. Shih et al. (2013) used in situ hybridizationto show that ddc transcript expression was ubiquitous in zebrafishearly embryonic stages (shield and bud) and became restricted to CNSregions in later embryonic stages. The ddc knockdown phenotype ex-hibited decreased brain size and touch response compared with con-trols (Shih et al., 2013), suggesting that ddc expression in the earlyembryo may be involved in CNS development. Since Shih et al. (2013)showed that zebrafish ddc transcript was expressed in all of the 16 de-velopmental stages tested (from egg to 5 days post-fertilization), it isclear that ddc is both maternally and zygotically expressed in zebrafish.Our data show that ddc is maternally expressed in cod. Further researchis needed to determine if ddc expression and function during embryo-genesis are conserved between zebrafish and cod.

In addition to its roles in nervous system development and function,ddc appears to play a number of roles in invertebrates. In larval andadult Drosophila melanogaster, ddc transcript is up-regulated in re-sponse to septic injury with either Gram-negative or Gram-positivebacteria (Davis et al., 2008). Scallop (Chlamys farreri) ddc transcript isup-regulated in larvae exposed to bacteria (Vibrio anguillarum), aswell as in adult haemocytes exposed to lipopolysaccharide (LPS),suggesting a role for mollusc ddc in the neuroendocrine-immuneregulatory network (Zhou et al., 2011, 2012). In mosquitoes, ddc tran-script is induced in ovary after ingestion of a blood meal (which is re-quired for egg maturation), and ddc is involved in egg choriontanning, melanotic encapsulation of pathogens, and larval moulting(Ferdig et al., 1996). The function of ddc in the cod egg is not known,

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

12 M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortality and maternal transcript expression among Atlantic cod (Gadusmorhua) broodstock: A functional genomics study, Mar. Genomics (2014), http://dx.doi.org/10.1016/j.margen.2014.05.004

13M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

and likewise, it is not known if ddc plays immune-relevant roles in earlylife stage fishes.

4.2. acy3

Since female 2 in our study had the highest quality eggs by a largemargin, and acy3 transcript expressionwas lowest in female 2 fertilizedand unfertilized eggs, it may be a candidate biomarker for extremes inegg quality. To our knowledge, there is no published information onacy3 gene expression or function in fish, and our study is the first toidentify acy3 as a maternal transcript. In mammals, ACY3 (synonym:AA3) deacetylates mercapturic acids and N-acetyl amino acids with ar-omatic side chains, and mediates the toxicity of trichloroethylene (anindustrial solvent and environmental pollutant) (Hsieh et al., 2010;Tsirulnikov et al., 2012). In addition, mammalian ACY3 binds to hepati-tis C virus (HCV) core protein and may be involved in HCV-associateddisease (Chen et al., 2009; Tsirulnikov et al., 2012). Despite what isknown regarding mammalian ACY3 function, the lack of informationon vertebrate egg or embryonic acy3 gene expression or functionmakes it difficult to speculate about its potential role in the Atlanticcod egg.

4.3. kpna7 and hacd1

Our studies show that cod kpna7 and hacd1 are maternal transcriptsexpressed at a range of levels in eggs from different females (Figs. 3D,Eand 4D,E).

The expression and function of kpna7 in the mammalian egg andearly embryo have been extensively studied. Mammalian KPNA7 be-longs to a family of seven importin α subtypes (Karyopherins α1-α7)that are involved in the translocation of proteins with nuclear localiza-tion signals (including transcription factors and chromatin remodelingfactors) into the nucleus (Wang et al., 2012). The nuclear importing sys-tem and nuclear proteins inmammals play key roles in early embryonicevents (e.g. nuclear reprogramming and zygotic gene activation) thatare required for successful development (Hu et al., 2010). In mammals,kpna7has been shown toplay important roles in early embryonic devel-opment (Tejomurtula et al., 2009; Wang et al., 2012; Hu et al., 2010).Bovine kpna7 is highly expressed at the transcript and protein levelsin mature oocytes and 2-cell embryos, with lower expression in blasto-cyst stage embryos (Tejomurtula et al., 2009). Mouse kpna7 transcriptexpression is high in mature oocytes, zygotes, and 2-cell embryos, anddecreases drastically in 4-cell and subsequent embryonic stages,where-as mouse KPNA7 protein is highly expressed in mature oocytes and zy-gotes and drastically decreases at the 2-cell stage (Hu et al., 2010).Targeted knockdown of bovine kpna7 by RNA interference caused a sig-nificant decrease in the proportion of embryos that reached the 8-cell to16-cell stage (Tejomurtula et al., 2009). Bovine KPNA7 interacts withnucleoplasmin 2, which in mouse is an important chromatin remodel-ing factor that is required for nuclear and nucleolar organization in oo-cytes and early embryos (Tejomurtula et al., 2009; Burns et al., 2003). Inaddition, mouse kpna7 mutants had altered chromatin state in matureoocytes and zygotes, suggesting that the function of maternal KPNA7in mammalian early embryos may involve control of epigenetic modifi-cation of the genome (Hu et al., 2010). Collectively, these studies sup-port the hypotheses of Tejomurtula et al. (2009) that mammaliankpna7 is a maternal effect gene and the mammalian KPNA7 proteinplays a crucial role in the import of nuclear factors necessary for thematernal-to-embryo transition. It is not known if kpna7 function is con-served between cod and mammals.

Fig. 3. Fertilized egg (7hpf) qPCR for 5microarray-identified genes thatwere qPCR-confirmedasand 3 IFN pathway genes (F–H). qPCR results for microarray-identified genes that were not qPCwith family affiliations in the broodstock program, are indicated below the graphs. Females areresented by two females (B11, B33, B35, B84) are on the right. Replicate beakernumber 2wasusthe fertilized egg qPCR study, see Supplemental Tables 10 and 11, respectively.

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

To our knowledge, no information is available on hacd1 (synonym:ptpla) gene expression or function in fish. During mouse embryogene-sis, hacd1 transcript is expressed in developing skeletal muscles, heart,and other tissues (Uwanogho et al., 1999). Since developmental expres-sion studies have not yet been performed for Atlantic cod hacd1, it is notknown if embryonic hacd1 expression is conserved between mammalsand cod.

Since cod hacd1 transcript expression was observed in unfertil-ized eggs and ~2-cell embryos, it appears that hacd1 may play arole in very early embryonic development in this species. In additionto maternal mRNAs and proteins, lipids accumulate during oogene-sis, and they are key components of fish eggs (Brooks et al., 1997).It is possible that maternal hacd1 transcript and its encoded enzymeare involved in lipid/fatty acid biosynthesis in cod eggs and earlyembryos. HACD1, HACD2, HACD3, and HACD4 all catalyze the dehy-dration of 3-hydroxyacyl-CoA in the elongation of very long-chainfatty acids (VLCFAs), and HACD1 interacts with reductases that actin VLCFA elongation (Konishi et al., 2010; Ikeda et al., 2008). VLCFAshave chain length≥ 20, and are involved in numerous biological pro-cesses in mammals including fetal growth and development, braindevelopment, and immunity (Konishi et al., 2010). In light of ourhacd1 transcript expression results, the potential roles of HACD1and VLCFAs in early embryonic development of Atlantic cod warrantfurther investigation.

4.4. IFN pathway transcripts

Most previous studies of fish IFN pathway gene expressionhave been conducted with later life stage (e.g. juvenile or adult) fish(e.g. Robertsen, 2006; Rise et al., 2008, 2010). While IFN-γ is knownto be involved in embryonic zebrafish anti-bacterial responses (Siegeret al., 2009), there is little available information on the functionsof IFN pathway genes and gene products during early development ofother fish species. However, Seppola et al. (2009) used qPCR to studytranscript expression of two IFN pathway genes (lgp2 and isg15) duringAtlantic cod embryonic and larval development, and Rise et al. (2012)used qPCR to show that Atlantic cod IFN pathway transcripts [e.g. irf1,irf7, and stat1] were present in unfertilized eggs and 7 hpf embryos,and exhibited dynamic expression profiles during embryogenesis.

4.4.1. irf7Atlantic cod irf7 transcript was previously shown to be expressed in

the egg and up-regulated during segmentation stage of embryonic de-velopment; based on these results, it was hypothesized that this genemay play an important role in the cod embryo (Rise et al., 2012). Thecurrent study confirms that cod irf7 is a maternal transcript, andshows that irf7 transcript levels vary over 20-fold in egg batches fromdifferent females.

All principal metazoan groups have irf family genes, which encodetranscription factors that play key roles in host defense (e.g. responsesto pathogens), immune cell development, and cancer (reviewed byNing et al., 2011). In addition, irf7 knockout in mice revealed that thisgene plays crucial roles in type I IFN (IFN-a/b) gene induction (Hondaet al., 2005). irf7-like genes have been identified in several species of tel-eost fish including Crucian carp (Carassius auratus), orange-spottedgrouper (Epinephelus coioides) and Atlantic cod (Zhang et al., 2003;Cui et al., 2011; Rise et al., 2008). Atlantic cod irf7 transcript expressionwas shown to be up-regulated in the spleen after intraperitoneal injec-tionwith the viralmimic pIC and affected by elevated temperature (Riseet al., 2008; Hori et al., 2012). Further, a microarray experiment showed

N2-fold differentially expressed between thehighest and the lowest quality females (A–E)R-confirmed are shown in Supplemental Fig. 1. All 15 females included in the study, alongarranged by family; families represented by one female are on the left, and families rep-

ed for each female for gene expression analyses. For CT and relative quantity (RQ) values for

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

14 M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortality and maternal transcript expression among Atlantic cod (Gadusmorhua) broodstock: A functional genomics study, Mar. Genomics (2014), http://dx.doi.org/10.1016/j.margen.2014.05.004

Fig. 5. The nucleotide and predicted amino acid sequences for Atlantic cod ddc. Cod ddc contains a 109 bp 5’ UTR, a 1461 bp open reading frame encoding a 486 amino acid protein, and a957 bp 3’UTR. TheUTRs are shown in italicized font, and thepolyadenylation signal is shown inbold lower case italics. Amino acids are displayed using the single letter code. The 8 residuesthat compose the conserved pyridoxal 5’-phosphate binding site, including the active site catalytic residue (i.e. pyridoxal 5’-phosphate binding lysine) (see Supplemental Fig. 4), are iden-tified with grey shading and bold upper case letters. The start codon is underlined, and the active site catalytic lysine is double-underlined.

15M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

that irf7 transcript was up-regulated in cod brain after experimental in-fection with nervous necrosis virus (Krasnov et al., 2013). While it isknown that irf7 responds to virus and pIC (and is therefore likely part

Fig. 4. Unfertilized egg qPCR for 5 microarray-identified genes that were shown in the fertilized(2) and both of the lowest quality females (12 and13) (A–E), and 3 IFNpathway genes (F–H). Rerelative quantity (RQ) values for the unfertilized egg qPCR study, see Supplemental Tables 12 anhad outlier normalizer CT values (see Supplemental Tables 12 and 13).

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

of anti-viral defense) in later life-stage cod (Krasnov et al., 2013; Riseet al., 2008; Hori et al., 2012), the role of irf7 in cod eggs and embryosis currently unknown.

egg qPCR study to be N 2-fold differentially expressed between the highest quality femaleplicate beaker number 2was used for each female for gene expression analyses. For CT andd 13, respectively. Note: Two females (15 and 17)were removed from this study since they

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

Fig. 6.Molecular phylogenetic tree based on amultiple sequence alignment (Supplemental Fig. 4) of Atlantic cod DDCwith putative orthologues from several invertebrate and vertebratespecies. The following common names are from the NCBI Taxonomy Browser. Bos taurus: cattle. Sus scrofa: pig.Homo sapiens: human. Rattus norvegicus: Norway rat. Gallus gallus: chicken.Xenopus tropicalis: western clawed frog.Gadus morhua: Atlantic cod.Danio rerio: zebrafish. Takifugu rubripes: torafugu. Oreochromis niloticus: Nile tilapia. Oryzias latipes: Japanesemedaka.Strongylocentrotus purpuratus: purple sea urchin. Tribolium castaneum: red flour beetle. Aedes aegypti: yellow fever mosquito. Bombyx mori: domestic silkworm. Manduca sexta: tobaccohornworm. Platynereis dumerilii: Dumeril’s clam worm. Azumapecten farreri: Farrer’s scallop.

16 M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

4.4.2. ifngr1IFN-γ is a cytokine produced by activated T cells and natural killer

(NK) cells that regulates mammalian immune responses to a varietyof pathogens (reviewed by Savan et al., 2009; Grayfer and Belosevic,2009; Yabu et al., 2011). Human IFN-γ interacts with a receptor com-plex containing IFN-γ receptors 1 and 2 (IFNGR1 and IFNGR2), leadingto activation of target genes (e.g. anti-viral) through the JAK-STAT sig-naling pathway (Grayfer and Belosevic, 2009; Gao et al., 2009; Aggadet al.2010). While IFN-γ receptor expression analyses (e.g. constitutive,or in response to a pathogen or other immune stimulation) have beenconducted using later life stage goldfish, ginbuna crucian carp (Carassiusauratus langsdorfii), zebrafish, and rainbow trout (Grayfer and Belosevic,2009; Gao et al., 2009; Aggad et al., 2010; Yabu et al., 2011; Hodgkinsonet al., 2012), to our knowledge the current study is the first to report onAtlantic cod ifngr1 and to show that ifngr1 is a highly expressed mater-nal transcript in a fish species. In mouse, indirect immunofluorescencewas used to detect IFNGR1-1 and IFNGR1-2 on oocytes and one-cell toblastocyst stage embryos, and RTPCR showed that ifngr2 transcriptwas expressed in oocytes and early embryos (Truchet et al., 2001).These results, along with subsequent work by Truchet et al. (2004)showing induction of IFN-γ target genes (irf-1 and socs-1) in 2-cellembryos after stimulation with exogenous IFN-γ, indicate there is afunctional IFN-γ signaling pathway inmouse early embryos. Our resultsshowing that Atlantic cod ifngr1 transcript is highly expressed in unfer-tilized eggs and 2-cell embryos supports the hypothesis that IFN-γsignaling in the very early embryo is conserved between mammalsand teleost fish.

4.4.3. ifrd1IFRD1 (synonyms TIS7 and PC4) proteins are highly conserved tran-

scriptional co-repressors (Vietor and Huber, 2007). Atlantic cod IFRD1(i.e. the deduced translation of the nucleotide sequence with GenBankaccession number ES775268) is over 80% identical to IFRD1 sequencesfrom other teleost fish species such as the zebrafish, torafugu, Nile

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

tilapia, and Atlantic salmon, and over 70% identical to IFRD1 sequencesfrom mammals including the human, rat, and mouse (SupplementalTable 14, and data not shown). Mouse ifrd1 transcript is ubiquitouslyexpressed, with notably high expression in fertilized eggs (Su et al.,2002; Vietor andHuber, 2007). Inmammals, ifrd1 is involved in the reg-ulation of cell proliferation and differentiation. For example, in early ratembryos, high ifrd1 transcript expression along the neural tube suggeststhat this gene is involved in embryonic neuroblast differentiation(reviewed by Vietor and Huber, 2007). In the embryonic mouse, ifrd1transcript is expressed in several tissues including developing kidney,lung, and the central nervous system (Buanne et al., 1998). While ifrd1knockout mice are fertile, they have decreased adult body weight(possibly due to muscle atrophy), altered muscle regeneration andfunction, and down-regulated muscle-specific genes (Vadivelu et al.,2004; reviewed by Vietor and Huber, 2007). It is thought that IFRD1may down-regulate β-catenin/Tcf-4 transcriptional activity in a histonedeacetylase (HDAC)-dependent manner, and thereby inhibit β-catenintarget genes (reviewed by Vietor and Huber, 2007).

We demonstrate for the first time that ifrd1 is a highly expressedmaternal transcript in a fish species. Apart from our results, and thoseof Su et al. (2002) showing high ifrd1 transcript expression in fertilizedmouse eggs (reviewed in Vietor and Huber, 2007), information is lack-ing on the expression and potential function of IFRD1 in vertebrateeggs and very early embryos. Given the potential role of IFRD1 in theregulation of β-catenin target genes (Vietor and Huber, 2007), and theimportance of β-catenin in the development of anteroposterior anddorsal-ventral axes in vertebrate embryos (Petersen and Reddien,2009), one could speculate that maternal ifrd1 transcript and theencoded protein may be involved in axis development by influencingWnt/β-catenin signaling.

5. Conclusions

We used microarray experiments and qPCR to study the cod eggtranscriptome, to compare global transcript expression in eggs from

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

17M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

the highest and lowest quality females, and to study variation in tran-script expression between egg batches from different females. Manyimmune-relevant genes (e.g. encoding complement components andIFN pathway proteins) were found to be highly expressed in cod eggs.Atlantic cod ddc was fully characterized at the cDNA level, and shownto contain a conserved pyridoxal 5’-phosphate binding site. Further,transcript expression of some genes involved in our study (e.g. dcbld1,acy3) may be useful for distinguishing between extremes in cod eggquality. However, the lack of significant correlation between egg qualityand transcript expression questions the usefulness of these genes as sin-gle biomarkers (e.g. with a singleplex qPCR assay, as used in the currentstudy) of egg quality in Atlantic cod. In future research, it would be valu-able to test multiple candidate biomarkers (including acy3, ddc, dcbld1,kpna7, and hacd1) in a multiplex qPCR assay to determine if expressionof a suite of biomarkers more consistently predicts egg quality (i.e. de-velopmental potential) than the expression of a single transcript. Also,in light of our results (e.g. the massive variation in dcbld1 transcript ex-pression between cod egg batches, and the potential influence of familyon egg dcbld1 and ddc transcript expression), it would be valuable to in-vestigate the expression and function of these maternal transcript inearly life stage cod. The resources generated in this study (e.g. list ofhighly expressed transcripts in cod eggs, complete cDNA sequence forcod ddc, and qPCR assays for maternal transcripts) will be valuable infuture studies involving eggs and early embryonic development ofAtlantic cod.

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.margen.2014.05.004.

Acknowledgements

This research was supported by a Natural Sciences and EngineeringResearch Council of Canada (NSERC) Discovery Grant and a Canada Re-search Chair to MLR, and by Genome Canada, Genome Atlantic, and theAtlantic Canada Opportunities Agency (ACOA) through the Atlantic CodGenomics and Broodstock Development Project. Steve Neil andNathaniel Feindel from the St. Andrews Biological Station, SusanHodkinson and Dr. Amber Garber from the Huntsman Marine ScienceCentre, and Tasha Harrold from the Ocean Sciences Centre providedtechnical support with spawning and embryo husbandry for whichthe authors are grateful.

References

Aegerter, S., Jalabert, B., Bobe, J., 2004. Messenger RNA stockpile of cyclin B, insulin-likegrowth factor I, insulin-like growth factor II, insulin-like growth factor receptor Ib,and p53 in the rainbow trout oocyte in relation with developmental competence.Mol. Reprod. Dev. 67, 127–135.

Aegerter, S., Jalabert, B., Bobe, J., 2005. Large scale real-time PCR analysis of mRNA abun-dance in rainbow trout eggs in relationship with egg quality and post-ovulatoryageing. Mol. Reprod. Dev. 72, 377–385.

Aggad, D., Stein, C., Sieger, D., Mazel, M., Boudinot, P., Herbomel, P., Levraud, J., Lutfalla, G.,Leptin, M., 2010. In vivo analysis of Ifn-γ1 and Ifn-γ2 signaling in zebrafish. J.Immunol. 185, 6774–6782.

Avery, T.S., Killen, S.S., Hollinger, T.R., 2009. The relationship of embryonic development,mortality, hatching success, and larval quality to normal or abnormal early embryon-ic cleavage in Atlantic cod, Gadus morhua. Aquaculture 289, 265–273.

Bobe, J., Labbé, C., 2010. Egg and sperm quality in fish. Gen. Comp. Endocrinol. 165,535–548.

Bonnet, E., Fostier, A., Bobe, J., 2007. Microarray-based analysis of fish egg quality afternatural or controlled ovulation. BMC Genomics 8, 55.

Booman, M., Borza, T., Hori, T.S., Feng, C.Y., Higgins, B., Culf, A., Leger, D., Chute, I., Hall, J.R.,Belkaid, A., Rise, M., Gamperl, A.K., Hubert, S., Kimball, J., Ouelette, R., Johnson, S.C.,Bowman, S., Rise, M.L., 2011. Development and experimental validation of a 20 K At-lantic cod (Gadus morhua) oligonucleotide microarray based on a collection of over150,000 ESTs. Mar. Biotechnol. 13, 733–750.

Bowman, S., Hubert, S., Higgins, B., Stone, C., Kimball, J., Borza, T., Bussey, J.T., Simpson, G.,Hall, J.R., Hori, T.S., Feng, C.Y., Gamperl, A.K., Booman, M., Rise, M., Symonds, J.,Johnson, S.C., Rise, M.L., 2011. An integrated approach to gene discovery and markerdevelopment in Atlantic cod (Gadus morhua). Mar. Biotechnol. 13, 242–255.

Bromage, N., Jones, J., Randall, C., Thrush, M., Davies, B., Springate, J., Duston, J., Barker, G.,1992. Broodstock management, fecundity, egg quality and the timing of egg produc-tion in the rainbow trout (Oncorhynchus mykiss). Aquaculture 100, 141–166.

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

Brooks, S., Tyler, C.R., Sumpter, J.P., 1997. Egg quality in fish: what makes a good egg? Rev.Fish Biol. Fish. 7, 387–416.

Buanne, P., Incerti, B., Guardavaccaro, D., Avvantaggiato, V., Simeone, A., Tirone, F., 1998.Cloning of the human interferon-related developmental regulator (IFRD1) gene cod-ing for the PC4 protein, a member of a novel family of developmentally regulatedgenes. Genomics 51, 233–242.

Burns, K.H., Viveiros, M.M., Ren, Y.,Wang, P., DeMayo, F.J., Frail, D.E., Eppig, J.J., Matzuk, M.M.,2003. Roles of NPM2 in chromatin and nucleolar organization in oocytes and embryos.Science 300, 633–636.

Chen, Y., Chen, T., Zhang, S., Lin, S., Zhao, Y., Ye, F., Zhang, X., Shi, L., Dang, S., Liu, M., 2009.Identification of a novel protein binding to hepatitis C virus core protein. J.Gastroenterol. Hepatol. 24, 1300–1304.

Cui, H., Yan, Y., Wei, J., Huang, X., Huang, Y., Ouyang, Z., Qin, Q., 2011. Identification andfunctional characterization of an interferon regulatory factor 7-like (IRF7-like) genefrom orange-spotted grouper, Epinephelus coioides. Dev. Comp. Immunol. 35,672–684.

Davis, M.M., Primrose, D.A., Hodgetts, R.B., 2008. A member of the p38 mitogen-activatedprotein kinase family is responsible for transcriptional induction of Dopa decarboxyl-ase in the epidermis of Drosophila melanogaster during the innate immune response.Mol. Cell. Biol. 28, 4883–4895.

Drivenes, Ø., Tarranger, G.L., Edvardsen, R.B., 2012. Gene expression profiling of Atlanticcod (Gadus morhua) embryogenesis using microarray. Mar. Biotechnol. 14, 167–176.

Ferdig, M.T., Li, J., Severson, D.W., Christensen, B.M., 1996. Mosquito dopa decarboxylasecDNA characterization and blood-meal-induced ovarian expression. Insect Mol. Biol.5, 119–126.

Gao, Q., Nie, P., Thompson, K.D., Adams, A., Wang, T., Secombes, C.J., Zou, J., 2009. Thesearch for the IFN-γ receptor in fish: Functional and expression analysis of putativebinding and signalling chains in rainbow trout Oncorhynchus mykiss. Dev. Comp.Immunol. 33, 920–931.

Garber, A.F., Fordham, S.E., Symonds, J.E., Trippel, E.A., Berlinsky, D.L., 2009. Hormonal in-duction of ovulation and spermiation in Atlantic cod (Gadus morhua). Aquaculture296, 179–183.

Grayfer, L., Belosevic, M., 2009. Molecular characterization of novel interferon gamma re-ceptor 1 isoforms in zebrafish (Danio rerio) and goldfish (Carassius auratus L.). Mol.Immunol. 46, 3050–3059.

Hall, T.E., Smith, P., Johnston, I.A., 2004. Stages of embryonic development in the Atlanticcod Gadus morhua. J. Morphol. 259, 255–270.

Hiruma, K., Carter, M.S., Riddiford, L.M., 1995. Characterization of the dopa decarboxylasegene of Manduca sexta and its suppression by 20-hydroxyecdysone. Dev. Biol. 169,195–209.

Hodgkinson, J.W., Ge, J., Grayfer, L., Stafford, J., Belosevic, M., 2012. Analysis of the immuneresponse in infections of the goldfish (Carassius auratus L.) with Mycobacteriummarinum. Dev. Comp. Immunol. 38, 456–465.

Honda, K., Yanai, H., Negishi, H., Asagiri, M., Sato, M., Mizutani, T., Shimada, N., Ohba, Y.,Takaoka, A., Yoshida, N., Taniguchi, T., 2005. IRF-7 is the master regulator of type-Iinterferon-dependent immune responses. Nature 434, 772–777.

Hori, T.S., Gamperl, A.K., Booman, M., Nash, G.W., Rise, M.L., 2012. A moderate in-crease in ambient temperature modulates the Atlantic cod (Gadus morhua)spleen transcriptome response to intraperitoneal viral mimic injection. BMCGenomics 13, 431.

Hsieh, J.M., Tsirulnikov, K., Sawaya, M.R., Magilnick, N., Abuladze, N., Kurtz, I., Abramson, J.,Pushkin, A., 2010. Structures of aminoacylase 3 in complex with acetylated substrates.Proc. Natl. Acad. Sci. U. S. A. 107, 17962–17967.

Hu, J., Wang, F., Yuan, Y., Zhu, X., Wang, Y., Zhang, Y., Kou, Z., Wang, S., Gao, S., 2010. NovelImportin-α family member Kpna7 is required for normal fertility and fecundity in themouse. J. Biol. Chem. 285, 33113–33122.

Ikeda, M., Kanao, Y., Yamanaka, M., Sakuraba, H., Mizutani, Y., Igarashi, Y., Kihara, A., 2008.Characterization of four mammalian 3-hydroxyacyl-CoA dehydratases involved invery long-chain fatty acid synthesis. FEBS Lett. 582, 2435–2440.

Kjesbu, O.S., Taranger, G.L., Trippel, E.A., 2006. Gadoid mariculture: development and fu-ture challenges. ICES J. Mar. Sci. 63, 187–191.

Kleppe, L., Edvardsen, R.B., Kuhl, H., Malde, K., Furmanek, T., Drivenes, Ø., Reinhardt, R.,Taranger, G.L., Wargelius, A., 2012. Maternal 3’UTRs: from egg to onset of zygotictranscript in Atlantic cod. BMC Genomics 13, 443.

Konishi, H., Okuda, A., Ohno, Y., Kihara, A., 2010. Characterization of HACD1 K64Qmutantfound in arrhythmogenic right ventricular dysplasia patients. J. Biochem. 148,617–622.

Krasnov, A., Kileng, Ø., Skugor, S., Jørgensen, S.M., Afanasyev, S., Timmerhaus, G., Sommer,A., Jensen, I., 2013. Genomic analysis of the host response to nervous necrosis virus inAtlantic cod (Gadus morhua) brain. Mol. Immunol. 54, 443–452.

Lanes, C.F.C., Fernandes, J.M.O., Babiak, K.I., 2012. Profiling of key apoptotic, stress, andimmune-related transcripts during embryonic and postembryonic development ofAtlantic cod (Gadus morhua L.). Theriogenology 78, 1583–1596.

Lanes, C.F.C., Bizuayehu, T.T., Fernandes, J.M.O., Kiron, V., Babiak, I., 2013. Transcriptome ofAtlantic cod (Gadus morhua L.) early embryos from farmed and wild broodstocks.Mar. Biotechnol. 15, 677–694.

Liu, Q., Rise, M.L., Spitsbergen, J.M., Hori, T.S., Mieritz, M., Geis, S., McGraw, J.E., Goetz, G.,Larson, J., Hutz, R.J., Carvan III, M.J., 2013. Gene expression and pathologic alterationsin juvenile rainbow trout due to chronic dietary TCDD exposure. Aquat. Toxicol.140–141, 356–368.

Mommens, M., Fernandes, J.M.O., Bizuayehu, T.T., Bolla, S.L., Johnston, I.A., Babiak, I., 2010.Maternal gene expression in Atlantic halibut (Hippoglossus hippoglossus L.) and its re-lation to egg quality. BMC Res. Notes 3, 138.

Morais, S., Edvardsen, R.B., Tocher, D.R., Bell, J.G., 2012. Transcriptomic analyses of intes-tinal gene expression of juvenile Atlantic cod (Gadus morhua) fed diets with Camelinaoil as replacement for fish oil. Comp. Biochem. Physiol. B 161, 283–293.

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004

18 M.L. Rise et al. / Marine Genomics xxx (2014) xxx–xxx

Ning, S., Pagano, J.S., Barber, G.N., 2011. IRF7: activation, regulation, modification andfunction. Genes Immun. 12, 399–414.

Petersen, C.P., Reddien, P.W., 2009. Wnt signaling and the polarity of the primary bodyaxis. Cell 139, 1056–1068.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45.

Rise, M.L., Hall, J., Rise, M., Hori, T., Gamperl, A.K., Kimball, J., Hubert, S., Bowman, S.,Johnson, S.C., 2008. Functional genomic analysis of the response of Atlantic cod(Gadus morhua) spleen to the viral mimic polyriboinosinic polyribocytidylic acid(pIC). Dev. Comp. Immunol. 32, 916–931.

Rise, M.L., Hall, J.R., Rise, M., Hori, T.S., Browne, M., Gamperl, A.K., Hubert, S., Kimball, J.,Bowman, S., Johnson, S.C., 2010. Impact of asymptomatic nodavirus carrier stateand intraperitoneal viral mimic injection on brain transcript expression in Atlanticcod (Gadus morhua). Physiol. Genomics 42, 266–280.

Rise, M.L., Hall, J.R., Alcock, B.P., Hori, T.S., 2012. Dynamic expression profiles of virus-responsive and putative antimicrobial peptide-encoding transcripts during Atlanticcod (Gadus morhua) embryonic and early larval development. Gene 509 (2),232–246.

Robertsen, B., 2006. The interferon system of teleost fish. Fish Shellfish Immunol. 20,172–191.

Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructingphylogenetic trees. Mol. Biol. Evol. 4, 406–425.

Savan, R., Ravichandran, S., Collins, J.R., Sakai, M., Young, H.A., 2009. Structural conserva-tion of interferon gamma among vertebrates. Cytokine Growth Factor Rev. 20,115–124.

Seppola, M., Johnsen, H., Mennen, S., Myrnes, B., Tveiten, H., 2009. Maternal transfer andtranscriptional onset of immune genes during ontogenesis in Atlantic cod. Dev.Comp. Immunol. 33, 1205–1211.

Shih, D., Hsiao, C., Min, M., Lai, W., Yang, C., Lee, W., Lee, S., 2013. Aromatic L-amino aciddecarboxylase (AADC) is crucial for brain development and motor functions. PLoSONE 8, e71741.

Sieger, D., Stein, C., Neifer, D., van der Sar, A.M., Leptin, M., 2009. The role of gamma inter-feron in innate immunity in the zebrafish embryo. Dis. Model. Mech. 2, 571–581.

Su, A.I., Cooke, M.P., Ching, K.A., Hakak, Y., Walker, J.R., Wiltshire, T., Orth, A.P., Vega, R.G.,Sapinoso, L.M., Moqrish, A., Patapoutian, A., Hampton, G.M., Schultz, P.G., Hogenesch,J.B., 2002. Large-scale analysis of the human and mouse transcriptomes. Proc. Natl.Acad. Sci. U. S. A. 99, 4465–4470.

Swain, P., Nayak, S.K., 2009. Role of maternally derived immunity in fish. Fish ShellfishImmunol. 27, 89–99.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molec-ular evolutionary genetics analysis using maximum likelihood, evolutionary distance,and maximum parsimony method. Mol. Biol. Evol. 28, 2731–2739.

Please cite this article as: Rise, M.L., et al., Variation in embryonic mortamorhua) broodstock: A functional genomics study, Mar. Genomics (2014)

Tejomurtula, J., Lee, K., Tripurani, S.K., Smith, G.W., Yao, J., 2009. Role of importin alpha8, anewmember of the importin alpha family of nuclear transport proteins, in early em-bryonic development in cattle. Biol. Reprod. 81, 333–342.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity ofprogressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.

Truchet, S., Wietzerbin, J., Debey, P., 2001. Mouse oocytes and preimplantation embryosbear the two sub-units of interferon-gamma receptor. Mol. Reprod. Dev. 60, 319–330.

Truchet, S., Chebrout, M., Djediat, C., Wietzerbin, J., Debey, P., 2004. Presence of perma-nently activated signal transducers and activators of transcription in nuclearinterchromatin granules of unstimulated mouse oocytes and preimplantation em-bryos. Biol. Reprod. 71, 1330–1339.

Tsirulnikov, K., Abuladze, N., Vahi, R., Hasnain, H., Phillips, M., Ryan, C.M., Atanasov, I.,Faull, K.F., Kurtz, I., Pushkin, A., 2012. Aminoacylase 3 binds to and cleaves the N-terminus of the hepatitis C virus core protein. FEBS Lett. 586, 3799–3804.

Uwanogho, D.A., Hardcastle, Z., Balogh, P., Mirza, G., Thornburg, K.L., Raguossis, J., Sharpe,P.T., 1999. Molecular cloning, chromosomal mapping, and developmental expressionof a novel protein tyrosine phosphatase-like gene. Genomics 62, 406–416.

Vadivelu, S.K., Kurzbauer, R., Dieplinger, B., Zweyer, M., Schafer, R., Wernig, A., Vietor, I.,Huber, L.A., 2004. Muscle regeneration and myogenic differentiation defects in micelacking TIS7. Mol. Cell. Biol. 24, 3514–3525.

Vietor, I., Huber, L.A., 2007. Role of TIS7 family of transcriptional regulators in differenti-ation and regeneration. Differentiation 75, 891–897.

Wang, X., Park, K., Koser, S., Liu, S., Magnani, L., Cabot, R.A., 2012. KPNA7, an oocyte- andembryo-specific karyopherin α subtype, is required for porcine embryo develop-ment. Reprod. Fertil. Dev. 24, 382–391.

Yabu, T., Toda, H., Shibasaki, Y., Araki, K., Tamashita, M., Anzai, H., Mano, N., Masuhiro, Y.,Hanazawa, S., Shiba, H., Moritomo, T., Nakanishi, T., 2011. Antiviral protection mech-anisms mediated by ginbuna crucian carp interferon gamma isoforms 1 and 2through two distinct interferon gamma-receptors. J. Biochem. 150, 635–648.

Zhang, Y., Hu, C., Zhang, J., Huang, G., Wei, L., Zhang, Q., Gui, J., 2003. Molecular cloningand characterization of crucian carp (Carassius auratus L.) interferon regulatory factor7. Fish Shellfish Immunol. 15, 453–466.

Zhou, Z., Yang, J., Wang, L., Zhang, H., Gao, Y., Shi, X., Wang, M., Kong, P., Qiu, L., Song, L.,2011. A dopa decarboxylase modulating the immune response of scallop Chlamysfarreri. PLoS ONE 6, e18596.

Zhou, Z., Wang, L., Shi, X., Yue, F., Wang, M., Zhang, H., Song, L., 2012. The expression ofdopa decarboxylase and dopamine beta hydroxylase and their responding to bacteri-al challenge during the ontogenesis of scallop Chlamys farreri. Fish Shellfish Immunol.33, 67–74.

lity and maternal transcript expression among Atlantic cod (Gadus, http://dx.doi.org/10.1016/j.margen.2014.05.004